CN107253996A - Sheep albumin interferon-tau interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon - Google Patents

Abstract

The invention discloses sheep albumin interferon-tau interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon, sheep albumin, sheep interferon-tau and sheep interleukin-22 are passed through into flexible flexibility linker connections, obtain sheep albumin interferon-tau interleukin-22 fusion protein, its encoding gene of design optimization, it is final to prepare restructuring sheep long-acting interferon, it is remarkably improved the half-life period of sheep interferon, the half-life period of more common sheep interferon improves more than 17 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its coding base Cause, a kind of sheep long-acting interferon

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to sheep albumin-interferon-tau-interleukin-22 merges egg In vain, preparation method and its encoding gene, a kind of sheep long-acting interferon.Sheep albumin, sheep interferon-tau and sheep interleukin-22 are passed through Flexible flexibility linker connections, obtain sheep albumin-interferon-tau-interleukin-22 fusion protein, its encoding gene of design optimization, most Restructuring sheep long-acting interferon is prepared eventually.

Background technology

The animal infectious disease as caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the most country of sheep breeding stock, the amount of delivering for sale, Mutton yield in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry.With the sustainable development of sheep aquaculture, the problem of inevitably facing disease caused by virus, domestic animals disease Huge economic loss is not only caused to sheep culturist, more seriously, some Zoonosis communicable diseases return the mankind Health care belt carrys out potential threat.

The preventing and treating of current sheep class communicable disease mainly uses vaccine immunity and drug therapy, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling can use, and some viruses may also directly jeopardize the health of the mankind.

Conventional drug therapy is mainly treated using antibiotic, but extensive and a large amount of due to antibiotic in recent years Use, cause endurance strain largely to produce, and given people by food chain infection, bigger threat is carried out to mankind's health care belt.It is existing In some countries, oneself prohibites the application of some antibiotic and antiseptic in aquaculture.Therefore, using interferon actively It will be the problem of mankind pay close attention to the most to treat and prevent domestic animal, the viral disease of poultry.

Seralbumin is the important component of blood plasma, is difficult to pass through glomerulus under normal circumstances, internal distributed pole it is wide and There is no zymetology and immunologic competence, be preferable pharmaceutical carrier.

Interferon Ct (in τ erferon τ au, IFN- τ) is initially referred to as trophoblast protein, the class secreted by trophoderm New I type IFN, are the conceptus signals of ruminant maternal gestational identification, are played during corpus luteum is maintained and gestation is set up Important biological function.Interferon Ct has the denominator of interferon type Ⅰ:With antiviral, anti-cell proliferation, immune tune The functions such as section.IFN- τ have own characteristic in terms of biological function, and it is expressed only in embryonic feeder confluent monolayer cells, without virus Induction, and the cytotoxicity less than IFN- τ/β.It is many diseases based on its distinctive biological activity and low cytotoxicity The treatment of disease brings new hope.

Cell factor IL-2 is interleukin 2, also known as SCIF.The main T lymphocytes by activating are produced The raw cell factor with extensive bioactivity, can both promote lymphopoiesis, strengthen immunologic function, and can restricted T Cell effect and the immune tolerance for strengthening body, therefore available for treatment tumour, infectious diseases and autoimmune disease.In beast In doctor, because IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level of body can be strengthened, the resistance against diseases of body is improved, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of medicine, make the metabolism time lengthening of medicine, action time increase, so as to put forward High curative effect of medication.IL-2 and other cell factors constitute fusion protein according to gene constructed, with strengthen the antibody of vaccine produce and Improve cellular immune level.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period is generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main cause of half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the aspect of molecular weight Part solve interferon molecule amount it is small and the problem of cause half-life short, while polyethylene glycol fused interferon cost is very Height, is unfavorable for clinically applying.

The content of the invention

In order to solve the above technical problems, merging egg it is an object of the invention to provide sheep albumin-interferon-tau-interleukin-22 Bletilla its preparation method, by sheep albumin, sheep interferon-tau and sheep interleukin-22 by flexible flexibility linker connections, obtains sheep white Albumen-interferon-tau-interleukin-22 fusion protein.

Another object of the present invention is the encoding gene for providing above-mentioned sheep albumin-interferon-tau-interleukin-22 fusion protein.

It is also an object of the present invention to provide a kind of long-acting sheep interferon, above-mentioned sheep albumin-interferon-tau-is utilized It is freeze-dried to prepare a kind of sheep long-acting interferon, the sheep after interleukin-22 fusion protein is mixed with freeze drying protectant Long-acting interferon is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon improves more than 17 times, and has There is broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.

The technical scheme that the present invention takes is：

A kind of sheep albumin-interferon-tau-interleukin-22 fusion protein, the amino acid sequence table of the fusion protein is such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

The gene for the coding sheep albumin-interferon-tau-interleukin-22 fusion protein that the present invention is also provided, the core of the gene Nucleotide sequence table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or such as SEQUENCE LISTING 400 Shown in the ＞ of ＜ 3, genome 2 is designated as.

The equal codified fusion protein of genome 1 and the genome 2.Genome 2 is the nucleotides sequence to genome 1 The result after optimizing is arranged, be considered as the gene during usual codon adaptation indexI CAI=1.0 is in the expression system Optimal high efficient expression state, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution model in gene Enclose for 30~70%, the scope is exceeded in any region can influence translation and rate of rotation efficiency.Sheep is found using software detection Albumin, sheep IFN- τ, sheep IL-2 original genes codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.23rd, 0.27,0.27, GC percentages are 44.0%, 54.4%, 54%；And by sheep albumin, sheep IFN- τ, sheep IL-2 bases Because obtained after optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC percentages 50.1%th, 53.1%, 53%.Significantly reduce the utilization rate of low codon by gene optimization, it is to avoid rare codon pair The influence of protein expression, improves the G/C content of gene, improves transcription and translation efficiency.

Present invention also offers the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, further, and the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers the preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, the preparation method Comprise the following steps：Expression vector containing genome 1 or genome 2 is imported into e. coli host cell, base is obtained Because of engineering bacteria, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG induced expressions, purified to be melted afterwards Hop protein.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2, and its preparation method is：

(1) primer, is designed, the white egg of sheep for connecting flexible linker sequences is obtained or be manually respectively synthesized by reverse transcription In vain, the target gene of sheep interferon-tau and sheep interleukin 2；It is by flexible linker that sheep albumin, sheep interferon-tau, sheep is white The target gene of cytokine 2 is connected, the nucleotides sequence list such as SEQUENCE LISTING of the target gene after connection Shown in the ＞ of 400 ＜ 2 or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2), the target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3), expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/ rAlb-IFNτ-IL2。

Further, the e. coli host cell is for BL21 (DE3) competent cells or with pGro7 plasmids BL21 (DE3) competent cell.Described BL21 (DE3) competent cell with pGro7 plasmids has purchased from Shanghai offshore science and technology Limit company/glad hundred promise is biological, and article No. is V205.

Further, the method for the purifying is：Through affinity chromatography, anion-exchange chromatography after the crude product elder generation of fusion protein With sieve chromatography purifying.

Further, the acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F1：

CCGGAATTCATGAAGTGGGTGACT, with EcoRI restriction enzyme sites；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGGCTGCTT, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCCTTCGTGC, with flexible linker；

Downstream IFN- τ-R1：

ACCACCACCAGAACCACCACCACCTCAACCTGAGATC, with flexible linker；

The primer sequence of sheep interleukin 2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAGATACAACCC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCATTGTTGAGTAGAT, with XhoI restriction enzyme sites；

B. RNA is extracted from sheep liver, sheep Alb, sheep IFN- τ and sheep IL-2 target gene, three are obtained by reverse transcription The gene order of person respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

Respectively using sheep Alb, sheep IFN- τ and sheep IL-2 target gene as template, and be utilized respectively sheep Alb, sheep IFN- τ and Sheep IL-2 upstream and downstream primer enters performing PCR amplification.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of geneome RNA 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix are 10 μ L, plus RNase Free water is to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection sheep Alb and sheep IFN τ gene are utilized, Alb-IFN τ genes are obtained:

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN- τ template DNAs 0.5 μ L, IFN- τ 0.5 μ L, Taq archaeal dna polymerase of anti-sense primer 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connections Alb-IFN τ genes and sheep IL2 genes are utilized, rAlb-IFN τ-IL2 genes are obtained：

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, Alb-IFN τ gene templates The μ L of DNA 1, connect the flexible linker μ L of 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 anti-sense primer 0.5, Taq archaeal dna polymerases 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C extension 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F2：CCGGAATTCATGAAATGGGTTACCTT, with EcoRI restriction enzyme sites；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGAGCAGCC, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCTTTCGTTCTG, with flexible linker；

Downstream IFN- τ-R2：

ACCACCACCAGAACCACCACCACCCGGAGAAGACAGGT, with flexible linker；

Sheep interleukin 2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATCCAGCC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCATGGTAGAGTAGA, with XhoI restriction enzyme sites.

B. the sheep Alb, sheep IFN- τ and sheep IL-2 target gene, the gene order of three is respectively such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 7 ＞, SEQUENCE LISTING, 400 ＜, 8 ＞ and SEQUENCE LISTING 9；

Respectively using sheep Alb, sheep IFN- τ and sheep IL-2 target gene as template, and be utilized respectively sheep Alb, sheep IFN- τ and Sheep IL-2 upstream and downstream primer enters performing PCR amplification.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.0, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection sheep Alb and sheep IFN τ gene are utilized, Alb-IFN τ genes are obtained:

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, the flexible linker of connection 1 μ L, Alb sense primer of IFN- τ template DNAs 0.5 μ L, IFN- τ 0.5 μ L, Taq archaeal dna polymerase of anti-sense primer 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connections Alb-IFN τ genes and sheep IL2 genes are utilized, rAlb-IFN τ-IL2 genes are obtained：

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, Alb-IFN τ gene templates The μ L of DNA 1, the flexible linker of connection the μ L of 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 anti-sense primer 0.5, Taq archaeal dna polymerases 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C extension 10min.

Present invention also offers a kind of sheep long-acting interferon, the sheep long-acting interferon is by described sheep albumin-interference It is freeze-dried to form after plain τ-interleukin-22 fusion protein and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Present invention also offers the application of the sheep long-acting interferon, its long half time was up to more than 68 hours, with wide spectrum Antivirus action and the immune response that sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep Alb, sheep IFN- τ and sheep IL-2 genes are realized into amalgamation and expression by flexible linker, interferon is improved Half-life period, compared with plain interferon, improve 17 times；

2. by being optimized to sheep Alb, sheep IFN- τ and sheep IL-2 genes, improve sheep Alb, sheep IFN- τ and sheep IL-2 The expression quantity of fusion protein.

3. using recombination bacillus coli pET-32a/Alb-IFN τ-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, it is less to produce inclusion body in protein expression, forms great amount of soluble albumen, it is to avoid inclusion body denaturation and multiple The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of sheep Alb, sheep IFN- τ and sheep IL-2 is not only wide with IFN- τ Antivirus action is composed, while significantly improving the immune response of sheep itself.

Brief description of the drawings

Fig. 1 is that sheep albumin gene, sheep interferon-tau gene and sheep Interleukin-2 Gene RT-PCR in embodiment 1 expand The result of increasing；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep interferon-tau gene RT-PCR amplified productions；Swimming lane 2：Sheep is white The gene RT-PCR amplified productions of interleukin 2；Swimming lane 3：Sheep albumin gene RT-PCR amplified productions；

The result that Fig. 2 expands for the PCR after the target gene connection of sheep Alb, IFN- τ and IL-2 in embodiment 1；Swimming Road M：DNA Marker DL10000；Swimming lane 1：Sheep albumin gene, sheep interferon-tau gene are connected expansion with sheep interleukin-22 gene Increase production thing；

PCR amplifications and double digestion qualification result of the Fig. 3 for the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 be embodiment 1 in recombinant protein SDS-PAGE electrophoretic examinations results；Swimming lane M：Albumen Marker；Swimming lane 1：Precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Wes τ ern Blo τ qualification results for the fusion protein that embodiment 1 is obtained；Swimming lane M：Albumen Marker；Swimming Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 causes cell to recombinate sheep long-acting interferon τ in embodiment 5 as made from the fusion protein in embodiment 1 to VSV The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 handles hole for the recombinant long-acting sheep interferon-tau of gradient dilution (from right to left)；

Fig. 7 is the restructuring sheep long-acting interferon τ intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Embodiment

Embodiment 1

The preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, comprises the following steps：

1. the acquisition of sheep albumin (Alb), sheep interferon-tau (IFN- τ) and sheep interleukin 2 (IL-2) target gene with Amplification

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upstream of sheep albumin In primer introduce EcoRI restriction enzyme sites, in anti-sense primer introduce Linker sequences, sheep interferon-tau sense primer and under Linker sequences are introduced respectively in trip primer, Linker sequences are introduced in the sense primer of sheep interleukin 2, in anti-sense primer Middle introducing SalI restriction enzyme sites.

The pcr amplification primer thing of table 1

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, sheep Alb, sheep IFN- τ and sheep IL-2 target gene are obtained by reverse transcription, The gene order of three is respectively such as the ＞ and SEQUENCE of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 Shown in the ＞ of 400 ＜ of LISTING 6；

RT-PCR reaction systems (25 μ L) are shown in Table 2

The RT-PCR reaction systems of table 2

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1850bp, 650bp and 490bp or so in RT-PCR amplified productions, Its result is as shown in figure 1, explanation has prepared sheep Alb, sheep IFN- τ and sheep IL-2 target gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

The Alb-IFN- τ PCR reaction systems of table 3

Alb-IFN- τ-IL-2PCR the reaction systems of table 4

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2930bp or so in pcr amplification product, its result as shown in Fig. 2 Alb-IFN τ and IL-2 amplified production bands are occurred in that in Fig. 2, because the process connected in Alb-IFN τ and IL-2 gene In, occur in that non-specific responding.The nucleotide sequence of obtained target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2.

3. expression vector establishment

Selection connection after target gene through be sequenced it is errorless after, PCR glue reclaims product is used with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 5：

The double digestion system of table 5

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 6,4 DEG C overnight connect：

The enzyme disjunctor system of table 6

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate incubated overnights of penicillin；Single bacterium colony on picking LB flat boards carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through EcoRI and XhoI double digestions, is accredited as positive and is represented that engineering bacteria is successfully constructed, PCR amplifications and double digestion Product detects single band through agarose gel electrophoresis at 2930bp, and its result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, engineering bacteria is designated as pET-32a/rAlb-IFNτ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the μ g/ml containing ampicillin 100), Add final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, its result is as schemed Shown in 4, it can be seen that after bacterial cell disruption after recombinant bacterium induction 5h supernatant to be deposited in 125.9KD or so places visible Predominant expression band, illustrates in precipitation and supernatant equal successful expression fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elu τ ion buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN τ-IL2 protein peaks.

5.2 DEAE anion-exchange chromatographies

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elu τ ion Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN τ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by using (the 50mM of Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, washed with Binding Buffer III It is de-, collect rAlb-IFN τ-IL2 protein peaks.

5.4 sample identification

Determine rAlb-IFN τ-IL2 potency and specific activity, specific activity >=10⁶IU/mg, albumen is qualified；It is aseptic subpackaged, -80 DEG C preserve.It can obtain the fusion protein being made up of sheep albumin, sheep interferon-tau and sheep interleukin 2, its amino acid sequence As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 2

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method be the same as Example 1, simply E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmids is thin Born of the same parents.The SDS-PAGE electrophoresis results be the same as Example 1 of its fusion protein is compareed, 125.9KD or so places predominant expression bar in supernatant Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with Expressing protein is correctly folded, and reaches solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 3

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, its preparation method is as follows：

1. the acquisition of sheep albumin (Alb), sheep interferon-tau (IFN- τ) and sheep interleukin 2 (IL-2) target gene with Amplification

Sheep Alb in embodiment 1, sheep IFN- τ and sheep IL-2 are optimized, artificial synthesized sheep Alb, sheep IFN- τ and sheep IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 ＜ of SEQUENCE LISTING 7 ＞, SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (op τ imal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilize rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to sheep Alb, sheep IFN- τ Optimized with sheep IL-2 gene codons.

Interpretation of result after 1.2 codon optimizations

It is considered as the gene during usual codon adaptation indexI (CAI)=1.0 optimal efficient in the expression system Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, the scope is exceeded in any region can influence to translate and rate of rotation efficiency.Sheep albumin, sheep are found using software detection IFN- τ, sheep IL-2 original genes codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.23,0.27, 0.27, GC percentage is 44.0%, 54.4%, 54%；And by being obtained after sheep albumin, sheep IFN- τ, sheep IL-2 gene optimizations To each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC percentages 50.1%, 53.1%, 53%.The utilization rate of low codon is significantly reduced by gene optimization, it is to avoid influence of the rare codon to protein expression, The G/C content of gene is improved, transcription and translation efficiency is improved.

1.3 design of primers：

The pcr amplification primer thing of table 7

Sheep Alb after optimization, sheep IFN- τ and sheep IL-2 genomic DNA are diluted to 0.05mg/mL respectively.Utilize PCR Amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

The PCR reaction systems of table 8

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Sheep Alb, sheep IFN- τ and sheep IL-2 pcr amplification product are through agarose gel electrophoresis respectively in 1850bp, 650bp There is specific band with 490bp or so, illustrate to have prepared the purpose base of sheep Alb, the sheep IFN- τ and sheep IL-2 after optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

The Alb-IFN τ PCR reaction systems of table 9

RAlb-IFN τ-IL2PCR the reaction systems of table 10

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2930bp or so in pcr amplification product, is Alb-IFN τ and IL-2 Amplified production band, because during Alb-IFN τ and IL-2 gene are connected, occurring in that non-specific responding.Obtain The nucleotide sequence of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids EcoRI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 11：

The double digestion system of table 11

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 12,4 DEG C overnight connect：

Table 12

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia Incubated overnight in the LB flat boards of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid warp through PCR EcoRI, XhoI double digestion are identified, are accredited as positive and are represented expression vector establishment success, PCR amplifications and double digestion product are through fine jade There is single band at 2930bp or so places in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN τ-IL2 fusions is carried Body is successfully constructed.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, engineering bacteria is designated as pET-32a/rAlb-IFNτ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the μ g/ml containing ampicillin 100), Add final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in 125.9KD or so places after bacterial cell disruption after 5h, illustrates in supernatant is precipitated Recombinant protein is obtained.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to the eggs of AKTAexplorer 100 On white purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away with PBS and not tied The albumen of conjunction, until A280nm is stable, then with Elu τ ion buffer I (50mM trishydroxymethylaminomethanes, 20~500mM miaows Azoles, PH8.0) elution, collect rAlb-IFN τ-IL2 protein peaks.

5.2 DEAE anion-exchange chromatographies

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elu τ ion Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN τ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, use Binding Buffer III elution, collects rAlb-IFN τ-IL2 protein peaks.

5.4 sample identification

Determine rAlb-IFN τ-IL2 potency and specific activity, specific activity >=10⁶IU/mg, albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.It can obtain the fusion protein being made up of sheep albumin, sheep interferon-tau and sheep interleukin 2, its amino acid sequence Row are as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 4

A kind of preparation method of sheep albumin-interferon-tau-interleukin-22 fusion protein, other be the same as Examples 3, simply by it In e. coli bl21 (DE3) competent cell replace for BL21 (DE3) competent cell with pGro7 plasmids.Its The SDS-PAGE electrophoresis results be the same as Example 3 of fusion protein is compareed, in supernatant 125.9KD or so places predominant expression band compared with Slightly, illustrate to introduce after molecular chaperones pGro7, more preferably, obtained fusion protein amount is higher for expression of the destination protein in supernatant. The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression in expression bacterial strain Albumen is correctly folded, and reaches solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Sheep albumin-interferon-tau-interleukin-22 fusion protein is prepared using the above method.

Embodiment 5

A kind of sheep long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively with after freeze drying protectant mixture, It is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, three with 10mmol/L PBS Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Embodiment 6

The identification for the sheep albumin-interferon-tau-interleukin-22 fusion protein that embodiment 1~4 is obtained

The quantitative detection of 6.1 protein contents

Lowry methods are used, the standard protein for examining and determine institute with Chinese food pharmaceutical biological product makees standard test, determine embodiment 1~4 obtained fusion protein concentration difference 2.5mg/ml, 2.4mg/ml, 2.6mg/ml, 2.6mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 125.9KD or so, as shown in Figure 4.

6.3 Wes τ ern Blo τ results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-sheep τ interferon (1 of abcam companies mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting sheep interferon sample can be with anti-sheep interferon-tau Specific reaction occurs for monoclonal antibody, and specific band occurs in 125.9KD or so place, as shown in Figure 5.

Embodiment 7

The bioactivity of the long-acting sheep interferon freeze-drying agent of four portions of sheep in embodiment 5

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, the recombinant long-acting of various dose is added Inhale and abandon after sheep interferon, 24h, then be inoculated with 100 TCID50 VSV viruses respectively.

Result of the test

As a result show that the recombinant long-acting sheep interferon obtained causes the lesion of HEp-2 cells to have obvious suppression to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the recombinant long-acting obtained After cell virus inoculation after the processing of sheep interferon, the Continuous Observation under inverted microscope, cellular morphology is normal, does not occur any Lesion, measures potency >=10⁶IU/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant long-acting sheep interferon freeze-drying agent obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 The measure of the half-life period of (being designated as A, B, C, D respectively) in sheep body

A be embodiment 1 prepare freeze-dried, B be embodiment 2 prepare freeze-dried, C be embodiment 3 prepare it is freeze-dried, D is the freeze-dried of the preparation of embodiment 4.

Cytopathic-effect inhibition assay determines rAlb-IFN τ-IL2 blood concentration and time relationship

The mutton sheep (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml restructuring sheep long-acting interferons are subcutaneously injected in neck The freeze-dried 2ml of τ, respectively in 1h, 3h, 6h, 12h, 24h, 48h, 72h, 96h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm low temperature 10min separation serum is centrifuged, each every sheep blood sample of time point is to be measured in -20 DEG C of preservations.Serum is determined using cytopathic-effect inhibition assay RAlb-IFN τ-IL2 concentration in sample, is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter result of calculation It is shown in Table 13.

Dominant dynamic parameters in serum after the recombinant long-acting sheep interferon-tau intramuscular injection of table 13

As a result show that the interference of recombinant long-acting sheep have longer half-life period.Half-life period can reach 68h or so after measured, more general Logical interferon improves about 17 times.

Embodiment 9

The measure that four parts of recombinant long-acting sheep interferon freeze-drying agent in embodiment 5 influence on sheep cellullar immunologic response

Take six roughly the same mutton sheeps of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted 2mg/ml recombinant long-acting sheep interferon freeze-drying agent 2ml are penetrated, 2mL PBS is subcutaneously injected in control group neck, taken after injecting 4 weeks outside sheep All blood, takes weekly a blood afterwards, and lymphocyte is separated using lymphocyte separation medium, and lymphocyte passes through serum-free RPMI 1640 culture mediums are washed after 2 times, and it is 2 × 10 to be resuspended with complete medium, adjust cell concentration⁶Individual/ml, 24 porocyte culture plates are every Hole adds 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IFN γ, IL-4 contents, are carried out, testing result is as shown in table 14 by kit specification：

The ELISA of table 14 detects each group sheep cellullar immunologic response level

As a result show injection recombinant long-acting sheep interferon after, can significantly improve sheep Evaluation of Cytokines in Peripheral Blood IFN γ, IL-4 content, enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned that a kind of sheep albumin-interferon-tau-interleukin-22 fusion protein and preparation method thereof is carried out with reference to embodiment Detailed description, be illustrative rather than limited, can include several embodiments according to limited scope, thus Changing and modifications under present general inventive concept is not departed from, should be belonged within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep are long-acting dry Disturb element

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 977

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Asn Asp Leu Gly Glu Glu Asn Phe Gln Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Lys Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Thr Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Asn

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Glu Pro Asp

130 135 140

Thr Leu Cys Ala Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Val Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Asp Ala Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Asp Phe Thr Asp Val Thr Lys

245 250 255

Ile Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp His Gln Asp Ala Leu Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Val Leu Glu Lys Ser His Cys Ile Ala Glu Val Asp Lys Asp Ala

305 310 315 320

Val Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Asp Cys Cys

370 375 380

Ala Lys Glu Asp Pro His Ala Cys Tyr Ala Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Lys Asn Cys Glu

405 410 415

Leu Phe Glu Lys His Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Ala Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Ile Ser Arg Ser Leu Gly Lys Val Gly Thr Lys Cys Cys Ala Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Asp Leu Thr Leu Asp Glu Thr Tyr Val Pro Lys Pro Phe Asp Glu Lys

515 520 525

Phe Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Gly Cys Phe Val

580 585 590

Leu Glu Gly Pro Lys Leu Val Ala Ser Thr Gln Ala Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Ala Phe Val Leu Ser Leu

610 615 620

Leu Met Ala Leu Val Leu Val Ser Tyr Gly Pro Gly Gly Ser Leu Gly

625 630 635 640

Cys Tyr Leu Ser Gln Arg Leu Met Leu Asp Ala Arg Glu Asn Leu Lys

645 650 655

Leu Leu Asp Arg Met Asn Arg Leu Ser Pro His Ser Cys Leu Gln Asp

660 665 670

Arg Lys Asp Phe Gly Leu Pro Gln Glu Met Val Glu Gly Asp Gln Leu

675 680 685

Gln Lys Asp Gln Ala Phe Pro Val Leu Tyr Glu Met Leu Gln Gln Ser

690 695 700

Phe Asn Leu Phe Tyr Thr Glu His Ser Ser Ala Ala Trp Asp Thr Thr

705 710 715 720

Leu Leu Asp Gln Leu Cys Thr Gly Leu Gln Gln Gln Leu Asp His Leu

725 730 735

Asp Thr Cys Arg Asp Gln Val Met Gly Glu Lys Asp Ser Glu Leu Gly

740 745 750

Asn Met Asp Pro Ile Val Thr Val Lys Lys Tyr Phe Gln Gly Ile His

755 760 765

Asp Tyr Leu Gln Glu Lys Gly Tyr Ser Asp Cys Ala Trp Glu Ile Val

770 775 780

Arg Val Glu Met Met Arg Ala Leu Thr Val Ser Thr Thr Leu Gln Lys

785 790 795 800

Arg Leu Thr Lys Met Gly Gly Asp Leu Asn Ser Pro Gly Gly Gly Gly

805 810 815

Ser Gly Gly Gly Gly Ser Met Tyr Lys Ile Gln Pro Leu Ser Cys Ile

820 825 830

Ala Leu Thr Leu Ala Leu Val Ala Asn Gly Ala Pro Thr Ser Ser Ser

835 840 845

Thr Gly Asn Thr Met Lys Glu Val Lys Ser Leu Leu Leu Asp Leu Gln

850 855 860

Leu Leu Leu Glu Lys Val Lys Asn Pro Glu Asn Leu Lys Leu Ser Arg

865 870 875 880

Met His Thr Phe Asn Phe Tyr Met Pro Lys Val Asn Ala Thr Glu Leu

885 890 895

Lys His Leu Lys Cys Leu Leu Glu Glu Leu Lys Leu Leu Glu Glu Val

900 905 910

Leu Asp Leu Ala Pro Ser Lys Asn Leu Asn Thr Arg Glu Ile Lys Asp

915 920 925

Ser Met Asp Asn Ile Lys Arg Ile Val Leu Glu Leu Gln Gly Ser Glu

930 935 940

Thr Arg Phe Thr Cys Glu Tyr Asp Asp Ala Thr Val Lys Ala Val Glu

945 950 955 960

Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile Tyr Ser Thr Met

965 970 975

Thr

<210> 2

<211> 2934

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc cggtggtggt ggttctggtg gtggtggttc tatggccttc 1860

gtgctctctc tactgatggc cctggtgctg gtcagctatg gcccaggagg atctctgggt 1920

tgttacctat ctcagagact catgctggat gccagggaga acctcaagct cctggaccga 1980

atgaacagac tctcccctca ttcctgtctg caggacagaa aagactttgg tcttccccag 2040

gagatggtgg agggcgacca gctccagaag gaccaggcct tccctgtgct ctacgagatg 2100

ctccagcaga gcttcaacct cttctacaca gagcactcct ctgctgcctg ggacaccacc 2160

ctcctggacc agctctgcac tggactccaa cagcagctgg accacctgga cacctgcagg 2220

gatcaagtga tgggagagaa agactctgaa ctgggtaaca tggaccccat tgtgaccgtg 2280

aagaagtact tccagggcat ccatgactac ctgcaagaga agggatacag cgactgcgcc 2340

tgggaaatcg tcagagtcga gatgatgaga gccctcactg tatcaaccac cttgcaaaaa 2400

aggttaacaa agatgggtgg agatctgaac tcaccttgag gtggtggtgg ttctggtggt 2460

ggtggttcta tgtacaagat acaacccttg tcttgcattg cactaactct tgcactcgtt 2520

gcaaacggtg cacctacttc aagctctacg gggaacacaa tgaaagaagt gaagtcattg 2580

ctgctagatt tacagttgct tttggagaaa gttaaaaatc ccgagaacct caagctctcc 2640

aggatgcata catttaactt ctacatgccc aaggttaacg ctacagaatt gaaacatctt 2700

aagtgtttac tagaagaact caaacttcta gaggaagtgc tagatttagc tccaagcaaa 2760

aacctgaaca ccagagagat caaggattca atggacaata tcaagagaat agttttggaa 2820

ctacagggat ctgaaacaag attcacatgt gaatatgatg atgcgacagt aaaggctgta 2880

gaatttctga acaaatggat taccttttgt caaagcatct actcaacaat gact 2934

<210> 3

<211> 2934

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc tatggctttc 1860

gttctgtctc tgctgatggc tctggttctg gtttcttacg gtccgggtgg ttctctgggt 1920

tgctacctgt ctcagcgtct gatgctggac gctcgtgaaa acctgaaact gctggaccgt 1980

atgaaccgtc tgtctccgca ctcttgcctg caggaccgta aagacttcgg tctgccgcag 2040

gaaatggttg aaggtgacca gctgcagaaa gaccaggctt tcccggttct gtacgaaatg 2100

ctgcagcagt ctttcaacct gttctacacc gaacactctt ctgctgcttg ggacaccacc 2160

ctgctggacc agctgtgcac cggtctgcag cagcagctgg accacctgga cacctgccgt 2220

gaccaggtta tgggtgaaaa agactctgaa ctgggtaaca tggacccgat cgttaccgtt 2280

aaaaaatact tccagggtat ccacgactac ctgcaggaaa aaggttactc tgactgcgct 2340

tgggaaatcg ttcgtgttga aatgatgcgt gctctgaccg tttctaccac cctgcagaaa 2400

cgtctgacca aaatgggtgg tgacctgaac tctccgtaag gtggtggtgg ttctggtggt 2460

ggtggttcta tgtacaaaat ccagccgctg tcttgcatcg ctctgaccct ggctctggtt 2520

gctaacggtg ctccgacctc ttcttctacc ggtaacacca tgaaagaagt taaatctctg 2580

ctgctggacc tgcagctgct gctggaaaaa gttaaaaacc cggaaaacct gaaactgtct 2640

cgtatgcaca ccttcaactt ctacatgccg aaagttaacg ctaccgaact gaaacacctg 2700

aaatgcctgc tggaagaact gaaactgctg gaagaagttc tggacctggc tccgtctaaa 2760

aacctgaaca cccgtgaaat caaagactct atggacaaca tcaaacgtat cgttctggaa 2820

ctgcagggtt cggagaccag gttcacctgc gaatacgacg acgctaccgt taaagctgtt 2880

gaattcctga acaaatggat caccttctgc cagtctatct actctaccat gacc 2934

<210> 4

<211> 1821

<212> DNA

<213>Sheep albumin gene sequence before optimization

<400> 4

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc c 1821

<210> 5

<211> 588

<212> DNA

<213>Sheep IFN- τ gene orders before optimization

<400> 5

atggccttcg tgctctctct actgatggcc ctggtgctgg tcagctatgg cccaggagga 60

tctctgggtt gttacctatc tcagagactc atgctggatg ccagggagaa cctcaagctc 120

ctggaccgaa tgaacagact ctcccctcat tcctgtctgc aggacagaaa agactttggt 180

cttccccagg agatggtgga gggcgaccag ctccagaagg accaggcctt ccctgtgctc 240

tacgagatgc tccagcagag cttcaacctc ttctacacag agcactcctc tgctgcctgg 300

gacaccaccc tcctggacca gctctgcact ggactccaac agcagctgga ccacctggac 360

acctgcaggg atcaagtgat gggagagaaa gactctgaac tgggtaacat ggaccccatt 420

gtgaccgtga agaagtactt ccagggcatc catgactacc tgcaagagaa gggatacagc 480

gactgcgcct gggaaatcgt cagagtcgag atgatgagag ccctcactgt atcaaccacc 540

ttgcaaaaaa ggttaacaaa gatgggtgga gatctgaact caccttga 588

<210> 6

<211> 465

<212> DNA

<213>Sheep IL-2 gene orders before optimization

<400> 6

atgtacaaga tacaaccctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctagat 120

ttacagttgc ttttggagaa agttaaaaat cccgagaacc tcaagctctc caggatgcat 180

acatttaact tctacatgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctagatttag ctccaagcaa aaacctgaac 300

accagagaga tcaaggattc aatggacaat atcaagagaa tagttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcgacag taaaggctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 7

<211> 1821

<212> DNA

<213>Sheep albumin gene sequence after optimization

<400> 7

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc t 1821

<210> 8

<211> 588

<212> DNA

<213>Sheep IFN- τ gene orders after optimization

<400> 8

atggctttcg ttctgtctct gctgatggct ctggttctgg tttcttacgg tccgggtggt 60

tctctgggtt gctacctgtc tcagcgtctg atgctggacg ctcgtgaaaa cctgaaactg 120

ctggaccgta tgaaccgtct gtctccgcac tcttgcctgc aggaccgtaa agacttcggt 180

ctgccgcagg aaatggttga aggtgaccag ctgcagaaag accaggcttt cccggttctg 240

tacgaaatgc tgcagcagtc tttcaacctg ttctacaccg aacactcttc tgctgcttgg 300

gacaccaccc tgctggacca gctgtgcacc ggtctgcagc agcagctgga ccacctggac 360

acctgccgtg accaggttat gggtgaaaaa gactctgaac tgggtaacat ggacccgatc 420

gttaccgtta aaaaatactt ccagggtatc cacgactacc tgcaggaaaa aggttactct 480

gactgcgctt gggaaatcgt tcgtgttgaa atgatgcgtg ctctgaccgt ttctaccacc 540

ctgcagaaac gtctgaccaa aatgggtggt gacctgaact ctccgtaa 588

<210> 9

<211> 465

<212> DNA

<213>Sheep IL-2 gene orders after optimization

<400> 9

atgtacaaaa tccagccgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcaact tctacatgcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctggacctgg ctccgtctaa aaacctgaac 300

acccgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaaagctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

Claims (10)

1. sheep albumin-interferon-tau-interleukin-22 fusion protein, it is characterised in that：The amino acid sequence table of the fusion protein As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1, fusion protein 1 is designated as.

2. a kind of gene for encoding sheep albumin-interferon-tau-interleukin-22 fusion protein as claimed in claim 1, its feature It is, the nucleotides sequence list of the gene is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, genome 2 is designated as.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. the preparation method of the sheep albumin-interferon-tau-interleukin-22 fusion protein described in claim 1, it is characterised in that institute Preparation method is stated to comprise the following steps：By the genome containing nucleotides sequence list as shown in the ＞ of 400 ＜ of SEQUENCELISTING 2 1 or the expression vector of genome 2 of the nucleotides sequence list as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3 imported into Escherichia coli In host cell, genetic engineering bacterium is obtained, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG induced expressions, passed through It can obtain fusion protein after purification.

6. preparation method according to claim 5, it is characterised in that the genetic engineering bacterium is pET-32a/rAlb-IFN τ-IL2, its preparation method is：

(1), design primer, obtained by reverse transcription or it is artificial be respectively synthesized connect flexible linker sequences sheep albumin, The target gene of sheep interferon-tau and sheep interleukin 2；It is by flexible linker that sheep albumin, sheep interferon-tau, sheep is thin in vain The target gene of born of the same parents' interleukin 2 is connected, the nucleotides sequence list such as SEQUENCE LISTING of the target gene after connection Shown in the ＞ of 400 ＜ 2 or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2), the target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3), expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-IFN τ-IL2。

7. the preparation method according to claim 5 or 6, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

8. preparation method according to claim 5, it is characterised in that the method for the purifying is：The crude product of fusion protein Purified after elder generation through affinity chromatography, anion-exchange chromatography and sieve chromatography.

9. a kind of sheep long-acting interferon, it is characterised in that the sheep long-acting interferon as the fusion protein described in claim 1 with It is freeze-dried to form after freeze drying protectant mixture.

10. sheep long-acting interferon according to claim 9, it is characterised in that the freeze drying protectant is glycerine, mannitol And sucrose.