CN108840935A - A kind of fusion protein being made of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of recombination sheep long-acting interferon γ - Google Patents

Abstract

The invention discloses a kind of fusion protein being made of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of recombination sheep long-acting interferon γ; the fusion protein is connect through flexible linker with sheep interferon gamma by sheep albumin and is formed, and is freeze-dried to obtain recombination sheep long-acting interferon γ after fusion protein and freeze drying protectant mixture.The recombination sheep long-acting interferon γ is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon gamma improves 12 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

A kind of fusion protein and preparation method thereof being made of sheep albumin and sheep interferon gamma With a kind of recombination sheep long-acting interferon γ

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to one kind is made of sheep albumin and sheep interferon gamma Fusion protein and preparation method thereof and a kind of recombination sheep long-acting interferon γ.

Background technique

Animal infectious disease caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the country that sheep breeding stock, the amount of delivering for sale, Mutton yield are most in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry.With the sustainable development of sheep aquaculture, inevitably will in face of virus caused by disease the problem of, domestic animals disease Huge economic loss not only is caused to sheep culturist, more seriously, some Zoonosis communicable diseases return the mankind Health care belt carrys out potential threat.

The prevention and treatment of sheep class communicable disease mainly uses vaccine immunity and drug therapy at present, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling is available, some viruses may also directly jeopardize the health of the mankind.

Common drug therapy mainly uses antibiotic to be treated, but extensive and a large amount of due to antibiotic in recent years It uses, causes endurance strain largely to generate, and be transmitted to people by food chain, bigger threat is brought to human health.It is existing In some countries, oneself prohibites the application of some antibiotic and antibacterial agent in aquaculture.Therefore, positive using interferon Treat and prevent domestic animal, the viral disease of poultry will be the problem of mankind pay close attention to the most.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ type IFN be T cell by activating and NK cell generates, and has relatively strong antiviral and immunoloregulation function.A large number of studies show that interferon gamma is in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of seed type can reaction of the mediated cell to virus infection, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partially solve the problems, such as that interferon molecule amount is small and leads to half-life short on face.By being carried out to two kinds of different type interferon Fusion, not only can be improved the molecular weight of interferon, but also can cooperate with the effect for playing two kinds of interferon.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg It is white to be linked in the cell through protein translation system by peptide bond, it is not required to additional extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after merging with it；Albumin is one stable " inert protein ", after merging with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein drug It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, merging egg with what sheep interferon gamma formed by sheep albumin the present invention provides a kind of Bletilla preparation method and a kind of recombination sheep long-acting interferon γ, the recombination sheep long-acting interferon γ are remarkably improved sheep interference The half-life period of element, the half-life period of more common sheep interferon gamma improve 12 times or more, and have broad-spectrum disease resistance toxic action and can improve The immune response of sheep itself.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of sheep albumin and sheep interferon gamma, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein 1 described in 1 codified of genome；The 2 codified fusion protein 2 of genome.Genome 2 is pair The nucleotide sequence of genome 1 optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the base Because being optimal high efficient expression state in the expression system, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region. The codon of the sheep albumin and IFN-γ original gene codon adaptation indexI in Escherichia coli is found using software detection (CAI) be respectively 0.23,0.25, GC percentage be 44.0%, 40.9%；And by sheep albumin and IFN-γ gene optimization After obtain recombination in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0, GC percentage 50.1%, 44.1%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to the shadow of protein expression It rings, improves the G/C content of gene, improve transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of recombination sheep long-acting interferon γ, the recombination sheep long-acting interferon γ is melted by described It is freeze-dried to form after hop protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ, and preparation method is：

(1) design primer, is obtained or the sheep albumin of the flexible linker sequence of artificial synthesized connection by reverse transcription With the target gene of sheep interferon gamma；Sheep albumin has been connected with the target gene of sheep interferon gamma by flexible linker Come, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING Shown in 400 <, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained IFNγ。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F1CCGGAATTCATGAAGTGGGTGACT has EcoRI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGGCTGCTT, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACAAGCTC, with flexible linker；

Downstream IFN-γ-R1：CCCTCGAGTTACATTGATGCTCT has XhoI restriction enzyme site；

B. RNA is extracted from sheep liver, and the target gene of Alb and IFN-γ, the gene sequence of the two are obtained by reverse transcription Column are respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification respectively obtains and connects the Alb of flexible linker and the target gene of IFN-γ.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA, connect 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F2：CCGGAATTCATGAAATGGGTTACCTT has EcoRI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGAGCAGCC, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTCT, with flexible linker；

Downstream IFN-γ-R2：

CCCTCGAGTTACATAGAAGCACG has XhoI restriction enzyme site；

B. the target gene of the Alb and IFN-γ, the gene order of the two is respectively such as SEQUENCE LISTING 400 Shown in 400 < of < 6 > and SEQUENCELISTING, 7 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification, the target gene of Alb and IFN-γ after respectively obtaining the optimization for connecting flexible linker.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb template DNA, connects 1 μ L, Alb upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, under IFN-γ Trip 0.5 μ L, Taq archaeal dna polymerase of primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR reaction Condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 Circulation；Last 72 DEG C of extensions 10min.

The present invention also provides the applications of the recombination sheep long-acting interferon γ, and long half time was up to 49 hours or more, tool There is broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep albumin and sheep Interferon-gamma gene are realized fusion by flexibility linker, improves interferon and partly decline Phase improves 12 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving sheep Alb and the fusion of sheep interferon gamma by optimizing to sheep albumin and sheep Interferon-gamma gene The expression quantity of albumen.

3. using recombination bacillus coli BL21/pET-32a-Alb-IFN γ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid does not generate inclusion body in protein expression, forms soluble protein, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of sheep albumin and sheep interferon gamma not only has interferon gamma Broad-spectrum disease resistance toxic action, while significantly improving the immune response of sheep itself.

Detailed description of the invention

Fig. 1 is the result of the sheep albumin gene and sheep Interferon-gamma gene RT-PCR amplification in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Sheep Interferon-gamma gene RT-PCR amplified production；Swimming lane 2：Sheep albumin gene RT-PCR Amplified production；

Fig. 2 is the result of the PCR amplification after the sheep albumin in embodiment 1 is connected with the target gene of sheep IFN-γ； Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep Interferon-gamma gene and sheep albumin gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：Empty bacterium Control；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the recombination sheep long-acting interferon γ as made from the fusion protein in embodiment 1 causes carefully VSV in embodiment 5 The inhibiting effect of born of the same parents' lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from dextrad It is left) human interferon standard items handle hole；B3-12 is that the recombination sheep long-acting interferon γ of gradient dilution (from right to left) is handled Hole；

Fig. 7 is to recombinate sheep long-acting interferon γ intramuscular injection blood in embodiment 8 as made from the fusion protein in embodiment 1 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of sheep albumin and sheep interferon gamma, preparation method are as follows：

1. the acquisition and amplification of sheep albumin (Alb) and sheep interferon gamma (IFN-γ) target gene

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of sheep albumin EcoRI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, sheep interferon gamma upstream primer and under Linker sequence and XhoI restriction enzyme site are introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, the target gene of Alb and IFN-γ, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band, result in 1850bp and 520bp or so through agarose gel electrophoresis in RT-PCR amplified production As shown in Figure 1, saying that bright Alto has not obtained the Alb of the flexible linker of connection and the target gene of IFN-γ.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

3 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2340bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs the band of sheep albumin amplified production and sheep interferon gamma amplified production in Fig. 2, this is because in sheep albumin gene During connecting with sheep Interferon-gamma gene PCR, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI and XhoI double digestion, being accredited as positive indicates expression vector establishment success, has obtained engineering bacteria pET-32a/ rAlb-IFNγ；There is single band, knot at the place 2340bp or so through agarose gel electrophoresis in PCR amplification and double enzyme digestion product Fruit is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rAlb-IFN γ shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, result as shown in figure 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant precipitate In the visible predominant expression band in the place 104.4KD or so, illustrate in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer On 100 protein purification systems, the His affinity column balanced with Binding Buffer I (PBS) is washed with PBS buffer solution Remove unbonded albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN γ protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rAlb-IFN γ protein peak.

5.4 sample identification

Measure rAlb-IFN γ potency and specific activity, specific activity >=1.0 × 10⁶U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of sheep albumin and sheep interferon gamma, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of sheep albumin and sheep interferon gamma, other, only will be therein big with embodiment 1 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 1, and 104.4KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made of sheep albumin and sheep interferon gamma, preparation method are as follows：

1. the acquisition and amplification of sheep albumin (Alb) and sheep interferon gamma (IFN-γ) target gene

To in embodiment 1 Alb and IFN-γ optimize, artificial synthesized Alb and IFN-γ target gene, after optimization, The nucleotide sequence of the two is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 6 > and SEQUENCE LISTING, 7 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the albumin of sheep and IFN- in the present embodiment γ gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Using software detection discovery sheep albumin and The codon of IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.23,0.25, GC percentage It is 44.0%, 40.9%；And by close in Escherichia coli to recombination is obtained after sheep albumin and IFN-γ gene optimization Numeral adaptation index (CAI) is 0.99,1.0, GC percentage 50.1%, 44.1%.It is significantly reduced by gene optimization low close The utilization rate of numeral avoids influence of the rare codon to protein expression, improves the G/C content of gene, improves transcription and turn over Efficiency is translated, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of Alb and IFN-γ after optimization are diluted to 0.05mg/mL respectively.Mesh is obtained using PCR amplification Gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Alb and the pcr amplification product of IFN-γ occur in 1850bp and 520bp or so special respectively through agarose gel electrophoresis Different band illustrates the target gene that the Alb after the optimization of the flexible linker of connection and IFN-γ have been prepared respectively.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects target gene, 25 μ L reaction systems such as 8 institute of table using over-lap PCR Show：

8 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2340bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to have obtained Alb Target gene after being connected with IFN-γ, the nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid EcoRI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 9：

9 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, PCR amplification and double enzyme digestion product warp There is single band at the place 2340bp or so in agarose gel electrophoresis, illustrates the target gene after connecting containing Alb with IFN-γ Expression vector establishment success.

4. the expression of recombinant protein

Picking engineering bacteria shakes bacterium 1h recovery engineering bacteria activity for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin, Engineering bacteria is denoted as pET-32a/rAlb-IFN γ；In LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h, When survey OD value reaches 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, Through SDS-PAGE electrophoresis detection, it is visible excellent to be deposited in the place 104.4KD or so for supernatant after the bacterial cell disruption after recombinant bacterium induction 5h Gesture band of expression illustrates to have obtained recombinant protein in supernatant precipitating.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer On 100 protein purification systems, the His affinity column balanced with Binding Buffer I (PBS) is washed with PBS buffer solution Remove unbonded albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN γ protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rAlb-IFN γ protein peak.

5.4 sample identification

Measure rAlb-IFN γ potency and specific activity, specific activity >=1.0 × 10⁶U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of sheep albumin and sheep interferon gamma, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of sheep albumin and sheep interferon gamma, other, only will be therein big with embodiment 3 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 3, and 104.4KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai offshore Science and Technology Ltd./glad hundred promise biology, article No. V205.

Embodiment 5

A kind of recombination sheep long-acting interferon γ, is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 It is freeze-dried to form with later.The freeze drying protectant is glycerol, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the identification for the fusion protein being made of sheep albumin and sheep interferon gamma

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.2mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 104.4KD or so, such as Fig. 4, shown.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-sheep interferon (1 of abcam company mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinating sheep long-acting interferon γ sample can be dry with anti-sheep It disturbs plain γ monoclonal antibody and specific reaction occurs, specific band occurs in the place 104.4KD or so, as shown in Figure 5.

Embodiment 7

Four parts in embodiment 5 recombinate the freeze-dried bioactivity of sheep long-acting interferon γ

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO2 culture for 24 hours, the recombination sheep that various dose is added is long Interferon gamma is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100 TCID respectively₅₀VSV virus.

Test result

The result shows that the recombination sheep long-acting interferon γ obtained causes the lesion of HEp-2 cell to have apparent suppression VSV Production is used.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombination sheep obtained After long-acting interferon γ treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur Any lesion, measures potency >=1.0 × 10⁶U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of recombination sheep long-acting interferon γ that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in sheep intracorporal half-life period

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN γ

The sheep (half male and half female) that six weight are roughly the same is taken, the long-acting sheep interferon gamma of intramuscular injection 2mg/ml sheep is freeze-dried 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 60h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low-temperature centrifugation 10min separates serum, and every sheep blood sample of each time point is to be measured in -20 DEG C of preservations.Blood serum sample is measured using cytopathic-effect inhibition assay The concentration of middle rAlb-IFN γ is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Matched curve is as shown in Figure 7；Ginseng Number calculated result is shown in Table 11.

Dominant dynamic parameters in serum after the recombination sheep long-acting interferon γ intramuscular injection of table 11

The result shows that recombination sheep long-acting interferon γ has longer half-life period.Half-life period can reach 49h or so after measured, compared with Plain interferon improves about 12 times.

Embodiment 9

Four parts of freeze-dried measurements that sheep cellullar immunologic response is influenced of recombination sheep long-acting interferon γ in embodiment 5

It takes six roughly the same sheep of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck 2mg/ml recombinates the freeze-dried 2ml of sheep long-acting interferon γ, and the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside sheep All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out by kit specification, and testing result is as shown in table 12：

It is horizontal that 12 ELISA of table detects each group sheep cellullar immunologic response

The result shows that injection recombination sheep long-acting interferon γ after, can significantly improve sheep Evaluation of Cytokines in Peripheral Blood IL-2, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion protein and preparation method thereof being made of sheep albumin and sheep interferon gamma It is illustrative without being restrictive with a kind of detailed description that recombination sheep long-acting interferon γ is carried out, it can be according to being limited Range enumerates several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to of the invention Within protection scope.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made of sheep albumin with sheep interferon gamma and preparation method thereof and a kind of recombination sheep are long

Imitate interferon gamma

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 783

<212> PRT

<213>Recombinate sheep long-acting interferon γ fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Asn Asp Leu Gly Glu Glu Asn Phe Gln Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Lys Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Thr Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Asn

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Glu Pro Asp

130 135 140

Thr Leu Cys Ala Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Val Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Asp Ala Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Asp Phe Thr Asp Val Thr Lys

245 250 255

Ile Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp His Gln Asp Ala Leu Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Val Leu Glu Lys Ser His Cys Ile Ala Glu Val Asp Lys Asp Ala

305 310 315 320

Val Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Asp Cys Cys

370 375 380

Ala Lys Glu Asp Pro His Ala Cys Tyr Ala Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Lys Asn Cys Glu

405 410 415

Leu Phe Glu Lys His Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Ala Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Ile Ser Arg Ser Leu Gly Lys Val Gly Thr Lys Cys Cys Ala Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Asp Leu Thr Leu Asp Glu Thr Tyr Val Pro Lys Pro Phe Asp Glu Lys

515 520 525

Phe Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Gly Cys Phe Val

580 585 590

Leu Glu Gly Pro Lys Leu Val Ala Ser Thr Gln Ala Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Ser Phe

610 615 620

Leu Ala Leu Leu Leu Cys Val Leu Leu Gly Phe Ser Gly Ser Tyr Gly

625 630 635 640

Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn

645 650 655

Ala Ser Asn Pro Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile

660 665 670

Leu Lys Asn Trp Lys Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln

675 680 685

Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln

690 695 700

Val Ile Gln Arg Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys

705 710 715 720

Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys Arg Leu Ile

725 730 735

Gln Ile Pro Val Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu

740 745 750

Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys

755 760 765

Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Met

770 775 780

<210> 2

<211> 2352

<212> DNA

<213>Recombinate sheep long-acting interferon γ genome 1

<400> 2

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc cggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860

acaagctcct tcttagcttt actgctctgt gtgcttttgg gtttttctgg ttcttatggc 1920

cagggcccat tttttaaaga aatagaaaac ttaaaggagt attttaatgc aagtaaccca 1980

gatgtagcta agggtgggcc tcttttctca gaaattttga agaattggaa agaggagagt 2040

gacaaaaaga ttattcagag ccaaattgtc tccttctact tcaaactctt tgaaaacctc 2100

aaagataacc aggtcattca aaggagcatg gatatcatca agcaagacat gtttcagaag 2160

ttcttgaacg gcagctctga gaaactggag gacttcaaaa ggctgattca aattccggtg 2220

gatgatctgc agatccagcg caaagccatc aatgaactca tcaaggtgat gaatgacctg 2280

tcgccaaaat ctaacctcag aaagcggaag agaagtcaga atctctttcg aggccggaga 2340

gcatcaatgt aa 2352

<210> 3

<211> 2352

<212> DNA

<213>Recombinate sheep long-acting interferon γ genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaacga cctgggtgaa 120

gaaaacttcc agggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taaagaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga caaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgctaccc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gaaccacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggaaccgg acaccctgtg cgctgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aagttgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgacgc tatgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgac ttcaccgacg ttaccaaaat cgttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgaccac caggacgctc tgtcttctaa actgaaagaa 900

tgctgcgaca aaccggttct ggaaaaatct cactgcatcg ctgaagttga caaagacgct 960

gttccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga agtttgcaaa 1020

aactaccagg aagctaaaga cgtttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagactgct gcgctaaaga agacccgcac gcttgctacg ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaaaaaa actgcgaact gttcgaaaaa 1260

cacggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agctccgcag 1320

gtttctaccc cgaccctggt tgaaatctct cgttctctgg gtaaagttgg taccaaatgc 1380

tgcgctaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgacc tgaccctgga cgaaacctac 1560

gttccgaaac cgttcgacga aaaattcttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg acgaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaaggttgc ttcgttctgg aaggtccgaa actggttgct 1800

tctacccagg ctgctctggc tggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860

acctcttctt tcctggctct gctgctgtgc gttctgctgg gtttctctgg ttcttacggt 1920

cagggtccgt tcttcaaaga aatcgaaaac ctgaaagaat acttcaacgc ttctaacccg 1980

gacgttgcta aaggtggtcc gctgttctct gaaatcctga aaaactggaa agaagaatct 2040

gacaaaaaaa tcatccagtc tcagatcgtt tctttctact tcaaactgtt cgaaaacctg 2100

aaagacaacc aggttatcca gcgttctatg gacatcatca aacaggacat gttccagaaa 2160

ttcctgaacg gttcttctga aaaactggaa gacttcaaac gtctgatcca gatcccggtt 2220

gacgacctgc agatccagcg taaagctatc aacgaactga tcaaagttat gaacgacctg 2280

tctccgaaat ctaacctgcg taaacgtaaa cgttctcaga acctgttccg tggtcgtcgt 2340

gcttctatgt aa 2352

<210> 4

<211> 1821

<212> DNA

<213>Sheep albumin

<400> 4

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc c 1821

<210> 5

<211> 501

<212> DNA

<213>Sheep IFN-γ

<400> 5

atgaaataca caagctcctt cttagcttta ctgctctgtg tgcttttggg tttttctggt 60

tcttatggcc agggcccatt ttttaaagaa atagaaaact taaaggagta ttttaatgca 120

agtaacccag atgtagctaa gggtgggcct cttttctcag aaattttgaa gaattggaaa 180

gaggagagtg acaaaaagat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaacgg cagctctgag aaactggagg acttcaaaag gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccatca atgaactcat caaggtgatg 420

aatgacctgt cgccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaatgta a 501

<210> 6

<211> 1821

<212> DNA

<213>Sheep albumin

<400> 6

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaacga cctgggtgaa 120

gaaaacttcc agggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taaagaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga caaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgctaccc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gaaccacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggaaccgg acaccctgtg cgctgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aagttgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgacgc tatgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgac ttcaccgacg ttaccaaaat cgttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgaccac caggacgctc tgtcttctaa actgaaagaa 900

tgctgcgaca aaccggttct ggaaaaatct cactgcatcg ctgaagttga caaagacgct 960

gttccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga agtttgcaaa 1020

aactaccagg aagctaaaga cgtttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagactgct gcgctaaaga agacccgcac gcttgctacg ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaaaaaa actgcgaact gttcgaaaaa 1260

cacggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agctccgcag 1320

gtttctaccc cgaccctggt tgaaatctct cgttctctgg gtaaagttgg taccaaatgc 1380

tgcgctaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgacc tgaccctgga cgaaacctac 1560

gttccgaaac cgttcgacga aaaattcttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg acgaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaaggttgc ttcgttctgg aaggtccgaa actggttgct 1800

tctacccagg ctgctctggc t 1821

<210> 7

<211> 501

<212> DNA

<213>Sheep IFN-γ

<400> 7

atgaaataca cctcttcttt cctggctctg ctgctgtgcg ttctgctggg tttctctggt 60

tcttacggtc agggtccgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaacg tctgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctatgta a 501

Claims (10)

1. a kind of fusion protein being made of sheep albumin and sheep interferon gamma, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of recombination sheep long-acting interferon γ, which is characterized in that the recombination sheep long-acting interferon γ is as described in claim 1 Fusion protein and freeze drying protectant mixture after, it is freeze-dried to form.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ, preparation method are：

(1) design primer, is obtained or the sheep albumin of the flexible linker sequence of artificial synthesized connection and sheep by reverse transcription The target gene of interferon gamma；The target gene of sheep albumin and sheep interferon gamma is connected by flexible linker, mesh Gene nucleotides sequence list as shown in 400 < of SEQUENCE LISTING, 2 > or such as 400 < of SEQUENCE LISTING, 3 > It is shown；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained γ。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of recombination sheep long-acting interferon γ according to claim 5, which is characterized in that the recombination sheep is long-acting The long half time of interferon gamma had broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself up to 49 hours or more.