CN107353348A

CN107353348A - A kind of restructuring sheep long-acting interferon τ and prepare fusion protein of this long-acting interferon and preparation method thereof

Info

Publication number: CN107353348A
Application number: CN201710676595.6A
Authority: CN
Inventors: 赵俊; 沈咏舟; 符修乐; 夏兵兵; 徐慕珍; 程正阳; 徐文俊; 单雪芹
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2017-08-09
Publication date: 2017-11-17
Also published as: CN108840934A; CN108840934B

Abstract

The invention discloses a kind of restructuring sheep long-acting interferon τ and the fusion protein for preparing this long-acting interferon and preparation method thereof; the fusion protein is connected by sheep interferon gamma with sheep interferon-tau and formed through flexible linker, and fusion protein through being freeze-dried to obtain after freeze drying protectant mixture with recombinating sheep long-acting interferon τ.The restructuring sheep long-acting interferon τ is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon improves more than 10 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

A kind of restructuring sheep long-acting interferon τ and prepare this long-acting interferon fusion protein and Its preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to one kind recombinates sheep long-acting interferon τ and prepares this Fusion protein of long-acting interferon and preparation method thereof.

Background technology

The animal infectious disease as caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the country that sheep breeding stock, the amount of delivering for sale, Mutton yield are most in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry.With the sustainable development of sheep aquaculture, the problem of inevitably facing disease caused by virus, domestic animals disease Huge economic loss is not only caused to sheep culturist, more seriously, some Zoonosis communicable diseases return the mankind Health care belt carrys out potential threat.

The preventing and treating of sheep class communicable disease at present mainly uses vaccine immunity and drug therapy, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling can use, and some viruses may also directly jeopardize the health of the mankind.

Conventional drug therapy is mainly treated using antibiotic, but extensive and a large amount of due to antibiotic in recent years Use, cause endurance strain largely to produce, and infected and given people by food chain, bigger threat is carried out to mankind's health care belt.It is existing In some countries, oneself prohibites the application of some antibiotic and antiseptic in aquaculture.Therefore, it is positive using interferon Treat and prevent domestic animal, the viral disease of poultry will be the problem of mankind pay close attention to the most.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and produce more species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA is come the activity that suppresses the growth and breeding of virus and play antitumor grade.According to IFN generation cell, biochemical character and The difference to be played a role in terms of immunity of organism, is divided into the class of α, β, γ tri-.Now, it is known that α types IFN can selectively make in vivo For infection cells such as viruses, by suppressing the biosynthesis of the virus protein in infected cell, play wide spectrum and efficiently resist Virus function.

γ types IFN is the T cell and the generation of NK cells by activating, and has relatively strong antiviral and immunoloregulation function.Largely Research shows that interferon gamma also plays the adjustment effect of key in addition to broad-spectrum antiviral function, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- Should, but the immunoregulatory activity of interferon gamma is coordinating immune response and is determining to play more in the long-term antiviral state of body Important effect, therefore interferon gamma has particularly important clinical value.

Interferon-tau (interferon tau, IFN- τ) is initially referred to as trophoblast protein, the one kind secreted by trophoderm New I type IFN, it is the conceptus signal of ruminant maternal gestational identification, is played during corpus luteum is maintained and gestation is established Important biological function.Interferon-tau has the denominator of interferon type Ⅰ:With antiviral, anti-cell proliferation, immune tune The functions such as section.IFN- τ have own characteristic in terms of biological function, and it is only expressed in embryonic feeder confluent monolayer cells, without virus Induction, and the cytotoxicity less than IFN-α or IFN-β.Based on its distinctive biological activity and low cytotoxicity, to be permitted The treatment of more diseases brings new hope.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, the layer only in molecular weight Face upper part solves the problems, such as that interferon molecule amount is small and causes half-life short, while polyethylene glycol fused interferon cost is non- Chang Gao, it is unfavorable for clinically applying in domestic animal.

The content of the invention

In order to solve the above technical problems, the invention provides one kind restructuring sheep long-acting interferon τ and prepare this long-acting interference Fusion protein of element and preparation method thereof, the restructuring sheep long-acting interferon is remarkably improved the half-life period of sheep interferon, more general The half-life period of logical sheep interferon improves more than 10 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of sheep interferon gamma and sheep interferon-tau, the amino acid sequence table of the fusion protein As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of SEQUENCE LISTING400 ＜ 3, it is designated as genome 2.

Fusion protein described in 2 equal codified of the genome 1 and the genome.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after result, be considered as the gene in the expression system during usual codon adaptation indexI CAI=1.0 In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection The codon of existing sheep IFN-γ and IFN- τ original genes codon adaptation indexI (CAI) in Escherichia coli is respectively 0.25, 0.27, GC percentage is 40.9%, 54.4%；And by existing to obtaining recombination after sheep IFN-γ and IFN- τ gene optimizations Codon adaptation indexI (CAI) is 1.0,1.0, GC percentages 44.1%, 53.1% in Escherichia coli.It is notable by gene optimization The utilization rate of low codon is reduced, influence of the rare codon to protein expression is avoided, improves the G/C content of gene, carry High transcription and translation efficiency.

The present invention also provides the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIFN γ-IFN τ.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers one kind to recombinate sheep long-acting interferon τ, and the restructuring sheep long-acting interferon τ is by described fusion It is freeze-dried to form after albumen and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, the final concentration of three For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, fusion protein is can obtain after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIFN γ-IFN τ, and its preparation method is：

(1) primer is designed, is obtained by reverse transcription or the sheep interferon of the flexible linker sequences of artificial synthesized connection γ and sheep interferon-tau target gene；Sheep interferon gamma has been connected with the target gene of sheep interferon-tau by flexible linker Come, the nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE LISTING Shown in the ＞ of 400 ＜ 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIFN γ-IFNτ。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F1：CCGGAATTCATGAAATACACAAGCTC, with EcoRI restriction enzyme sites；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCCATTGATGCTCTCCG, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCCTTCGTGC, with flexible linker；

Downstream IFN- τ-R1：CCCTCGAGTCAAGGTGAGTTC, with XhoI restriction enzyme sites；

B. RNA is extracted from sheep liver, IFN-γ and IFN- τ target gene, both genes are obtained by reverse transcription Sequence is respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞ and SEQUENCE LISTING 5；

Respectively using IFN-γ and IFN- τ target gene as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN- τ is drawn Thing enters performing PCR amplification, respectively obtains the target gene of the IFN-γ and IFN- τ that connect flexible linker.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN- τ genes are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IFN-γ template DNA 1, connect the flexible linker μ L of IFN-α template DNA I 1, IFN-γ sense primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of τ anti-sense primers 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F2：CGGGATCCATGAAATACACCTCTTCT, with BamHI restriction enzyme sites；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCCATAGAAGCACGACG；With flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCTTTCGTTCTG, with flexible linker；

Downstream IFN- τ-R2：CCCTCGAGTTACGGAGAGTTC, with XhoI restriction enzyme sites；

B. the target gene of IFN-γ and the IFN- τ, both gene orders are respectively such as SEQUENCE LISTING Shown in the ＞ of 400 ＜, 6 ＞ and SEQUENCE LISTING, 400 ＜ 7；

Respectively using IFN-γ and IFN- τ target gene as template, and the upstream and downstream for being utilized respectively IFN-γ and IFN- τ is drawn Thing enters performing PCR amplification.Respectively obtain the target gene of IFN-γ and IFN- τ after the optimization for connecting flexible linker.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.0, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene and IFN- τ genes are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IFN-γ template DNA 1, connect the flexible linker μ L of IFN-α template DNA 1, IFN-γ sense primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of τ anti-sense primers 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Present invention also offers the application of the restructuring sheep long-acting interferon τ, its long half time had up to more than 41 hours Broad-spectrum disease resistance toxic action and the immune response that sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep interferon gamma and sheep interferon-tau gene are realized into fusion by flexible linker, improve interferon and partly decline Phase, compared with plain interferon, improve more than 10 times；

2. by being optimized to sheep interferon gamma and sheep interferon-tau gene, improve interferon gamma and sheep interferon-tau melts The expression quantity of hop protein；

3. using recombination bacillus coli BL21/pET-32a-IFN γ-IFN τ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, inclusion body is not produced in protein expression, form soluble protein, avoid the mistake of inclusion body denaturation and renaturation Journey, substantially reduce the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of sheep interferon gamma and sheep interferon-tau not only has interferon-tau Broad-spectrum disease resistance toxic action, while significantly improve the immune response of sheep itself.

Brief description of the drawings

Fig. 1 is sheep Interferon-gamma gene and the result of sheep interferon-tau gene RT-PCR amplifications in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Sheep Interferon-gamma gene RT-PCR amplified productions；Swimming lane 2：Sheep interferon-tau gene RT- Pcr amplification product；

Fig. 2 is the result of the PCR amplifications after the sheep IFN-γ in embodiment 1 connects with sheep IFN- τ target gene；Swimming Road M：DNA Marker DL2000；Swimming lane 1：Sheep Interferon-gamma gene and sheep interferon-tau gene ligation amplification product；

Fig. 3 is PCR amplifications and the double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium compares；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is to recombinate sheep long-acting interferon τ as made from the fusion protein in embodiment 1 in embodiment 5 to cause cell to VSV The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 is that the restructuring sheep long-acting interferon τ of gradient dilution (from right to left) handles hole；

Fig. 7 is to recombinate sheep long-acting interferon τ intramuscular injection blood in embodiment 8 as made from the fusion protein in embodiment 1 Concentration-time changing curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of sheep interferon gamma and sheep interferon-tau, its preparation method are as follows：

1. the acquisition and amplification of sheep interferon gamma (IFN-γ) and sheep interferon-tau (IFN- τ) target gene

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upper of sheep interferon gamma Trip primer and anti-sense primer in introduce EcoRI restriction enzyme sites and Linker sequences respectively, sheep interferon-tau sense primer and under Linker sequences and XhoI restriction enzyme sites are introduced respectively in trip primer.

Table 1PCR amplimers

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, IFN-γ and IFN- τ target gene, both bases are obtained by reverse transcription Because sequence is respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING, 4 ＞ and SEQUENCE LISTING400 ＜ 5；

RT-PCR reaction systems (25 μ L) are shown in Table 2

Table 2RT-PCR reaction systems

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 620bp or so in RT-PCR amplified productions, and its result is such as Shown in Fig. 1, illustrate that the target gene that the dog interferon γ for being connected to flexible linker has successfully been prepared disturbs with dog Plain τ target gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

Table 3PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1110bp or so in pcr amplification product, its result as shown in Fig. 2 The nucleotide sequence of obtained target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2.

3. expression vector establishment

The PCR glue reclaims product for selecting the target gene after connection errorless after sequencing uses with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 4：

The double digestion system of table 4

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recovery fragment	2uL
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through EcoRI and XhoI double digestions, be accredited as positive and represent expression vector establishment success, obtain engineering bacteria pET-32a/ rIFNγ-IFNτ；PCR is expanded and double digestion product single band occurs through agarose gel electrophoresis at 1110bp or so places, its As a result it is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN τ shakes for 37 DEG C in the LB culture mediums of the μ g/ml containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity, in LB culture mediums (the μ g/ml containing ampicillin 100) after amplification culture 4h, survey OD values and reach When 1.0；Add IPTG, 32 DEG C of induced expression (the μ g/ml of final concentration 100) 5h；Bacterium is collected, is examined through SDS-PAGE electrophoresis Survey, supernatant is deposited in the visible predominant expression band in 59.1KD or so places, its result after the bacterial cell disruption after recombinant bacterium induction 5h As shown in figure 4, it can be seen that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in 59.1KD or so places can See predominant expression band, illustrate precipitating with equal successful expression in supernatant fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns that have been balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN tau proteins peak.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, DEAE anion exchange chromatography that loading has balanced by using Binding Buffer II, then After crossing post to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN tau proteins peak.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, with Binding Buffer III elution, collects rIFN γ-IFN τ protein peak

5.4 sample identification：Determine rIFN γ-IFN τ potency and specific activity, specific activity >=1.0 × 10⁶IU/mg albumen is conjunction Lattice；It is aseptic subpackaged, -80 DEG C of preservations.The i.e. available fusion protein being made up of sheep interferon gamma and sheep interferon-tau, its amino acid Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of sheep interferon gamma and sheep interferon-tau, other, simply will be therein with embodiment 1 E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results of albumen compare with embodiment 1, and 59KD or so places predominant expression band is thicker in supernatant, and explanation is drawn After entering molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Escherichia coli The albumen of expression is mostly present in inclusion body；By introducing molecular chaperones in bacterial strain is expressed, coordinate expression albumen is correct Fold, reach solubility expression of protein.

Embodiment 3

IFN-γ in embodiment 1 and IFN- τ are optimized, artificial synthesized IFN-γ and IFN- τ target gene, optimized Afterwards, both nucleotide sequences are respectively such as the ＞ institutes of 400 ＜ of SEQUENCE LISTING 400 ＜, 6 ＞ and SEQUENCE LISTING 7 Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IFN-γ and IFN- of sheep in the present embodiment τ gene codons optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered as the gene during usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, it can influence translation and transcriptional efficiency more than the scope in any region.Using software detection find sheep IFN-γ and The codon of IFN- τ original genes codon adaptation indexI (CAI) in Escherichia coli is respectively 0.25,0.27, GC percentages For 40.9%, 54.4%；And by obtaining recombination password in Escherichia coli after sheep IFN-γ and IFN- τ gene optimizations Sub- adaptation index (CAI) is 1.0,1.0, GC percentages 44.1%, 53.1%.Low codon is significantly reduced by gene optimization Utilization rate, avoid influence of the rare codon to protein expression, improve the G/C content of gene, improve transcription and translation effect Rate.

1.3 design of primers：

Table 6PCR amplimers

The genomic DNA of IFN-γ after optimization and IFN- τ is diluted to 0.05mg/mL respectively.Expanded and obtained using PCR Target gene, 25 μ L reaction systems are as shown in table 7：

Table 7PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 620bp or so in pcr amplification product, and explanation is prepared into To the target gene for being connected to the IFN-γ after flexible linker optimization and IFN- τ.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 8：

Table 8PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1110bp or so in pcr amplification product, illustrates successfully to obtain IFN-γ connected with IFN- τ after target gene.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING Shown in the ＞ of 400 ＜ 3.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 9：

The double digestion system of table 9

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through BamHI, XhoI double digestion, be accredited as positive and represent expression vector establishment success, obtain engineering bacteria pET-32a/ rIFNγ-IFNτ；PCR is expanded and double digestion product single band occurs through agarose gel electrophoresis at 1110bp or so places, is said It is bright connected containing IFN-γ with IFN- τ after target gene expression vector establishment success.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN τ shakes for 37 DEG C in the LB culture mediums of the μ g/ml containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity, in LB culture mediums (the μ g/ml containing ampicillin 100) after amplification culture 4h, survey OD values and reach When 1.0；Add IPTG, 32 DEG C of induced expression (the μ g/ml of final concentration 100) 5h；Bacterium is collected, is examined through SDS-PAGE electrophoresis Survey, supernatant is deposited in the visible predominant expression band in 59.1KD or so places after the bacterial cell disruption after recombinant bacterium induction 5h, illustrates Recombinant protein has been obtained in supernatant precipitation.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns that have been balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIFN γ-IFN τ protein peak.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, DEAE anion exchange chromatography that loading has balanced by using Binding Buffer II, then After crossing post to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIFN γ-IFN τ protein peak.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, with Binding Buffer III elution, collects rIFN γ-IFN τ protein peak.

5.4 sample identification

Determine rIFN γ-IFN τ potency and specific activity, specific activity >=1 × 10⁶IU/mg albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.The i.e. available fusion protein being made up of sheep interferon gamma and sheep interferon-tau, its amino acid sequence such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 1.

Embodiment 4

A kind of fusion protein being made up of sheep interferon gamma and sheep interferon-tau, other, simply will be therein with embodiment 3 E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results of albumen compare with embodiment 3, and 59.1KD or so places predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in bacterial strain is expressed, coordinate expression albumen is just Really fold, reach solubility expression of protein.

Embodiment 5

One kind restructuring sheep long-acting interferon τ, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 obtains the identification for the fusion protein being made up of sheep interferon gamma and sheep interferon-tau

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, determines embodiment 1~4 obtained fusion protein concentration is all higher than 1.2mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 59.1KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-sheep τ interferon (1 of abcam companies mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinating sheep long-acting interferon τ samples can be with anti-sheep interferon τ monoclonal antibodies occur specific reaction, 59.1KD or so place and specific band occur, as shown in Figure 5.

Embodiment 7

Four parts in embodiment 5 recombinate the freeze-dried bioactivities of sheep long-acting interferon τ

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, adds the restructuring sheep length of various dose Interferon-tau is imitated, inhales and abandons after 24h, then is inoculated with 100TCID50VSV viruses respectively.

Result of the test

As a result the restructuring sheep long-acting interferon τ for showing to obtain causes the lesion of HEp-2 cells to have obvious suppress to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the restructuring sheep length obtained After imitating the cell virus inoculation after interferon-tau processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=1.0 × 10⁶IU/ml, as shown in Figure 6.

Embodiment 8

Recombinate the measure of half-life period of the sheep long-acting interferon τ in sheep body

The four parts of restructuring sheep long-acting interferon τ obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed The measure of half-life period of the agent (being designated as A, B, C, D respectively) in sheep body

The blood concentration and time relationship of cytopathic-effect inhibition assay measure rIFN γ-IFN τ

The sheep (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml restructuring sheep long-acting interferons τ is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 24h, 48h, 72h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm low temperature from Heart 10min separates serum, and each every sheep blood sample of time point is to be measured in -20 DEG C of preservations.Serum sample is determined using cytopathic-effect inhibition assay The concentration of rIFN γ-IFN τ in product, carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.A matched curve such as Fig. 7 It is shown；Parameter result of calculation is shown in Table 11.

Dominant dynamic parameters in serum after the restructuring sheep long-acting interferon τ intramuscular injection of table 11

As a result show that recombinating sheep long-acting interferon τ has longer half-life period.Half-life period can reach 41h or so after measured, compared with Plain interferon improves about 10 times.

Embodiment 9

Four parts of freeze-dried measure influenceed on sheep cellullar immunologic response of restructuring sheep long-acting interferon τ in embodiment 5

Take six roughly the same young sheeps of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml restructuring sheep long-acting interferon freeze-dried 2ml of τ are penetrated, 2mL PBS is subcutaneously injected in control group neck, takes after injecting 4 weeks outside sheep All blood, take a blood weekly afterwards, separate lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI After 1640 culture mediums wash 2 times, it is resuspended with complete medium, adjusts cell concentration as 2 × 10⁶Individual/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out, testing result is as shown in table 12 by kit specification：

Table 12ELISA detection each group sheep cellullar immunologic responses are horizontal

As a result after showing injection restructuring sheep long-acting interferon τ, can significantly improve sheep Evaluation of Cytokines in Peripheral Blood IL-2, IL-4 content, cellullar immunologic response level is enhanced, significantly improves immunity level.

It is above-mentioned to restructuring sheep long-acting interferon τ and to prepare fusion protein and its preparation of this long-acting interferon with reference to embodiment The detailed description that method is carried out, is illustrative rather than limited, can include several implementations according to limited scope Example, therefore changing and modifications in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of restructuring sheep long-acting interferon τ and prepare fusion protein of this long-acting interferon and preparation method thereof

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 371

<212> PRT

<213>Recombinate sheep long-acting interferon τ fusion proteins

<400> 1

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

165 170 175

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

180 185 190

Gly Pro Gly Gly Ser Leu Gly Cys Tyr Leu Ser Gln Arg Leu Met Leu

195 200 205

Asp Ala Arg Glu Asn Leu Lys Leu Leu Asp Arg Met Asn Arg Leu Ser

210 215 220

Pro His Ser Cys Leu Gln Asp Arg Lys Asp Phe Gly Leu Pro Gln Glu

225 230 235 240

Met Val Glu Gly Asp Gln Leu Gln Lys Asp Gln Ala Phe Pro Val Leu

245 250 255

Tyr Glu Met Leu Gln Gln Ser Phe Asn Leu Phe Tyr Thr Glu His Ser

260 265 270

Ser Ala Ala Trp Asp Thr Thr Leu Leu Asp Gln Leu Cys Thr Gly Leu

275 280 285

Gln Gln Gln Leu Asp His Leu Asp Thr Cys Arg Asp Gln Val Met Gly

290 295 300

Glu Lys Asp Ser Glu Leu Gly Asn Met Asp Pro Ile Val Thr Val Lys

305 310 315 320

Lys Tyr Phe Gln Gly Ile His Asp Tyr Leu Gln Glu Lys Gly Tyr Ser

325 330 335

Asp Cys Ala Trp Glu Ile Val Arg Val Glu Met Met Arg Ala Leu Thr

340 345 350

Val Ser Thr Thr Leu Gln Lys Arg Leu Thr Lys Met Gly Gly Asp Leu

355 360 365

Asn Ser Pro

370

<210> 2

<211> 1116

<212> DNA

<213>Recombinate sheep long-acting interferon τ genomes 1

<400> 2

atgaaataca caagctcctt cttagcttta ctgctctgtg tgcttttggg tttttctggt 60

tcttatggcc agggcccatt ttttaaagaa atagaaaact taaaggagta ttttaatgca 120

agtaacccag atgtagctaa gggtgggcct cttttctcag aaattttgaa gaattggaaa 180

gaggagagtg acaaaaagat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaacgg cagctctgag aaactggagg acttcaaaag gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccatca atgaactcat caaggtgatg 420

aatgacctgt cgccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaatggg tggtggtggt tctggtggtg gtggttctat ggccttcgtg 540

ctctctctac tgatggccct ggtgctggtc agctatggcc caggaggatc tctgggttgt 600

tacctatctc agagactcat gctggatgcc agggagaacc tcaagctcct ggaccgaatg 660

aacagactct cccctcattc ctgtctgcag gacagaaaag actttggtct tccccaggag 720

atggtggagg gcgaccagct ccagaaggac caggccttcc ctgtgctcta cgagatgctc 780

cagcagagct tcaacctctt ctacacagag cactcctctg ctgcctggga caccaccctc 840

ctggaccagc tctgcactgg actccaacag cagctggacc acctggacac ctgcagggat 900

caagtgatgg gagagaaaga ctctgaactg ggtaacatgg accccattgt gaccgtgaag 960

aagtacttcc agggcatcca tgactacctg caagagaagg gatacagcga ctgcgcctgg 1020

gaaatcgtca gagtcgagat gatgagagcc ctcactgtat caaccacctt gcaaaaaagg 1080

ttaacaaaga tgggtggaga tctgaactca ccttga 1116

<210> 3

<211> 1116

<212> DNA

<213>Recombinate sheep long-acting interferon τ genomes 2

<400> 3

atgaaataca cctcttcttt cctggctctg ctgctgtgcg ttctgctggg tttctctggt 60

tcttacggtc agggtccgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaacg tctgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctatggg tggtggtggt tctggtggtg gtggttctat ggctttcgtt 540

ctgtctctgc tgatggctct ggttctggtt tcttacggtc cgggtggttc tctgggttgc 600

tacctgtctc agcgtctgat gctggacgct cgtgaaaacc tgaaactgct ggaccgtatg 660

aaccgtctgt ctccgcactc ttgcctgcag gaccgtaaag acttcggtct gccgcaggaa 720

atggttgaag gtgaccagct gcagaaagac caggctttcc cggttctgta cgaaatgctg 780

cagcagtctt tcaacctgtt ctacaccgaa cactcttctg ctgcttggga caccaccctg 840

ctggaccagc tgtgcaccgg tctgcagcag cagctggacc acctggacac ctgccgtgac 900

caggttatgg gtgaaaaaga ctctgaactg ggtaacatgg acccgatcgt taccgttaaa 960

aaatacttcc agggtatcca cgactacctg caggaaaaag gttactctga ctgcgcttgg 1020

gaaatcgttc gtgttgaaat gatgcgtgct ctgaccgttt ctaccaccct gcagaaacgt 1080

ctgaccaaaa tgggtggtga cctgaactct ccgtaa 1116

<210> 4

<211> 498

<212> DNA

<213>Sheep interferon gamma

<400> 4

atgaaataca caagctcctt cttagcttta ctgctctgtg tgcttttggg tttttctggt 60

tcttatggcc agggcccatt ttttaaagaa atagaaaact taaaggagta ttttaatgca 120

agtaacccag atgtagctaa gggtgggcct cttttctcag aaattttgaa gaattggaaa 180

gaggagagtg acaaaaagat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaacgg cagctctgag aaactggagg acttcaaaag gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccatca atgaactcat caaggtgatg 420

aatgacctgt cgccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaatg 498

<210> 5

<211> 588

<212> DNA

<213>Sheep interferon-tau

<400> 5

atggccttcg tgctctctct actgatggcc ctggtgctgg tcagctatgg cccaggagga 60

tctctgggtt gttacctatc tcagagactc atgctggatg ccagggagaa cctcaagctc 120

ctggaccgaa tgaacagact ctcccctcat tcctgtctgc aggacagaaa agactttggt 180

cttccccagg agatggtgga gggcgaccag ctccagaagg accaggcctt ccctgtgctc 240

tacgagatgc tccagcagag cttcaacctc ttctacacag agcactcctc tgctgcctgg 300

gacaccaccc tcctggacca gctctgcact ggactccaac agcagctgga ccacctggac 360

acctgcaggg atcaagtgat gggagagaaa gactctgaac tgggtaacat ggaccccatt 420

gtgaccgtga agaagtactt ccagggcatc catgactacc tgcaagagaa gggatacagc 480

gactgcgcct gggaaatcgt cagagtcgag atgatgagag ccctcactgt atcaaccacc 540

ttgcaaaaaa ggttaacaaa gatgggtgga gatctgaact caccttga 588

<210> 6

<211> 498

<212> DNA

<213>Sheep interferon gamma

<400> 6

atgaaataca cctcttcttt cctggctctg ctgctgtgcg ttctgctggg tttctctggt 60

tcttacggtc agggtccgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaacg tctgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctatg 498

<210> 7

<211> 588

<212> DNA

<213>Sheep interferon-tau

<400> 7

atggctttcg ttctgtctct gctgatggct ctggttctgg tttcttacgg tccgggtggt 60

tctctgggtt gctacctgtc tcagcgtctg atgctggacg ctcgtgaaaa cctgaaactg 120

ctggaccgta tgaaccgtct gtctccgcac tcttgcctgc aggaccgtaa agacttcggt 180

ctgccgcagg aaatggttga aggtgaccag ctgcagaaag accaggcttt cccggttctg 240

tacgaaatgc tgcagcagtc tttcaacctg ttctacaccg aacactcttc tgctgcttgg 300

gacaccaccc tgctggacca gctgtgcacc ggtctgcagc agcagctgga ccacctggac 360

acctgccgtg accaggttat gggtgaaaaa gactctgaac tgggtaacat ggacccgatc 420

gttaccgtta aaaaatactt ccagggtatc cacgactacc tgcaggaaaa aggttactct 480

gactgcgctt gggaaatcgt tcgtgttgaa atgatgcgtg ctctgaccgt ttctaccacc 540

ctgcagaaac gtctgaccaa aatgggtggt gacctgaact ctccgtaa 588

Claims

A kind of 1. fusion protein being made up of sheep interferon gamma and sheep interferon-tau, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
A kind of 2. gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, It is designated as genome 2.
3. the expression vector containing gene as claimed in claim 2.
4. the genetic engineering bacterium containing gene as claimed in claim 2.
5. one kind restructuring sheep long-acting interferon τ, it is characterised in that the restructuring sheep long-acting interferon τ is as described in claim 1 It is freeze-dried to form after fusion protein and freeze drying protectant mixture.
6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, and fusion protein is can obtain after purified.
7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium be pET-32a/rIFN γ- IFN τ, its preparation method are：

(1) design primer, obtained by reverse transcription or the sheep interferon gamma of the flexible linker sequences of artificial synthesized connection and The target gene of sheep interferon-tau；The target gene of sheep interferon gamma and sheep interferon-tau is connected by flexible linker, The nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE LISTING 400 Shown in the ＞ of ＜ 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/r IFN γs- IFNτ。
8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.
9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Product successively purify through affinity chromatography, anion-exchange chromatography and sieve chromatography.
10. restructuring sheep long-acting interferon τ according to claim 5 application, it is characterised in that the restructuring sheep is long-acting dry Plain τ long half time is disturbed up to more than 41 hours, there is broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.