CN109053897A

CN109053897A - A kind of fusion protein and preparation method thereof being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α

Info

Publication number: CN109053897A
Application number: CN201810768495.0A
Authority: CN
Inventors: 鲍可兵; 高耀辉; 徐慕珍; 杨建伟; 王红朵; 徐文俊; 周炜; 何志远
Original assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Current assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-13
Publication date: 2018-12-21
Also published as: CN107383203A

Abstract

The fusion protein and preparation method thereof that the invention discloses a kind of to be made of recombinant chIL-2, chicken interferon gamma and chicken interferon α; the fusion protein is connected through flexible linker with chicken interferon α by recombinant chIL-2, chicken interferon gamma and is formed, and is freeze-dried to obtain recombination chicken long-acting interferon after fusion protein and freeze drying protectant mixture.The recombination chicken long-acting interferon is remarkably improved the half-life period of chicken interferon, and the half-life period of more common chicken interferon improves 18 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of chicken itself.

Description

A kind of fusion being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by recombinant chIL-2, chicken interferon gamma and chicken The fusion protein and preparation method thereof of interferon-' alpha ' composition.

Background technique

In recent years, as the scale of aquaculture and livestock and poultry and products thereof circulation industry rapidly develop, China's domestic fowl farming is taken Tremendous development is obtained, the huge industry that annual value of production exceedes hundred billion yuan is formd.However due to the animal epidemic prevention system of China's weakness, poultry diease It is still the serious problems that China's poultry production faces, this has become an important factor for restricting the development of China's poultry cultivation industry. Poultry diease is more, loss is big, and the death rate is higher than 15%, and for death and culling rate up to 20%~25% (developed country is less than 5%), China's poultry husbandry is every Year chicken The dead quantity caused by infectious disease is about 300,000,000, about 3,000,000,000 yuan of the economic loss directly contributed, caused by between Connect about 10,000,000,000 yuan of loss.

At present for the prevention and treatment of chicken viral diseases mainly using vaccine immunity and drug therapy, due to epidemic disease The immune serotype of seedling is single, and virus serotype is numerous and virus stain speed of mutation is fast, to frequently result in vaccine immunity mistake It loses.Although some antibiotic and chemically synthesized antiviral drugs have some effects to a small number of viruses, since medicament residue passes through Food chain is brought a negative impact to human health, and China prohibited some antibiotic and antibacterial agent in aquaculture since 16 years In application.Therefore, be actively developed production have no toxic side effect, drug residue free and the interferon formulation for not generating drug resistance, it is right Chicken viral diseases, which prevent and treat predicament, at present important clinical meaning.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selectively Act on the infection cells such as virus, by inhibit infected cell in virus protein biosynthesis, play wide spectrum and efficiently Antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition virus Duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

γ type IFN is that the T cell and NK cell by activating generate, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to the anti-of virus infection It answers, but the immunoregulatory activity of interferon gamma is coordinating immune response and determining in the long-term antiviral state of body to play more Important role, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve Curative effect of medication.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two: the too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

It is interfered in order to solve the above technical problems, the present invention provides one kind by recombinant chIL-2, chicken interferon gamma and chicken The fusion protein and preparation method thereof of plain α composition, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of recombination chicken long-acting interferon, the recombination chicken long-acting interferon is remarkably improved the half-life period of chicken interferon, compared with The half-life period of common chicken interferon improves 18 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of chicken itself and answer It answers.

The technical scheme adopted by the invention is as follows:

A kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, the fusion protein Amino acid sequence table as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection The now codon of recombinant chIL-2, chicken IFN-γ, chicken IFN-α original gene codon adaptation indexI in Escherichia coli (CAI) be respectively 0.27,0.25,0.31, GC percentage be 36.1%, 42.9%, 61.7%；And by chicken interleukin-2 2, obtained after chicken IFN-γ, chicken IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 1.0, 1.0,1.0, GC percentage 46.2%, 47.6%, 58.5%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of recombination chicken long-acting interferon, the recombination chicken long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps: will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, preparation method are as follows:

(1) design primer, is obtained or the chicken interleukin-2 of the flexible linker sequence of artificial synthesized band by reverse transcription 2, the target gene of chicken interferon gamma, chicken interferon α；By flexible linker by recombinant chIL-2, chicken interferon gamma, chicken The target gene of interferon-' alpha ' connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2- can be obtained IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying are as follows: the crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are as follows:

A. design of primers

The primer sequence of recombinant chIL-2 (IL-2) are as follows:

Upstream IL-2-F1:CCGGAATTCATGATGTGCAAAGTACT has EcoRI restriction enzyme site；

Downstream IL-2-R1:

ACCACCACCAGAACCACCACCACCTTTTTGCAGATATCTCAC, with flexible linker；

The primer sequence of chicken interferon gamma (IFN-γ) are as follows:

Upstream IFN-γ-F1:

GGTGGTTCTGGTGGTGGTGGTTCTATGACTTGCCAGACTT, with flexible linker；

Downstream IFN-γ-R1:

ACCACCACCAGAACCACCACCACCGCAATTGCATCTCCTC, with flexible linker；

The primer sequence of chicken interferon α (IFN-α) are as follows:

Upstream IFN-α-F1:

GGTGGTTCTGGTGGTGGTGGTTCTCCCACCATGGCTGT, with flexible linker；

Downstream IFN-α-R1:CCCTCGAGAGTGCGCGTGTTG has XhoI restriction enzyme site；

B. RNA is extracted from chicken liver, and the target gene of chicken IL-2 gene, chicken IFN-γ and chicken IFN-α is obtained by reverse transcription, The gene order of three respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of chicken IL-2 gene, chicken IFN-γ and chicken IFN-α as template, and it is utilized respectively chicken IL-2 gene, chicken The upstream and downstream primer of IFN-γ and chicken IFN-α carries out PCR amplification, respectively obtains the chicken IL-2 gene for connecting flexible linker, chicken IFN-γ and chicken IFN-α gene.

PCR reaction system and condition are as follows: in the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition are as follows: 50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ gene is obtained using flexible linker connection chicken IL-2 gene and chicken IFN-γ target gene

The PCR reaction system and reaction condition of connection are as follows: in the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connect PCR reaction condition are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN is obtained using flexible linker connection rIL2-IFN γ gene and chicken IFN-α target gene α gene

The PCR reaction system and reaction condition of connection are as follows: in the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR reaction condition are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 Are as follows:

A. design of primers

The primer sequence of recombinant chIL-2 (IL-2) are as follows:

Upstream IL-2-F2:CGGGATCCATGATGTGCAAAGTTCT has BamHI restriction enzyme site；

Downstream IL-2-R2:

ACCACCACCAGAACCACCACCACCTTTCTGCAGGTAACG, with flexible linker；

The primer sequence of chicken interferon gamma (IFN-γ) are as follows:

Upstream IFN-γ-F2:

GGTGGTTCTGGTGGTGGTGGTTCTATGACCTGCCAGAC, with flexible linker；

Downstream IFN-γ-R2:

ACCACCACCAGAACCACCACCACCGCAGTTGCAACGAC, with flexible linker；

Chicken interferon α (IFN-α):

Upstream IFN-α-F2:

GGTGGTTCTGGTGGTGGTGGTTCTCCGACCATGGCTG, with flexible linker；

Downstream IFN-α-R2:

CCCTCGAGGGTACGGGTGTTACC has XhoI restriction enzyme site.

B. the chicken IL-2 gene, chicken IFN-γ and chicken IFN-α target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are as follows: in the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition are as follows: 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection are as follows: in the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connect PCR reaction condition are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection are as follows: in the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR reaction condition are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

The present invention also provides the application of the recombination chicken long-acting interferon, long half time had up to 73 hours or more Broad-spectrum disease resistance toxic action and the immune response that chicken itself can be improved.

Compared with prior art, the invention has the following beneficial effects:

1. chicken IL-2 gene, chicken IFN-γ and chicken IFN-α gene are realized amalgamation and expression by flexibility linker, interference is improved Plain half-life period improves 18 times or more compared with plain interferon；It is significant to drop compared with common polyethylene glycol fused interferon Low cost.

2. by being optimized to chicken IL-2 gene, chicken IFN-γ and chicken IFN-α gene, improve chicken IL-2 gene, chicken IFN-γ and The expression quantity of chicken IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of chicken IL-2 gene, chicken IFN-γ and chicken IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improving the immune response of chicken itself.

Detailed description of the invention

Fig. 1 is recombinant chIL-2 gene, chicken interferon α gene and the chicken interferon gamma gene RT-PCR in embodiment 1 The result of amplification；Swimming lane M:DNA Marker DL2000；Swimming lane 1: 2 gene RT-PCR amplified production of chicken interleukin-2；Swimming lane 2: chicken Interferon-gamma gene RT-PCR amplified production；Swimming lane 3: chicken interferon α gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in chicken IL-2 gene, IFN-γ connected with the target gene of IFN-α after PCR amplification knot Fruit；Swimming lane M:DNA Marker DL2000；Swimming lane 1: 2 gene of chicken interleukin-2, chicken interferon gamma gene and chicken interferon α gene Ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M:DNA Marker DL10000；Swimming lane 1: recombinant plasmid double digestion result；Swimming lane 2: plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M: albumen Marker；Swimming lane 1: zero load control；Swimming lane 2: it is precipitated after the bacterial cell disruption after recombinant bacterium induction；Swimming lane 3: after the bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M: albumen Marker；Swimming Road 1: supernatant after recombinant bacterium induction is broken；Swimming lane 2: it is precipitated after being crushed for recombinant bacterium induction；

Fig. 6 is that the recombination chicken long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombination chicken long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the recombination chicken long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, preparation method is such as Under:

1. recombinant chIL-2 (IL-2), chicken interferon gamma (IFN-γ) and chicken interferon α (IFN-α) target gene It obtains and expands

Design of primers:

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in recombinant chIL-2 EcoRI restriction enzyme site and Linker sequence are introduced in upstream primer and downstream primer respectively, in the upstream primer of chicken interferon gamma With Linker sequence is introduced in downstream primer respectively, introduced respectively in the upstream primer and downstream primer of chicken interferon α Linker sequence and XhoI restriction enzyme site.

Table 1PCR amplimer

RT-PCR obtains target gene:

RNA is extracted from chicken liver tissue, the purpose base of chicken IL-2 gene, chicken IFN-γ and chicken IFN-α is obtained by reverse transcription Cause, the gene order of three respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

Table 2RT-PCR reaction system

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter are as follows: 50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation: 95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 460bp, 550bp and 610bp or so through agarose gel electrophoresis in RT-PCR amplified production, As a result as shown in Figure 1, illustrating that the chicken IL-2 gene for being separately connected flexible linker sequence, chicken IFN-γ and chicken have been prepared respectively The target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4:

Table 3rIL2-IFN γ PCR reaction system

Table 4rIL2-IFN γ-IFN α PCR reaction system

Response parameter are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1570bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occur rIL2-IFN γ and IFN-α amplified product band in Fig. 2, this is because connecting in rIL2-IFN γ with IFN-α gene During, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > It is shown.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5:

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection:

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion Product detects single band at the place 1570bp or so through agarose gel electrophoresis, and result is as shown in figure 3, illustrate successfully to obtain PET-32a/rIL2-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as shown in figure 4, it can be seen from the figure that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in the place 75.7KD or so after bacterial cell disruption after leading 5h, illustrates in precipitating and supernatant Equal successful expression fusion protein.

Precipitating is resuspended in the PBS that mass volume ratio 1:1 is added；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, amino acid sequence can be obtained Column are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, other same embodiments 1, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,75.7KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 3

Chicken IL-2 gene, chicken IFN-γ and chicken IFN-α in embodiment 1 is optimized, artificial synthesized chicken IL-2 gene, chicken IFN-γ With chicken IFN-α target gene, after optimization, the nucleotide sequence of three respectively as 400 < of SEQUENCE LISTING, 7 >, Shown in 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 of chicken, chicken IFN- in the present embodiment γ and chicken IFN-α gene codon optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Chicken IL-2 gene, chicken are found using software detection The codon of IFN-γ and chicken IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.27, 0.25,0.31, GC percentage is 36.1%, 42.9%, 61.7%；And by chicken IL-2 gene, chicken IFN-γ and chicken IFN-α gene It is respectively 1.0,1.0,1.0, GC percentage that recombination codon adaptation indexI (CAI) in Escherichia coli is obtained after optimization 46.2%, 47.6%, 58.5%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers:

Table 7PCR amplimer

The genomic DNA of chicken IL-2 gene, chicken IFN-γ and chicken IFN-α after optimization is diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8:

Table 8PCR reaction system

RNase F_reeWater	10.5_μL
		dNTP Mi_x	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter are as follows: 95 DEG C of initial denaturation 4min, into circulation: 95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Chicken IL-2 gene, chicken IFN-γ and chicken IFN-α pcr amplification product through agarose gel electrophoresis respectively 610bp, There is specific band in 550bp and 460bp or so, illustrate that the chicken for being separately connected flexible linker after optimization has been prepared The target gene of IL-2, chicken IFN-γ and chicken IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10:

Table 9rIL2-IFN γ PCR reaction system

Table 10rIL2-IFN γ-IFN-_αPCR reaction system

Response parameter are as follows: 95 DEG C of initial denaturation 4min, into circulation: 94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1570bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400 Shown in 3 > of <.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11:

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection:

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 1570bp or so in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN α constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in the place 75.7KD or so illustrates to have obtained recombinant protein in supernatant precipitating.

5. fusion protein purification

5.1His affinity chromatography

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, other same embodiments 3, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,75.7KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 5

A kind of recombination chicken long-acting interferon α, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the mirror of recombinant chIL-2, chicken interferon gamma and chicken interferon the α fusion protein formed It is fixed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 75.7KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected respectively, with the anti-chicken alpha interferon of abcam company mouse (1:5000 dilution) for one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilution).Recombination chicken long-acting interferon sample can be with anti-chicken interferon α Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 75.7KD or so, as shown in Figure 5.

Embodiment 7

Four parts of recombination chicken long-acting interferon α in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombination chicken that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100TCID respectively₅₀VSV virus.

Test result

The result shows that the recombination chicken long-acting interferon α obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombination chicken obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of recombination chicken long-acting interferon α that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in chicken intracorporal half-life period

Cytopathic-effect inhibition assay measures rIL2-IFN γ-IFN α blood concentration and time relationship

The broiler chicken (half male and half female) that six weight are roughly the same is taken, 2mg/ml recombination chicken long-acting interferon is subcutaneously injected in neck The freeze-dried 2ml of α, respectively in 1h, 2h, 4h, 8h, 16h, 32h, 64h, 96h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm low temperature It is centrifuged 10min and separates serum, every chicken blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay RIL2-IFN γ-IFN α concentration in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculates knot Fruit is shown in Table 13.

Dominant dynamic parameters in serum after 13 recombination chicken long-acting interferon α intramuscular injection of table

The result shows that recombination chicken long-acting interferon α has longer half-life period.Half-life period can reach 73h or so after measured, compared with Plain interferon improves 18 times or more.

Embodiment 9

The freeze-dried measurement that chicken cell immune response is influenced of four parts of recombination chicken long-acting interferon α in embodiment 5

It takes six roughly the same broiler chicken of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml recombination chicken long-acting interferon freeze-dried 2ml of α is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside chicken All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 content is carried out by kit specification, and testing result is as shown in table 14:

It is horizontal that table 14ELISA detects each group chicken cell immune response

The result shows that can significantly improve chicken Evaluation of Cytokines in Peripheral Blood IL-4's after injection recombination chicken long-acting interferon α Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion egg being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Anhui Jiuchuan Biotechnology Co., Ltd.

<120>a kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α and its preparation

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 522

<212> PRT

<213>chicken IL2-IFN γ-IFN α fusion protein

<400> 1

Met Met Cys Lys Val Leu Ile Phe Gly Cys Ile Ser Val Ala Met Leu

1 5 10 15

Met Thr Thr Ala Tyr Gly Ala Ser Leu Ser Ser Glu Lys Trp Lys Thr

20 25 30

Leu Gln Thr Leu Ile Lys Asp Leu Glu Ile Leu Glu Asn Ile Lys Asn

35 40 45

Lys Ile His Leu Glu Leu Tyr Thr Pro Thr Glu Thr Gln Glu Cys Thr

50 55 60

Gln Gln Thr Leu Gln Cys Tyr Leu Gly Glu Val Val Thr Leu Lys Lys

65 70 75 80

Glu Thr Glu Asp Asp Thr Glu Ile Lys Glu Glu Phe Val Thr Ala Ile

85 90 95

Gln Asn Ile Glu Lys Asn Leu Lys Ser Leu Thr Gly Leu Asn His Thr

100 105 110

Gly Ser Glu Cys Lys Ile Cys Glu Ala Asn Asn Lys Lys Lys Phe Pro

115 120 125

Asp Phe Leu His Glu Leu Thr Asn Phe Val Arg Tyr Leu Gln Lys Gly

130 135 140

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Thr Cys Gln Thr Tyr Asn

145 150 155 160

Leu Phe Val Leu Ser Val Ile Met Ile Tyr Tyr Gly His Thr Ala Ser

165 170 175

Ser Leu Ile Leu Val Gln Leu Gln Asp Asp Ile Ala Lys Leu Lys Ala

180 185 190

Asp Phe Asn Ser Ser His Ser Asp Val Ala Asp Gly Gly Pro Ile Ile

195 200 205

Ala Glu Lys Leu Lys Asn Trp Thr Glu Arg Asn Gln Lys Arg Ile Ile

210 215 220

Leu Ser Gln Ile Val Ser Met Tyr Leu Glu Met Leu Ala Asn Thr Asp

225 230 235 240

Lys Thr Lys Pro His Thr Lys His Ile Ser Glu Glu Leu Tyr Thr Leu

245 250 255

Lys Asn Asn Leu Pro Asp Gly Val Lys Lys Val Lys Asp Ile Met Asp

260 265 270

Leu Ala Lys Leu Pro Met Asn Asp Leu Arg Val Gln Leu Lys Ala Ala

275 280 285

Asn Glu Leu Phe Ser Ile Leu Gln Lys Leu Val Asn Pro Pro Ser Phe

290 295 300

Lys Arg Asn Met Ser Gln Ser Gln Arg Arg Cys Asn Cys Gly Gly Gly

305 310 315 320

Gly Ser Gly Gly Gly Gly Ser Pro Thr Met Ala Val Pro Ala Ser Pro

325 330 335

Gln His Pro Arg Gly Tyr Gly Ile Leu Leu Leu Thr Leu Leu Leu Lys

340 345 350

Ala Leu Ala Thr Thr Ala Ser Ala Cys Asn His Leu Arg Pro Gln Asp

355 360 365

Ala Thr Phe Ser His Asp Ser Leu Gln Leu Leu Arg Asp Met Ala Pro

370 375 380

Thr Leu Pro Gln Leu Cys Pro Gln His Asn Ala Ser Cys Ser Phe Asn

385 390 395 400

Asp Thr Ile Leu Asp Thr Ser Asn Thr Arg Gln Ala Asp Lys Thr Thr

405 410 415

His Asp Ile Leu Gln His Leu Phe Lys Ile Leu Ser Ser Pro Ser Thr

420 425 430

Pro Ala His Trp Asn Asp Ser Gln Arg Gln Ser Leu Leu Asn Arg Ile

435 440 445

His Arg Tyr Thr Gln His Leu Glu Gln Cys Leu Asp Ser Ser Asp Thr

450 455 460

Arg Ser Arg Thr Arg Trp Pro Arg Asn Leu His Leu Thr Ile Lys Lys

465 470 475 480

His Phe Ser Cys Leu His Thr Phe Leu Gln Asp Asn Asp Tyr Ser Ala

485 490 495

Cys Ala Trp Glu His Val Arg Leu Gln Ala Arg Ala Trp Phe Leu His

500 505 510

Ile His Asn Leu Thr Gly Asn Thr Arg Thr

515 520

<210> 2

<211> 1566

<212> DNA

<213>genome 1

<400> 2

atgatgtgcaaagtactgatctttggctgtatttcggtagcaatgctaatgactacagct 60

tatggagcatctctatcatcagaaaaatggaaaactcttcaaacattaataaaggattta 120

gaaatattggaaaatatcaagaataagattcatctcgagctctacacaccaactgagacc 180

caggagtgcacccagcaaactctgcagtgttacctgggagaagtggttactctgaagaaa 240

gaaactgaagatgacactgaaattaaagaagaatttgtaactgctattcaaaatatcgaa 300

aagaacctcaagagtcttacgggtctaaatcacaccggaagtgaatgcaagatctgtgaa 360

gctaacaacaagaaaaaatttcctgattttctccatgaactgaccaactttgtgagatat 420

ctgcaaaaaggtggtggtggttctggtggtggtggttctatgacttgccagacttacaac 480

ttgtttgttctgtccgtcatcatgatttattatggacatactgcaagtagtctaattctt 540

gttcaacttcaagatgatatagccaaactgaaagctgactttaactcaagtcattcagat 600

gtagctgacggtggacctattattgcagagaaactgaagaactggacagagagaaatcag 660

aaaaggatcatactgagccagattgtttcgatgtacttggaaatgcttgcaaacactgac 720

aagacaaagccgcacaccaaacacatatctgaggagctctatactctgaaaaacaacctt 780

cctgatggcgtgaagaaggtgaaagatatcatggacctggccaagctcccgatgaacgac 840

ttgagagtccagctcaaagccgcgaatgaactcttcagcatcttacagaagctggtgaat 900

cctccgagtttcaaaaggaacatgagccagtctcagaggagatgcaattgcggtggtggt 960

ggttctggtggtggtggttctcccaccatggctgtgcctgcaagcccacagcacccacgg 1020

gggtacggcatcctgctgctcacgctccttctgaaagctctcgccaccaccgcctccgcc 1080

tgcaaccaccttcgcccccaggatgccaccttctctcacgacagcctccagctcctccgg 1140

gacatggctcccacactaccccagctgtgcccacagcacaacgcgtcttgctccttcaac 1200

gacaccatcctggacaccagcaacacccggcaagccgacaaaaccacccacgacatcctt 1260

cagcacctcttcaaaatcctcagcagccccagcactccagcccactggaacgacagccaa 1320

cgccaaagcctcctcaaccggatccaccgctacacccagcacctcgagcaatgcttggac 1380

agcagcgacacgcgctcccggacgcgatggcctcgcaaccttcacctcaccatcaaaaaa 1440

cacttcagctgcctccacaccttcctccaagacaacgattacagcgcctgcgcctgggaa 1500

cacgtccgcctgcaagctcgtgcctggttcctgcacatccacaacctcacaggcaacacg 1560

cgcact 1566

<210> 3

<211> 1566

<212> DNA

<213>genome 2

<400> 3

atgatgtgcaaagtactgatctttggctgtatttcggtagcaatgctaatgactacagct 60

tatggagcatctctatcatcagaaaaatggaaaactcttcaaacattaataaaggattta 120

gaaatattggaaaatatcaagaataagattcatctcgagctctacacaccaactgagacc 180

caggagtgcacccagcaaactctgcagtgttacctgggagaagtggttactctgaagaaa 240

gaaactgaagatgacactgaaattaaagaagaatttgtaactgctattcaaaatatcgaa 300

aagaacctcaagagtcttacgggtctaaatcacaccggaagtgaatgcaagatctgtgaa 360

gctaacaacaagaaaaaatttcctgattttctccatgaactgaccaactttgtgagatat 420

ctgcaaaaaggtggtggtggttctggtggtggtggttctatgacctgccagacctacaac 480

ctgttcgttctgtctgttatcatgatctactacggtcacaccgcttcttctctgatcctg 540

gttcagctgcaggacgacatcgctaaactgaaagctgacttcaactcttctcactctgac 600

gttgctgacggtggtccgatcatcgctgaaaaactgaaaaactggaccgaacgtaaccag 660

aaacgtatcatcctgtctcagatcgtttctatgtacctggaaatgctggctaacaccgac 720

aaaaccaaaccgcacaccaaacacatctctgaagaactgtacaccctgaaaaacaacctg 780

ccggacggtgttaaaaaagttaaagacatcatggacctggctaaactgccgatgaacgac 840

ctgcgtgttcagctgaaagctgctaacgaactgttctctatcctgcagaaactggttaac 900

ccgccgtctttcaaacgtaacatgtctcagtctcagcgtcgttgcaactgcggtggtggt 960

ggttctggtggtggtggttctccgaccatggctgttccggcttctccgcagcacccgcgt 1020

ggttacggtatcctgctgctgaccctgctgctgaaagctctggctaccaccgcttctgct 1080

tgcaaccacctgcgtccgcaggacgctaccttctctcacgactctctgcagctgctgcgt 1140

gacatggctccgaccctgccgcagctgtgcccgcagcacaacgcttcttgctctttcaac 1200

gacaccatcctggacacctctaacacccgtcaggctgacaaaaccacccacgacatcctg 1260

cagcacctgttcaaaatcctgtcttctccgtctaccccggctcactggaacgactctcag 1320

cgtcagtctctgctgaaccgtatccaccgttacacccagcacctggaacagtgcctggac 1380

tcttctgacacccgttctcgtacccgttggccgcgtaacctgcacctgaccatcaaaaaa 1440

cacttctcttgcctgcacaccttcctgcaggacaacgactactctgcttgcgcttgggaa 1500

cacgttcgtctgcaggctcgtgcttggttcctgcacatccacaacctgaccggtaacacc 1560

cgtacc 1566

<210> 4

<211> 429

<212> DNA

<213>chicken IL-2 gene

<400> 4

atgatgtgcaaagtactgatctttggctgtatttcggtagcaatgctaatgactacagct 60

tatggagcatctctatcatcagaaaaatggaaaactcttcaaacattaataaaggattta 120

gaaatattggaaaatatcaagaataagattcatctcgagctctacacaccaactgagacc 180

caggagtgcacccagcaaactctgcagtgttacctgggagaagtggttactctgaagaaa 240

gaaactgaagatgacactgaaattaaagaagaatttgtaactgctattcaaaatatcgaa 300

aagaacctcaagagtcttacgggtctaaatcacaccggaagtgaatgcaagatctgtgaa 360

gctaacaacaagaaaaaatttcctgattttctccatgaactgaccaactttgtgagatat 420

ctgcaaaaa 429

<210> 5

<211> 492

<212> DNA

<213>chicken IFN-γ

<400> 5

atgacttgccagacttacaacttgtttgttctgtccgtcatcatgatttattatggacat 60

actgcaagtagtctaattcttgttcaacttcaagatgatatagccaaactgaaagctgac 120

tttaactcaagtcattcagatgtagctgacggtggacctattattgcagagaaactgaag 180

aactggacagagagaaatcagaaaaggatcatactgagccagattgtttcgatgtacttg 240

gaaatgcttgcaaacactgacaagacaaagccgcacaccaaacacatatctgaggagctc 300

tatactctgaaaaacaaccttcctgatggcgtgaagaaggtgaaagatatcatggacctg 360

gccaagctcccgatgaacgacttgagagtccagctcaaagccgcgaatgaactcttcagc 420

atcttacagaagctggtgaatcctccgagtttcaaaaggaacatgagccagtctcagagg 480

agatgcaattgc 492

<210> 6

<211> 585

<212> DNA

<213>chicken IFN-α

<400> 6

cccaccatggctgtgcctgcaagcccacagcacccacgggggtacggcatcctgctgctc 60

acgctccttctgaaagctctcgccaccaccgcctccgcctgcaaccaccttcgcccccag 120

gatgccaccttctctcacgacagcctccagctcctccgggacatggctcccacactaccc 180

cagctgtgcccacagcacaacgcgtcttgctccttcaacgacaccatcctggacaccagc 240

aacacccggcaagccgacaaaaccacccacgacatccttcagcacctcttcaaaatcctc 300

agcagccccagcactccagcccactggaacgacagccaacgccaaagcctcctcaaccgg 360

atccaccgctacacccagcacctcgagcaatgcttggacagcagcgacacgcgctcccgg 420

acgcgatggcctcgcaaccttcacctcaccatcaaaaaacacttcagctgcctccacacc 480

ttcctccaagacaacgattacagcgcctgcgcctgggaacacgtccgcctgcaagctcgt 540

gcctggttcctgcacatccacaacctcacaggcaacacgcgcact 585

<210> 7

<211> 429

<212> DNA

<213>chicken IL-2 gene

<400> 7

atgatgtgcaaagttctgatcttcggttgcatctctgttgctatgctgatgaccaccgct 60

tacggtgcttctctgtcttctgaaaaatggaaaaccctgcagaccctgatcaaagacctg 120

gaaatcctggaaaacatcaaaaacaaaatccacctggaactgtacaccccgaccgaaacc 180

caggaatgcacccagcagaccctgcagtgctacctgggtgaagttgttaccctgaaaaaa 240

gaaaccgaagacgacaccgaaatcaaagaagaattcgttaccgctatccagaacatcgaa 300

aaaaacctgaaatctctgaccggtctgaaccacaccggttctgaatgcaaaatctgcgaa 360

gctaacaacaaaaaaaaattcccggacttcctgcacgaactgaccaacttcgttcgttac 420

ctgcagaaa 429

<210> 8

<211> 492

<212> DNA

<213>chicken IFN-γ

<400> 8

atgacctgccagacctacaacctgttcgttctgtctgttatcatgatctactacggtcac 60

accgcttcttctctgatcctggttcagctgcaggacgacatcgctaaactgaaagctgac 120

ttcaactcttctcactctgacgttgctgacggtggtccgatcatcgctgaaaaactgaaa 180

aactggaccgaacgtaaccagaaacgtatcatcctgtctcagatcgtttctatgtacctg 240

gaaatgctggctaacaccgacaaaaccaaaccgcacaccaaacacatctctgaagaactg 300

tacaccctgaaaaacaacctgccggacggtgttaaaaaagttaaagacatcatggacctg 360

gctaaactgccgatgaacgacctgcgtgttcagctgaaagctgctaacgaactgttctct 420

atcctgcagaaactggttaacccgccgtctttcaaacgtaacatgtctcagtctcagcgt 480

cgttgcaactgc 492

<210> 9

<211> 585

<212> DNA

<213>chicken IFN-α

<400> 9

ccgaccatggctgttccggcttctccgcagcacccgcgtggttacggtatcctgctgctg 60

accctgctgctgaaagctctggctaccaccgcttctgcttgcaaccacctgcgtccgcag 120

gacgctaccttctctcacgactctctgcagctgctgcgtgacatggctccgaccctgccg 180

cagctgtgcccgcagcacaacgcttcttgctctttcaacgacaccatcctggacacctct 240

aacacccgtcaggctgacaaaaccacccacgacatcctgcagcacctgttcaaaatcctg 300

tcttctccgtctaccccggctcactggaacgactctcagcgtcagtctctgctgaaccgt 360

atccaccgttacacccagcacctggaacagtgcctggactcttctgacacccgttctcgt 420

acccgttggccgcgtaacctgcacctgaccatcaaaaaacacttctcttgcctgcacacc 480

ttcctgcaggacaacgactactctgcttgcgcttgggaacacgttcgtctgcaggctcgt 540

gcttggttcctgcacatccacaacctgaccggtaacacccgtacc 585

Claims

1. a kind of fusion protein being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α, it is characterised in that: described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of recombination chicken long-acting interferon, which is characterized in that the recombination chicken long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step It is rapid: expression vector as claimed in claim 3 being imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, preparation method are as follows:

(1) design primer, is obtained or the sheep interleukin 2 of the flexible linker sequence of artificial synthesized band, sheep by reverse transcription The target gene of interferon gamma, sheep interferon-tau；Recombinant chIL-2, chicken interferon gamma, chicken are interfered by flexible linker The target gene of plain α connects, the nucleotides sequence list of the target gene after connection such as 400 < of SEQUENCE LISTING, 2 > It is shown or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2-IFN can be obtained γ-IFNα。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying are as follows: fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of recombination chicken long-acting interferon according to claim 5, which is characterized in that the recombination chicken is long-acting dry The long half time of element is disturbed up to 73 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of chicken itself can be improved.