CN108794643A - A kind of fusion protein and preparation method thereof being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2 - Google Patents

Abstract

The invention discloses a kind of fusion proteins and preparation method thereof being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2; the fusion protein is connected through flexible linker with canine leucocyte interleukin 2 by dog albumin, dog interferon γ and is formed, through being freeze-dried to obtain canine recombinant long-acting interferon after fusion protein and freeze drying protectant mixture.The canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, and the half-life period of more common dog interferon improves 18 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of dog itself.

Description

A kind of fusion egg being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2 Bletilla preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to thin in vain by dog albumin, dog interferon γ and dog The fusion protein and preparation method thereof that born of the same parents' interleukin 2 forms.

Background technology

It is analyzed according to Chinese pet Industry, the market scale by the end of 2014 year end China pet industries has reached 105800000000 RMB, and Chinese Medical pet industry only accounts for about 20% at present, the city of the U.S. for the pet industry relative maturity that compares , the output value ratio of Medical pet reaches 50%, and there are huge development spaces for Chinese Medical pet industry.

Dog is the friend of mankind's loyalty, with increasing considerably for the canines feeding quantity such as domestic pet dog, canine disease The continuous raising of incidence, the death rate causes spirit and double loss economically to the mankind.Dog causes with mankind's intimate contact The probability that the mankind are infected by dog disease poison is high, such as rabies viruses, canine parvovirus and canine distemper virus, can all give human health Bring great threat.

Report interferon is studied as a kind of important cell factor, to canine distemper, canine parvovirus according to related science Certain curative effect is all had in the treatments of diseases such as disease, canine infectious hepatitis and canine coronavirus disease.Therefore actively research interference Element has broad application prospects in canine viral disease treatment.

IFN is that the infection induced body of a viroid is generated with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, mainly by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ types IFN be T cell by activating and NK cells generate, and have relatively strong antiviral and immunoloregulation function.Numerous studies show interferon gamma in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of type can mediated cell to virus infection reaction, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocytes activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease is treated.In addition, IL-2 can also influence the metabolism of drug, make the metabolism time lengthening of drug, action time increases, to improve Curative effect of medication.With other cell factors according to gene constructed, composition fusion protein, the antibody to enhance vaccine is generated and is carried IL-2 High cellular immune level.

Seralbumin is the important component of blood plasma, is not easy to penetrate glomerulus under normal circumstances, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg It is linked in the cell by peptide bond through protein translation system in vain, is not required to additional extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after being merged with it；Albumin is one stable " inert protein ", after being merged with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein drug It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partly solve the problems, such as that interferon molecule amount is small and leads to half-life short on face.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Invention content

It is situated between by dog albumin, dog interferon γ and canine leucocyte in order to solve the above technical problems, the present invention provides one kind The fusion proteins and preparation method thereof of 2 composition of element, and thus fusion protein with after freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of canine recombinant long-acting interferon, the canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, compared with The half-life period of common dog interferon improves 18 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of dog itself and answer It answers.

The technical solution that the present invention takes is：

A kind of fusion protein being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2, the fusion protein Amino acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in 2 equal codified of the genome 1 and the genome.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth ranging from 30~70% can influence translation and transcriptional efficiency in any region more than the range.It is sent out using software detection The now codon of dog albumin, canine IFN-γ, dog IL-2 original genes codon adaptation indexI (CAI) difference in Escherichia coli It is 48.8%, 39.8%, 39.6% for 0.25,0.22,0.19, GC percentages；And by dog albumin, canine IFN-γ, dog Obtained after IL-2 gene optimizations each gene in Escherichia coli codon adaptation indexI (CAI) be 0.97,1.0,1.0, GC percentages Than 50.3%, 45.0%, 48.8%.The utilization rate that low codon is significantly reduced by gene optimization, avoids rare codon Influence of the son to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

The present invention also provides a kind of canine recombinant long-acting interferon, the canine recombinant long-acting interferon is by the fusion egg In vain with after freeze drying protectant mixture, it is freeze-dried to form.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, can be obtained fusion protein after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, and preparation method is：

(1) design primer obtains by reverse transcription or is manually respectively synthesized the white egg of dog for connecting flexible linker sequences In vain, dog interferon γ, canine leucocyte interleukin 2 target gene；By flexible linker by dog albumin, dog interferon γ, dog The target gene of interleukin 2 connects, the nucleotides sequence list such as SEQUENCE of the target gene after connection Shown in 400 < of LISTING, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb- IFNγ-IL2。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of dog albumin (Alb) is：

Upstream Alb-F1：CGGGATCCATGAAGTGGGTAACTTT carries BamHI restriction enzyme sites；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGACTAAGGCAGCTTG, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAATTATACAAGCTATATC, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCTTTCGATGCTCTGC, with flexible linker；

The primer sequence of canine leucocyte interleukin 2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATGCAACTC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCAGTGTTGAGAAG carries XhoI restriction enzyme sites；

B. RNA is extracted from dog liver, obtains the target gene of dog Alb, canine IFN-γ and dog IL-2 by reverse transcription, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of dog Alb, canine IFN-γ and dog IL-2 as template, and it is utilized respectively dog Alb, canine IFN-γ PCR amplification is carried out with the upstream and downstream primer of dog IL-2.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rAlb-IFN γ genes are obtained using flexible linker connection dog Alb and canine IFN-γ target gene

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's Alb gene template DNA1 μ L connect 1 μ L, Alb sense primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, IFN-γ 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 cycles；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IL2 are obtained using flexible linker connections rAlb-IFN γ genes and dog IL-2 target gene Gene

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, rAlb-IFN γ gene templates 1 μ L of DNA connect 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerases is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of dog albumin (Alb) is：

Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCTT carries BamHI restriction enzyme sites；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAACCAGAGCAGCCT, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAACTACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGACG, with flexible linker；

Canine leucocyte interleukin 2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATGCAGC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCAGGGTAGAGAA carries XhoI restriction enzyme sites.

B. the target gene of the dog Alb, canine IFN-γ and dog IL-2, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

Respectively using the target gene of dog Alb, canine IFN-γ and dog IL-2 as template, and it is utilized respectively dog Alb, canine IFN-γ PCR amplification is carried out with the upstream and downstream primer of dog IL-2.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C extend 1kb/min, follow Ring 35 times, last 72 DEG C of extensions 10min.

C. rAlb-IFN γ genes are obtained using flexible linker connection dog Alb and canine IFN-γ target gene

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's Alb gene template DNA1 μ L connect 1 μ L, Alb sense primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, IFN-γ 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 cycles；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IL2 are obtained using flexible linker connections rAlb-IFN γ genes and dog IL-2 target gene Gene

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, rAlb-IFN γ gene templates 1 μ L of DNA connect 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerases is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

The present invention also provides the application of the canine recombinant long-acting interferon, long half time had up to 73 hours or more Broad-spectrum disease resistance toxic action and the immune response that dog itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. dog Alb, canine IFN-γ and dog IL-2 genes are realized amalgamation and expression by flexible linker, interferon is improved Half-life period improves 18 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce Cost.

2. by being optimized to dog Alb, canine IFN-γ and dog IL-2 genes, dog Alb, canine IFN-γ and dog are improved The expression quantity of IL-2 fusion proteins.

3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of dog Alb, canine IFN-γ and dog IL-2 not only has IFN-γ Broad-spectrum disease resistance toxic action, while significantly improving the immune response of dog itself.

Description of the drawings

Fig. 1 is that dog albumin gene, dog interleukin-22 gene and the dog interferon γ genes RT-PCR in embodiment 1 are expanded Result；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Dog interleukin-22 gene RT-PCR amplified productions；Swimming lane 2：Dog interferes Plain γ genes RT-PCR amplified productions；Swimming lane 3：Dog albumin gene RT-PCR amplified productions；

Fig. 2 be embodiment 1 in dog Alb, IFN-γ connected with the target gene of IL-2 after PCR amplification result； Swimming lane M：DNA Marker DL10000；Swimming lane 1：Dog albumin gene, dog interferon γ genes are connect with dog interleukin-22 gene Amplified production；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the canine recombinant long-acting interferon made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the canine recombinant long-acting interferon of gradient dilution (from right to left) handles hole；

Fig. 7 is the canine recombinant long-acting interferon intramuscular injection blood medicine made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time change curve.

Specific implementation mode

Embodiment 1

A kind of fusion protein being made of with canine leucocyte interleukin 2 dog albumin, dog interferon γ, preparation method is such as Under：

1. the acquisition of dog albumin (Alb), dog interferon γ (IFN-γ) and canine leucocyte interleukin 2 (IL-2) target gene With amplification

Design of primers：

It is shown in Table 1 according to the objective gene sequence design synthetic primer reported in Genebank, in the upstream of dog albumin BamHI restriction enzyme sites and Linker sequences are introduced in primer and downstream primer respectively, dog interferon γ sense primer and under Linker sequences are introduced respectively in trip primer, are introduced respectively in the sense primer of canine leucocyte interleukin 2 and downstream primer Linker sequences and XhoI restriction enzyme sites.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from dog liver organization, the target gene of dog Alb, canine IFN-γ and dog IL-2 is obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction systems (25 μ L) are shown in Table 2

2 RT-PCR reaction systems of table

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1850bp, 560bp and 490bp or so in RT-PCR amplified productions, The results are shown in Figure 1 for it, illustrates the target gene that dog Alb, canine IFN-γ and dog IL-2 has been prepared.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rAlb-IFN γ PCR reaction systems of table

4 rAlb-IFN γ-IL2PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2850bp or so in pcr amplification product, and the results are shown in Figure 2, Occur rAlb-IFN γ and IL-2 amplified production bands in Fig. 2, this is because connected with IL-2 genes in rAlb-IFN γ In the process, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > institutes Show.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmids BamHI and XhoI restriction enzymes carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

It converts in connection product to e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plates of penicillin are incubated overnight；Single bacterium colony on picking LB tablets carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through BamHI and XhoI double digestions, is accredited as positive and is indicated that engineering bacteria is built successfully, PCR amplification and double digestion Product detects single band through agarose gel electrophoresis at the places 2850bp or so, and the results are shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture mediums containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNγ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h is added；Thalline is collected, through SDS-PAGE electrophoresis detections, result is as schemed Shown in 4, it can be seen from the figure that be deposited in the places 122.7KD or so visible for supernatant after bacterial cell disruption after recombinant bacterium induction 5h Predominant expression band illustrates precipitating and the fusion protein of equal successful expression in supernatant.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifuges 15min, Supernatant, inclusion body (inclusion body is through dissolving, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peaks.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purifications displacement to (the 50mM trihydroxy methyls of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After crossing column to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatographies of Superdex have been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN γ-IL2 protein peaks.

5.4 sample identification

Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁵U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C preserve.It can be obtained the fusion protein being made of with canine leucocyte interleukin 2 dog albumin, dog interferon γ, amino acid sequence Row are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2, other with embodiment 1, Only e. coli bl21 therein (DE3) competent cell is replaced for BL21 (DE3) competence with pGro7 plasmids Cell.The SDS-PAGE electrophoresis results of its fusion protein are compareed with embodiment 1,122.7KD or so place's predominant expressions in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Measure higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made of with canine leucocyte interleukin 2 dog albumin, dog interferon γ, preparation method is such as Under：

1. the acquisition of dog albumin (Alb), dog interferon γ (IFN-γ) and canine leucocyte interleukin 2 (IL-2) target gene With amplification

Dog Alb, canine IFN-γ and dog IL-2 in embodiment 1 is optimized, artificial synthesized dog Alb, canine IFN-γ and Dog IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common each biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the profit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to dog Alb, canine IFN-γ and Dog IL-2 gene codons optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution ranging from 30 in gene~ 70%, in any region translation and transcriptional efficiency can be influenced more than the range.Dog Alb, dog are found using software detection The codon of IFN-γ and dog IL-2 original genes codon adaptation indexI (CAI) in Escherichia coli is respectively 0.25,0.22, 0.19, GC percentage is 48.8%, 39.8%, 39.6%；And by after to dog Alb, canine IFN-γ and dog IL-2 gene optimizations Obtain recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.97,1.0,1.0, GC percentages 50.3%, 45.0%, 48.8%.The utilization rate that low codon is significantly reduced by gene optimization avoids rare codon to albumen table The influence reached improves the G/C content of gene, improves transcription and translation efficiency, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of dog Alb, canine IFN-γ and dog IL-2 after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction systems of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of dog Alb, canine IFN-γ and dog IL-2 are through agarose gel electrophoresis respectively in 1850bp, 560bp There is specific band with 490bp or so, illustrates to be prepared the purpose base of dog Alb after optimization, canine IFN-γ and dog IL-2 Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rAlb-IFN γ PCR reaction systems of table

10 rAlb-IFN γ-IL2PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2850bp or so in pcr amplification product, illustrates successfully to be connected RAlb-IFN γ-IL2 genes after connecing, nucleotide sequence such as 400 < of SEQUENCE LISTING, 3 > of obtained target gene It is shown.

3. expression vector establishment

The glue recovery product of target gene PCR errorless after sequencing after selection connection is used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 11：

11 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB tablets of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid warp through PCR BamHI, XhoI double digestion are identified, are accredited as positive and are indicated expression vector establishment success, PCR amplification and double digestion product are through fine jade There is single band at the places 2850bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN γ-IL2 fusions carries Body is built successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture mediums containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNγ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h is added；Thalline is collected, through SDS-PAGE electrophoresis detections, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in the places 122.7KD or so after bacterial cell disruption after 5h, illustrates in supernatant precipitates Recombinant protein is obtained.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifuges 15min, Supernatant, inclusion body (inclusion body is through dissolving, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peaks.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purifications displacement to (the 50mM trihydroxy methyls of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After crossing column to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatographies of Superdex have been balanced, with Binding Buffer III elution, collects rAlb-IFN γ-IL2 protein peaks.

5.4 sample identification

Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁵U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.It can be obtained the fusion protein being made of with canine leucocyte interleukin 2 dog albumin, dog interferon γ, amino acid Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2, other with embodiment 3, Only e. coli bl21 therein (DE3) competent cell is replaced for BL21 (DE3) competence with pGro7 plasmids Cell.The SDS-PAGE electrophoresis results of its fusion protein are compareed with embodiment 3,122.7KD or so place's predominant expressions in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Measure higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expressing bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 5

A kind of canine recombinant long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Later, freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the mirror of dog albumin, dog interferon the γ fusion protein formed with canine leucocyte interleukin 2 It is fixed

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, measures embodiment 1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 122.7KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in Examples 1 to 4 is detected respectively, with the anti-dog interferon of abcam companies mouse (1:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Canine recombinant long-acting interferon sample can be interfered with anti-dog Specific reaction occurs for plain γ monoclonal antibodies, and specific band occur in the places 122.7KD or so, as shown in Figure 5.

Embodiment 7

The freeze-dried bioactivity of four parts of canine recombinant long-acting interferons in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the canine recombinant that various dose is added is long for culture Interferon is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV viruses respectively.

Test result

The result shows that the canine recombinant long-acting interferon obtained causes the lesion of HEp-2 cells to have apparent inhibit VSV Effect.The lesions such as occurs cell rounding after untreated cell inoculation virus, falls off, is disintegrated.And the canine recombinant obtained is long After imitating interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁵U/ml, as shown in Figure 6.

Embodiment 8

The four parts of canine recombinant long-acting interferons obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried The measurement of the half-life period of (being denoted as A, B, C, D respectively) in dog body

Cytopathic-effect inhibition assay measures the blood concentration and time relationship of rAlb-IFN γ-IL2

Take the dog (half male and half female) that six weight are roughly the same, neck that 2mg/ml canine recombinant long-acting interferons are subcutaneously injected and freeze Dry agent 2ml, respectively 1h, 3h, 6h, 12h, for 24 hours, 36h, 48h, 72h, 96h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm is low Temperature centrifugation 10min detaches serum, and every dog blood sample of each time point is to be measured in -20 DEG C of preservations.Blood is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN γ-IL2 in final proof product is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter calculates knot Fruit is shown in Table 13.

Dominant dynamic parameters in serum after 13 canine recombinant long-acting interferon intramuscular injection of table

The result shows that canine recombinant long-acting interferon has longer half-life period.Half-life period can reach 73h or so after measured, more general Logical interferon improves about 18 times.

Embodiment 9

The freeze-dried measurement that canine cells immune response is influenced of four parts of canine recombinant long-acting interferons in embodiment 5

The meat dog for taking six weight roughly the same is divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml freeze-dried 2ml of canine recombinant long-acting interferon are penetrated, the PBS of 2mL is subcutaneously injected in control group neck, takes after injecting 4 weeks outside dog All blood takes weekly a blood later, detaches lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out by kit specification, and testing result is as shown in table 14：

Table 14 ELISA detection each group canine cells immune responses are horizontal

The result shows that after injection canine recombinant long-acting interferon, containing for cell factor IL-4 in canine peripheral blood can be significantly improved Amount enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned with reference to embodiment to a kind of fusion egg being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2 The detailed description that bletilla preparation method carries out is illustrative without being restrictive, and can be enumerated according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2 and its preparation side

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 949

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Phe Phe Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Leu Val Arg Arg Glu Ala Tyr Lys Ser Glu Ile Ala

20 25 30

His Arg Tyr Asn Asp Leu Gly Glu Glu His Phe Arg Gly Leu Val Leu

35 40 45

Val Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val

50 55 60

Lys Leu Ala Lys Glu Val Thr Glu Phe Ala Lys Ala Cys Ala Ala Glu

65 70 75 80

Glu Ser Gly Ala Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Lys Leu Cys Thr Val Ala Ser Leu Arg Asp Lys Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Asp Arg Asn Glu Cys Phe Leu Ala

115 120 125

His Lys Asp Asp Asn Pro Gly Phe Pro Pro Leu Val Ala Pro Glu Pro

130 135 140

Asp Ala Leu Cys Ala Ala Phe Gln Asp Asn Glu Gln Leu Phe Leu Gly

145 150 155 160

Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro

165 170 175

Glu Leu Leu Tyr Tyr Ala Gln Gln Tyr Lys Gly Val Phe Ala Glu Cys

180 185 190

Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Gly Pro Lys Ile Glu Ala

195 200 205

Leu Arg Glu Lys Val Leu Leu Ser Ser Ala Lys Glu Arg Phe Lys Cys

210 215 220

Ala Ser Leu Gln Lys Phe Gly Asp Arg Ala Phe Lys Ala Trp Ser Val

225 230 235 240

Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Asp Phe Ala Glu Ile Ser

245 250 255

Lys Val Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly

260 265 270

Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Met

275 280 285

Cys Glu Asn Gln Asp Ser Ile Ser Thr Lys Leu Lys Glu Cys Cys Asp

290 295 300

Lys Pro Val Leu Glu Lys Ser Gln Cys Leu Ala Glu Val Glu Arg Asp

305 310 315 320

Glu Leu Pro Gly Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Asp

325 330 335

Lys Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly

340 345 350

Thr Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Glu Tyr Ser Val Ser

355 360 365

Leu Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Lys Cys

370 375 380

Cys Ala Thr Asp Asp Pro Pro Thr Cys Tyr Ala Lys Val Leu Asp Glu

385 390 395 400

Phe Lys Pro Leu Val Asp Glu Pro Gln Asn Leu Val Lys Thr Asn Cys

405 410 415

Glu Leu Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Leu

420 425 430

Val Arg Tyr Thr Lys Lys Ala Pro Gln Val Ser Thr Pro Thr Leu Val

435 440 445

Glu Val Ser Arg Lys Leu Gly Lys Val Gly Thr Lys Cys Cys Lys Lys

450 455 460

Pro Glu Ser Glu Arg Met Ser Cys Ala Glu Asp Phe Leu Ser Val Val

465 470 475 480

Leu Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Arg

485 490 495

Val Thr Lys Cys Cys Ser Glu Ser Leu Val Asn Arg Arg Pro Cys Phe

500 505 510

Ser Gly Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala

515 520 525

Glu Thr Phe Thr Phe His Ala Asp Leu Cys Thr Leu Pro Glu Ala Glu

530 535 540

Lys Gln Val Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys

545 550 555 560

Pro Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Gly Asp Phe Gly

565 570 575

Ala Phe Val Glu Lys Cys Cys Ala Ala Glu Asn Lys Glu Gly Cys Phe

580 585 590

Ser Glu Glu Gly Pro Lys Leu Val Ala Ala Ala Gln Ala Ala Leu Val

595 600 605

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Asn Tyr Thr Ser Tyr

610 615 620

Ile Leu Ala Phe Gln Leu Cys Val Ile Leu Cys Ser Ser Gly Cys Asn

625 630 635 640

Cys Gln Ala Met Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe

645 650 655

Asn Ala Ser Asn Pro Asp Val Ser Asp Gly Gly Ser Leu Phe Val Asp

660 665 670

Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp Lys Thr Ile Ile Gln Ser

675 680 685

Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe Asp Asn Phe Lys Asp Asn

690 695 700

Gln Ile Ile Gln Arg Ser Met Asp Thr Ile Lys Glu Asp Met Leu Gly

705 710 715 720

Lys Phe Leu Asn Ser Ser Thr Ser Lys Arg Glu Asp Phe Leu Lys Leu

725 730 735

Ile Gln Ile Pro Val Asn Asp Leu Gln Val Gln Arg Lys Ala Ile Asn

740 745 750

Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg

755 760 765

Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Lys

770 775 780

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Tyr Lys Met Gln Leu

785 790 795 800

Leu Ser Cys Ile Ala Leu Thr Leu Val Leu Val Ala Asn Ser Ala Pro

805 810 815

Ile Thr Ser Ser Ser Thr Lys Glu Thr Glu Gln Gln Met Glu Gln Leu

820 825 830

Leu Leu Asp Leu Gln Leu Leu Leu Asn Gly Val Asn Asn Tyr Glu Asn

835 840 845

Pro Gln Leu Ser Arg Met Leu Thr Phe Lys Phe Tyr Thr Pro Lys Lys

850 855 860

Ala Thr Glu Phe Thr His Leu Gln Cys Leu Ala Glu Glu Leu Lys Asn

865 870 875 880

Leu Glu Glu Val Leu Gly Leu Pro Gln Ser Lys Asn Val His Leu Thr

885 890 895

Asp Thr Lys Glu Leu Ile Ser Asn Met Asn Val Thr Leu Leu Lys Leu

900 905 910

Lys Gly Ser Glu Thr Ser Tyr Asn Cys Glu Tyr Asp Asp Glu Thr Ala

915 920 925

Thr Ile Thr Glu Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile

930 935 940

Phe Ser Thr Leu Thr

945

<210> 2

<211> 2847

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg taacttttat ttccctcttc tttctcttta gctctgctta ttccaggggc 60

ttggttcgac gagaagcata taagagtgag attgctcatc ggtacaatga tttgggagaa 120

gaacatttca gaggcctggt gctggttgcc ttttctcagt atctccagca gtgtccattt 180

gaggatcatg tgaaactagc caaggaagtg actgagtttg caaaagcctg tgctgctgaa 240

gagtcagggg ccaactgtga caaatccctt cacaccctgt tcggggacaa gctgtgcacg 300

gtggcctccc tccgggacaa gtacggggac atggccgact gctgcgagaa gcaggagccc 360

gacaggaacg agtgcttcct ggcgcacaag gacgacaacc cgggcttccc cccgctggtg 420

gcccccgagc ccgacgcgct gtgcgccgcc ttccaggaca acgagcagct gttcctgggg 480

aagtacctgt acgaaattgc cagaagacat ccgtacttct acgccccaga actcctgtac 540

tatgctcaac agtataaagg agtctttgcg gagtgctgcc aggccgcaga caaggccgcc 600

tgcctgggac ccaagattga ggctttgagg gaaaaagtac tgctttcatc tgccaaggag 660

agattcaagt gtgccagcct ccaaaaattc ggagatagag cctttaaagc ctggtcagta 720

gctcgcctga gccagcgatt tcccaaagct gactttgcag agatctccaa ggtggtgaca 780

gatcttacca aagtccacaa ggaatgctgc catggtgacc tgctggagtg tgcagatgac 840

agggcggatc ttgccaagta tatgtgtgaa aatcaagatt caatctccac taaactgaag 900

gaatgctgtg ataagcctgt gttggaaaaa tcccagtgtc ttgctgaggt ggaaagagat 960

gagttacctg gtgacctgcc ctcattagct gctgattttg ttgaagataa ggaggtttgc 1020

aaaaactatc aggaggcaaa ggatgtgttc ctgggcacgt ttttgtatga atacgcaaga 1080

aggcatccag agtactctgt ctcattgctt ttgagactcg ccaaggaata tgaagccaca 1140

ctagagaaat gctgtgccac cgatgatcct cctacatgct atgccaaagt gcttgatgaa 1200

tttaaacctc ttgtggatga gcctcagaat ttagtcaaaa caaactgtga actttttgaa 1260

aaacttggag agtatggctt ccaaaatgcg ctcttagttc gttacaccaa gaaagcaccc 1320

caagtgtcaa ctccaactct cgtggaggtc tcaagaaaac taggaaaagt gggcaccaaa 1380

tgttgtaaga aacctgaatc agagagaatg tcctgtgctg aagactttct gtccgtggtc 1440

ctgaaccggt tgtgtgtgtt gcacgagaag accccagtga gcgagagagt taccaaatgc 1500

tgctcagagt ccttggtgaa cagacgacca tgcttttctg gtctggaagt cgatgagacc 1560

tatgttccca aagagtttaa tgctgaaaca ttcactttcc atgcagattt atgcacactt 1620

cctgaggctg agaaacaagt caagaaacaa actgcacttg ttgaactgct gaaacacaag 1680

cccaaggcaa cagatgaaca actgaaaact gttatgggag attttggagc ctttgtagag 1740

aagtgctgcg cagctgaaaa taaagagggc tgcttttctg aagagggtcc aaaactcgtt 1800

gctgctgctc aagctgcctt agtcggtggt ggtggttctg gtggtggtgg ttctatgaac 1860

tacacctctt acatcctggc tttccagctg tgcgttatcc tgtgctcttc tggttgcaac 1920

tgccaggcta tgttcttcaa agaaatcgaa aacctgaaag aatacttcaa cgcttctaac 1980

ccggacgttt ctgacggtgg ttctctgttc gttgacatcc tgaaaaaatg gcgtgaagaa 2040

tctgacaaaa ccatcatcca gtctcagatc gtttctttct acctgaaact gttcgacaac 2100

ttcaaagaca accagatcat ccagcgttct atggacacca tcaaagaaga catgctgggt 2160

aaattcctga actcttctac ctctaaacgt gaagacttcc tgaaactgat ccagatcccg 2220

gttaacgacc tgcaggttca gcgtaaagct atcaacgaac tgatcaaagt tatgaacgac 2280

ctgtctccgc gttctaacct gcgtaaacgt aaacgttctc agaacctgtt ccgtggtcgt 2340

cgtgcttcta aaggtggtgg tggttctggt ggtggtggtt ctatgtacaa aatgcaactc 2400

ttgtcttgca tcgcactgac gcttgtactt gtcgcaaaca gtgcacctat tacttcaagc 2460

tctacaaagg aaacagagca acagatggag caattactgc tggatttaca gttgcttttg 2520

aatggagtta ataattatga gaacccccaa ctctccagga tgctcacatt taagttttac 2580

acgcccaaga aggccacaga atttacacac cttcaatgtc tagcagaaga actcaaaaac 2640

ctggaggaag tgctaggttt acctcaaagc aaaaacgttc acttgacaga caccaaggaa 2700

ttaatcagca atatgaatgt aacacttctg aaactaaagg gatctgaaac aagttacaac 2760

tgtgaatatg atgacgagac agcaaccatt acagaatttc tgaacaaatg gattaccttt 2820

tgtcaaagca tcttctcaac actgact 2847

<210> 3

<211> 2847

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgttc ttcctgttct cttctgctta ctctcgtggt 60

ctggttcgtc gtgaagctta caaatctgaa atcgctcacc gttacaacga cctgggtgaa 120

gaacacttcc gtggtctggt tctggttgct ttctctcagt acctgcagca gtgcccgttc 180

gaagaccacg ttaaactggc taaagaagtt accgaattcg ctaaagcttg cgctgctgaa 240

gaatctggtg ctaactgcga caaatctctg cacaccctgt tcggtgacaa actgtgcacc 300

gttgcttctc tgcgtgacaa atacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaccgtaacg aatgcttcct ggctcacaaa gacgacaacc cgggtttccc gccgctggtt 420

gctccggaac cggatgctct gtgcgctgcg ttccaggaca acgagcagct gttcctgggt 480

aaatacctgt acgaaatcgc tcgtcgtcac ccgtacttct acgctccgga actgctgtac 540

tacgctcagc agtacaaagg tgttttcgct gaatgctgcc aggctgctga caaagctgct 600

tgcctgggtc cgaaaatcga agctctgcgt gaaaaagttc tgctgtcttc tgctaaagaa 660

cgtttcaaat gcgcttctct gcagaaattc ggtgaccgtg ctttcaaagc ttggtctgtt 720

gctcgtctgt cgcagaggtt cccgaaagct gacttcgctg aaatctctaa agttgttacc 780

gacctgacca aagttcacaa agaatgctgc cacggtgacc tgctggaatg cgctgacgac 840

cgtgctgacc tggctaaata catgtgcgaa aaccaggact ctatctctac caaactgaaa 900

gaatgctgcg acaaaccggt tctggaaaaa tctcagtgcc tggctgaagt tgaacgtgac 960

gaactgccgg gtgacctgcc gtctctggct gctgacttcg ttgaagataa ggaagtgtgc 1020

aagaactacc aggaagctaa agacgttttc ctgggtacct tcctgtacga atacgctcgt 1080

cgtcacccgg aatactctgt ttctctgctg ctgcgtctgg ctaaagaata cgaagctacc 1140

ctggaaaaat gctgcgctac cgacgacccg ccgacctgct acgctaaagt tctggacgaa 1200

ttcaaaccgc tggttgacga accgcagaac ctggttaaaa ccaactgcga actgttcgaa 1260

aaactgggtg aatacggttt ccagaacgct ctgctggttc gttacaccaa aaaagctccg 1320

caggtttcta ccccgaccct ggttgaagtt tctcgtaaac tgggtaaagt tggtaccaaa 1380

tgctgcaaaa aaccggaatc tgaacgtatg tcttgcgctg aagacttcct gtctgttgtt 1440

ctgaaccgtc tgtgcgttct gcacgaaaaa accccggttt ctgaacgtgt taccaaatgc 1500

tgctctgaat ctctggttaa ccgtcgtccg tgcttctctg gtctggaagt tgacgaaacc 1560

tacgttccga aagaattcaa cgctgaaacc ttcaccttcc acgctgacct gtgcaccctg 1620

ccggaagctg aaaaacaggt taaaaaacag accgctctgg ttgaactgct gaaacacaaa 1680

ccgaaagcta ccgacgaaca gctgaaaacc gttatgggtg acttcggtgc tttcgttgaa 1740

aaatgctgcg ctgctgaaaa caaagaaggt tgcttctctg aagaaggtcc gaaactggtt 1800

gctgctgctc aggctgctct ggttggtggt ggtggttctg gtggtggtgg ttctatgaac 1860

tacacctctt acatcctggc tttccagctg tgcgttatcc tgtgctcttc tggttgcaac 1920

tgccaggcta tgttcttcaa agaaatcgaa aacctgaaag aatacttcaa cgcttctaac 1980

ccggacgttt ctgacggtgg ttctctgttc gttgacatcc tgaaaaaatg gcgtgaagaa 2040

tctgacaaaa ccatcatcca gtctcagatc gtttctttct acctgaaact gttcgacaac 2100

ttcaaagaca accagatcat ccagcgttct atggacacca tcaaagaaga catgctgggt 2160

aaattcctga actcttctac ctctaaacgt gaagacttcc tgaaactgat ccagatcccg 2220

gttaacgacc tgcaggttca gcgtaaagct atcaacgaac tgatcaaagt tatgaacgac 2280

ctgtctccgc gttctaacct gcgtaaacgt aaacgttctc agaacctgtt ccgtggtcgt 2340

cgtgcttcta aaggtggtgg tggttctggt ggtggtggtt ctatgtacaa aatgcagctg 2400

ctgtcttgca tcgctctgac cctggttctg gttgctaact ctgctccgat cacctcttct 2460

tctaccaaag aaaccgaaca gcagatggaa cagctgctgc tggacctgca gctgctgctg 2520

aacggtgtta acaactacga aaacccgcag ctgtctcgta tgctgacctt caaattctac 2580

accccgaaaa aagctaccga attcacccac ctgcagtgcc tggctgaaga actgaaaaac 2640

ctggaagaag ttctgggtct gccgcagtct aaaaacgttc acctgaccga caccaaagaa 2700

ctgatctcta acatgaacgt taccctgctg aaactgaaag gttctgaaac ctcttacaac 2760

tgcgaatacg acgacgaaac cgctaccatc accgaattcc tgaacaaatg gatcaccttc 2820

tgccagtcta tcttctctac cctgacc 2847

<210> 4

<211> 1824

<212> DNA

<213>Dog albumin

<400> 4

atgaagtggg taacttttat ttccctcttc tttctcttta gctctgctta ttccaggggc 60

ttggttcgac gagaagcata taagagtgag attgctcatc ggtacaatga tttgggagaa 120

gaacatttca gaggcctggt gctggttgcc ttttctcagt atctccagca gtgtccattt 180

gaggatcatg tgaaactagc caaggaagtg actgagtttg caaaagcctg tgctgctgaa 240

gagtcagggg ccaactgtga caaatccctt cacaccctgt tcggggacaa gctgtgcacg 300

gtggcctccc tccgggacaa gtacggggac atggccgact gctgcgagaa gcaggagccc 360

gacaggaacg agtgcttcct ggcgcacaag gacgacaacc cgggcttccc cccgctggtg 420

gcccccgagc ccgacgcgct gtgcgccgcc ttccaggaca acgagcagct gttcctgggg 480

aagtacctgt acgaaattgc cagaagacat ccgtacttct acgccccaga actcctgtac 540

tatgctcaac agtataaagg agtctttgcg gagtgctgcc aggccgcaga caaggccgcc 600

tgcctgggac ccaagattga ggctttgagg gaaaaagtac tgctttcatc tgccaaggag 660

agattcaagt gtgccagcct ccaaaaattc ggagatagag cctttaaagc ctggtcagta 720

gctcgcctga gccagcgatt tcccaaagct gactttgcag agatctccaa ggtggtgaca 780

gatcttacca aagtccacaa ggaatgctgc catggtgacc tgctggagtg tgcagatgac 840

agggcggatc ttgccaagta tatgtgtgaa aatcaagatt caatctccac taaactgaag 900

gaatgctgtg ataagcctgt gttggaaaaa tcccagtgtc ttgctgaggt ggaaagagat 960

gagttacctg gtgacctgcc ctcattagct gctgattttg ttgaagataa ggaggtttgc 1020

aaaaactatc aggaggcaaa ggatgtgttc ctgggcacgt ttttgtatga atacgcaaga 1080

aggcatccag agtactctgt ctcattgctt ttgagactcg ccaaggaata tgaagccaca 1140

ctagagaaat gctgtgccac cgatgatcct cctacatgct atgccaaagt gcttgatgaa 1200

tttaaacctc ttgtggatga gcctcagaat ttagtcaaaa caaactgtga actttttgaa 1260

aaacttggag agtatggctt ccaaaatgcg ctcttagttc gttacaccaa gaaagcaccc 1320

caagtgtcaa ctccaactct cgtggaggtc tcaagaaaac taggaaaagt gggcaccaaa 1380

tgttgtaaga aacctgaatc agagagaatg tcctgtgctg aagactttct gtccgtggtc 1440

ctgaaccggt tgtgtgtgtt gcacgagaag accccagtga gcgagagagt taccaaatgc 1500

tgctcagagt ccttggtgaa cagacgacca tgcttttctg gtctggaagt cgatgagacc 1560

tatgttccca aagagtttaa tgctgaaaca ttcactttcc atgcagattt atgcacactt 1620

cctgaggctg agaaacaagt caagaaacaa actgcacttg ttgaactgct gaaacacaag 1680

cccaaggcaa cagatgaaca actgaaaact gttatgggag attttggagc ctttgtagag 1740

aagtgctgcg cagctgaaaa taaagagggc tgcttttctg aagagggtcc aaaactcgtt 1800

gctgctgctc aagctgcctt agtc 1824

<210> 5

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 5

atgaactaca cctcttacat cctggctttc cagctgtgcg ttatcctgtg ctcttctggt 60

tgcaactgcc aggctatgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgtttctga cggtggttct ctgttcgttg acatcctgaa aaaatggcgt 180

gaagaatctg acaaaaccat catccagtct cagatcgttt ctttctacct gaaactgttc 240

gacaacttca aagacaacca gatcatccag cgttctatgg acaccatcaa agaagacatg 300

ctgggtaaat tcctgaactc ttctacctct aaacgtgaag acttcctgaa actgatccag 360

atcccggtta acgacctgca ggttcagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaaa 498

<210> 6

<211> 465

<212> DNA

<213>Dog IL-2

<400> 6

atgtacaaaa tgcaactctt gtcttgcatc gcactgacgc ttgtacttgt cgcaaacagt 60

gcacctatta cttcaagctc tacaaaggaa acagagcaac agatggagca attactgctg 120

gatttacagt tgcttttgaa tggagttaat aattatgaga acccccaact ctccaggatg 180

ctcacattta agttttacac gcccaagaag gccacagaat ttacacacct tcaatgtcta 240

gcagaagaac tcaaaaacct ggaggaagtg ctaggtttac ctcaaagcaa aaacgttcac 300

ttgacagaca ccaaggaatt aatcagcaat atgaatgtaa cacttctgaa actaaaggga 360

tctgaaacaa gttacaactg tgaatatgat gacgagacag caaccattac agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc ttctcaacac tgact 465

<210> 7

<211> 1824

<212> DNA

<213>Dog albumin

<400> 7

atgaaatggg ttaccttcat ctctctgttc ttcctgttct cttctgctta ctctcgtggt 60

ctggttcgtc gtgaagctta caaatctgaa atcgctcacc gttacaacga cctgggtgaa 120

gaacacttcc gtggtctggt tctggttgct ttctctcagt acctgcagca gtgcccgttc 180

gaagaccacg ttaaactggc taaagaagtt accgaattcg ctaaagcttg cgctgctgaa 240

gaatctggtg ctaactgcga caaatctctg cacaccctgt tcggtgacaa actgtgcacc 300

gttgcttctc tgcgtgacaa atacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaccgtaacg aatgcttcct ggctcacaaa gacgacaacc cgggtttccc gccgctggtt 420

gctccggaac cggatgctct gtgcgctgcg ttccaggaca acgagcagct gttcctgggt 480

aaatacctgt acgaaatcgc tcgtcgtcac ccgtacttct acgctccgga actgctgtac 540

tacgctcagc agtacaaagg tgttttcgct gaatgctgcc aggctgctga caaagctgct 600

tgcctgggtc cgaaaatcga agctctgcgt gaaaaagttc tgctgtcttc tgctaaagaa 660

cgtttcaaat gcgcttctct gcagaaattc ggtgaccgtg ctttcaaagc ttggtctgtt 720

gctcgtctgt cgcagaggtt cccgaaagct gacttcgctg aaatctctaa agttgttacc 780

gacctgacca aagttcacaa agaatgctgc cacggtgacc tgctggaatg cgctgacgac 840

cgtgctgacc tggctaaata catgtgcgaa aaccaggact ctatctctac caaactgaaa 900

gaatgctgcg acaaaccggt tctggaaaaa tctcagtgcc tggctgaagt tgaacgtgac 960

gaactgccgg gtgacctgcc gtctctggct gctgacttcg ttgaagataa ggaagtgtgc 1020

aagaactacc aggaagctaa agacgttttc ctgggtacct tcctgtacga atacgctcgt 1080

cgtcacccgg aatactctgt ttctctgctg ctgcgtctgg ctaaagaata cgaagctacc 1140

ctggaaaaat gctgcgctac cgacgacccg ccgacctgct acgctaaagt tctggacgaa 1200

ttcaaaccgc tggttgacga accgcagaac ctggttaaaa ccaactgcga actgttcgaa 1260

aaactgggtg aatacggttt ccagaacgct ctgctggttc gttacaccaa aaaagctccg 1320

caggtttcta ccccgaccct ggttgaagtt tctcgtaaac tgggtaaagt tggtaccaaa 1380

tgctgcaaaa aaccggaatc tgaacgtatg tcttgcgctg aagacttcct gtctgttgtt 1440

ctgaaccgtc tgtgcgttct gcacgaaaaa accccggttt ctgaacgtgt taccaaatgc 1500

tgctctgaat ctctggttaa ccgtcgtccg tgcttctctg gtctggaagt tgacgaaacc 1560

tacgttccga aagaattcaa cgctgaaacc ttcaccttcc acgctgacct gtgcaccctg 1620

ccggaagctg aaaaacaggt taaaaaacag accgctctgg ttgaactgct gaaacacaaa 1680

ccgaaagcta ccgacgaaca gctgaaaacc gttatgggtg acttcggtgc tttcgttgaa 1740

aaatgctgcg ctgctgaaaa caaagaaggt tgcttctctg aagaaggtcc gaaactggtt 1800

gctgctgctc aggctgctct ggtt 1824

<210> 8

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 8

atgaactaca cctcttacat cctggctttc cagctgtgcg ttatcctgtg ctcttctggt 60

tgcaactgcc aggctatgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgtttctga cggtggttct ctgttcgttg acatcctgaa aaaatggcgt 180

gaagaatctg acaaaaccat catccagtct cagatcgttt ctttctacct gaaactgttc 240

gacaacttca aagacaacca gatcatccag cgttctatgg acaccatcaa agaagacatg 300

ctgggtaaat tcctgaactc ttctacctct aaacgtgaag acttcctgaa actgatccag 360

atcccggtta acgacctgca ggttcagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaaa 498

<210> 9

<211> 465

<212> DNA

<213>Dog IL-2

<400> 9

atgtacaaaa tgcagctgct gtcttgcatc gctctgaccc tggttctggt tgctaactct 60

gctccgatca cctcttcttc taccaaagaa accgaacagc agatggaaca gctgctgctg 120

gacctgcagc tgctgctgaa cggtgttaac aactacgaaa acccgcagct gtctcgtatg 180

ctgaccttca aattctacac cccgaaaaaa gctaccgaat tcacccacct gcagtgcctg 240

gctgaagaac tgaaaaacct ggaagaagtt ctgggtctgc cgcagtctaa aaacgttcac 300

ctgaccgaca ccaaagaact gatctctaac atgaacgtta ccctgctgaa actgaaaggt 360

tctgaaacct cttacaactg cgaatacgac gacgaaaccg ctaccatcac cgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc ttctctaccc tgacc 465

Claims (10)

1. a kind of fusion protein being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene of coding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of canine recombinant long-acting interferon, which is characterized in that the canine recombinant long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, can be obtained fusion protein after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, preparation method are：

(1) design primer is obtained by reverse transcription or is manually respectively synthesized the dog albumin for connecting flexible linker sequences, dog The target gene of interferon gamma, canine leucocyte interleukin 2；By flexible linker by dog albumin, dog interferon γ, canine leucocyte The target gene of interleukin 2 connects, the nucleotides sequence list such as SEQUENCE LISTING 400 of the target gene after connection Shown in 2 > of < or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-IFN γ-IL2。

8. the preparation method described according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method described according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively purified through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of canine recombinant long-acting interferon according to claim 5, which is characterized in that the canine recombinant is long-acting dry The long half time of element is disturbed up to 73 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of dog itself can be improved.