CN108864306A - A kind of fusion protein and preparation method thereof being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha - Google Patents

Abstract

The fusion protein and preparation method thereof that the invention discloses a kind of to be made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha; the fusion protein is connected through flexible linker with dog interferon alpha by canine leucocyte interleukin 2, dog interferon γ and is formed, and is freeze-dried to obtain canine recombinant long-acting interferon after fusion protein and freeze drying protectant mixture.The canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, and the half-life period of more common dog interferon improves 15 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of dog itself.

Description

A kind of fusion being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by canine leucocyte interleukin 2, dog interferon γ and dog The fusion protein and preparation method thereof of interferon-' alpha ' composition.

Background technique

It is analyzed according to Chinese pet Industry, the market scale by the end of 2014 year end China pet industries has reached 105800000000 RMB, and Chinese Medical pet industry only accounts for about 20% at present, the city of the U.S. for the pet industry relative maturity that compares , the output value ratio of Medical pet reaches 50%, and there are huge development spaces for Chinese Medical pet industry.

Dog is the friend of mankind's loyalty, with increasing considerably for the canines feeding quantity such as domestic pet dog, canine disease The continuous raising of disease incidence, the death rate causes spirit and double loss economically to the mankind.Dog causes with mankind's intimate contact The mankind are high by the probability of dog virus infection, such as rabies viruses, canine parvovirus and canine distemper virus, can all give human health Bring great threat.

Report interferon is studied as a kind of important cell factor, to canine distemper, canine parvovirus according to related science Certain curative effect is all had in the treatments of diseases such as disease, canine infectious hepatitis and canine coronavirus disease.Therefore actively research interference Element has broad application prospects in canine viral disease treatment.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selectively Act on the infection cells such as virus, by inhibit infected cell in virus protein biosynthesis, play wide spectrum and efficiently Antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition virus Duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

γ type IFN is that the T cell and NK cell by activating generate, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to the anti-of virus infection It answers, but the immunoregulatory activity of interferon gamma is coordinating immune response and determining in the long-term antiviral state of body to play more Important role, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve Curative effect of medication.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

It is interfered in order to solve the above technical problems, the present invention provides one kind by canine leucocyte interleukin 2, dog interferon γ and dog The fusion protein and preparation method thereof of plain α composition, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of canine recombinant long-acting interferon, the canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, compared with The half-life period of common dog interferon improves 15 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of dog itself and answer It answers.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, the fusion protein Amino acid sequence table as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection Existing canine leucocyte interleukin 2, canine IFN-γ, dog IFN-α original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.19,0.22,0.27, GC percentage be 39.6%, 39.8%, 59.7%；And by canine leucocyte interleukin 2, obtained after canine IFN-γ, dog IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 1.0, 1.0,1.0, GC percentage 48.8%, 45.0%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of canine recombinant long-acting interferon, the canine recombinant long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, and preparation method is：

(1) design primer, is obtained or the canine leucocyte interleukin of the flexible linker sequence of artificial synthesized band by reverse transcription 2, the target gene of dog interferon γ, dog interferon alpha；By flexible linker by canine leucocyte interleukin 2, dog interferon γ, dog The target gene of interferon-' alpha ' connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2- can be obtained IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of canine leucocyte interleukin 2 (IL-2) is：

Upstream IL-2-F1：CGGGATCCATGTACAAAATGCAACTC has BamHI restriction enzyme site；

Downstream IL-2-R1：

ACCACCACCAGAACCACCACCACCAGTCAGTGTTGAGAAG, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAATTATACAAGCTATATC, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCTTTCGATGCTCTGC, with flexible linker；

The primer sequence of dog interferon alpha (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCCCTGCCC, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGTTTCCTCCTCCTTACT has XhoI restriction enzyme site；

B. RNA is extracted from dog liver, the target gene of dog IL-2, canine IFN-γ and dog IFN-α is obtained by reverse transcription, The gene order of three respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of dog IL-2, canine IFN-γ and dog IFN-α as template, and it is utilized respectively dog IL-2, dog The upstream and downstream primer of IFN-γ and dog IFN-α carries out PCR amplification, respectively obtains the dog IL-2 for connecting flexible linker, dog IFN-γ and dog IFN-α gene.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ gene is obtained using flexible linker connection dog IL-2 and canine IFN-γ target gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN is obtained using flexible linker connection rIL2-IFN γ gene and dog IFN-α target gene α gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of canine leucocyte interleukin 2 (IL-2) is：

Upstream IL-2-F2：CGGGATCCATGTACAAAATGCAGC has BamHI restriction enzyme site；

Downstream IL-2-R2：

ACCACCACCAGAACCACCACCACCGGTCAGGGTAGAGAA, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAACTACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGACG, with flexible linker；

Dog interferon alpha (IFN-α)：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCTCTGCCGT, with flexible linker；

Downstream IFN-α-R2：

CCCTCGAGTTTACGACGACGAAC has XhoI restriction enzyme site.

B. the target gene of the dog IL-2, canine IFN-γ and dog IFN-α, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

Respectively using the target gene of dog IL-2, canine IFN-γ and dog IFN-α as template, and it is utilized respectively dog IL-2, dog The upstream and downstream primer of IFN-γ and dog IFN-α carries out PCR amplification, respectively obtains the dog IL-2 for connecting flexible linker, dog IFN-γ and dog IFN-α gene.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ gene is obtained using flexible linker connection dog IL-2 and canine IFN-γ target gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN is obtained using flexible linker connection rIL2-IFN γ gene and dog IFN-α target gene α gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α downstream primer 0.5 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

The present invention also provides the application of the canine recombinant long-acting interferon, long half time had up to 63 hours or more Broad-spectrum disease resistance toxic action and the immune response that dog itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. dog IL-2, canine IFN-γ and dog IFN-α gene are realized amalgamation and expression by flexibility linker, interference is improved Plain half-life period improves 15 times or more compared with plain interferon；It is significant to drop compared with common polyethylene glycol fused interferon Low cost.

2. by being optimized to dog IL-2, canine IFN-γ and dog IFN-α gene, improve dog IL-2, canine IFN-γ and The expression quantity of dog IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of dog IL-2, canine IFN-γ and dog IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improving the immune response of dog itself.

Detailed description of the invention

Fig. 1 is 2 gene of canine leucocyte interleukin, dog interferon alpha gene and the dog interferon γ gene RT-PCR in embodiment 1 The result of amplification；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Dog interleukin-22 gene RT-PCR amplified production；Swimming lane 2：Dog Interferon-gamma gene RT-PCR amplified production；Swimming lane 3：Dog interferon alpha gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in dog IL-2, IFN-α connected with the target gene of IFN-γ after PCR amplification knot Fruit；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Dog interleukin-22 gene, dog interferon γ gene and dog interferon alpha gene Ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the canine recombinant long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the canine recombinant long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the canine recombinant long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, preparation method is such as Under：

1. canine leucocyte interleukin 2 (IL-2), dog interferon γ (IFN-γ) and dog interferon alpha (IFN-α) target gene It obtains and expands

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in canine leucocyte interleukin 2 BamHI restriction enzyme site and Linker sequence are introduced in upstream primer and downstream primer respectively, in the upstream primer of dog interferon γ With Linker sequence is introduced in downstream primer respectively, introduced respectively in the upstream primer and downstream primer of dog interferon alpha Linker sequence and XhoI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from dog liver organization, the purpose base of dog IL-2, canine IFN-γ and dog IFN-α is obtained by reverse transcription Cause, the gene order of three respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 490bp, 560bp and 590bp or so through agarose gel electrophoresis in RT-PCR amplified production, As a result as shown in Figure 1, illustrating that dog IL-2, canine IFN-γ and the dog for being separately connected flexible linker sequence have been prepared respectively The target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rIL2-IFN γ PCR reaction system of table

4 rIL2-IFN γ of table-IFN α PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1580bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occur rIL2-IFN γ and IFN-α amplified product band in Fig. 2, this is because connecting in rIL2-IFN γ with IFN-α gene During, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > It is shown.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid BamHI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through BamHI and XhoI double digestion Product detects single band at the place 1580bp or so through agarose gel electrophoresis, and result is as shown in figure 3, illustrate successfully to obtain PET-32a/rIL2-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as shown in figure 4, it can be seen from the figure that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in the place 76.4KD or so after bacterial cell disruption after leading 5h, illustrates in precipitating and supernatant Equal successful expression fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁵U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, amino acid sequence can be obtained Column are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, other same embodiments 1, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,76.4KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, preparation method is such as Under：

1. canine leucocyte interleukin 2 (IL-2), dog interferon γ (IFN-γ) and dog interferon alpha (IFN-α) target gene It obtains and expands

Dog IL-2, canine IFN-γ and dog IFN-α in embodiment 1 is optimized, artificial synthesized dog IL-2, canine IFN-γ With dog IFN-α target gene, after optimization, the nucleotide sequence of three respectively as 400 < of SEQUENCE LISTING, 7 >, Shown in 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, dog IL-2, the dog IFN- in the present embodiment couple γ and dog IFN-α gene codon optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Dog IL-2, dog are found using software detection The codon of IFN-γ and dog IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19, 0.22,0.27, GC percentage is 39.6%, 39.8%, 59.7%；And by dog IL-2, canine IFN-γ and dog IFN-α gene It is respectively 1.0,1.0,1.0, GC percentage that recombination codon adaptation indexI (CAI) in Escherichia coli is obtained after optimization 48.8%, 45.0%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of dog IL-2, canine IFN-γ and dog IFN-α after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of dog IL-2, canine IFN-γ and dog IFN-α through agarose gel electrophoresis respectively 490bp, There is specific band in 560bp and 590bp or so, illustrate that the dog for being separately connected flexible linker after optimization has been prepared The target gene of IL-2, canine IFN-γ and dog IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rIL2-IFN γ PCR reaction system of table

10 rIL2-IFN γ of table-IFN-α PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1580bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400 Shown in 3 > of <.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 1580bp or so in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN α constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in the place 76.4KD or so illustrates to have obtained recombinant protein in supernatant precipitating.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁵U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, other same embodiments 3, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,76.4KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 5

A kind of canine recombinant long-acting interferon α, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the mirror for the fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha It is fixed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 76.4KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-canine interferon alpha (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Canine recombinant long-acting interferon sample can be with anti-dog interferon alpha Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 76.4KD or so, as shown in Figure 5.

Embodiment 7

Four parts of canine recombinant long-acting interferon α in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the canine recombinant that various dose is added is long for culture Interferon-' alpha ' is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the canine recombinant long-acting interferon α obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the canine recombinant obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=10⁵U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of canine recombinant long-acting interferon α that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in dog intracorporal half-life period

Cytopathic-effect inhibition assay measures rIL2-IFN γ-IFN α blood concentration and time relationship

The dog (half male and half female) that six weight are roughly the same is taken, 2mg/ml canine recombinant long-acting interferon α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 32h, 64h, 96h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm low temperature from Heart 10min separates serum, and every dog blood sample of each time point is to be measured in -20 DEG C of preservations.Serum sample is measured using cytopathic-effect inhibition assay RIL2-IFN γ-IFN α concentration in product is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculated result It is shown in Table 13.

Dominant dynamic parameters in serum after 13 canine recombinant long-acting interferon α intramuscular injection of table

The result shows that canine recombinant long-acting interferon α has longer half-life period.Half-life period can reach 63h or so after measured, compared with Plain interferon improves 15 times or more.

Embodiment 9

The freeze-dried measurement that canine cells immune response is influenced of four parts of canine recombinant long-acting interferon α in embodiment 5

It takes six roughly the same dogs of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck The PBS of 2mL is subcutaneously injected in the 2mg/ml canine recombinant long-acting interferon freeze-dried 2ml of α, control group neck, takes dog periphery after injection 4 weeks Blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 content, is carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group canine cells immune response

The result shows that cell factor IL-4 in canine peripheral blood can be significantly improved after injection canine recombinant long-acting interferon α Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion egg being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha and its preparation

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 528

<212> PRT

<213>Dog IL2-IFN γ-IFN α fusion protein

<400> 1

Met Tyr Lys Met Gln Leu Leu Ser Cys Ile Ala Leu Thr Leu Val Leu

1 5 10 15

Val Ala Asn Ser Ala Pro Ile Thr Ser Ser Ser Thr Lys Glu Thr Glu

20 25 30

Gln Gln Met Glu Gln Leu Leu Leu Asp Leu Gln Leu Leu Leu Asn Gly

35 40 45

Val Asn Asn Tyr Glu Asn Pro Gln Leu Ser Arg Met Leu Thr Phe Lys

50 55 60

Phe Tyr Thr Pro Lys Lys Ala Thr Glu Phe Thr His Leu Gln Cys Leu

65 70 75 80

Ala Glu Glu Leu Lys Asn Leu Glu Glu Val Leu Gly Leu Pro Gln Ser

85 90 95

Lys Asn Val His Leu Thr Asp Thr Lys Glu Leu Ile Ser Asn Met Asn

100 105 110

Val Thr Leu Leu Lys Leu Lys Gly Ser Glu Thr Ser Tyr Asn Cys Glu

115 120 125

Tyr Asp Asp Glu Thr Ala Thr Ile Thr Glu Phe Leu Asn Lys Trp Ile

130 135 140

Thr Phe Cys Gln Ser Ile Phe Ser Thr Leu Thr Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Gly Gly Ser Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln

165 170 175

Leu Cys Val Ile Leu Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe

180 185 190

Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro

195 200 205

Asp Val Ser Asp Gly Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp

210 215 220

Arg Glu Glu Ser Asp Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe

225 230 235 240

Tyr Leu Lys Leu Phe Asp Asn Phe Lys Asp Asn Gln Ile Ile Gln Arg

245 250 255

Ser Met Asp Thr Ile Lys Glu Asp Met Leu Gly Lys Phe Leu Asn Ser

260 265 270

Ser Thr Ser Lys Arg Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val

275 280 285

Asn Asp Leu Gln Val Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val

290 295 300

Met Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser

305 310 315 320

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Lys Gly Gly Gly Gly Ser

325 330 335

Gly Gly Gly Gly Ser Met Ala Leu Pro Cys Ser Phe Ser Val Ala Leu

340 345 350

Val Leu Leu Ser Cys His Ser Leu Cys Cys Leu Ala Cys Asp Leu Pro

355 360 365

Asp Thr His Ser Leu Arg Asn Trp Arg Val Leu Thr Leu Leu Gly Gln

370 375 380

Met Arg Arg Leu Ser Ala Ser Ser Cys Asp His Tyr Thr Thr Asp Phe

385 390 395 400

Ala Phe Pro Lys Glu Leu Phe Asp Gly Gln Arg Leu Gln Glu Ala Gln

405 410 415

Ala Leu Ser Val Val His Val Met Thr Gln Lys Val Phe His Leu Phe

420 425 430

Cys Thr Asn Met Ser Ser Ala Pro Trp Asn Met Thr Leu Leu Gly Glu

435 440 445

Leu Cys Ser Gly Leu Ser Glu Gln Leu Asp Asp Leu Asp Ala Cys Pro

450 455 460

Leu Gln Glu Ala Gly Leu Ala Glu Thr Pro Leu Met His Glu Asp Ser

465 470 475 480

Thr Leu Arg Thr Tyr Phe Gln Arg Ile Ser Leu Tyr Leu Gln Asp Arg

485 490 495

Asn His Ser Pro Cys Ala Trp Glu Met Val Arg Ala Glu Ile Gly Arg

500 505 510

Ser Phe Phe Ser Leu Thr Ile Leu Gln Glu Arg Val Arg Arg Arg Lys

515 520 525

<210> 2

<211> 1584

<212> DNA

<213>Genome 1

<400> 2

atgtacaaaa tgcaactctt gtcttgcatc gcactgacgc ttgtacttgt cgcaaacagt 60

gcacctatta cttcaagctc tacaaaggaa acagagcaac agatggagca attactgctg 120

gatttacagt tgcttttgaa tggagttaat aattatgaga acccccaact ctccaggatg 180

ctcacattta agttttacac gcccaagaag gccacagaat ttacacacct tcaatgtcta 240

gcagaagaac tcaaaaacct ggaggaagtg ctaggtttac ctcaaagcaa aaacgttcac 300

ttgacagaca ccaaggaatt aatcagcaat atgaatgtaa cacttctgaa actaaaggga 360

tctgaaacaa gttacaactg tgaatatgat gacgagacag caaccattac agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc ttctcaacac tgactggtgg tggtggttct 480

ggtggtggtg gttctatgaa ttatacaagc tatatcttag cttttcagct ttgcgtgatt 540

ttgtgttctt ctggctgtaa ctgtcaggcc atgtttttta aagaaataga aaacctaaag 600

gaatatttta atgcaagtaa tccagatgta tcggacggtg ggtctctttt cgtagatatt 660

ttgaagaaat ggagagagga gagtgacaaa acaatcattc agagccaaat tgtctctttc 720

tacttgaaac tgtttgacaa ctttaaagat aaccagatca ttcaaaggag catggatacc 780

atcaaggaag acatgcttgg caagttctta aatagcagca ccagtaagag ggaggacttc 840

cttaagctga ttcaaattcc tgtgaacgat ctgcaggtcc agcgcaaggc gataaatgaa 900

ctcatcaaag tgatgaatga tctctcacca agatccaacc taaggaagcg gaaaaggagt 960

cagaatctgt ttcgaggccg cagagcatcg aaaggtggtg gtggttctgg tggtggtggt 1020

tctatggccc tgccctgctc cttctcggtg gccctggtgc tgctcagctg ccactccctg 1080

tgctgtctgg cttgcgacct gcccgacacc cacagcctgc gcaactggag ggtcctgacg 1140

ctcctgggac agatgaggag actctccgcc agctcttgtg accactacac cactgacttt 1200

gccttcccca aggaactgtt tgatggccag cggctccagg aggcgcaagc cctctctgtg 1260

gtccacgtga tgacccagaa ggtcttccac ctcttctgca cgaacatgtc ctctgctcct 1320

tggaacatga ccctcctggg ggaattgtgc tcggggctct ctgagcagct ggatgacctg 1380

gatgcctgtc ccctgcagga ggcagggctg gccgagaccc ccctcatgca tgaagactcc 1440

accctgagga cctacttcca aaggatctcc ctctacctgc aagacaggaa ccacagcccg 1500

tgtgcctggg agatggtccg agcagaaatc gggagatcct tcttctcctt gaccatcttg 1560

caagaaagag taaggaggag gaaa 1584

<210> 3

<211> 1584

<212> DNA

<213>Genome 2

<400> 3

atgtacaaaa tgcagctgct gtcttgcatc gctctgaccc tggttctggt tgctaactct 60

gctccgatca cctcttcttc taccaaagaa accgaacagc agatggaaca gctgctgctg 120

gacctgcagc tgctgctgaa cggtgttaac aactacgaaa acccgcagct gtctcgtatg 180

ctgaccttca aattctacac cccgaaaaaa gctaccgaat tcacccacct gcagtgcctg 240

gctgaagaac tgaaaaacct ggaagaagtt ctgggtctgc cgcagtctaa aaacgttcac 300

ctgaccgaca ccaaagaact gatctctaac atgaacgtta ccctgctgaa actgaaaggt 360

tctgaaacct cttacaactg cgaatacgac gacgaaaccg ctaccatcac cgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc ttctctaccc tgaccggtgg tggtggttct 480

ggtggtggtg gttctatgaa ctacacctct tacatcctgg ctttccagct gtgcgttatc 540

ctgtgctctt ctggttgcaa ctgccaggct atgttcttca aagaaatcga aaacctgaaa 600

gaatacttca acgcttctaa cccggacgtt tctgacggtg gttctctgtt cgttgacatc 660

ctgaaaaaat ggcgtgaaga atctgacaaa accatcatcc agtctcagat cgtttctttc 720

tacctgaaac tgttcgacaa cttcaaagac aaccagatca tccagcgttc tatggacacc 780

atcaaagaag acatgctggg taaattcctg aactcttcta cctctaaacg tgaagacttc 840

ctgaaactga tccagatccc ggttaacgac ctgcaggttc agcgtaaagc tatcaacgaa 900

ctgatcaaag ttatgaacga cctgtctccg cgttctaacc tgcgtaaacg taaacgttct 960

cagaacctgt tccgtggtcg tcgtgcttct aaaggtggtg gtggttctgg tggtggtggt 1020

tctatggctc tgccgtgctc tttctctgtt gctctggttc tgctgtcttg ccactctctg 1080

tgctgcctgg cttgcgacct gccggacacc cactctctgc gtaactggcg tgttctgacc 1140

ctgctgggtc agatgcgtcg tctgtctgct tcttcttgcg accactacac caccgacttc 1200

gctttcccga aagaactgtt cgacggtcag cgtctgcagg aagctcaggc tctgtctgtt 1260

gttcacgtta tgacccagaa agttttccac ctgttctgca ccaacatgtc ttctgctccg 1320

tggaacatga ccctgctggg tgaactgtgc tctggtctgt ctgaacagct ggacgacctg 1380

gacgcttgcc cgctgcagga agctggtctg gctgaaaccc cgctgatgca cgaagactct 1440

accctgcgta cctacttcca gcgtatctct ctgtacctgc aggaccgtaa ccactctccg 1500

tgcgcttggg aaatggttcg tgctgaaatc ggtcgttctt tcttctctct gaccatcctg 1560

caggaacgtg ttcgtcgtcg taaa 1584

<210> 4

<211> 465

<212> DNA

<213>Dog IL-2

<400> 4

atgtacaaaa tgcaactctt gtcttgcatc gcactgacgc ttgtacttgt cgcaaacagt 60

gcacctatta cttcaagctc tacaaaggaa acagagcaac agatggagca attactgctg 120

gatttacagt tgcttttgaa tggagttaat aattatgaga acccccaact ctccaggatg 180

ctcacattta agttttacac gcccaagaag gccacagaat ttacacacct tcaatgtcta 240

gcagaagaac tcaaaaacct ggaggaagtg ctaggtttac ctcaaagcaa aaacgttcac 300

ttgacagaca ccaaggaatt aatcagcaat atgaatgtaa cacttctgaa actaaaggga 360

tctgaaacaa gttacaactg tgaatatgat gacgagacag caaccattac agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc ttctcaacac tgact 465

<210> 5

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 5

atgaattata caagctatat cttagctttt cagctttgcg tgattttgtg ttcttctggc 60

tgtaactgtc aggccatgtt ttttaaagaa atagaaaacc taaaggaata ttttaatgca 120

agtaatccag atgtatcgga cggtgggtct cttttcgtag atattttgaa gaaatggaga 180

gaggagagtg acaaaacaat cattcagagc caaattgtct ctttctactt gaaactgttt 240

gacaacttta aagataacca gatcattcaa aggagcatgg ataccatcaa ggaagacatg 300

cttggcaagt tcttaaatag cagcaccagt aagagggagg acttccttaa gctgattcaa 360

attcctgtga acgatctgca ggtccagcgc aaggcgataa atgaactcat caaagtgatg 420

aatgatctct caccaagatc caacctaagg aagcggaaaa ggagtcagaa tctgtttcga 480

ggccgcagag catcgaaa 498

<210> 6

<211> 561

<212> DNA

<213>Dog IFN-α

<400> 6

atggccctgc cctgctcctt ctcggtggcc ctggtgctgc tcagctgcca ctccctgtgc 60

tgtctggctt gcgacctgcc cgacacccac agcctgcgca actggagggt cctgacgctc 120

ctgggacaga tgaggagact ctccgccagc tcttgtgacc actacaccac tgactttgcc 180

ttccccaagg aactgtttga tggccagcgg ctccaggagg cgcaagccct ctctgtggtc 240

cacgtgatga cccagaaggt cttccacctc ttctgcacga acatgtcctc tgctccttgg 300

aacatgaccc tcctggggga attgtgctcg gggctctctg agcagctgga tgacctggat 360

gcctgtcccc tgcaggaggc agggctggcc gagacccccc tcatgcatga agactccacc 420

ctgaggacct acttccaaag gatctccctc tacctgcaag acaggaacca cagcccgtgt 480

gcctgggaga tggtccgagc agaaatcggg agatccttct tctccttgac catcttgcaa 540

gaaagagtaa ggaggaggaa a 561

<210> 7

<211> 465

<212> DNA

<213>Dog IL-2

<400> 7

atgtacaaaa tgcagctgct gtcttgcatc gctctgaccc tggttctggt tgctaactct 60

gctccgatca cctcttcttc taccaaagaa accgaacagc agatggaaca gctgctgctg 120

gacctgcagc tgctgctgaa cggtgttaac aactacgaaa acccgcagct gtctcgtatg 180

ctgaccttca aattctacac cccgaaaaaa gctaccgaat tcacccacct gcagtgcctg 240

gctgaagaac tgaaaaacct ggaagaagtt ctgggtctgc cgcagtctaa aaacgttcac 300

ctgaccgaca ccaaagaact gatctctaac atgaacgtta ccctgctgaa actgaaaggt 360

tctgaaacct cttacaactg cgaatacgac gacgaaaccg ctaccatcac cgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc ttctctaccc tgacc 465

<210> 8

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 8

atgaactaca cctcttacat cctggctttc cagctgtgcg ttatcctgtg ctcttctggt 60

tgcaactgcc aggctatgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgtttctga cggtggttct ctgttcgttg acatcctgaa aaaatggcgt 180

gaagaatctg acaaaaccat catccagtct cagatcgttt ctttctacct gaaactgttc 240

gacaacttca aagacaacca gatcatccag cgttctatgg acaccatcaa agaagacatg 300

ctgggtaaat tcctgaactc ttctacctct aaacgtgaag acttcctgaa actgatccag 360

atcccggtta acgacctgca ggttcagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaaa 498

<210> 9

<211> 561

<212> DNA

<213>Dog IFN-α

<400> 9

atggctctgc cgtgctcttt ctctgttgct ctggttctgc tgtcttgcca ctctctgtgc 60

tgcctggctt gcgacctgcc ggacacccac tctctgcgta actggcgtgt tctgaccctg 120

ctgggtcaga tgcgtcgtct gtctgcttct tcttgcgacc actacaccac cgacttcgct 180

ttcccgaaag aactgttcga cggtcagcgt ctgcaggaag ctcaggctct gtctgttgtt 240

cacgttatga cccagaaagt tttccacctg ttctgcacca acatgtcttc tgctccgtgg 300

aacatgaccc tgctgggtga actgtgctct ggtctgtctg aacagctgga cgacctggac 360

gcttgcccgc tgcaggaagc tggtctggct gaaaccccgc tgatgcacga agactctacc 420

ctgcgtacct acttccagcg tatctctctg tacctgcagg accgtaacca ctctccgtgc 480

gcttgggaaa tggttcgtgc tgaaatcggt cgttctttct tctctctgac catcctgcag 540

gaacgtgttc gtcgtcgtaa a 561

Claims (10)

1. a kind of fusion protein being made of canine leucocyte interleukin 2, dog interferon γ and dog interferon alpha, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of canine recombinant long-acting interferon, which is characterized in that the canine recombinant long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, preparation method are：

(1) design primer, is obtained or the canine leucocyte interleukin 2 of the flexible linker sequence of artificial synthesized band, dog by reverse transcription The target gene of interferon gamma, dog interferon alpha；Canine leucocyte interleukin 2, dog interferon γ, dog are interfered by flexible linker The target gene of plain α connects, the nucleotides sequence list of the target gene after connection such as 400 < of SEQUENCE LISTING, 2 > It is shown or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2-IFN can be obtained γ-IFNα。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of canine recombinant long-acting interferon according to claim 5, which is characterized in that the canine recombinant is long-acting dry The long half time of element is disturbed up to 63 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of dog itself can be improved.