CN108822220A - Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon - Google Patents

Abstract

The invention discloses sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding genes, a kind of sheep long-acting interferon, sheep albumin, sheep interferon-tau and sheep interleukin-22 are connected by flexibility linker, obtain sheep albumin-interferon-tau-interleukin-22 fusion protein, its encoding gene of design optimization, recombination sheep long-acting interferon is finally prepared, it is remarkably improved the half-life period of sheep interferon, the half-life period of more common sheep interferon improves 17 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its coding base Cause, a kind of sheep long-acting interferon

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to sheep albumin-interferon-tau-interleukin-22 merges egg White, preparation method and its encoding gene, a kind of sheep long-acting interferon.Sheep albumin, sheep interferon-tau and sheep interleukin-22 are passed through Flexible flexibility linker connection, obtains sheep albumin-interferon-tau-interleukin-22 fusion protein, its encoding gene of design optimization, most Recombination sheep long-acting interferon is prepared eventually.

Background technique

Animal infectious disease caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the country that sheep breeding stock, the amount of delivering for sale, Mutton yield are most in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry.With the sustainable development of sheep aquaculture, inevitably will in face of virus caused by disease the problem of, domestic animals disease Huge economic loss not only is caused to sheep culturist, more seriously, some Zoonosis communicable diseases return the mankind Health care belt carrys out potential threat.

The prevention and treatment of sheep class communicable disease mainly uses vaccine immunity and drug therapy at present, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling is available, some viruses may also directly jeopardize the health of the mankind.

Common drug therapy mainly uses antibiotic to be treated, but extensive and a large amount of due to antibiotic in recent years It uses, causes endurance strain largely to generate, and be transmitted to people by food chain, bigger threat is brought to human health.It is existing In some countries, oneself prohibites the application of some antibiotic and antibacterial agent in aquaculture.Therefore, positive using interferon Treat and prevent domestic animal, the viral disease of poultry will be the problem of mankind pay close attention to the most.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.

Interferon Ct (in τ erferon τ au, IFN- τ) is initially referred to as trophoblast protein, the one kind secreted by trophoderm Novel I type IFN is the conceptus signal of ruminant maternal gestational identification, maintains to play in pregnant establishment process in corpus luteum Important biological function.Interferon Ct has the denominator of interferon type Ⅰ:With antiviral, anti-cell proliferation, immune tune The functions such as section.IFN- τ has own characteristic in terms of biological function, it is only expressed in embryonic feeder confluent monolayer cells, without virus Induction, and cytotoxicity more less than IFN- τ/β.It is many diseases based on its distinctive biological activity and low cytotoxicity The treatment zone of disease carrys out new hope.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly produced by the T lymphocyte activated The raw cell factor with extensive bioactivity can both promote lymphopoiesis, enhance immune function, and can restricted T Cell effect and the immune tolerance for enhancing body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In beast In doctor, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level that body can be enhanced improves the disease resistance of body, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to mention High curative effect of medication.IL-2 and other cell factors form fusion protein according to gene constructed, with enhance the antibody of vaccine generate and Improve cellular immune level.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, the purpose of the present invention is to provide sheep albumin-interferon-tau-interleukin-22s to merge egg Sheep albumin, sheep interferon-tau and sheep interleukin-22 are connected by flexibility flexibility linker, it is white to obtain sheep by bletilla preparation method Albumen-interferon-tau-interleukin-22 fusion protein.

Another object of the present invention is to provide the encoding gene of above-mentioned sheep albumin-interferon-tau-interleukin-22 fusion protein.

It is also an object of the present invention to provide a kind of long-acting sheep interferon, utilize above-mentioned sheep albumin-interferon-tau- It is freeze-dried that a kind of sheep long-acting interferon, the sheep is prepared after interleukin-22 fusion protein is mixed with freeze drying protectant Long-acting interferon is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon improves 17 times or more, and has There is broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.

The technical scheme adopted by the invention is as follows：

A kind of sheep albumin-interferon-tau-interleukin-22 fusion protein, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides coding sheep albumin-interferon-tau-interleukin-22 fusion protein gene, the core of the gene Nucleotide sequence table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as SEQUENCE LISTING 400 Shown in 3 > of <, it is denoted as genome 2.

The genome 1 and the equal codified fusion protein of the genome 2.Genome 2 is the nucleotides sequence to genome 1 Column optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene and be in the expression system Optimal high efficient expression state, CAI value is lower to show that expression is lower in host.G/C content most ideal distribution model in gene Enclosing is 30~70%, is more than that the range will affect translation and rate of rotation efficiency in any region.Sheep is found using software detection Albumin, sheep IFN- τ, sheep IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.23,0.27,0.27, GC percentage is 44.0%, 54.4%, 54%；And by sheep albumin, sheep IFN- τ, sheep IL-2 base It is 0.99,1.0,1.0, GC percentage because obtaining each gene codon adaptation indexI (CAI) in Escherichia coli after optimization 50.1%, 53.1%, 53%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon pair The influence of protein expression improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides the preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, the preparation methods Include the following steps：Expression vector containing genome 1 or genome 2 is imported into e. coli host cell, base is obtained Because of engineering bacteria, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, can be obtained and melts after purified Hop protein.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2, and preparation method is：

(1), design primer obtains by reverse transcription or is manually respectively synthesized the white egg of sheep for connecting flexible linker sequence White, sheep interferon-tau and sheep interleukin 2 target gene；It is by flexible linker that sheep albumin, sheep interferon-tau, sheep is white The target gene of cytokine 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2), the target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/ can be obtained rAlb-IFNτ-IL2。

Further, the e. coli host cell is for BL21 (DE3) competent cell or with pGro7 plasmid BL21 (DE3) competent cell.BL21 (DE3) competent cell with pGro7 plasmid has purchased from Shanghai offshore science and technology Limit company/glad hundred promise biology, article No. V205.

Further, the method for the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography And molecular sieve chromatography purification.

Further, the acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F1：

CCGGAATTCATGAAGTGGGTGACT has EcoRI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGGCTGCTT, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCCTTCGTGC, with flexible linker；

Downstream IFN- τ-R1：

ACCACCACCAGAACCACCACCACCTCAACCTGAGATC, with flexible linker；

The primer sequence of sheep interleukin 2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAGATACAACCC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCATTGTTGAGTAGAT has XhoI restriction enzyme site；

B. RNA is extracted from sheep liver, by reverse transcription obtain sheep Alb, sheep IFN- τ and sheep IL-2 target gene, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of sheep Alb, sheep IFN- τ and sheep IL-2 as template, and be utilized respectively sheep Alb, sheep IFN- τ and The upstream and downstream primer of sheep IL-2 carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of geneome RNA, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection sheep Alb and sheep IFN τ gene are utilized, Alb-IFN τ gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN- τ template DNA, 0.5 μ L, the IFN- τ of flexible linker 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN τ gene and sheep IL2 gene are utilized, rAlb-IFN τ-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN τ gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F2：CCGGAATTCATGAAATGGGTTACCTT has EcoRI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGAGCAGCC, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCTTTCGTTCTG, with flexible linker；

Downstream IFN- τ-R2：

ACCACCACCAGAACCACCACCACCCGGAGAAGACAGGT, with flexible linker；

Sheep interleukin 2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATCCAGCC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCATGGTAGAGTAGA has XhoI restriction enzyme site.

B. the target gene of the sheep Alb, sheep IFN- τ and sheep IL-2, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

Respectively using the target gene of sheep Alb, sheep IFN- τ and sheep IL-2 as template, and be utilized respectively sheep Alb, sheep IFN- τ and The upstream and downstream primer of sheep IL-2 carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq DNA polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition be：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, Circulation 35 times, 10 min of last 72 DEG C of extensions.

C. flexibility linker connection sheep Alb and sheep IFN τ gene are utilized, Alb-IFN τ gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L, Alb upstream primer of IFN- τ template DNA, 0.5 μ L, the IFN- τ of 1 μ L of Alb gene template DNA, the flexible linker of connection 0.5 μ L, Taq archaeal dna polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN τ gene and sheep IL2 gene are utilized, rAlb-IFN τ-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN τ gene template 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of 1 μ L of DNA, the flexible linker of connection, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

The present invention also provides a kind of sheep long-acting interferon, the sheep long-acting interferon is by the sheep albumin-interference It is freeze-dried to form after plain τ-interleukin-22 fusion protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The present invention also provides the application of the sheep long-acting interferon, long half time had wide spectrum up to 68 hours or more Antivirus action and the immune response that sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep Alb, sheep IFN- τ and sheep IL-2 gene are realized amalgamation and expression by flexibility linker, interferon is improved Half-life period improves 17 times compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving sheep Alb, sheep IFN- τ and sheep IL-2 by optimizing to sheep Alb, sheep IFN- τ and sheep IL-2 gene The expression quantity of fusion protein.

3. using recombination bacillus coli pET-32a/Alb-IFN τ-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of sheep Alb, sheep IFN- τ and sheep IL-2 not only has, IFN- τ's is wide Antivirus action is composed, while significantly improving the immune response of sheep itself.

Detailed description of the invention

Fig. 1 is that sheep albumin gene, sheep interferon-tau gene and the sheep Interleukin-2 Gene RT-PCR in embodiment 1 expand The result of increasing；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep interferon-tau gene RT-PCR amplified production；Swimming lane 2：Sheep is white 2 gene RT-PCR amplified production of interleukin；Swimming lane 3：Sheep albumin gene RT-PCR amplified production；

Fig. 2 is the result of the PCR amplification after sheep Alb, IFN- τ in embodiment 1 are connected with the target gene of IL-2；Swimming Road M：DNA Marker DL10000；Swimming lane 1：Sheep albumin gene, sheep interferon-tau gene connect expansion with sheep interleukin-22 gene Increase production object；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Wes τ ern Blo τ qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the recombination sheep long-acting interferon τ as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant long-acting sheep interferon-tau of gradient dilution (from right to left) handles hole；

Fig. 7 is to recombinate sheep long-acting interferon τ intramuscular injection blood in embodiment 8 as made from the fusion protein in embodiment 1 Concentration-time changing curve.

Specific embodiment

Embodiment 1

The preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, includes the following steps：

1. the acquisition of sheep albumin (Alb), sheep interferon-tau (IFN- τ) and sheep interleukin 2 (IL-2) target gene with Amplification

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of sheep albumin In primer introduce EcoRI restriction enzyme site, in downstream primer introduce Linker sequence, sheep interferon-tau upstream primer and under Linker sequence is introduced respectively in trip primer, Linker sequence is introduced in the upstream primer of sheep interleukin 2, in downstream primer Middle introducing SalI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, the target gene of sheep Alb, sheep IFN- τ and sheep IL-2 are obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1850bp, 650bp and 490bp or so through agarose gel electrophoresis in RT-PCR amplified production, Its result illustrates the target gene that sheep Alb, sheep IFN- τ and sheep IL-2 has been prepared as shown in Fig. 1.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 Alb-IFN- τ PCR reaction system of table

4 Alb-IFN- τ-IL-2PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2930bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs Alb-IFN τ and IL-2 amplified product band in Fig. 2, this is because the process connected in Alb-IFN τ with IL-2 gene In, there is non-specific responding.The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion Product detects single band through agarose gel electrophoresis at 2930bp, and result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNτ-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, result is such as Shown in Fig. 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the place 125.9KD or so can See predominant expression band, illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elu τ ion buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN τ-IL2 protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with II (50mM trihydroxy methyl amino of Elu τ ion Buffer Methane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN τ-IL2 protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN τ-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN τ-IL2 potency and specific activity, specific activity >=10⁶U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C It saves.The fusion protein being made of sheep albumin, sheep interferon-tau and sheep interleukin 2 can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 2

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, the preparation method is the same as that of Example 1, only E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmid is thin Born of the same parents.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,125.9KD or so place's predominant expression item in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with Expression albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 3

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method are as follows：

1. the acquisition of sheep albumin (Alb), sheep interferon-tau (IFN- τ) and sheep interleukin 2 (IL-2) target gene with Amplification

Sheep Alb, sheep IFN- τ and sheep IL-2 in embodiment 1 is optimized, artificial synthesized sheep Alb, sheep IFN- τ and sheep IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (op τ imal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, sheep Alb, the sheep IFN- τ in the present embodiment couple It is optimized with sheep IL-2 gene codon.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and rate of rotation efficiency in any region.Sheep albumin, sheep are found using software detection IFN- τ, sheep IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.23,0.27, 0.27, GC percentage is 44.0%, 54.4%, 54%；And by being obtained to after sheep albumin, sheep IFN- τ, sheep IL-2 gene optimization To each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC percentage 50.1%, 53.1%, 53%.The utilization rate of low codon is significantly reduced by gene optimization, avoids influence of the rare codon to protein expression, The G/C content for improving gene improves transcription and translation efficiency, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of sheep Alb, sheep IFN- τ and sheep IL-2 after optimization are diluted to 0.05mg/mL respectively.Utilize PCR Amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of sheep Alb, sheep IFN- τ and sheep IL-2 are through agarose gel electrophoresis respectively in 1850bp, 650bp There is specific band with 490bp or so, the purpose base of sheep Alb, sheep IFN- τ and sheep IL-2 after illustrating to be prepared optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 Alb-IFN τ PCR reaction system of table

Table 10rAlb-IFN τ-IL2PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2930bp or so through agarose gel electrophoresis in pcr amplification product, is Alb-IFN τ and IL-2 Amplified product band, this is because there is non-specific responding during Alb-IFN τ is connected with IL-2 gene.It obtains The nucleotide sequence of target gene is as shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid EcoRI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of EcoRI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 2930bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN τ-IL2 fusion carries Body constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNτ-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium is lured Supernatant is deposited in the visible predominant expression band in the place 125.9KD or so after bacterial cell disruption after leading 5h, illustrates to precipitate in supernatant In obtained recombinant protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elu τ ion buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN τ-IL2 protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with II (50mM trihydroxy methyl amino of Elu τ ion Buffer Methane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN τ-IL2 protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, use Binding Buffer III is eluted, and collects rAlb-IFN τ-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN τ-IL2 potency and specific activity, specific activity >=10⁶U/mg, albumen are qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of sheep albumin, sheep interferon-tau and sheep interleukin 2, amino acid sequence can be obtained As shown in 400 < of SEQUENCE LISTING, 1 >.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 4

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, other are with embodiment 3, only by it In e. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.Its The SDS-PAGE electrophoresis result of fusion protein is compareed with embodiment 3, in supernatant 125.9KD or so place's predominant expression band compared with Slightly, illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher. The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression in expression bacterial strain Albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 5

A kind of sheep long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively and after freeze drying protectant mixture, It is freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, three with 10mmol/L PBS Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Embodiment 6

The identification for the sheep albumin-interferon-tau-interleukin-22 fusion protein that Examples 1 to 4 obtains

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration difference 2.5mg/ml, 2.4mg/ml, 2.6mg/ml, 2.6mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 125.9KD or so, as shown in Figure 4.

6.3Wes τ ern Blo τ result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-sheep τ interferon (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting sheep interferon sample can be with anti-sheep interferon-tau Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 125.9KD or so, as shown in Figure 5.

Embodiment 7

The bioactivity of the long-acting sheep interferon freeze-drying agent of four portions of sheep in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant long-acting of various dose is added in culture Sheep interferon is inhaled afterwards abandon for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the recombinant long-acting sheep interferon obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant long-acting obtained After sheep interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁶U/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant long-acting sheep interferon freeze-drying agent obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 The measurement of (being denoted as A, B, C, D respectively) in sheep intracorporal half-life period

A be embodiment 1 prepare freeze-dried, B be embodiment 2 prepare freeze-dried, C be embodiment 3 prepare it is freeze-dried, D is the freeze-dried of the preparation of embodiment 4.

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN τ-IL2

The mutton sheep (half male and half female) that six weight are roughly the same is taken, neck is subcutaneously injected 2mg/ml and recombinates sheep long-acting interferon The freeze-dried 2ml of τ, respectively 1h, 3h, 6h, 12h, for 24 hours, 48h, 72h, 96h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low temperature It is centrifuged 10min and separates serum, every sheep blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN τ-IL2 in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculated result It is shown in Table 13.

Dominant dynamic parameters in serum after 13 recombinant long-acting sheep interferon-tau intramuscular injection of table

The result shows that recombinant long-acting sheep interferon has longer half-life period.Half-life period can reach 68h or so after measured, more general Logical interferon improves about 17 times.

Embodiment 9

The measurement that four parts of recombinant long-acting sheep interferon freeze-drying agent in embodiment 5 influence sheep cellullar immunologic response

It takes six roughly the same mutton sheeps of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused 2mg/ml recombinant long-acting sheep interferon freeze-drying agent 2ml is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside sheep All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IFN γ, IL-4 content, are carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group sheep cellullar immunologic response

The result shows that injection recombinant long-acting sheep interferon after, can significantly improve sheep Evaluation of Cytokines in Peripheral Blood IFN γ, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned that a kind of sheep albumin-interferon-tau-interleukin-22 fusion protein and preparation method thereof is carried out referring to embodiment Detailed description, be illustrative without being restrictive, can enumerate several embodiments according to limited range, thus The change and modification under present general inventive concept are not departed from, should be belonged within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep are long-acting dry Disturb element

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 977

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Asn Asp Leu Gly Glu Glu Asn Phe Gln Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Lys Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Thr Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Asn

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Glu Pro Asp

130 135 140

Thr Leu Cys Ala Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Val Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Asp Ala Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Asp Phe Thr Asp Val Thr Lys

245 250 255

Ile Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp His Gln Asp Ala Leu Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Val Leu Glu Lys Ser His Cys Ile Ala Glu Val Asp Lys Asp Ala

305 310 315 320

Val Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Asp Cys Cys

370 375 380

Ala Lys Glu Asp Pro His Ala Cys Tyr Ala Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Lys Asn Cys Glu

405 410 415

Leu Phe Glu Lys His Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Ala Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Ile Ser Arg Ser Leu Gly Lys Val Gly Thr Lys Cys Cys Ala Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Asp Leu Thr Leu Asp Glu Thr Tyr Val Pro Lys Pro Phe Asp Glu Lys

515 520 525

Phe Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Gly Cys Phe Val

580 585 590

Leu Glu Gly Pro Lys Leu Val Ala Ser Thr Gln Ala Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Ala Phe Val Leu Ser Leu

610 615 620

Leu Met Ala Leu Val Leu Val Ser Tyr Gly Pro Gly Gly Ser Leu Gly

625 630 635 640

Cys Tyr Leu Ser Gln Arg Leu Met Leu Asp Ala Arg Glu Asn Leu Lys

645 650 655

Leu Leu Asp Arg Met Asn Arg Leu Ser Pro His Ser Cys Leu Gln Asp

660 665 670

Arg Lys Asp Phe Gly Leu Pro Gln Glu Met Val Glu Gly Asp Gln Leu

675 680 685

Gln Lys Asp Gln Ala Phe Pro Val Leu Tyr Glu Met Leu Gln Gln Ser

690 695 700

Phe Asn Leu Phe Tyr Thr Glu His Ser Ser Ala Ala Trp Asp Thr Thr

705 710 715 720

Leu Leu Asp Gln Leu Cys Thr Gly Leu Gln Gln Gln Leu Asp His Leu

725 730 735

Asp Thr Cys Arg Asp Gln Val Met Gly Glu Lys Asp Ser Glu Leu Gly

740 745 750

Asn Met Asp Pro Ile Val Thr Val Lys Lys Tyr Phe Gln Gly Ile His

755 760 765

Asp Tyr Leu Gln Glu Lys Gly Tyr Ser Asp Cys Ala Trp Glu Ile Val

770 775 780

Arg Val Glu Met Met Arg Ala Leu Thr Val Ser Thr Thr Leu Gln Lys

785 790 795 800

Arg Leu Thr Lys Met Gly Gly Asp Leu Asn Ser Pro Gly Gly Gly Gly

805 810 815

Ser Gly Gly Gly Gly Ser Met Tyr Lys Ile Gln Pro Leu Ser Cys Ile

820 825 830

Ala Leu Thr Leu Ala Leu Val Ala Asn Gly Ala Pro Thr Ser Ser Ser

835 840 845

Thr Gly Asn Thr Met Lys Glu Val Lys Ser Leu Leu Leu Asp Leu Gln

850 855 860

Leu Leu Leu Glu Lys Val Lys Asn Pro Glu Asn Leu Lys Leu Ser Arg

865 870 875 880

Met His Thr Phe Asn Phe Tyr Met Pro Lys Val Asn Ala Thr Glu Leu

885 890 895

Lys His Leu Lys Cys Leu Leu Glu Glu Leu Lys Leu Leu Glu Glu Val

900 905 910

Leu Asp Leu Ala Pro Ser Lys Asn Leu Asn Thr Arg Glu Ile Lys Asp

915 920 925

Ser Met Asp Asn Ile Lys Arg Ile Val Leu Glu Leu Gln Gly Ser Glu

930 935 940

Thr Arg Phe Thr Cys Glu Tyr Asp Asp Ala Thr Val Lys Ala Val Glu

945 950 955 960

Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile Tyr Ser Thr Met

965 970 975

Thr

<210> 2

<211> 2934

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc cggtggtggt ggttctggtg gtggtggttc tatggccttc 1860

gtgctctctc tactgatggc cctggtgctg gtcagctatg gcccaggagg atctctgggt 1920

tgttacctat ctcagagact catgctggat gccagggaga acctcaagct cctggaccga 1980

atgaacagac tctcccctca ttcctgtctg caggacagaa aagactttgg tcttccccag 2040

gagatggtgg agggcgacca gctccagaag gaccaggcct tccctgtgct ctacgagatg 2100

ctccagcaga gcttcaacct cttctacaca gagcactcct ctgctgcctg ggacaccacc 2160

ctcctggacc agctctgcac tggactccaa cagcagctgg accacctgga cacctgcagg 2220

gatcaagtga tgggagagaa agactctgaa ctgggtaaca tggaccccat tgtgaccgtg 2280

aagaagtact tccagggcat ccatgactac ctgcaagaga agggatacag cgactgcgcc 2340

tgggaaatcg tcagagtcga gatgatgaga gccctcactg tatcaaccac cttgcaaaaa 2400

aggttaacaa agatgggtgg agatctgaac tcaccttgag gtggtggtgg ttctggtggt 2460

ggtggttcta tgtacaagat acaacccttg tcttgcattg cactaactct tgcactcgtt 2520

gcaaacggtg cacctacttc aagctctacg gggaacacaa tgaaagaagt gaagtcattg 2580

ctgctagatt tacagttgct tttggagaaa gttaaaaatc ccgagaacct caagctctcc 2640

aggatgcata catttaactt ctacatgccc aaggttaacg ctacagaatt gaaacatctt 2700

aagtgtttac tagaagaact caaacttcta gaggaagtgc tagatttagc tccaagcaaa 2760

aacctgaaca ccagagagat caaggattca atggacaata tcaagagaat agttttggaa 2820

ctacagggat ctgaaacaag attcacatgt gaatatgatg atgcgacagt aaaggctgta 2880

gaatttctga acaaatggat taccttttgt caaagcatct actcaacaat gact 2934

<210> 3

<211> 2934

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc tatggctttc 1860

gttctgtctc tgctgatggc tctggttctg gtttcttacg gtccgggtgg ttctctgggt 1920

tgctacctgt ctcagcgtct gatgctggac gctcgtgaaa acctgaaact gctggaccgt 1980

atgaaccgtc tgtctccgca ctcttgcctg caggaccgta aagacttcgg tctgccgcag 2040

gaaatggttg aaggtgacca gctgcagaaa gaccaggctt tcccggttct gtacgaaatg 2100

ctgcagcagt ctttcaacct gttctacacc gaacactctt ctgctgcttg ggacaccacc 2160

ctgctggacc agctgtgcac cggtctgcag cagcagctgg accacctgga cacctgccgt 2220

gaccaggtta tgggtgaaaa agactctgaa ctgggtaaca tggacccgat cgttaccgtt 2280

aaaaaatact tccagggtat ccacgactac ctgcaggaaa aaggttactc tgactgcgct 2340

tgggaaatcg ttcgtgttga aatgatgcgt gctctgaccg tttctaccac cctgcagaaa 2400

cgtctgacca aaatgggtgg tgacctgaac tctccgtaag gtggtggtgg ttctggtggt 2460

ggtggttcta tgtacaaaat ccagccgctg tcttgcatcg ctctgaccct ggctctggtt 2520

gctaacggtg ctccgacctc ttcttctacc ggtaacacca tgaaagaagt taaatctctg 2580

ctgctggacc tgcagctgct gctggaaaaa gttaaaaacc cggaaaacct gaaactgtct 2640

cgtatgcaca ccttcaactt ctacatgccg aaagttaacg ctaccgaact gaaacacctg 2700

aaatgcctgc tggaagaact gaaactgctg gaagaagttc tggacctggc tccgtctaaa 2760

aacctgaaca cccgtgaaat caaagactct atggacaaca tcaaacgtat cgttctggaa 2820

ctgcagggtt cggagaccag gttcacctgc gaatacgacg acgctaccgt taaagctgtt 2880

gaattcctga acaaatggat caccttctgc cagtctatct actctaccat gacc 2934

<210> 4

<211> 1821

<212> DNA

<213>Sheep albumin gene sequence before optimizing

<400> 4

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc c 1821

<210> 5

<211> 588

<212> DNA

<213>Sheep IFN- τ gene order before optimizing

<400> 5

atggccttcg tgctctctct actgatggcc ctggtgctgg tcagctatgg cccaggagga 60

tctctgggtt gttacctatc tcagagactc atgctggatg ccagggagaa cctcaagctc 120

ctggaccgaa tgaacagact ctcccctcat tcctgtctgc aggacagaaa agactttggt 180

cttccccagg agatggtgga gggcgaccag ctccagaagg accaggcctt ccctgtgctc 240

tacgagatgc tccagcagag cttcaacctc ttctacacag agcactcctc tgctgcctgg 300

gacaccaccc tcctggacca gctctgcact ggactccaac agcagctgga ccacctggac 360

acctgcaggg atcaagtgat gggagagaaa gactctgaac tgggtaacat ggaccccatt 420

gtgaccgtga agaagtactt ccagggcatc catgactacc tgcaagagaa gggatacagc 480

gactgcgcct gggaaatcgt cagagtcgag atgatgagag ccctcactgt atcaaccacc 540

ttgcaaaaaa ggttaacaaa gatgggtgga gatctgaact caccttga 588

<210> 6

<211> 465

<212> DNA

<213>Sheep IL-2 gene order before optimizing

<400> 6

atgtacaaga tacaaccctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctagat 120

ttacagttgc ttttggagaa agttaaaaat cccgagaacc tcaagctctc caggatgcat 180

acatttaact tctacatgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctagatttag ctccaagcaa aaacctgaac 300

accagagaga tcaaggattc aatggacaat atcaagagaa tagttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcgacag taaaggctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 7

<211> 1821

<212> DNA

<213>Sheep albumin gene sequence after optimization

<400> 7

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc t 1821

<210> 8

<211> 588

<212> DNA

<213>Sheep IFN- τ gene order after optimization

<400> 8

atggctttcg ttctgtctct gctgatggct ctggttctgg tttcttacgg tccgggtggt 60

tctctgggtt gctacctgtc tcagcgtctg atgctggacg ctcgtgaaaa cctgaaactg 120

ctggaccgta tgaaccgtct gtctccgcac tcttgcctgc aggaccgtaa agacttcggt 180

ctgccgcagg aaatggttga aggtgaccag ctgcagaaag accaggcttt cccggttctg 240

tacgaaatgc tgcagcagtc tttcaacctg ttctacaccg aacactcttc tgctgcttgg 300

gacaccaccc tgctggacca gctgtgcacc ggtctgcagc agcagctgga ccacctggac 360

acctgccgtg accaggttat gggtgaaaaa gactctgaac tgggtaacat ggacccgatc 420

gttaccgtta aaaaatactt ccagggtatc cacgactacc tgcaggaaaa aggttactct 480

gactgcgctt gggaaatcgt tcgtgttgaa atgatgcgtg ctctgaccgt ttctaccacc 540

ctgcagaaac gtctgaccaa aatgggtggt gacctgaact ctccgtaa 588

<210> 9

<211> 465

<212> DNA

<213>Sheep IL-2 gene order after optimization

<400> 9

atgtacaaaa tccagccgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcaact tctacatgcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctggacctgg ctccgtctaa aaacctgaac 300

acccgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaaagctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

Claims (10)

1. sheep albumin-interferon-tau-interleukin-22 fusion protein, it is characterised in that：The amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >, it is denoted as fusion protein 1.

2. a kind of gene for encoding sheep albumin-interferon-tau-interleukin-22 fusion protein as described in claim 1, feature It is, the nucleotides sequence list of the gene is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as Shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. the preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein described in claim 1, which is characterized in that institute Preparation method is stated to include the following steps：Nucleotides sequence list gene as shown in 400 < of SEQUENCE LISTING, 2 > will be contained The expression vector of group 1 or nucleotides sequence list genome 2 as shown in 400 < of SEQUENCE LISTING, 3 > imported into large intestine bar In bacterium host cell, genetic engineering bacterium is obtained, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, Fusion protein can be obtained after purified.

6. preparation method according to claim 5, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2, preparation method are：

(1), design primer, by reverse transcription obtain or manually be respectively synthesized connect flexible linker sequence sheep albumin, The target gene of sheep interferon-tau and sheep interleukin 2；It is by flexible linker that sheep albumin, sheep interferon-tau, sheep is white thin The target gene of born of the same parents' interleukin 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2), the target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained τ-IL2。

7. preparation method according to claim 5 or 6, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

8. preparation method according to claim 5, which is characterized in that the method for the purifying is：The crude product of fusion protein Successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

9. a kind of sheep long-acting interferon, which is characterized in that the sheep long-acting interferon by fusion protein described in claim 1 with It is freeze-dried to form after freeze drying protectant mixture.

10. sheep long-acting interferon according to claim 9, which is characterized in that the freeze drying protectant is glycerol, mannitol And sucrose.