CN108864294A

CN108864294A - A kind of fusion protein being made of bovine albumin and Bov IFN γ and preparation method thereof and a kind of recombinant bovine long-acting interferon γ

Info

Publication number: CN108864294A
Application number: CN201810701388.6A
Authority: CN
Inventors: 刘家炉; 单雪芹; 王亚男; 徐文俊; 高耀辉; 周炜; 蒋敏之; 王红朵
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-06-29
Publication date: 2018-11-23
Also published as: CN107353350A

Abstract

The invention discloses a kind of fusion protein being made of bovine albumin and Bov IFN γ and preparation method thereof and a kind of recombinant bovine long-acting interferon γ; the fusion protein is connect through flexible linker with Bov IFN γ by bovine albumin and is formed, and is freeze-dried to obtain recombinant bovine long-acting interferon γ after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon γ is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN γ improves 12 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.

Description

A kind of fusion protein and preparation method thereof being made of bovine albumin and Bov IFN γ With a kind of recombinant bovine long-acting interferon γ

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to one kind is made of bovine albumin and Bov IFN γ Fusion protein and preparation method thereof and a kind of recombinant bovine long-acting interferon γ.

Background technique

Ox is important one of the herding type in China, with intensive and large-scale cultivation continuous development, bovine viral The disease incidence of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease infects fastly, and disease incidence, the death rate are high seriously to restrict the sound development of China's ox aquaculture；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

Mainly pass through vaccine inoculation to the prevention and treatment approach of ox communicable disease at present and uses antibiotic.Big portion Antibiotics and traditional oral antiviral medicament is divided to bring a negative impact due to medicament residue problem to health；And Traditional vaccine, high specific and side effect due to it, can not resist virus variation and new virus continuously emerges to pig Aquaculture bring significant damage.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical application potentiality, can be used to prevent and treat bovine viral bacterial infection disease.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ type IFN be T cell by activating and NK cell generates, and has relatively strong antiviral and immunoloregulation function.A large number of studies show that interferon gamma is in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of seed type can reaction of the mediated cell to virus infection, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partially solve the problems, such as that interferon molecule amount is small and leads to half-life short on face.By being carried out to two kinds of different type interferon Fusion, not only can be improved the molecular weight of interferon, but also can cooperate with the effect for playing two kinds of interferon.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg It is white to be linked in the cell through protein translation system by peptide bond, it is not required to additional extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after merging with it；Albumin is one stable " inert protein ", after merging with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein drug It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, merging egg with what Bov IFN γ was formed by bovine albumin the present invention provides a kind of Bletilla preparation method and a kind of recombinant bovine long-acting interferon γ, the recombinant bovine long-acting interferon γ are remarkably improved ox interference The half-life period of element, the half-life period of more common Bov IFN γ improve 12 times or more, and have broad-spectrum disease resistance toxic action and can improve The immune response of ox itself.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of bovine albumin and Bov IFN γ, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein 1 described in 1 codified of genome；The 2 codified fusion protein 2 of genome.Genome 2 is pair The nucleotide sequence of genome 1 optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the base Because being optimal high efficient expression state in the expression system, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region. The codon of the bovine albumin and IFN-γ original gene codon adaptation indexI in Escherichia coli is found using software detection (CAI) be respectively 0.22,0.24, GC percentage be 42.9%, 39.8%；And by bovine albumin and IFN-γ gene optimization After obtain recombination in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0, GC percentage 49.9%, 44.8%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to the shadow of protein expression It rings, improves the G/C content of gene, improve transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of recombinant bovine long-acting interferon γ, the recombinant bovine long-acting interferon γ is melted by described It is freeze-dried to form after hop protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ, and preparation method is：

(1) design primer, is obtained or the bovine albumin of the flexible linker sequence of artificial synthesized connection by reverse transcription With the target gene of Bov IFN γ；Bovine albumin has been connected with the target gene of Bov IFN γ by flexible linker Come, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING Shown in 400 <, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained IFNγ。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of bovine albumin (Alb) is：

Upstream Alb-F1：CCGGAATTCATGAAGTGGGTGACTT has EcoRI restriction enzyme site；

Downstream Alb-R1：ACCACCACCAGAACCACCACCACCGGCTAAGGCTGTTTG, with flexible linker；

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGAAATATACAAGCTATTT, with flexible linker；

Downstream IFN-γ-R1：CCCTCGAGCGTTGATGCTCTCC has XhoI restriction enzyme site；

B. RNA is extracted from cattle liver, and the target gene of Alb and IFN-γ, the gene sequence of the two are obtained by reverse transcription Column are respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification has respectively obtained the Alb of the flexible linker of connection and the target gene of IFN-γ.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's Alb gene template DNA1 μ L, connect 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of bovine albumin (Alb) is：

Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCTT has BamHI restriction enzyme site；

Downstream Alb-R2：ACCACCACCAGAACCACCACCACCAGCCAGAGCGGTC, with flexible linker；

The primer sequence of Bov IFN γ (IFN-γ) is：

Upstream IFN-γ-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：CCCTCGAGGGTCATGGTAGAGTAGA has XhoI restriction enzyme site；

B. the target gene of the Alb and IFN-γ, the gene order of the two is respectively such as SEQUENCE LISTING 400 Shown in 6 > and SEQUENCE LISTING of <, 400 <, 7 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification, the target gene of Alb and IFN-γ after having respectively obtained the optimization of the flexible linker of connection.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's Alb gene template DNA1 μ L, connect 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the recombinant bovine long-acting interferon γ, long half time was up to 49 hours or more, tool There is broad-spectrum disease resistance toxic action and the immune response of Niu Zishen can be improved.

Compared with prior art, the present invention has the advantages that：

1. bovine albumin and Bov IFN γ gene are realized fusion by flexibility linker, improves interferon and partly decline Phase improves 12 times or more compared with plain interferon；

2. improving ox Alb and Bov IFN γ fusion by optimizing to bovine albumin and Bov IFN γ gene The expression quantity of albumen.

3. using recombination bacillus coli BL21/pET-32a-Alb-IFN γ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid does not generate inclusion body in protein expression, forms soluble protein, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of bovine albumin and Bov IFN γ not only has interferon gamma Broad-spectrum disease resistance toxic action, while significantly improving the immune response of Niu Zishen.

Detailed description of the invention

Fig. 1 is the result of the bovine albumin gene and Bov IFN γ gene RT-PCR amplification in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Bov IFN γ gene RT-PCR amplified production；Swimming lane 2：Bovine albumin gene RT-PCR Amplified production；Compared with common polyethylene glycol fused interferon, cost is significantly reduced.

Fig. 2 is the result of the PCR amplification after the bovine albumin in embodiment 1 is connected with the target gene of ox IFN-γ； Swimming lane M：DNA Marker DL2000；Swimming lane 1：Bov IFN γ gene and bovine albumin gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：Empty bacterium Control；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：It is precipitated after being crushed for recombinant bacterium induction；

Fig. 6 is that the recombinant bovine long-acting interferon γ as made from the fusion protein in embodiment 1 causes carefully VSV in embodiment 5 The inhibiting effect of born of the same parents' lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from dextrad It is left) human interferon standard items handle hole；B3-12 is that the recombinant bovine long-acting interferon γ of gradient dilution (from right to left) is handled Hole；

Fig. 7 is the recombinant bovine long-acting interferon γ intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of bovine albumin and Bov IFN γ, preparation method are as follows：

1. the acquisition and amplification of bovine albumin (Alb) and Bov IFN γ (IFN-γ) target gene

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of bovine albumin EcoRI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, Bov IFN γ upstream primer and under Linker sequence and XhoI restriction enzyme site are introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, the target gene of Alb and IFN-γ, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band, result in 1850bp and 530bp or so through agarose gel electrophoresis in RT-PCR amplified production As shown in Figure 1, explanation has respectively obtained the Alb of the flexible linker of connection and the target gene of IFN-γ.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects target gene, 25 μ L reaction systems such as 3 institute of table using over-lap PCR Show：

3 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2350bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs the band of bovine albumin amplified production and Bov IFN γ amplified production in Fig. 2, this is because in bovine albumin gene During connecting with Bov IFN γ gene PCR, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 4：

4 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI and XhoI double digestion, being accredited as positive indicates expression vector establishment success, has obtained engineering bacteria pET-32a/ rAlb-IFNγ；There is single band through agarose gel electrophoresis at 2350bp in PCR amplification and double enzyme digestion product, and result is such as Shown in Fig. 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rAlb-IFN γ shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, result as shown in figure 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant precipitate In the visible predominant expression band in the place 104.4KD or so, illustrate in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer On 100 protein purification systems, the His affinity column balanced with Binding Buffer I (PBS) is washed away with PBS buffer solution Unbonded albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN γ protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rAlb-IFN γ protein peak.

5.4 sample identification

Measure rAlb-IFN γ potency and specific activity, specific activity >=1.0 × 10⁷U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of bovine albumin and Bov IFN γ, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of bovine albumin and Bov IFN γ, other, only will be therein big with embodiment 1 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 1, and 104.4KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.

Embodiment 3

To in embodiment 1 Alb and IFN-γ optimize, artificial synthesized Alb and IFN-γ target gene, after optimization, The nucleotide sequence of the two is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 6 > and SEQUENCE LISTING, 7 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the albumin of ox and IFN- in the present embodiment γ gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Using software detection discovery bovine albumin and The codon of IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.22,0.24, GC percentage It is 42.9%, 39.8%；And by close in Escherichia coli to recombination is obtained after bovine albumin and IFN-γ gene optimization Numeral adaptation index (CAI) is 0.99,1.0, GC percentage 49.9%, 44.8%.It is significantly reduced by gene optimization low close The utilization rate of numeral avoids influence of the rare codon to protein expression, improves the G/C content of gene, improves transcription and turn over Efficiency is translated, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of Alb and IFN-γ after optimization are diluted to 0.05mg/mL respectively.Mesh is obtained using PCR amplification Gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Alb and the pcr amplification product of IFN-γ occur in 1850bp and 530bp or so special respectively through agarose gel electrophoresis Different band illustrates the target gene that the Alb after the optimization of the flexible linker of connection and IFN-γ have been prepared respectively.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects target gene, 25 μ L reaction systems such as 8 institute of table using over-lap PCR Show：

8 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2350bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to have obtained Alb Target gene after being connected with IFN-γ, the nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 9：

9 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, PCR amplification and double enzyme digestion product warp There is single band at 2350bp in agarose gel electrophoresis, illustrates the table of the target gene after connecting containing Alb with IFN-γ Up to vector construction success, engineering bacteria pET-32a/rAlb-IFN γ has been obtained.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rAlb-IFN γ shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the visible predominant expression band in the place 104.4KD or so, Illustrate to have obtained recombinant protein in supernatant precipitating.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

5.4 sample identification

Embodiment 4

A kind of fusion protein being made of bovine albumin and Bov IFN γ, other, only will be therein big with embodiment 3 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 3, and 104.4KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai offshore Science and Technology Ltd./glad hundred promise biology, article No. V205.

Embodiment 5

A kind of recombinant bovine long-acting interferon γ is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 It is freeze-dried to form with later.The freeze drying protectant is glycerol, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the identification of bovine albumin and Bov IFN the γ fusion protein formed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.2mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 104.4KD or so, such as Fig. 4, shown.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-moggy gamma interferon (1 of abcam company mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon γ sample can be dry with anti-ox It disturbs plain γ monoclonal antibody and specific reaction occurs, specific band occurs in the place 104.4KD or so, as shown in Figure 5.

Embodiment 7

Four parts of recombinant bovine long-acting interferon γ in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO2 culture for 24 hours, the recombinant bovine that various dose is added is long Interferon gamma is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100TCID respectively₅₀VSV virus.

Test result

The result shows that the recombinant bovine long-acting interferon γ obtained causes the lesion of HEp-2 cell to have apparent suppression VSV Production is used.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant bovine obtained After long-acting interferon γ treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur Any lesion, measures potency >=1.0 × 10⁷U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of recombinant bovine long-acting interferon γ that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in ox intracorporal half-life period

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN γ

The ox (half male and half female) that six weight are roughly the same is taken, intramuscular injection 2mg/ml Niu Changxiao Bov IFN γ is freeze-dried 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 60h, 88h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low temperature It is centrifuged 10min and separates serum, every ox blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN γ in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Matched curve such as Fig. 7 institute Show；Parameter calculated result is shown in Table 11.

Dominant dynamic parameters in serum after 11 recombinant bovine long-acting interferon γ intramuscular injection of table

The result shows that recombinant bovine long-acting interferon γ has longer half-life period.Half-life period can reach 49h or so after measured, compared with Plain interferon improves about 12 times.

Embodiment 9

The freeze-dried measurement that ox cellullar immunologic response is influenced of four parts of recombinant bovine long-acting interferon γ in embodiment 5

It takes six roughly the same oxen of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck The PBS of 2mL is subcutaneously injected in the 2mg/ml recombinant bovine long-acting interferon freeze-dried 2ml of γ, control group neck, after taking injection 4 weeks outside ox All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out by kit specification, and testing result is as shown in table 12：

It is horizontal that 12 ELISA of table detects each group ox cellullar immunologic response

The result shows that injection recombinant bovine long-acting interferon γ after, can significantly improve ox Evaluation of Cytokines in Peripheral Blood IL-2, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion protein and preparation method thereof being made of bovine albumin and Bov IFN γ The detailed description carried out with a kind of recombinant bovine long-acting interferon γ, is illustrative without being restrictive, can be according to being limited Range enumerates several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to of the invention Within protection scope.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>It is a kind of long by bovine albumin and the Bov IFN γ fusion protein formed and preparation method thereof and a kind of recombinant bovine

Imitate interferon gamma

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 783

<212> PRT

<213>Recombinant bovine long-acting interferon γ fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Lys Asp Leu Gly Glu Glu His Phe Lys Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Asn Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Glu Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Ser Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Ser

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Asp Pro Asn

130 135 140

Thr Leu Cys Asp Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Glu Thr Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Glu Phe Val Glu Val Thr Lys

245 250 255

Leu Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp Asn Gln Asp Thr Ile Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Lys Asp Ala

305 310 315 320

Ile Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Asp Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Ala Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Glu Cys Cys

370 375 380

Ala Lys Asp Asp Pro His Ala Cys Tyr Ser Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Asp

405 410 415

Gln Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Val Ser Arg Ser Leu Gly Lys Val Gly Thr Arg Cys Cys Thr Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Ala Leu Thr Pro Asp Glu Thr Tyr Val Pro Lys Ala Phe Asp Glu Lys

515 520 525

Leu Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Glu Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Ala Cys Phe Ala

580 585 590

Val Glu Gly Pro Lys Leu Val Val Ser Thr Gln Thr Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Tyr Phe

610 615 620

Leu Ala Leu Leu Leu Cys Gly Leu Leu Gly Phe Ser Gly Ser Tyr Gly

625 630 635 640

Gln Gly Gln Phe Phe Arg Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn

645 650 655

Ala Ser Ser Pro Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile

660 665 670

Leu Lys Asn Trp Lys Asp Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln

675 680 685

Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln

690 695 700

Val Ile Gln Arg Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys

705 710 715 720

Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys Lys Leu Ile

725 730 735

Gln Ile Pro Val Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu

740 745 750

Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys

755 760 765

Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Thr

770 775 780

<210> 2

<211> 2349

<212> DNA

<213>Recombinant bovine long-acting interferon γ genome 1

<400> 2

atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120

gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180

gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240

gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420

ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780

ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840

gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900

tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960

atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020

aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260

cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320

gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380

tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560

gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800

tcaactcaaa cagccttagc cggtggtggt ggttctggtg gtggtggttc tatgaaatat 1860

acaagctatt tcttagcttt actgctctgt gggcttttgg gtttttctgg ttcttatggc 1920

cagggccaat tttttagaga aatagaaaac ttaaaggagt attttaatgc aagtagccca 1980

gatgtagcta agggtgggcc tctcttctca gaaattttga agaattggaa agatgaaagt 2040

gacaaaaaaa ttattcagag ccaaattgtc tccttctact tcaaactctt tgaaaacctc 2100

aaagataacc aggtcattca aaggagcatg gatatcatca agcaagacat gtttcagaag 2160

ttcttgaatg gcagctctga gaaactggag gacttcaaaa agctgattca aattccggtg 2220

gatgatctgc agatccagcg caaagccata aatgaactca tcaaagtgat gaatgacctg 2280

tcaccaaaat ctaacctcag aaagcggaag agaagtcaga atctctttcg aggccggaga 2340

gcatcaacg 2349

<210> 3

<211> 2349

<212> DNA

<213>Recombinant bovine long-acting interferon γ genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860

acctcttact tcctggctct gctgctgtgc ggtctgctgg gtttctctgg ttcttacggt 1920

cagggtcagt tcttccgtga aatcgaaaac ctgaaagaat acttcaacgc ttcttctccg 1980

gacgttgcta aaggtggtcc gctgttctct gaaatcctga aaaactggaa agacgaatct 2040

gacaaaaaaa tcatccagtc tcagatcgtt tctttctact tcaaactgtt cgaaaacctg 2100

aaagacaacc aggttatcca gcgttctatg gacatcatca aacaggacat gttccagaaa 2160

ttcctgaacg gttcttctga aaaactggaa gacttcaaaa aactgatcca gatcccggtt 2220

gacgacctgc agatccagcg taaagctatc aacgaactga tcaaagttat gaacgacctg 2280

tctccgaaat ctaacctgcg taaacgtaaa cgttctcaga acctgttccg tggtcgtcgt 2340

gcttctacc 2349

<210> 4

<211> 1821

<212> DNA

<213>Bovine albumin

<400> 4

atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120

gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180

gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240

gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420

ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780

ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840

gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900

tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960

atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020

aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260

cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320

gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380

tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560

gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800

tcaactcaaa cagccttagc c 1821

<210> 5

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 5

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacg 498

<210> 6

<211> 1821

<212> DNA

<213>Bovine albumin

<400> 6

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc t 1821

<210> 7

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 7

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctacc 498

Claims

1. a kind of fusion protein being made of bovine albumin and Bov IFN γ, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of recombinant bovine long-acting interferon γ, which is characterized in that the recombinant bovine long-acting interferon γ is as described in claim 1 Fusion protein and freeze drying protectant mixture after, it is freeze-dried to form.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ, preparation method are：

(1) design primer, is obtained or the bovine albumin of the flexible linker sequence of artificial synthesized connection and ox by reverse transcription The target gene of interferon gamma；The target gene of bovine albumin and Bov IFN γ is connected by flexible linker, mesh Gene nucleotides sequence list as shown in 400 < of SEQUENCE LISTING, 2 > or such as 400 < of SEQUENCE LISTING, 3 > It is shown；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained γ。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of recombinant bovine long-acting interferon γ according to claim 5, which is characterized in that the recombinant bovine is long-acting The long half time of interferon gamma had broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen up to 49 hours or more.