CN108840945A

CN108840945A - Pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a boar long-acting interferon

Info

Publication number: CN108840945A
Application number: CN201810751030.4A
Authority: CN
Inventors: 高耀辉; 鲍可兵; 徐慕珍; 杨建伟; 付超; 周炜; 凡玉芳; 徐文俊
Original assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Current assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-10
Publication date: 2018-11-20
Also published as: CN107383205A

Abstract

The invention discloses pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding genes, a boar long-acting interferon, pig albumin, porcine interferon alpha and porcine interleukin 2 are connected by flexibility linker, obtain pig albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, Recombinant Swine long-acting interferon is finally prepared, it is remarkably improved the half-life period of pig interferon, the half-life period of more common pig interferon improves 27 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

Pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its coding base Cause, a boar long-acting interferon

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to pig albumin-interferon-' alpha '-interleukin-22 merges egg White, preparation method and its encoding gene, a boar long-acting interferon.Pig albumin, porcine interferon alpha and porcine interleukin 2 are passed through Flexible flexibility linker connection, obtains pig albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, most Recombinant Swine long-acting interferon is prepared eventually.

Background technique

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease control method is far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, in addition original animal epidemic, causes aquaculture industry of China huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.Vaccine inoculation and use are mainly passed through to the prevention and treatment approach of porcine viral diseases at present Antibiotic, but since breeding environment is not perfect, the reasons such as virus variation and Abwehrkraft des Koepers variation make traditional prevention and control Treatment approach receives huge challenge, most of antibiotics and traditional oral antiviral medicament, due to medicament residue Problem is brought a negative impact to people's health；And traditional vaccine, high specific and side effect due to it can not be resisted Virus variation and new virus, which continuously emerge, gives pig aquaculture bring significant damage.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor In conjunction with rear, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation disease Malicious RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selective Ground acts on the infection cells such as virus, by inhibiting the biosynthesis of the virus protein in infected cell, plays wide spectrum and height Imitate antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition disease Malicious duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly produced by the T lymphocyte activated The raw cell factor with extensive bioactivity can both promote lymphopoiesis, enhance immune function, and can restricted T Cell effect and the immune tolerance for enhancing body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In beast In doctor, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level that body can be enhanced improves the disease resistance of body, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to mention High curative effect of medication.IL-2 and other cell factors form fusion protein according to gene constructed, with enhance the antibody of vaccine generate and Improve cellular immune level.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, the purpose of the present invention is to provide pig albumin-interferon-' alpha '-interleukin-22s to merge egg Pig albumin, porcine interferon alpha and porcine interleukin 2 are connected by flexibility flexibility linker, it is white to obtain pig by bletilla preparation method Albumen-interferon-' alpha '-interleukin-22 fusion protein.

Another object of the present invention is to provide the encoding gene of above-mentioned pig albumin-interferon-' alpha '-interleukin-22 fusion protein.

It is also an object of the present invention to provide a kind of long-acting pig interferons, utilize above-mentioned pig albumin-interferon-' alpha '- It is freeze-dried that a boar long-acting interferon, the pig is prepared after interleukin-22 fusion protein is mixed with freeze drying protectant Long-acting interferon is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves 27 times or more, and has There is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.

The technical scheme adopted by the invention is as follows：

One boar albumin-interferon-' alpha '-interleukin-22 fusion protein, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides coding pig albumin-interferon-' alpha '-interleukin-22 fusion protein gene, the core of the gene Nucleotide sequence table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as SEQUENCE LISTING 400 Shown in 3 > of <, it is denoted as genome 2.

The genome 1 and the equal codified fusion protein of the genome 2.Genome 2 is the nucleotides sequence to genome 1 Column optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene and be in the expression system Optimal high efficient expression state, CAI value is lower to show that expression is lower in host.G/C content most ideal distribution model in gene Enclosing is 30~70%, is more than that the range will affect translation and rate of rotation efficiency in any region.Pig is found using software detection Albumin, pig-α, pig IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.24, 0.22,0.23, GC percentage is 43.7%, 59.1%, 38.7%；And by pig albumin, pig-α, pig IL-2 gene optimization After obtain each gene in Escherichia coli codon adaptation indexI (CAI) be 0.98,1.0,0.97, GC percentage 50.3%, 55.6%, 47.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to albumen table The influence reached improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides the preparation method of pig albumin-interferon-' alpha '-interleukin-22 fusion protein, the preparation methods Include the following steps：Expression vector containing genome 1 or genome 2 is imported into e. coli host cell, base is obtained Because of engineering bacteria, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, can be obtained and melts after purified Hop protein.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, and preparation method is：

(1), design primer obtains by reverse transcription or is manually respectively synthesized the white egg of pig for connecting flexible linker sequence The target gene of white, porcine interferon alpha and pig interleukin 2 and 6；It is by flexible linker that pig albumin, porcine interferon alpha, pig is white The target gene of cytokine 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2), the target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/ can be obtained rAlb-IFNα-IL2。

Further, the e. coli host cell is for BL21 (DE3) competent cell or with pGro7 plasmid BL21 (DE3) competent cell.BL21 (DE3) competent cell with pGro7 plasmid has purchased from Shanghai offshore science and technology Limit company/glad hundred promise biology, article No. V205.

Further, the method for the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography And molecular sieve chromatography purification.

Further, the acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F1：

CATGCCATGGTGACACCTACAAATCTG has NcoI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCAGCCAGGATACCACG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTTGCGACCTGCCTCAGAC, with flexible linker；

Downstream-α-R1：

ACCACCACCAGAACCACCACCACCCTCCTTCTTCCTGAGTCTGT, with flexible linker；

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTATAAGATGCAGCTCTTGC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCAGTGTTGAGTAGATGCTT has XhoI restriction enzyme site；

B. RNA is extracted from pig liver, by reverse transcription obtain pig Alb, pig IFN-α and pig IL-2 target gene, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of pig Alb, pig IFN-α and pig IL-2 as template, and be utilized respectively pig Alb, pig IFN-α and The upstream and downstream primer of pig IL-2 carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of geneome RNA, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection pig Alb and Po IFNα gene are utilized, Alb-IFN α gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α 0.5 μ L, Taq DNA polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN α gene and pig IL2 gene are utilized, rAlb-IFN α-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F2：CATGCCATGGTGACACCTACAAATCTG has NcoI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGGATACCACG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGCTCTTACCTG, with flexible linker；

Downstream-α-R2：

ACCACCACCAGAACCACCACCACCTTCTTTACGACGCAG, with flexible linker；

Pig interleukin 2 and 6 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATGCAGC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCAGGGTAGAGTAG has XhoI restriction enzyme site.

B. the pig Alb, pig IFN-α and pig IL-2 target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq DNA polymerase, dNTP Mix are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：95 DEG C of 4 min of initial denaturation, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, circulation 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-α template DNA, the 0.5 μ L of flexible linker, IFN-α 0.5 μ L, Taq DNA polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

The present invention also provides a boar long-acting interferon, the pig long-acting interferon is by the pig albumin-interference It is freeze-dried to form after plain α-interleukin-22 fusion protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The present invention also provides the application of the pig long-acting interferon, long half time had wide spectrum up to 109 hours or more Antivirus action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig Alb, pig IFN-α and pig IL-2 gene are realized amalgamation and expression by flexibility linker, interferon is improved Half-life period improves 27 times compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving pig Alb, pig IFN-α and pig IL-2 by optimizing to pig Alb, pig IFN-α and pig IL-2 gene The expression quantity of fusion protein.

3. using recombination bacillus coli pET-32a/Alb- α-IL2 as expression bacterial strain, by introducing molecular chaperones pGro7 matter Grain, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of pig Alb, pig IFN-α and pig IL-2 not only has the wide of IFN-α Antivirus action is composed, while significantly improving the immune response of pig itself.

Detailed description of the invention

Fig. 1 is that pig albumin gene, porcine interferon alpha gene and the pig interleukin 2 and 6 gene RT-PCR in embodiment 1 expand The result of increasing；Swimming lane M：DNA Marker DL2000；Swimming lane 1：2 gene RT-PCR amplified production of porcine interleukin；Swimming lane 2：Pig is dry Disturb plain α gene RT-PCR amplified production；Swimming lane 3：Pig albumin gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in pig Alb, IFN-α connected with the target gene of IL-2 after PCR amplification result；Swimming Road M：DNA Marker DL10000；Swimming lane 1：Pig albumin gene, porcine interferon alpha gene connect expansion with 2 gene of porcine interleukin Increase production object；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the Recombinant Swine long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant long-acting porcine interferon alpha of gradient dilution (from right to left) handles hole；

Fig. 7 is the Recombinant Swine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

The preparation method of pig albumin-interferon-' alpha '-interleukin-22 fusion protein, includes the following steps：

1. the acquisition of pig albumin (Alb), porcine interferon alpha (IFN-α) and pig interleukin 2 and 6 (IL-2) target gene with Amplification

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of pig albumin In primer introduce EcoRI restriction enzyme site, in downstream primer introduce Linker sequence, porcine interferon alpha upstream primer and under Linker sequence is introduced respectively in trip primer, Linker sequence is introduced in the upstream primer of pig interleukin 2 and 6, in downstream primer Middle introducing SalI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, and the target gene of pig Alb, pig IFN-α and pig IL-2 are obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1780bp, 740bp and 490bp or so through agarose gel electrophoresis in RT-PCR amplified production, Its result illustrates the target gene that pig Alb, pig IFN-α and pig IL-2 has been prepared as shown in Fig. 1.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 Alb-IFN- α PCR reaction system of table

4 Alb-IFN- α-IL-2 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2950bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs Alb-IFN α and IL-2 amplified product band in Fig. 2, this is because the process connected in Alb-IFN α with IL-2 gene In, there is non-specific responding.The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

For target gene after selection connection after sequencing is errorless, PCR glue recovery product and pET-32a plasmid use NcoI Double digestion and recycling are carried out with XhoI restriction enzyme, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, and PCR amplification and double digestion are produced through NcoI and XhoI double digestion Object detects single band through agarose gel electrophoresis at 2950bp, and result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, result is such as Shown in Fig. 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the place 126.4KD or so can See predominant expression band, illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN α-IL2 protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN α-IL2 protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁵U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C It saves.The fusion protein being made of pig albumin, porcine interferon alpha and pig interleukin 2 and 6 can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Pig albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 2

The preparation method of one boar albumin-interferon-' alpha '-interleukin-22 fusion protein, the preparation method is the same as that of Example 1, only E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmid is thin Born of the same parents.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,126.4KD or so place's predominant expression item in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with Expression albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

The preparation method of one boar albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method are as follows：

Pig Alb, pig IFN-α and pig IL-2 in embodiment 1 is optimized, artificially synthesized pig Alb, pig IFN-α and pig IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, the pig Alb in the present embodiment couple, pig IFN-α It is optimized with pig IL-2 gene codon.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and rate of rotation efficiency in any region.Using software detection discovery pig albumin, Pig-α, pig IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.24,0.22, 0.23, GC percentage is 43.7%, 59.1%, 38.7%；And by being obtained to after pig albumin, pig-α, pig IL-2 gene optimization To each gene in Escherichia coli codon adaptation indexI (CAI) be 0.98,1.0,0.97, GC percentage 50.3%, 55.6%, 47.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to the shadow of protein expression It rings, improves the G/C content of gene, improve transcription and translation efficiency, and then improve the expression quantity of recombinant protein.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of pig Alb, pig IFN-α and pig IL-2 after optimization are diluted to 0.05mg/mL respectively.Utilize PCR Amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of pig Alb, pig IFN-α and pig IL-2 are through agarose gel electrophoresis respectively in 1780bp, 740bp There is specific band with 490bp or so, the purpose base of pig Alb, pig IFN-α and pig IL-2 after illustrating to be prepared optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 Alb-IFN α PCR reaction system of table

10 rAlb-IFN α-IL2 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2950bp or so through agarose gel electrophoresis in pcr amplification product, is Alb-IFN α and IL-2 Amplified product band, this is because there is non-specific responding during Alb-IFN α is connected with IL-2 gene.It obtains The nucleotide sequence of target gene is as shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid NcoI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of NcoI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 2950bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN α-IL2 fusion carries Body constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in the place 126.4KD or so after bacterial cell disruption after 5h, illustrates in supernatant precipitating Recombinant protein is obtained.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, use Binding Buffer III is eluted, and collects rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁵U/mg, albumen are qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of pig albumin, porcine interferon alpha and pig interleukin 2 and 6, amino acid sequence can be obtained As shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

The preparation method of one boar albumin-interferon-' alpha '-interleukin-22 fusion protein, other are with embodiment 3, only by it In e. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.Its The SDS-PAGE electrophoresis result of fusion protein is compareed with embodiment 3, in supernatant 126.4KD or so place's predominant expression band compared with Slightly, illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher. The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression in expression bacterial strain Albumen correctly folds, and reaches solubility expression of protein.

Embodiment 5

One boar long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively and after freeze drying protectant mixture, It is freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, three with 10mmol/L PBS Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Embodiment 6

The identification for the pig albumin-interferon-' alpha '-interleukin-22 fusion protein that Examples 1 to 4 obtains

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration difference 2.5mg/ml, 2.4mg/ml, 2.6mg/ml, 2.6mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 126.4KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-porcine alpha-IFN (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting pig interferon sample can be with anti-porcine interferon alpha Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 126.4KD or so, as shown in Figure 5.

Embodiment 7

The freeze-dried bioactivity of four parts of long-acting pig interferons of pig in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant long-acting of various dose is added in culture Pig interferon is inhaled afterwards abandon for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the recombinant long-acting pig interferon obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant long-acting obtained After pig interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁵U/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant long-acting pig interferons obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried The measurement of (being denoted as A, B, C, D respectively) in pig intracorporal half-life period

A be embodiment 1 prepare freeze-dried, B be embodiment 2 prepare freeze-dried, C be embodiment 3 prepare it is freeze-dried, D is the freeze-dried of the preparation of embodiment 4.

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN α-IL2

The pork pig (half male and half female) that six weight are roughly the same is taken, 2mg/ml Recombinant Swine long-acting interferon is subcutaneously injected in neck The freeze-dried 2ml of α, respectively in 1h, 2h, 4h, 8h, 16h, 26h, 44h, 79h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm low temperature It is centrifuged 10min and separates serum, every pig blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN α-IL2 in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculated result It is shown in Table 13.

Dominant dynamic parameters in serum after 13 recombinant long-acting porcine interferon alpha intramuscular injection of table

The result shows that recombinant long-acting pig interferon has longer half-life period.Half-life period can reach 109h or so after measured, compared with Plain interferon improves about 27 times.

Embodiment 9

The freeze-dried measurement that pig cell immune response is influenced of four parts of recombinant long-acting pig interferons in embodiment 5

It takes six roughly the same pork pigs of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml freeze-dried 2ml of recombinant long-acting pig interferon is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside pig All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IFN γ, IL-4 content, are carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group pig cell immune response

The result shows that injection recombinant long-acting pig interferon after, can significantly improve cell factor IFN γ in pig peripheral blood, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned that one boar albumin-interferon-' alpha '-interleukin-22 fusion protein and preparation method thereof is carried out referring to embodiment Detailed description, be illustrative without being restrictive, can enumerate several embodiments according to limited range, thus The change and modification under present general inventive concept are not departed from, should be belonged within protection scope of the present invention.

SEQUENCE LISTING

<110>Anhui Jiuchuan Biotechnology Co., Ltd.

<120>Pig albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a boar are long-acting dry Disturb element

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 983

<212> PRT

<213>Fusion protein

<400> 1

Asp Thr Tyr Lys Ser Glu Ile Ala His Arg Phe Lys Asp Leu Gly Glu

1 5 10 15

Gln Tyr Phe Lys Gly Leu Val Leu Ile Ala Phe Ser Gln His Leu Gln

20 25 30

Gln Cys Pro Tyr Glu Glu His Val Lys Leu Val Arg Glu Val Thr Glu

35 40 45

Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys

50 55 60

Ser Ile His Thr Leu Phe Gly Asp Lys Leu Cys Ala Ile Pro Ser Leu

65 70 75 80

Arg Glu His Tyr Gly Asp Leu Ala Asp Cys Cys Glu Lys Glu Glu Pro

85 90 95

Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asn Asp Asn Pro Asp Ile

100 105 110

Pro Lys Leu Lys Pro Asp Pro Val Ala Leu Cys Ala Asp Phe Gln Glu

115 120 125

Asp Glu Gln Lys Phe Trp Gly Lys Tyr Leu Tyr Glu Ile Ala Arg Arg

130 135 140

His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Tyr Tyr Ala Ile Ile Tyr

145 150 155 160

Lys Asp Val Phe Ser Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys

165 170 175

Leu Leu Pro Lys Ile Glu His Leu Arg Glu Lys Val Leu Thr Ser Ala

180 185 190

Ala Lys Gln Arg Leu Lys Cys Ala Ser Ile Gln Lys Phe Gly Glu Arg

195 200 205

Ala Phe Lys Ala Trp Ser Leu Ala Arg Leu Ser Gln Arg Phe Pro Lys

210 215 220

Ala Asp Phe Thr Glu Ile Ser Lys Ile Val Thr Asp Leu Ala Lys Val

225 230 235 240

His Lys Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg

245 250 255

Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Thr Ile Ser Thr

260 265 270

Lys Leu Lys Glu Cys Cys Asp Lys Pro Leu Leu Glu Lys Ser His Cys

275 280 285

Ile Ala Glu Ala Lys Arg Asp Glu Leu Pro Ala Asp Leu Asn Pro Leu

290 295 300

Glu His Asp Phe Val Glu Asp Lys Glu Val Cys Lys Asn Tyr Lys Glu

305 310 315 320

Ala Lys His Val Phe Leu Gly Thr Phe Leu Tyr Glu Tyr Ser Arg Arg

325 330 335

His Pro Asp Tyr Ser Val Ser Leu Leu Leu Arg Ile Ala Lys Ile Tyr

340 345 350

Glu Ala Thr Leu Glu Asp Cys Cys Ala Lys Glu Asp Pro Pro Ala Cys

355 360 365

Tyr Ala Thr Val Phe Asp Lys Phe Gln Pro Leu Val Asp Glu Pro Lys

370 375 380

Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Lys Leu Gly Glu Tyr

385 390 395 400

Gly Phe Gln Asn Ala Leu Ile Val Arg Tyr Thr Lys Lys Val Pro Gln

405 410 415

Val Ser Thr Pro Thr Leu Val Glu Val Ala Arg Lys Leu Gly Leu Val

420 425 430

Gly Ser Arg Cys Cys Lys Arg Pro Glu Glu Glu Arg Leu Ser Cys Ala

435 440 445

Glu Asp Tyr Leu Ser Leu Val Leu Asn Arg Leu Cys Val Leu His Glu

450 455 460

Lys Thr Pro Val Ser Glu Lys Val Thr Lys Cys Cys Thr Glu Ser Leu

465 470 475 480

Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Thr Pro Asp Glu Thr Tyr

485 490 495

Lys Pro Lys Glu Phe Val Glu Gly Thr Phe Thr Phe His Ala Asp Leu

500 505 510

Cys Thr Leu Pro Glu Asp Glu Lys Gln Ile Lys Lys Gln Thr Ala Leu

515 520 525

Val Glu Leu Leu Lys His Lys Pro His Ala Thr Glu Glu Gln Leu Arg

530 535 540

Thr Val Leu Gly Asn Phe Ala Ala Phe Val Gln Lys Cys Cys Ala Ala

545 550 555 560

Pro Asp His Glu Ala Cys Phe Ala Val Glu Gly Pro Lys Phe Val Ile

565 570 575

Glu Ile Arg Gly Ile Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly

580 585 590

Ser Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg Ser Ser Asn

595 600 605

Ile Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala Arg Thr Ala

610 615 620

Ala Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe Leu Thr Ala

625 630 635 640

Leu Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly Cys Asp Leu

645 650 655

Pro Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg Leu Leu Ala

660 665 670

Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His Arg Arg Asp

675 680 685

Phe Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val Gln Lys Ala

690 695 700

Gln Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr Phe Gln Leu

705 710 715 720

Phe Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser Leu Leu His

725 730 735

Gln Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu Glu Ala Cys

740 745 750

Val Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu Glu Glu Asp

755 760 765

Ser Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr Leu

770 775 780

Gln Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val Arg Ala Glu

785 790 795 800

Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp Arg Leu Arg

805 810 815

Arg Lys Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Tyr Lys

820 825 830

Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala Leu Met Ala Asn

835 840 845

Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys Lys Gln Leu Glu

850 855 860

Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu Val Lys Asn Tyr

865 870 875 880

Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys Phe Tyr Met Pro

885 890 895

Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu Val Glu Glu Leu

900 905 910

Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser Lys Asn Ser Asp

915 920 925

Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn Val Thr Val Leu

930 935 940

Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu Tyr Asp Asp Glu

945 950 955 960

Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln

965 970 975

Ser Ile Tyr Ser Thr Leu Thr

980

<210> 2

<211> 2949

<212> DNA

<213>Genome 1

<400> 2

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagccg gtggtggtgg ttctggtggt ggtggttcta tgtgttccta tttaagacac 1800

aggcctgagg gaaggtcttc aaacatccta gagagcaggg tcacagagtc acccacctca 1860

gccaggacag cagcatctgc aaggtcccca atggccccaa cctcagcctt cctcacggcc 1920

ctggtgctgc tcagctgcaa tgccatctgc tctctgggct gcgacctgcc tcagacccac 1980

agcctggctc acaccagggc cctgaggctc ctggcacaaa tgaggagaat ctcccccttc 2040

tcctgcctgg accacagaag ggactttgga ttcccccaag aggccttggg gggcaaccag 2100

gtccagaagg ctcaagccat ggctctggtg catgagatgc tccagcagac cttccagctc 2160

ttcagcacag agggctcggc tgctgcctgg gatgagagcc tcctgcacca gttctgcact 2220

ggactggatc agcagctcag ggacctggaa gcctgtgtca tgcaggaggc cgggctggaa 2280

gggacccccc tgctggagga ggactccatc ctggctgtga ggaaatactt ccacagactc 2340

accctctatc tgcaagagaa gagctacagc ccctgtgcct gggagatcgt cagggcagaa 2400

gtcatgagag ccttctcttc ctccacaaac ctgcaagaca gactcaggag gaaggagggt 2460

ggtggtggtt ctggtggtgg tggttctatg tataagatgc agctcttgtg ttgcattgca 2520

ctaacccttg cactcatggc aaacggtgca cctacttcaa gctctacaaa gaacacaaag 2580

aaacaactgg agccattgct gctggattta cagttgcttt tgaaggaagt taagaattac 2640

gagaatgctg atctctccag gatgctcaca tttaaatttt acatgcccaa gcaggctaca 2700

gaattgaaac accttcagtg tttagtagaa gaactcaaag ctctggaggg agtgctaaat 2760

ttaggtcaaa gcaaaaactc tgactcagca aatatcaagg aatcaatgaa caatatcaac 2820

gtaacagttt tggaactaaa gggatctgaa acaagtttca aatgtgaata tgatgatgag 2880

acagtaactg ctgttgaatt tctgaacaaa tggattacct tttgtcaaag catctactca 2940

acactgact 2949

<210> 3

<211> 2949

<212> DNA

<213>Genome 2

<400> 3

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggctg gtggtggtgg ttctggtggt ggtggttcta tgtgctctta cctgcgtcac 1800

cgtccggaag gtcgttcttc taacatcctg gaatctcgtg ttaccgaatc tccgacctct 1860

gctcgtaccg ctgcttctgc tcgttctccg atggctccga cctctgcttt cctgaccgct 1920

ctggttctgc tgtcttgcaa cgctatctgc tctctgggtt gcgacctgcc gcagacccac 1980

tctctggctc acacccgtgc tctgcgtctg ctggctcaga tgcgtcgtat ctctccgttc 2040

tcttgcctgg accaccgtcg tgacttcggt ttcccgcagg aagctctggg tggtaaccag 2100

gttcagaaag ctcaggctat ggctctggtt cacgaaatgc tgcagcagac cttccagctg 2160

ttctctaccg aaggttctgc tgctgcttgg gacgaatctc tgctgcacca gttctgcacc 2220

ggtctggacc agcagctgcg tgacctggaa gcttgcgtta tgcaggaagc tggtctggaa 2280

ggtaccccgc tgctggaaga agactctatc ctggctgttc gtaaatactt ccaccgtctg 2340

accctgtacc tgcaggaaaa atcttactct ccgtgcgctt gggaaatcgt tcgtgctgaa 2400

gttatgcgtg ctttctcttc ttctaccaac ctgcaggacc gtctgcgtcg taaagaaggt 2460

ggtggtggtt ctggtggtgg tggttctatg tacaaaatgc agctgctgtg ctgcatcgct 2520

ctgaccctgg ctctgatggc taacggtgct ccgacctctt cttctaccaa aaacaccaaa 2580

aaacagctgg aaccgctgct gctggacctg cagctgctgc tgaaagaagt taaaaactac 2640

gaaaacgctg acctgtctcg tatgctgacc ttcaaattct acatgccgaa acaggctacc 2700

gaactgaaac acctgcagtg cctggttgaa gaactgaaag ctctggaagg tgttctgaac 2760

ctgggtcagt ctaaaaactc tgactctgct aacatcaaag aatctatgaa caacatcaac 2820

gttaccgttc tggaactgaa aggctcggaa accagcttca aatgcgaata cgacgacgaa 2880

accgttaccg ctgttgaatt cctgaacaaa tggatcacct tctgccagtc tatctactct 2940

accctgacc 2949

<210> 4

<211> 1749

<212> DNA

<213>Pig albumin gene sequence before optimizing

<400> 4

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagcc 1749

<210> 5

<211> 678

<212> DNA

<213>Pig IFN-α gene order before optimizing

<400> 5

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 60

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 120

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 180

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 240

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 300

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 360

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 420

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 480

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 540

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 600

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 660

agactcagga ggaaggag 678

<210> 6

<211> 462

<212> DNA

<213>Pig IL-2 gene order before optimizing

<400> 6

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ct 462

<210> 7

<211> 1749

<212> DNA

<213>Pig albumin gene sequence after optimization

<400> 7

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggct 1749

<210> 8

<211> 678

<212> DNA

<213>Pig IFN-α gene order after optimization

<400> 8

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 60

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 120

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 180

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 240

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 300

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 360

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 420

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 480

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 540

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 600

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 660

cgtctgcgtc gtaaagaa 678

<210> 9

<211> 462

<212> DNA

<213>Pig IL-2 gene order after optimization

<400> 9

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga cc 462

Claims

1. pig albumin-interferon-' alpha '-interleukin-22 fusion protein, it is characterised in that：The amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >, it is denoted as fusion protein 1.

2. a kind of gene for encoding pig albumin-interferon-' alpha '-interleukin-22 fusion protein as described in claim 1, feature It is, the nucleotides sequence list of the gene is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as Shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. the preparation method of pig albumin-interferon-' alpha '-interleukin-22 fusion protein described in claim 1, which is characterized in that institute Preparation method is stated to include the following steps：Nucleotides sequence list gene as shown in 400 < of SEQUENCE LISTING, 2 > will be contained The expression vector of group 1 or nucleotides sequence list genome 2 as shown in 400 < of SEQUENCE LISTING, 3 > imported into large intestine bar In bacterium host cell, genetic engineering bacterium is obtained, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, Fusion protein can be obtained after purified.

6. preparation method according to claim 5, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, preparation method are：

(1), design primer, by reverse transcription obtain or manually be respectively synthesized connect flexible linker sequence pig albumin, The target gene of porcine interferon alpha and pig interleukin 2 and 6；It is by flexible linker that pig albumin, porcine interferon alpha, pig is white thin The target gene of born of the same parents' interleukin 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained α-IL2。

7. preparation method according to claim 5 or 6, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

8. preparation method according to claim 5, which is characterized in that the method for the purifying is：The crude product of fusion protein Successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

9. a boar long-acting interferon, which is characterized in that the pig long-acting interferon by fusion protein described in claim 1 with It is freeze-dried to form after freeze drying protectant mixture.

10. pig long-acting interferon according to claim 9, which is characterized in that the freeze drying protectant is glycerol, mannitol And sucrose.