CN108840950A

CN108840950A - A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha

Info

Publication number: CN108840950A
Application number: CN201810768483.8A
Authority: CN
Inventors: 高耀辉; 周炜; 郭志燕; 何志远; 单雪芹; 鲍可兵; 付超
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-13
Publication date: 2018-11-20
Also published as: CN107253994A

Abstract

The fusion protein and preparation method thereof that the invention discloses a kind of to be made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha; the fusion protein is connected through flexible linker by pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and is formed, and is freeze-dried to obtain Recombinant Swine long-acting interferon after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves 19 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of fusion being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by pig interleukin 2 and 6, Porcine interferon-gamma and pig The fusion protein and preparation method thereof of interferon-' alpha ' composition.

Background technique

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease control method is far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, in addition original animal epidemic, causes aquaculture industry of China huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.

Mainly pass through vaccine inoculation to the prevention and treatment approach of porcine viral diseases at present and uses antibiotic, but by It is not perfect in breeding environment, virus variation and Abwehrkraft des Koepers variation etc. reasons, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament give people due to medicament residue problem Health is brought a negative impact；And traditional vaccine, high specific and side effect due to it, virus variation and new can not be resisted Type virus, which continuously emerges, gives pig aquaculture bring significant damage.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selectively Act on the infection cells such as virus, by inhibit infected cell in virus protein biosynthesis, play wide spectrum and efficiently Antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition virus Duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

γ type IFN is that the T cell and NK cell by activating generate, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to the anti-of virus infection It answers, but the immunoregulatory activity of interferon gamma is coordinating immune response and determining in the long-term antiviral state of body to play more Important role, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly produced by the T lymphocyte activated The raw cell factor with extensive bioactivity can both promote lymphopoiesis, enhance immune function, and can restricted T Cell effect and the immune tolerance for enhancing body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In beast In doctor, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level that body can be enhanced improves the disease resistance of body, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to mention High curative effect of medication.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

It is interfered in order to solve the above technical problems, the present invention provides one kind by pig interleukin 2 and 6, Porcine interferon-gamma and pig The fusion protein and preparation method thereof of plain α composition, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, compared with The half-life period of common pig interferon improves 19 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of pig itself and answer It answers.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, the fusion protein Amino acid sequence table as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection The now codon of pig interleukin 2 and 6, porcine IFN γ, pig IFN-α original gene codon adaptation indexI in Escherichia coli (CAI) be respectively 0.23,0.24,0.22, GC percentage be 38.7%, 39.2%, 59.1%；And by pig interleukin 2, obtained after porcine IFN γ, pig IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.97, 1.0,1.0, GC percentage 47.6%, 45.4%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, and preparation method is：

(1) design primer, is obtained or the pig interleukin of the flexible linker sequence of artificial synthesized band by reverse transcription 2, the target gene of Porcine interferon-gamma, porcine interferon alpha；By flexible linker by pig interleukin 2 and 6, Porcine interferon-gamma, pig The target gene of interferon-' alpha ' connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2- can be obtained IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F1：CATGCCATGGATGTATAAGATGCAGCT has NcoI restriction enzyme site；

Downstream IL-2-R1：ACCACCACCAGAACCACCACCACCAGTCAGTGTTGAGTAG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGAGTTATACAACTT, with flexible linker；

Downstream IFN-γ-R1：ACCACCACCAGAACCACCACCACCTTTTGATGCTCTCTG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream IFN-α-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGTGTTCCTATTTA, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGCTCCTTCCTCCTGAG has XhoI restriction enzyme site；

B. RNA is extracted from pig liver, and the target gene of pig IL-2, porcine IFN γ and pig IFN-α is obtained by reverse transcription, The gene order of three respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of pig IL-2, porcine IFN γ and pig IFN-α as template, and it is utilized respectively pig IL-2, pig The upstream and downstream primer of IFN-γ and pig IFN-α carries out PCR amplification, respectively obtains the pig IL-2 for connecting flexible linker, pig IFN-γ and pig IFN-α gene.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ gene is obtained using flexible linker connection pig IL-2 and porcine IFN γ target gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN is obtained using flexible linker connection rIL2-IFN γ gene and pig IFN-α target gene α gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F2：CATGCCATGGATGTACAAAATGCAGC has NcoI restriction enzyme site；

Downstream IL-2-R2：ACCACCACCAGAACCACCACCACCGGTCAGGGTAGAGTAG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGTCTTACACCACCT, with flexible linker；

Downstream IFN-γ-R2：ACCACCACCAGAACCACCACCACCTTTAGAAGCACGCTG, with flexible linker；

Porcine interferon alpha (IFN-α)：

Upstream IFN-α-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGTGCTCTTACCTG, with flexible linker；

Downstream IFN-α-R2：CCCTCGAGTTCTTTACGACGCAG has XhoI restriction enzyme site.

B. the target gene of the pig IL-2, porcine IFN γ and pig IFN-α, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

The present invention also provides the application of the Recombinant Swine long-acting interferon, long half time had up to 76 hours or more Broad-spectrum disease resistance toxic action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig IL-2, porcine IFN γ and pig IFN-α gene are realized amalgamation and expression by flexibility linker, interference is improved Plain half-life period improves 19 times or more compared with plain interferon；It is significant to drop compared with common polyethylene glycol fused interferon Low cost.

2. by being optimized to pig IL-2, porcine IFN γ and pig IFN-α gene, improve pig IL-2, porcine IFN γ and The expression quantity of pig IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of pig IL-2, porcine IFN γ and pig IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improving the immune response of pig itself.

Detailed description of the invention

Fig. 1 is pig interleukin 2 and 6 gene, porcine interferon alpha gene and the Porcine interferon-gamma gene RT-PCR in embodiment 1 The result of amplification；Swimming lane M：DNA Marker DL2000；Swimming lane 1：2 gene RT-PCR amplified production of porcine interleukin；Swimming lane 2：Pig Interferon-gamma gene RT-PCR amplified production；Swimming lane 3：Porcine interferon alpha gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in pig IL-2, IFN-γ connected with the target gene of IFN-α after PCR amplification knot Fruit；Swimming lane M：DNA Marker DL2000；Swimming lane 1：2 gene of porcine interleukin, Porcine interferon-gamma gene and porcine interferon alpha gene Ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the Recombinant Swine long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the Recombinant Swine long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the Recombinant Swine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, preparation method is such as Under：

1. pig interleukin 2 and 6 (IL-2), Porcine interferon-gamma (IFN-γ) and porcine interferon alpha (IFN-α) target gene It obtains and expands

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in pig interleukin 2 and 6 NcoI restriction enzyme site and Linker sequence are introduced in upstream primer and downstream primer respectively, Porcine interferon-gamma upstream primer and Linker sequence is introduced in downstream primer respectively, introduces Linker respectively in the upstream primer and downstream primer of porcine interferon alpha Sequence and XhoI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, and the purpose base of pig IL-2, porcine IFN γ and pig IFN-α is obtained by reverse transcription Cause, the gene order of three respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 490bp, 560bp and 710bp or so through agarose gel electrophoresis in RT-PCR amplified production, As a result as shown in Figure 1, illustrating that pig IL-2, porcine IFN γ and the pig for being separately connected flexible linker sequence have been prepared respectively The target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rIL2-IFN γ PCR reaction system of table

4 rIL2-IFN γ of table-IFN α PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1700bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occur rIL2-IFN γ and IFN-α amplified product band in Fig. 2, this is because connecting in rIL2-IFN γ with IFN-α gene During, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > It is shown.

3. expression vector establishment

For target gene after selection connection after sequencing is errorless, PCR glue recovery product and pET-32a plasmid use NcoI Double digestion and recycling are carried out with XhoI restriction enzyme, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, and PCR amplification and double digestion are produced through NcoI and XhoI double digestion Object detects single band at the place 1700bp or so through agarose gel electrophoresis, and result is as shown in figure 3, illustrate successfully to obtain PET-32a/rIL2-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as shown in figure 4, it can be seen from the figure that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in the place 80.6KD or so after bacterial cell disruption after leading 5h, illustrates in precipitating and supernatant Equal successful expression fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, amino acid sequence can be obtained Column are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, other same embodiments 1, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,80.6KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 3

Pig IL-2, porcine IFN γ and pig IFN-α in embodiment 1 is optimized, artificially synthesized pig IL-2, porcine IFN γ With pig IFN-α target gene, after optimization, the nucleotide sequence of three respectively as 400 < of SEQUENCE LISTING, 7 >, Shown in 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 of pig, pig IFN- in the present embodiment γ and pig IFN-α gene codon optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Pig IL-2, pig are found using software detection The codon of IFN-γ and pig IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.23, 0.24,0.22, GC percentage is 38.7%, 39.2%, 59.1%；And by pig IL-2, porcine IFN γ and pig IFN-α gene It is respectively 0.97,1.0,1.0, GC percentage that recombination codon adaptation indexI (CAI) in Escherichia coli is obtained after optimization 47.6%, 45.4%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of pig IL-2, porcine IFN γ and pig IFN-α after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of pig IL-2, porcine IFN γ and pig IFN-α through agarose gel electrophoresis respectively 490bp, There is specific band in 560bp and 710bp or so, illustrate that the pig for being separately connected flexible linker after optimization has been prepared The target gene of IL-2, porcine IFN γ and pig IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rIL2-IFN γ PCR reaction system of table

10 rIL2-IFN γ of table-IFN-α PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1700bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400 Shown in 3 > of <.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid NcoI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of NcoI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 1700bp or so in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN α constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in the place 80.6KD or so illustrates to have obtained recombinant protein in supernatant precipitating.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, other same embodiments 3, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,80.6KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 5

A kind of Recombinant Swine long-acting interferon α, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the mirror for the fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha It is fixed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 80.6KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-porcine alpha-IFN (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon sample can be with anti-porcine interferon alpha Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 80.6KD or so, as shown in Figure 5.

Embodiment 7

Four parts of Recombinant Swine long-acting interferon α in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the Recombinant Swine that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the Recombinant Swine long-acting interferon α obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the Recombinant Swine obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of Recombinant Swine long-acting interferon α that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in pig intracorporal half-life period

Cytopathic-effect inhibition assay measures rIL2-IFN γ-IFN α blood concentration and time relationship

The pig (half male and half female) that six weight are roughly the same is taken, 2mg/ml Recombinant Swine long-acting interferon α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 36h, 72h, 96h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm low temperature from Heart 10min separates serum, and every pig blood sample of each time point is to be measured in -20 DEG C of preservations.Serum sample is measured using cytopathic-effect inhibition assay RIL2-IFN γ-IFN α concentration in product is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculated result It is shown in Table 13.

Dominant dynamic parameters in serum after 13 Recombinant Swine long-acting interferon α intramuscular injection of table

The result shows that Recombinant Swine long-acting interferon α has longer half-life period.Half-life period can reach 76h or so after measured, compared with Plain interferon improves 19 times or more.

Embodiment 9

The freeze-dried measurement that pig cell immune response is influenced of four parts of Recombinant Swine long-acting interferon α in embodiment 5

It takes six roughly the same pigs of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck The PBS of 2mL is subcutaneously injected in the 2mg/ml Recombinant Swine long-acting interferon freeze-dried 2ml of α, control group neck, takes pig periphery after injection 4 weeks Blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 content, is carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that table 14ELISA detects each group pig cell immune response

The result shows that cell factor IL-4 in pig peripheral blood can be significantly improved after injection Recombinant Swine long-acting interferon α Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion egg being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and its preparation

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 566

<212> PRT

<213>Pig IL2-IFN γ-IFN α fusion protein

<400> 1

Met Tyr Lys Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Met Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys Lys

20 25 30

Gln Leu Glu Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu Val

35 40 45

Lys Asn Tyr Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys Phe

50 55 60

Tyr Met Pro Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu Val

65 70 75 80

Glu Glu Leu Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser Lys

85 90 95

Asn Ser Asp Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn Val

100 105 110

Thr Val Leu Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu Tyr

115 120 125

Asp Asp Glu Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile Thr

130 135 140

Phe Cys Gln Ser Ile Tyr Ser Thr Leu Thr Gly Gly Gly Gly Ser Gly

145 150 155 160

Gly Gly Gly Ser Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu

165 170 175

Cys Val Thr Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe

180 185 190

Lys Glu Ile Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly

195 200 205

Val Pro Asn Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys

210 215 220

Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr

225 230 235 240

Phe Lys Phe Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser

245 250 255

Met Asp Val Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser

260 265 270

Ser Gly Lys Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp

275 280 285

Asn Leu Gln Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met

290 295 300

Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln

305 310 315 320

Thr Met Phe Gln Gly Gln Arg Ala Ser Lys Gly Gly Gly Gly Ser Gly

325 330 335

Gly Gly Gly Ser Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg

340 345 350

Ser Ser Asn Ile Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala

355 360 365

Arg Thr Ala Ala Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe

370 375 380

Leu Thr Ala Leu Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly

385 390 395 400

Cys Asp Leu Pro Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg

405 410 415

Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His

420 425 430

Arg Arg Asp Phe Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val

435 440 445

Gln Lys Ala Gln Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr

450 455 460

Phe Gln Leu Phe Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser

465 470 475 480

Leu Leu His Gln Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu

485 490 495

Glu Ala Cys Val Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu

500 505 510

Glu Glu Asp Ser Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr

515 520 525

Leu Tyr Leu Gln Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val

530 535 540

Arg Ala Glu Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp

545 550 555 560

Arg Leu Arg Arg Lys Glu

565

<210> 2

<211> 1698

<212> DNA

<213>Genome 1

<400> 2

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ctggtggtgg tggttctggt 480

ggtggtggtt ctatgagtta tacaacttat ttcttagctt ttcagctttg cgtgactttg 540

tgtttttctg gctcttactg ccaggcgccc ttttttaaag aaataacgat cctaaaggac 600

tattttaatg caagtacctc aggtgtacct aatggtggac ctcttttctt agaaattttg 660

gagaattgga aagaggagag tgacaaaaaa ataattcaga gccaaattgt ctccttctac 720

ttcaaattct ttgaaatctt caaagataac caggccattc aaaggagcat ggatgtgatc 780

aagcaagaca tgtttcagag gttcctaaat ggtagctctg ggaaactgaa tgacttcgaa 840

aagctggtta aaattccggt agataatctg cagatccagc gcaaagccat cagtgaactc 900

atcaaagtga tgaatgatct gtcaccaaga tctaacctaa gaaagcggaa gagaagtcag 960

actatgttcc aaggccagag agcatcaaaa ggtggtggtg gttctggtgg tggtggttct 1020

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 1080

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 1140

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 1200

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 1260

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 1320

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 1380

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 1440

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 1500

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 1560

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 1620

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 1680

agactcagga ggaaggag 1698

<210> 3

<211> 1698

<212> DNA

<213>Genome 2

<400> 3

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga ccggtggtgg tggttctggt 480

ggtggtggtt ctatgtctta caccacctac ttcctggctt tccagctgtg cgttaccctg 540

tgcttctctg gttcttactg ccaggctccg ttcttcaaag aaatcaccat cctgaaagac 600

tacttcaacg cttctacctc tggtgttccg aacggtggtc cgctgttcct ggaaatcctg 660

gaaaactgga aagaagaatc tgacaaaaaa atcatccagt ctcagatcgt ttctttctac 720

ttcaaattct tcgaaatctt caaagacaac caggctatcc agcgttctat ggacgttatc 780

aaacaggaca tgttccagcg tttcctgaac ggttcttctg gtaaactgaa cgacttcgaa 840

aaactggtta aaatcccggt tgacaacctg cagatccagc gtaaagctat ctctgaactg 900

atcaaagtta tgaacgacct gtctccgcgt tctaacctgc gtaaacgtaa acgttctcag 960

accatgttcc agggtcagcg tgcttctaaa ggtggtggtg gttctggtgg tggtggttct 1020

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 1080

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 1140

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 1200

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 1260

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 1320

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 1380

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 1440

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 1500

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 1560

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 1620

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 1680

cgtctgcgtc gtaaagaa 1698

<210> 4

<211> 462

<212> DNA

<213>Pig IL-2

<400> 4

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ct 462

<210> 5

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 5

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 6

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 6

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 60

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 120

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 180

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 240

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 300

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 360

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 420

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 480

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 540

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 600

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 660

agactcagga ggaaggag 678

<210> 7

<211> 462

<212> DNA

<213>Pig IL-2

<400> 7

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga cc 462

<210> 8

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 8

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

<210> 9

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 9

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 60

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 120

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 180

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 240

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 300

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 360

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 420

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 480

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 540

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 600

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 660

cgtctgcgtc gtaaagaa 678

Claims

1. a kind of fusion protein being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of Recombinant Swine long-acting interferon, which is characterized in that the Recombinant Swine long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, preparation method are：

(1) design primer, is obtained or the pig interleukin 2 and 6 of the flexible linker sequence of artificial synthesized band, pig by reverse transcription The target gene of interferon gamma, porcine interferon alpha；Pig interleukin 2 and 6, Porcine interferon-gamma, pig are interfered by flexible linker The target gene of plain α connects, the nucleotides sequence list of the target gene after connection such as 400 < of SEQUENCE LISTING, 2 > It is shown or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2-IFN can be obtained γ-IFNα。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of Recombinant Swine long-acting interferon according to claim 5, which is characterized in that the Recombinant Swine is long-acting dry The long half time of element is disturbed up to 76 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.