CN108864298A

CN108864298A - A kind of canine recombinant long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof

Info

Publication number: CN108864298A
Application number: CN201810725701.XA
Authority: CN
Inventors: 周炜; 赵雨; 夏兵兵; 徐慕珍; 付超; 杨建伟; 徐文俊; 单雪芹
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-04
Publication date: 2018-11-23
Also published as: CN107337738A

Abstract

The invention discloses a kind of canine recombinant long-acting interferon and the fusion proteins for preparing this long-acting interferon and preparation method thereof; the fusion protein is connected through flexible linker by canine leucocyte interleukin 2 and dog interferon alpha and is formed, and Hu Jing is freeze-dried to obtain canine recombinant long-acting interferon after fusion protein and freeze drying protectant mixture.The canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, and the half-life period of more common dog interferon improves 10 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of dog itself.

Description

A kind of canine recombinant long-acting interferon and prepare this long-acting interferon fusion protein and its Preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of canine recombinant long-acting interferon and prepare this length Imitate the fusion protein and preparation method thereof of interferon.

Background technique

It is analyzed according to Chinese pet Industry, the market scale by the end of 2014 year end China pet industries has reached 105800000000 RMB, and Chinese Medical pet industry only accounts for about 20% at present, the city of the U.S. for the pet industry relative maturity that compares , the output value ratio of Medical pet reaches 50%, and there are huge development spaces for Chinese Medical pet industry.

Dog is the friend of mankind's loyalty, with increasing considerably for the canines feeding quantity such as domestic pet dog, canine disease The continuous raising of disease incidence, the death rate causes spirit and double loss economically to the mankind.Dog is led with mankind's intimate contact It causes the mankind high by the probability of dog virus infection, such as rabies viruses, canine parvovirus and canine distemper virus, can all give the mankind Health care belt greatly threatens.

Report interferon is studied as a kind of important cell factor, to canine distemper, canine parvovirus according to related science Certain curative effect is all had in the treatments of diseases such as disease, canine infectious hepatitis and canine coronavirus disease.Therefore actively research interference Effect of the element in canine viral disease treatment has broad application prospects.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor In conjunction with rear, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation disease Malicious RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.According to the generation cell of IFN, biochemical character and The difference to be played a role in terms of immunity of organism is divided into α, β, γ three classes.Now it is known that α type IFN in vivo can be selective Ground acts on the infection cells such as virus, by inhibiting the biosynthesis of the virus protein in infected cell, plays wide spectrum and height Imitate antivirus action.

IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly had by what the T lymphocyte activated generated The cell factor of extensive bioactivity, can both promote lymphopoiesis, enhance immune function, and can restricted T cells reaction And enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In medical domain The recombinant human il-2 of upper commercialization has been used to the treatment of the diseases such as tumour, AIDS, hepatitis B.In animal doctor, due to IL-2 can improve the immune response of vaccine and reduce the generation of disease, wide application prospect also occur.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience to treatment, the increase for the treatment of number of times, corresponding time cost and it is economical at This increases therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main original of half-life short Because there are two：The too small tachytrophism in vivo of the molecular weight of interferon, the interferon especially poor quilt of recombinant interferon affinity Immune system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in molecular weight Partially solve the problems, such as that interferon molecule amount is small and leads to half-life short in level, at the same polyethylene glycol fused interferon at This is very high, is unfavorable for clinically applying in poultry.

Summary of the invention

In order to solve the above technical problems, the present invention provides a kind of canine recombinant long-acting interferon and preparing this long-acting interferon Fusion protein and preparation method thereof, the canine recombinant long-acting interferon is remarkably improved the half-life period of dog interferon, more commonly The half-life period of dog interferon improves 10 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of dog itself.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha, the amino acid sequence of the fusion protein Table is as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system It is optimal high efficient expression state in system, CAI value is lower to show that expression is lower in host.G/C content is most managed in gene Think that distribution is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is examined using software Surveying the codon for finding dog IL-2 and IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19,0.27, GC percentage is 39.6%, 59.7%；And by obtained after dog IL-2 and IFN-α gene optimization recombination base Because codon adaptation indexI (CAI) is 1.0,1.0, GC percentage 48.8%, 55.6% to genome 2 in Escherichia coli.Pass through Gene optimization significantly reduces the utilization rate of low codon, avoids influence of the rare codon to protein expression, improves base The G/C content of cause improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN α.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is that BL21 (DE3) competence is thin Born of the same parents or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of canine recombinant long-acting interferon, the canine recombinant long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN α, and preparation method is：

(1) design primer, is obtained or the canine leucocyte of the flexible linker sequence of artificial synthesized connection by reverse transcription The target gene of interleukin 2 and dog interferon alpha；By flexible linker by the purpose base of canine leucocyte interleukin 2 and dog interferon alpha Because connecting, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE Shown in 400 < of LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2- can be obtained IFNα。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of canine leucocyte interleukin 2 (IL-2) is：

Upstream IL-2-F1：CGGGATCCATGTACAAAATGCAACTC has BamHI restriction enzyme site；

Downstream IL-2-R1：

ACCACCACCAGAACCACCACCACCAGTCAGTGTTGAGAAG, with flexible linker；

The primer sequence of dog interferon alpha (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCCCTGCCC, with flexible linker；

Downstream IFN-α-R1：

CCCTCGAGTTTCCTCCTCCTTACT has XhoI restriction enzyme site；

B. RNA is extracted from dog liver, the target gene of IL-2 and IFN-α, the gene sequence of the two is obtained by reverse transcription Column are respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

Respectively using IL-2 and the target gene of IFN-α as template, and be utilized respectively the upstream and downstream primer of IL-2 and IFN-α into Row PCR amplification respectively obtains and connects the IL-2 of flexible linker and the target gene of IFN-α.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. IL-2 gene and IFN-α gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 template DNA, connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, under IFN-α Trip 0.5 μ L, Taq archaeal dna polymerase of primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；It is anti-to connect PCR The condition is answered to be：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of canine leucocyte interleukin 2 (IL-2) is：

Upstream IL-2-F2：CGGGATCCATGTACAAAATGCAGC has BamHI restriction enzyme site；

Downstream IL-2-R2：

ACCACCACCAGAACCACCACCACCGGTCAGGGTAGAGAA, with flexible linker；

The primer sequence of dog interferon alpha (IFN-α) is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGGCTCTGCCGT, with flexible linker；

Downstream IFN-α-R2：

CCCTCGAGTTTACGACGACGAAC has XhoI restriction enzyme site；

B. the target gene of the IL-2 and IFN-α, the gene order of the two is respectively such as SEQUENCE LISTING 400 Shown in 6 > and SEQUENCE LISTING of <, 400 <, 7 >；

Respectively using IL-2 and the target gene of IFN-α as template, and be utilized respectively the upstream and downstream primer of IL-2 and IFN-α into Row PCR amplification, the target gene of IL-2 and IFN-α after respectively obtaining the optimization for connecting flexible linker.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq DNA polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition be：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45S, 60 DEG C of annealing 45S, 72 DEG C of extension 1kb/ Min is recycled 35 times, last 72 DEG C of extensions 10min.

C. IL-2 gene and IFN-α gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 template DNA, connects 1 μ L, IL-2 upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, under IFN-α Trip 0.5 μ L, Taq archaeal dna polymerase of primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；It is anti-to connect PCR The condition is answered to be：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the canine recombinant long-acting interferon, long half time had up to 43 hours or more Broad-spectrum disease resistance toxic action and the immune response that dog itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. dog IL-2 and dog interferon alpha gene are realized fusion by flexibility linker, interferon half-life period is improved, with Plain interferon is compared, and improves 10 times or more；Compared with common polyethylene glycol fused interferon, cost is significantly reduced.

2. improving dog IL-2 and dog interferon alpha fusion protein by optimizing to dog IL-2 and dog interferon alpha gene Expression quantity.

3. using recombination bacillus coli BL21/pET-32a-IL2-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid does not generate inclusion body in protein expression, forms soluble protein, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the wide spectrum that the fusion protein disclosed by the invention being made of dog IL-2 and dog interferon alpha not only has interferon-' alpha ' Antivirus action, while significantly improving the immune response of dog itself.

Detailed description of the invention

Fig. 1 is the result of 2 gene of canine leucocyte interleukin and dog interferon alpha gene RT-PCR amplification in embodiment 1；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Dog interleukin-22 RT-PCR amplified production；Swimming lane 2：Dog interferon alpha gene RT- Pcr amplification product；

Fig. 2 is the result of the PCR amplification after the dog IL-2 in embodiment 1 is connected with the target gene of dog IFN-α；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Dog interferon alpha gene and dog interleukin-22 gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium control；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Empty bacterium control；Swimming lane 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the canine recombinant long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant long-acting dog interferon alpha of gradient dilution (from right to left) handles hole；

Fig. 7 is the canine recombinant long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve；

Specific embodiment

Embodiment 1

A kind of fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha, preparation method are as follows：

1. the acquisition and amplification of canine leucocyte interleukin 2 (IL-2) and dog interferon alpha (IFN-α) target gene

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of dog interleukin-22 BamHI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, dog interferon alpha upstream primer and under Linker sequence and XhoI restriction enzyme site are introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from dog liver organization, the target gene of IL-2 and IFN-α, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 490bp and 590bp or so through agarose gel electrophoresis in RT-PCR amplified production, and result is such as Shown in Fig. 1, illustrate to have respectively obtained the dog IL-2 of the flexible linker of connection and the target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

3 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1050bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs the band of dog interleukin-22 amplified production and dog interferon alpha amplified production in Fig. 2, this is because in dog interleukin-22 base During cause is connected with dog interferon alpha gene, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

The PCR glue recovery product for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Target fragment DNA	10μL
		Expression vector	3μL
Buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony mycoplasma through PCR Grain identifies that being accredited as positive indicates expression vector establishment success through BamHI and XhoI double digestion, obtain engineering bacteria pET- There is single band at the place 1050bp or so through agarose gel electrophoresis in 32a/rIL2-IFN α PCR amplification and double enzyme digestion product, Its result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN α shakes bacterium for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin 1h recovery engineering bacteria activity；In LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h, surveys OD value and reach When 1.0；IPTG, 32 DEG C of inducing expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis Survey, result as shown in figure 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in Visible predominant expression band at 56.8KD illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN α protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino of Elution Buffer II Methane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN α protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, uses Binding Buffer III is eluted, and collects rIL2-IFN α protein peak.

5.4 sample identification

Measure rIL2-IFN α potency and specific activity, specific activity >=1.0 × 10⁵U/mg albumen is qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha, other, only will wherein with embodiment 1 E. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.It melts The SDS-PAGE electrophoresis result of hop protein is compareed with embodiment 1, and 56.8KD or so place's predominant expression band is thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in expression bacterial strain White correct folding, reaches solubility expression of protein.

Embodiment 3

To in embodiment 1 IL-2 and IFN-α optimize, artificial synthesized IL-2 and IFN-α target gene, after optimization, The nucleotide sequence of the two is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 6 > and SEQUENCE LISTING, 7 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or sharp With the low codon of rate (rare or low-usage codons).In fact, common every kind of life for doing protein expression or production Object (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows password to a certain degree The difference or preference that son utilizes.It is obviously high to the expression efficiency of the gene containing best codon in Escherichia coli, yeast and drosophila In the expression efficiency of the gene of the codon containing poor efficiency.Therefore, in heterologous expression system, the preferences of codon are very The expression of recombinant protein is affected in big degree.Using preference codon (preferred codons) and avoid using rare Codon carries out gene chemical synthesis, and the redesign of this gene is codon optimization.Therefore, in the present embodiment to the IL-2 of dog and IFN-α gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Using software detection discovery dog IL-2 and The codon of IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19,0.27, GC percentage It is 39.6%, 59.7%；And by obtaining recombination genome 2 in Escherichia coli after dog IL-2 and IFN-α gene optimization Middle codon adaptation indexI (CAI) is 1.0,1.0, GC percentage 48.8%, 55.6%.It is significantly reduced by gene optimization The utilization rate of low codon avoids influence of the rare codon to protein expression, improves the G/C content of gene, improve Transcription and translation efficiency, and then improve the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of IL-2 and IFN-α after optimization are diluted to 0.05mg/mL respectively.Mesh is obtained using PCR amplification Gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

IL-2 and the pcr amplification product of IFN-α occur in 490bp and 590bp or so special respectively through agarose gel electrophoresis Different band illustrates the target gene for having respectively obtained the dog IL-2 after the optimization of the flexible linker of connection and IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects target gene, 25 μ L reaction systems such as 8 institute of table using over-lap PCR Show：

8 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1050bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to have obtained IL- 2 connected with IFN-α after target gene.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 9：

9 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony mycoplasma through PCR Grain identifies that being accredited as positive indicates expression vector establishment success, and PCR amplification and double digestion are produced through BamHI, XhoI double digestion There is single band through agarose gel electrophoresis at 1050bp in object, illustrates the target gene after connecting containing IL-2 with IFN-α Expression vector establishment success, obtained engineering bacteria pET-32a/rIL2-IFN α.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN α shakes bacterium for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin 1h recovery engineering bacteria activity；In LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h, surveys OD value and reach When 1.0；IPTG, 32 DEG C of inducing expression (100 μ g/ml of final concentration) 5h is added；Bacterium is collected, is examined through SDS-PAGE electrophoresis It surveys, supernatant is deposited in the visible predominant expression band in the place 56.8KD or so after the bacterial cell disruption after recombinant bacterium induction 5h, illustrates Recombinant protein has been obtained in supernatant precipitating.

5. fusion protein purification

5.1His affinity chromatography

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

5.4 sample identification

Embodiment 4

A kind of fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha, other, only will wherein with embodiment 3 E. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.It melts The SDS-PAGE electrophoresis result of hop protein is compareed with embodiment 3, and 56.8KD or so place's predominant expression band is thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in expression bacterial strain White correct folding, reaches solubility expression of protein.

Embodiment 5

A kind of canine recombinant long-acting interferon α, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the identification for the fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is respectively 0.5mg/ml 0.5mg/ml, 0.6mg/ml, 0.6mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 56.8KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-canine interferon alpha (1 of abcam company mouse:5000 dilutions) For primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting dog interferon alpha sample can be with anti-dog Specific reaction occurs for interferon-' alpha ' monoclonal antibody, and specific band occurs in the place 56.8KD or so, as shown in Figure 5.

Embodiment 7

Four parts of canine recombinant long-acting interferon α in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant long-acting of various dose is added in culture Dog interferon alpha is inhaled afterwards abandon for 24 hours, then is inoculated with 100TCID respectively₅₀VSV virus.

Test result

The result shows that the canine recombinant long-acting interferon α obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the canine recombinant obtained is long After imitating interferon-' alpha ' treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=1 × 10⁵U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of canine recombinant long-acting interferon α that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in dog intracorporal half-life period

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rIL2-IFN α

The dog (half male and half female) that six weight are roughly the same is taken, 2mg/ml canine recombinant long-acting interferon α is subcutaneously injected in neck Freeze-dried 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 79h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm Low-temperature centrifugation 10min separates serum, and every dog blood sample of each time point is to be measured in -20 DEG C of preservations.It is measured using cytopathic-effect inhibition assay The concentration of rIL2-IFN α in blood serum sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.The matched curve of A See Fig. 7, each parameter calculated result is shown in Table 11.

Dominant dynamic parameters in serum after 11 canine recombinant long-acting interferon α intramuscular injection of table

The result shows that canine recombinant long-acting interferon α has longer half-life period.Half-life period can reach 43h or so after measured, compared with Plain interferon improves about 10 times.

Embodiment 9

The freeze-dried measurement that canine cells immune response is influenced of four parts of canine recombinant long-acting interferon α in embodiment 5

It takes six roughly the same dogs of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck The PBS of 2mL is subcutaneously injected in the 2mg/ml canine recombinant long-acting interferon freeze-dried 2ml of α, control group neck, after taking injection 4 weeks outside dog All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates Every hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detection culture IL-4, IFN-γ content in supernatant, are carried out by kit specification, and testing result is as shown in table 12：

It is horizontal that 12 ELISA of table detects each group canine cells immune response

The result shows that injection canine recombinant long-acting interferon α after, can significantly improve cell factor IL-4 in canine peripheral blood, The content of IFN-γ enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned to canine recombinant long-acting interferon and to prepare fusion protein and its preparation of this long-acting interferon referring to embodiment The detailed description that method carries out, is illustrative without being restrictive, can enumerate several implementations according to limited range Example, therefore the change and modification in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of canine recombinant long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 352

<212> PRT

<213>Canine recombinant long-acting interferon fusion protein

<400> 1

Met Tyr Lys Met Gln Leu Leu Ser Cys Ile Ala Leu Thr Leu Val Leu

1 5 10 15

Val Ala Asn Ser Ala Pro Ile Thr Ser Ser Ser Thr Lys Glu Thr Glu

20 25 30

Gln Gln Met Glu Gln Leu Leu Leu Asp Leu Gln Leu Leu Leu Asn Gly

35 40 45

Val Asn Asn Tyr Glu Asn Pro Gln Leu Ser Arg Met Leu Thr Phe Lys

50 55 60

Phe Tyr Thr Pro Lys Lys Ala Thr Glu Phe Thr His Leu Gln Cys Leu

65 70 75 80

Ala Glu Glu Leu Lys Asn Leu Glu Glu Val Leu Gly Leu Pro Gln Ser

85 90 95

Lys Asn Val His Leu Thr Asp Thr Lys Glu Leu Ile Ser Asn Met Asn

100 105 110

Val Thr Leu Leu Lys Leu Lys Gly Ser Glu Thr Ser Tyr Asn Cys Glu

115 120 125

Tyr Asp Asp Glu Thr Ala Thr Ile Thr Glu Phe Leu Asn Lys Trp Ile

130 135 140

Thr Phe Cys Gln Ser Ile Phe Ser Thr Leu Thr Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Gly Gly Ser Met Ala Leu Pro Cys Ser Phe Ser Val Ala Leu

165 170 175

Val Leu Leu Ser Cys His Ser Leu Cys Cys Leu Ala Cys Asp Leu Pro

180 185 190

Asp Thr His Ser Leu Arg Asn Trp Arg Val Leu Thr Leu Leu Gly Gln

195 200 205

Met Arg Arg Leu Ser Ala Ser Ser Cys Asp His Tyr Thr Thr Asp Phe

210 215 220

Ala Phe Pro Lys Glu Leu Phe Asp Gly Gln Arg Leu Gln Glu Ala Gln

225 230 235 240

Ala Leu Ser Val Val His Val Met Thr Gln Lys Val Phe His Leu Phe

245 250 255

Cys Thr Asn Met Ser Ser Ala Pro Trp Asn Met Thr Leu Leu Gly Glu

260 265 270

Leu Cys Ser Gly Leu Ser Glu Gln Leu Asp Asp Leu Asp Ala Cys Pro

275 280 285

Leu Gln Glu Ala Gly Leu Ala Glu Thr Pro Leu Met His Glu Asp Ser

290 295 300

Thr Leu Arg Thr Tyr Phe Gln Arg Ile Ser Leu Tyr Leu Gln Asp Arg

305 310 315 320

Asn His Ser Pro Cys Ala Trp Glu Met Val Arg Ala Glu Ile Gly Arg

325 330 335

Ser Phe Phe Ser Leu Thr Ile Leu Gln Glu Arg Val Arg Arg Arg Lys

340 345 350

<210> 2

<211> 1056

<212> DNA

<213>Long-acting dog interferon genome 1

<400> 2

atgtacaaaa tgcaactctt gtcttgcatc gcactgacgc ttgtacttgt cgcaaacagt 60

gcacctatta cttcaagctc tacaaaggaa acagagcaac agatggagca attactgctg 120

gatttacagt tgcttttgaa tggagttaat aattatgaga acccccaact ctccaggatg 180

ctcacattta agttttacac gcccaagaag gccacagaat ttacacacct tcaatgtcta 240

gcagaagaac tcaaaaacct ggaggaagtg ctaggtttac ctcaaagcaa aaacgttcac 300

ttgacagaca ccaaggaatt aatcagcaat atgaatgtaa cacttctgaa actaaaggga 360

tctgaaacaa gttacaactg tgaatatgat gacgagacag caaccattac agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc ttctcaacac tgactggtgg tggtggttct 480

ggtggtggtg gttctatggc cctgccctgc tccttctcgg tggccctggt gctgctcagc 540

tgccactccc tgtgctgtct ggcttgcgac ctgcccgaca cccacagcct gcgcaactgg 600

agggtcctga cgctcctggg acagatgagg agactctccg ccagctcttg tgaccactac 660

accactgact ttgccttccc caaggaactg tttgatggcc agcggctcca ggaggcgcaa 720

gccctctctg tggtccacgt gatgacccag aaggtcttcc acctcttctg cacgaacatg 780

tcctctgctc cttggaacat gaccctcctg ggggaattgt gctcggggct ctctgagcag 840

ctggatgacc tggatgcctg tcccctgcag gaggcagggc tggccgagac ccccctcatg 900

catgaagact ccaccctgag gacctacttc caaaggatct ccctctacct gcaagacagg 960

aaccacagcc cgtgtgcctg ggagatggtc cgagcagaaa tcgggagatc cttcttctcc 1020

ttgaccatct tgcaagaaag agtaaggagg aggaaa 1056

<210> 3

<211> 1056

<212> DNA

<213>Long-acting dog interferon genome 2

<400> 3

atgtacaaaa tgcagctgct gtcttgcatc gctctgaccc tggttctggt tgctaactct 60

gctccgatca cctcttcttc taccaaagaa accgaacagc agatggaaca gctgctgctg 120

gacctgcagc tgctgctgaa cggtgttaac aactacgaaa acccgcagct gtctcgtatg 180

ctgaccttca aattctacac cccgaaaaaa gctaccgaat tcacccacct gcagtgcctg 240

gctgaagaac tgaaaaacct ggaagaagtt ctgggtctgc cgcagtctaa aaacgttcac 300

ctgaccgaca ccaaagaact gatctctaac atgaacgtta ccctgctgaa actgaaaggt 360

tctgaaacct cttacaactg cgaatacgac gacgaaaccg ctaccatcac cgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc ttctctaccc tgaccggtgg tggtggttct 480

ggtggtggtg gttctatggc tctgccgtgc tctttctctg ttgctctggt tctgctgtct 540

tgccactctc tgtgctgcct ggcttgcgac ctgccggaca cccactctct gcgtaactgg 600

cgtgttctga ccctgctggg tcagatgcgt cgtctgtctg cttcttcttg cgaccactac 660

accaccgact tcgctttccc gaaagaactg ttcgacggtc agcgtctgca ggaagctcag 720

gctctgtctg ttgttcacgt tatgacccag aaagttttcc acctgttctg caccaacatg 780

tcttctgctc cgtggaacat gaccctgctg ggtgaactgt gctctggtct gtctgaacag 840

ctggacgacc tggacgcttg cccgctgcag gaagctggtc tggctgaaac cccgctgatg 900

cacgaagact ctaccctgcg tacctacttc cagcgtatct ctctgtacct gcaggaccgt 960

aaccactctc cgtgcgcttg ggaaatggtt cgtgctgaaa tcggtcgttc tttcttctct 1020

ctgaccatcc tgcaggaacg tgttcgtcgt cgtaaa 1056

<210> 4

<211> 465

<212> DNA

<213>Dog IL-2

<400> 4

atgtacaaaa tgcaactctt gtcttgcatc gcactgacgc ttgtacttgt cgcaaacagt 60

gcacctatta cttcaagctc tacaaaggaa acagagcaac agatggagca attactgctg 120

gatttacagt tgcttttgaa tggagttaat aattatgaga acccccaact ctccaggatg 180

ctcacattta agttttacac gcccaagaag gccacagaat ttacacacct tcaatgtcta 240

gcagaagaac tcaaaaacct ggaggaagtg ctaggtttac ctcaaagcaa aaacgttcac 300

ttgacagaca ccaaggaatt aatcagcaat atgaatgtaa cacttctgaa actaaaggga 360

tctgaaacaa gttacaactg tgaatatgat gacgagacag caaccattac agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc ttctcaacac tgact 465

<210> 5

<211> 561

<212> DNA

<213>Dog IFN-α

<400> 5

atggccctgc cctgctcctt ctcggtggcc ctggtgctgc tcagctgcca ctccctgtgc 60

tgtctggctt gcgacctgcc cgacacccac agcctgcgca actggagggt cctgacgctc 120

ctgggacaga tgaggagact ctccgccagc tcttgtgacc actacaccac tgactttgcc 180

ttccccaagg aactgtttga tggccagcgg ctccaggagg cgcaagccct ctctgtggtc 240

cacgtgatga cccagaaggt cttccacctc ttctgcacga acatgtcctc tgctccttgg 300

aacatgaccc tcctggggga attgtgctcg gggctctctg agcagctgga tgacctggat 360

gcctgtcccc tgcaggaggc agggctggcc gagacccccc tcatgcatga agactccacc 420

ctgaggacct acttccaaag gatctccctc tacctgcaag acaggaacca cagcccgtgt 480

gcctgggaga tggtccgagc agaaatcggg agatccttct tctccttgac catcttgcaa 540

gaaagagtaa ggaggaggaa a 561

<210> 6

<211> 465

<212> DNA

<213>Dog IL-2

<400> 6

atgtacaaaa tgcagctgct gtcttgcatc gctctgaccc tggttctggt tgctaactct 60

gctccgatca cctcttcttc taccaaagaa accgaacagc agatggaaca gctgctgctg 120

gacctgcagc tgctgctgaa cggtgttaac aactacgaaa acccgcagct gtctcgtatg 180

ctgaccttca aattctacac cccgaaaaaa gctaccgaat tcacccacct gcagtgcctg 240

gctgaagaac tgaaaaacct ggaagaagtt ctgggtctgc cgcagtctaa aaacgttcac 300

ctgaccgaca ccaaagaact gatctctaac atgaacgtta ccctgctgaa actgaaaggt 360

tctgaaacct cttacaactg cgaatacgac gacgaaaccg ctaccatcac cgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc ttctctaccc tgacc 465

<210> 7

<211> 561

<212> DNA

<213>Dog IFN-α

<400> 7

atggctctgc cgtgctcttt ctctgttgct ctggttctgc tgtcttgcca ctctctgtgc 60

tgcctggctt gcgacctgcc ggacacccac tctctgcgta actggcgtgt tctgaccctg 120

ctgggtcaga tgcgtcgtct gtctgcttct tcttgcgacc actacaccac cgacttcgct 180

ttcccgaaag aactgttcga cggtcagcgt ctgcaggaag ctcaggctct gtctgttgtt 240

cacgttatga cccagaaagt tttccacctg ttctgcacca acatgtcttc tgctccgtgg 300

aacatgaccc tgctgggtga actgtgctct ggtctgtctg aacagctgga cgacctggac 360

gcttgcccgc tgcaggaagc tggtctggct gaaaccccgc tgatgcacga agactctacc 420

ctgcgtacct acttccagcg tatctctctg tacctgcagg accgtaacca ctctccgtgc 480

gcttgggaaa tggttcgtgc tgaaatcggt cgttctttct tctctctgac catcctgcag 540

gaacgtgttc gtcgtcgtaa a 561

Claims

1. a kind of fusion protein being made of canine leucocyte interleukin 2 and dog interferon alpha, it is characterised in that：The fusion protein Amino acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of canine recombinant long-acting interferon, which is characterized in that the canine recombinant long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN α, preparation method are：

(1) design primer, is obtained or the canine leucocyte interleukin 2 of the flexible linker sequence of artificial synthesized connection by reverse transcription With the target gene of dog interferon alpha；Canine leucocyte interleukin 2 is connected with the target gene of dog interferon alpha by flexible linker Get up, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING Shown in 400 <, 3 >；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2-IFN can be obtained α。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of canine recombinant long-acting interferon according to claim 5, which is characterized in that the Recombinant Swine is long-acting dry The long half time of element is disturbed up to 43 hours or more, there is spectrum antivirus action and the immune response of pig itself can be improved.