CN108864293A - A kind of fusion protein being made of dog albumin and dog interferon γ and preparation method thereof and a kind of canine recombinant long-acting interferon γ - Google Patents

Abstract

The invention discloses a kind of fusion protein being made of dog albumin and dog interferon γ and preparation method thereof and a kind of canine recombinant long-acting interferon γ; the fusion protein is connect through flexible linker with dog interferon γ by dog albumin and is formed, and is freeze-dried to obtain canine recombinant long-acting interferon γ after fusion protein and freeze drying protectant mixture.The canine recombinant long-acting interferon γ is remarkably improved the half-life period of dog interferon, and the half-life period of more common dog interferon γ improves 13 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of dog itself.

Description

A kind of fusion protein and preparation method thereof being made of dog albumin and dog interferon γ With a kind of canine recombinant long-acting interferon γ

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to one kind is made of dog albumin and dog interferon γ Fusion protein and preparation method thereof and a kind of canine recombinant long-acting interferon γ.

Background technique

It is analyzed according to Chinese pet Industry, the market scale by the end of 2014 year end China pet industries has reached 105800000000 RMB, and Chinese Medical pet industry only accounts for about 20% at present, the city of the U.S. for the pet industry relative maturity that compares , the output value ratio of Medical pet reaches 50%, and there are huge development spaces for Chinese Medical pet industry.

Dog is the friend of mankind's loyalty, with increasing considerably for the canines feeding quantity such as domestic pet dog, canine disease The continuous raising of disease incidence, the death rate causes spirit and double loss economically to the mankind.Dog causes with mankind's intimate contact The mankind are high by the probability of dog virus infection, such as rabies viruses, canine parvovirus and canine distemper virus, can all give human health Bring great threat.

Report interferon is studied as a kind of important cell factor, to canine distemper, canine parvovirus according to related science Certain curative effect is all had in the treatments of diseases such as disease, canine infectious hepatitis and canine coronavirus disease.Therefore actively research interference Effect of the element in canine viral disease treatment has broad application prospects.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ type IFN be T cell by activating and NK cell generates, and has relatively strong antiviral and immunoloregulation function.A large number of studies show that interferon gamma is in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of seed type can reaction of the mediated cell to virus infection, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partially solve the problems, such as that interferon molecule amount is small and leads to half-life short on face.By being carried out to two kinds of different type interferon Fusion, not only can be improved the molecular weight of interferon, but also can cooperate with the effect for playing two kinds of interferon.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg It is white to be linked in the cell through protein translation system by peptide bond, it is not required to additional extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after merging with it；Albumin is one stable " inert protein ", after merging with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein drug It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, merging egg with what dog interferon γ was formed by dog albumin the present invention provides a kind of Bletilla preparation method and a kind of canine recombinant long-acting interferon γ, the canine recombinant long-acting interferon γ are remarkably improved dog interference The half-life period of element, the half-life period of more common dog interferon γ improve 13 times or more, and have broad-spectrum disease resistance toxic action and can improve The immune response of dog itself.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of dog albumin and dog interferon γ, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein 1 described in 1 codified of genome；The 2 codified fusion protein 2 of genome.Genome 2 is pair The nucleotide sequence of genome 1 optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the base Because being optimal high efficient expression state in the expression system, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region. The codon of the dog albumin and IFN-γ original gene codon adaptation indexI in Escherichia coli is found using software detection (CAI) be respectively 0.25,0.22, GC percentage be 48.8%, 39.8%；And by dog albumin and IFN-γ gene optimization After obtain recombination in Escherichia coli codon adaptation indexI (CAI) be 0.97,1.0, GC percentage 50.3%, 45.0%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to the shadow of protein expression It rings, improves the G/C content of gene, improve transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of canine recombinant long-acting interferon γ, the canine recombinant long-acting interferon γ is melted by described It is freeze-dried to form after hop protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ, and preparation method is：

(1) design primer, is obtained or the dog albumin of the flexible linker sequence of artificial synthesized connection by reverse transcription With the target gene of dog interferon γ；Dog albumin has been connected with the target gene of dog interferon γ by flexible linker Come, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 2 > or such as SEQUENCE LISTING Shown in 400 <, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained IFNγ。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of dog albumin (Alb) is：

Upstream Alb-F1：CGGGATCCATGAAGTGGGTAACTTT has BamHI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGACTAAGGCAGCTTG, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGAATTATACAAGCTATATC, with flexible linker；

Downstream IFN-γ-R1：CCCTCGAGTTTCGATGCTCTGC has XhoI restriction enzyme site；

B. RNA is extracted from dog liver, the target gene of Alb and IFN-γ, the gene sequence of the two is obtained by reverse transcription Column are respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification respectively obtains and connects the Alb of flexible linker and the target gene of IFN-γ.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, the flexible linker of A connection 1 μ L of Alb gene template DNA, connect 1 μ L, Alb upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of dog albumin (Alb) is：

Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCTT has BamHI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAACCAGAGCAGCCT, with flexible linker；

The primer sequence of dog interferon γ (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAACTACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：CCCTCGAGTTTAGAAGCACGACG has XhoI restriction enzyme site；

B. the target gene of the Alb and IFN-γ, the gene order of the two is respectively such as SEQUENCE LISTING 400 Shown in 6 > and SEQUENCE LISTING of <, 400 <, 7 >；

Respectively using Alb and the target gene of IFN-γ as template, and be utilized respectively the upstream and downstream primer of Alb and IFN-γ into Row PCR amplification, the target gene of Alb and IFN-γ after respectively obtaining the optimization for connecting flexible linker.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. Alb gene and IFN-γ gene are connected using flexible linker

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's Alb gene template DNA1 μ L, connect 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the canine recombinant long-acting interferon γ, long half time was up to 53 hours or more, tool There is broad-spectrum disease resistance toxic action and the immune response of dog itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. dog albumin and dog interferon γ gene are realized fusion by flexibility linker, improves interferon and partly decline Phase improves 13 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving dog Alb and dog interferon γ fusion by optimizing to dog albumin and dog interferon γ gene The expression quantity of albumen.

3. using recombination bacillus coli BL21/pET-32a-Alb-IFN γ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid does not generate inclusion body in protein expression, forms soluble protein, avoids the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of dog albumin and dog interferon γ not only has interferon gamma Broad-spectrum disease resistance toxic action, while significantly improving the immune response of dog itself.

Detailed description of the invention

Fig. 1 is the result of the pig albumin gene and Porcine interferon-gamma gene RT-PCR amplification in embodiment 1；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Porcine interferon-gamma gene RT-PCR amplified production；Swimming lane 2：Pig albumin gene RT-PCR Amplified production；

Fig. 2 is the result of the PCR amplification after the pig albumin in embodiment 1 is connected with the target gene of porcine IFN γ； Swimming lane M：DNA Marker DL2000；Swimming lane 1：Porcine interferon-gamma gene and pig albumin gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium control；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：It is precipitated after being crushed for recombinant bacterium induction；

Fig. 6 is that the Recombinant Swine long-acting interferon γ as made from the fusion protein in embodiment 1 causes carefully VSV in embodiment 5 The inhibiting effect of born of the same parents' lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from dextrad It is left) human interferon standard items handle hole；B3-12 is that the recombinant long-acting Porcine interferon-gamma of gradient dilution (from right to left) is handled Hole；

Fig. 7 is the Recombinant Swine long-acting interferon γ intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of dog albumin and dog interferon γ, preparation method are as follows：

1. the acquisition and amplification of dog albumin (Alb) and dog interferon γ (IFN-γ) target gene

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of dog albumin BamHI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, dog interferon γ upstream primer and under Linker sequence and XhoI restriction enzyme site are introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from dog liver organization, the target gene of Alb and IFN-γ, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 4 > and SEQUENCE LISTING, 5 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band, result in 1850bp and 530bp or so through agarose gel electrophoresis in RT-PCR amplified production As shown in Figure 1.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

3 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2350bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs the band of dog albumin amplified production and dog interferon γ amplified production in Fig. 2, this is because in dog albumin gene During connecting with dog interferon γ gene PCR, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through BamHI and XhoI double digestion, being accredited as positive indicates expression vector establishment success, has obtained engineering bacteria pET-32a/ rAlb-IFNγ；There is single band, knot at the place 2350bp or so through agarose gel electrophoresis in PCR amplification and double enzyme digestion product Fruit is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rAlb-IFN γ shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, result as shown in figure 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant precipitate In the visible predominant expression band in the place 104.5KD or so, illustrate in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer On 100 protein purification systems, the His affinity column balanced with Binding Buffer I (PBS) is washed with PBS buffer solution Remove unbonded albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN γ protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rAlb-IFN γ protein peak.

5.4 sample identification

Measure rAlb-IFN γ potency and specific activity, specific activity >=1.0 × 10⁵U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of dog albumin and dog interferon γ, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of dog albumin and dog interferon γ, other, only will be therein big with embodiment 1 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 1, and 104.5KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made of dog albumin and dog interferon γ, preparation method are as follows：

1. the acquisition and amplification of dog albumin (Alb) and dog interferon γ (IFN-γ) target gene

To in embodiment 1 Alb and IFN-γ optimize, artificial synthesized Alb and IFN-γ target gene, after optimization, The nucleotide sequence of the two is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 6 > and SEQUENCE LISTING, 7 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the albumin of dog and IFN- in the present embodiment γ gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and rate of rotation efficiency in any region.Using software detection discovery dog albumin and The codon of IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.25,0.22, GC percentage It is 48.8%, 39.8%；And by close in Escherichia coli to recombination is obtained after dog albumin and IFN-γ gene optimization Numeral adaptation index (CAI) is 0.97,1.0, GC percentage 50.3%, 45.0%.It is significantly reduced by gene optimization low close The utilization rate of numeral avoids influence of the rare codon to protein expression, improves the G/C content of gene, improves transcription and turn over Efficiency is translated, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of Alb and IFN-γ after optimization are diluted to 0.05mg/mL respectively.Mesh is obtained using PCR amplification Gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Alb and the pcr amplification product of IFN-γ occur in 1850bp and 530bp or so special respectively through agarose gel electrophoresis Different band illustrates the target gene for the Alb and IFN-γ being prepared after optimizing.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects target gene, 25 μ L reaction systems such as 8 institute of table using over-lap PCR Show：

8 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2350bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to have obtained Alb Target gene after being connected with IFN-γ, the nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 9：

9 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubation of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, PCR amplification and double enzyme digestion product warp There is single band at the place 2350bp or so in agarose gel electrophoresis, illustrates the target gene after connecting containing Alb with IFN-γ Expression vector establishment success, obtained engineering bacteria pET-32a/rAlb-IFN γ.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rAlb-IFN γ shakes for 37 DEG C in the LB culture medium of the 100 μ g/ml containing ampicillin Bacterium 1h recovery engineering bacteria activity is surveyed OD value and is reached in LB culture medium (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of inducing expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the visible predominant expression band in the place 104.5KD or so, Illustrate to have obtained recombinant protein in supernatant precipitating.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer On 100 protein purification systems, the His affinity column balanced with Binding Buffer I (PBS) is washed with PBS buffer solution Remove unbonded albumen, until A280nm stablize, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~ 500mM imidazoles, PH8.0) elution, collect rAlb-IFN γ protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatography of Superdex, with Binding Buffer III elution, collects rAlb-IFN γ protein peak.

5.4 sample identification

Measure rAlb-IFN γ potency and specific activity, specific activity >=1.0 × 10⁵U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of dog albumin and dog interferon γ, amino acid sequence such as SEQUENCE can be obtained Shown in 400 < of LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of dog albumin and dog interferon γ, other, only will be therein big with embodiment 3 The replacement of enterobacteria BL21 (DE3) competent cell is for BL21 (DE3) competent cell with pGro7 plasmid.It merges egg White SDS-PAGE electrophoresis result is compareed with embodiment 3, and 104.5KD or so place's predominant expression band is thicker in supernatant, explanation After introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Large intestine bar The albumen of bacterium expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is just It really folds, reaches solubility expression of protein.BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai offshore Science and Technology Ltd./glad hundred promise biology, article No. V205.

Embodiment 5

A kind of canine recombinant long-acting interferon γ is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 It is freeze-dried to form with later.The freeze drying protectant is glycerol, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 is obtained by the identification of dog albumin and dog interferon the γ fusion protein formed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.2mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 104.5KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-dog interferon (1 of abcam company mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Canine recombinant long-acting interferon γ sample can be dry with anti-dog It disturbs plain γ monoclonal antibody and specific reaction occurs, specific band occurs in the place 104.5KD or so, as shown in Figure 5.

Embodiment 7

Four parts of canine recombinant long-acting interferon γ in embodiment 5 freeze-dried bioactivity

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO2 culture for 24 hours, the canine recombinant that various dose is added is long Interferon gamma is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100TCID respectively₅₀VSV virus.

Test result

The result shows that the canine recombinant long-acting interferon γ obtained causes the lesion of HEp-2 cell to have apparent suppression VSV Production is used.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the canine recombinant obtained After long-acting interferon γ treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur Any lesion, measures potency >=1.0 × 10⁵U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of canine recombinant long-acting interferon γ that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in dog intracorporal half-life period

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN γ

The dog (half male and half female) that six weight are roughly the same is taken, the long-acting dog interferon γ of intramuscular injection 2mg/ml dog is freeze-dried 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 60h, 88h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low temperature It is centrifuged 10min and separates serum, every dog blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN γ in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Matched curve such as Fig. 7 institute Show；Parameter calculated result is shown in Table 11.

Dominant dynamic parameters in serum after 11 canine recombinant long-acting interferon γ intramuscular injection of table

The result shows that canine recombinant long-acting interferon γ has longer half-life period.Half-life period can reach 53h or so after measured, compared with Plain interferon improves about 13 times.

Embodiment 9

The freeze-dried measurement that canine cells immune response is influenced of four parts of canine recombinant long-acting interferon γ in embodiment 5

It takes six roughly the same dogs of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck The PBS of 2mL is subcutaneously injected in the 2mg/ml canine recombinant long-acting interferon freeze-dried 2ml of γ, control group neck, after taking injection 4 weeks outside dog All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out by kit specification, and testing result is as shown in table 12：

It is horizontal that 12 ELISA of table detects each group canine cells immune response

The result shows that injection canine recombinant long-acting interferon γ after, can significantly improve cell factor IL-2 in canine peripheral blood, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion protein and preparation method thereof being made of dog albumin and dog interferon γ The detailed description carried out with a kind of canine recombinant long-acting interferon γ, is illustrative without being restrictive, can be according to being limited Range enumerates several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to of the invention Within protection scope.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>It is a kind of long by dog albumin and the dog interferon γ fusion protein formed and preparation method thereof and a kind of canine recombinant

Imitate interferon gamma

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 784

<212> PRT

<213>Canine recombinant long-acting interferon γ fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Phe Phe Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Leu Val Arg Arg Glu Ala Tyr Lys Ser Glu Ile Ala

20 25 30

His Arg Tyr Asn Asp Leu Gly Glu Glu His Phe Arg Gly Leu Val Leu

35 40 45

Val Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val

50 55 60

Lys Leu Ala Lys Glu Val Thr Glu Phe Ala Lys Ala Cys Ala Ala Glu

65 70 75 80

Glu Ser Gly Ala Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Lys Leu Cys Thr Val Ala Ser Leu Arg Asp Lys Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Asp Arg Asn Glu Cys Phe Leu Ala

115 120 125

His Lys Asp Asp Asn Pro Gly Phe Pro Pro Leu Val Ala Pro Glu Pro

130 135 140

Asp Ala Leu Cys Ala Ala Phe Gln Asp Asn Glu Gln Leu Phe Leu Gly

145 150 155 160

Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro

165 170 175

Glu Leu Leu Tyr Tyr Ala Gln Gln Tyr Lys Gly Val Phe Ala Glu Cys

180 185 190

Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Gly Pro Lys Ile Glu Ala

195 200 205

Leu Arg Glu Lys Val Leu Leu Ser Ser Ala Lys Glu Arg Phe Lys Cys

210 215 220

Ala Ser Leu Gln Lys Phe Gly Asp Arg Ala Phe Lys Ala Trp Ser Val

225 230 235 240

Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Asp Phe Ala Glu Ile Ser

245 250 255

Lys Val Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly

260 265 270

Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Met

275 280 285

Cys Glu Asn Gln Asp Ser Ile Ser Thr Lys Leu Lys Glu Cys Cys Asp

290 295 300

Lys Pro Val Leu Glu Lys Ser Gln Cys Leu Ala Glu Val Glu Arg Asp

305 310 315 320

Glu Leu Pro Gly Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Asp

325 330 335

Lys Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly

340 345 350

Thr Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Glu Tyr Ser Val Ser

355 360 365

Leu Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Lys Cys

370 375 380

Cys Ala Thr Asp Asp Pro Pro Thr Cys Tyr Ala Lys Val Leu Asp Glu

385 390 395 400

Phe Lys Pro Leu Val Asp Glu Pro Gln Asn Leu Val Lys Thr Asn Cys

405 410 415

Glu Leu Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Leu

420 425 430

Val Arg Tyr Thr Lys Lys Ala Pro Gln Val Ser Thr Pro Thr Leu Val

435 440 445

Glu Val Ser Arg Lys Leu Gly Lys Val Gly Thr Lys Cys Cys Lys Lys

450 455 460

Pro Glu Ser Glu Arg Met Ser Cys Ala Glu Asp Phe Leu Ser Val Val

465 470 475 480

Leu Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Arg

485 490 495

Val Thr Lys Cys Cys Ser Glu Ser Leu Val Asn Arg Arg Pro Cys Phe

500 505 510

Ser Gly Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala

515 520 525

Glu Thr Phe Thr Phe His Ala Asp Leu Cys Thr Leu Pro Glu Ala Glu

530 535 540

Lys Gln Val Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys

545 550 555 560

Pro Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Gly Asp Phe Gly

565 570 575

Ala Phe Val Glu Lys Cys Cys Ala Ala Glu Asn Lys Glu Gly Cys Phe

580 585 590

Ser Glu Glu Gly Pro Lys Leu Val Ala Ala Ala Gln Ala Ala Leu Val

595 600 605

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Asn Tyr Thr Ser Tyr

610 615 620

Ile Leu Ala Phe Gln Leu Cys Val Ile Leu Cys Ser Ser Gly Cys Asn

625 630 635 640

Cys Gln Ala Met Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe

645 650 655

Asn Ala Ser Asn Pro Asp Val Ser Asp Gly Gly Ser Leu Phe Val Asp

660 665 670

Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp Lys Thr Ile Ile Gln Ser

675 680 685

Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe Asp Asn Phe Lys Asp Asn

690 695 700

Gln Ile Ile Gln Arg Ser Met Asp Thr Ile Lys Glu Asp Met Leu Gly

705 710 715 720

Lys Phe Leu Asn Ser Ser Thr Ser Lys Arg Glu Asp Phe Leu Lys Leu

725 730 735

Ile Gln Ile Pro Val Asn Asp Leu Gln Val Gln Arg Lys Ala Ile Asn

740 745 750

Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg

755 760 765

Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Lys

770 775 780

<210> 2

<211> 2352

<212> DNA

<213>Canine recombinant long-acting interferon γ genome 1

<400> 2

atgaagtggg taacttttat ttccctcttc tttctcttta gctctgctta ttccaggggc 60

ttggttcgac gagaagcata taagagtgag attgctcatc ggtacaatga tttgggagaa 120

gaacatttca gaggcctggt gctggttgcc ttttctcagt atctccagca gtgtccattt 180

gaggatcatg tgaaactagc caaggaagtg actgagtttg caaaagcctg tgctgctgaa 240

gagtcagggg ccaactgtga caaatccctt cacaccctgt tcggggacaa gctgtgcacg 300

gtggcctccc tccgggacaa gtacggggac atggccgact gctgcgagaa gcaggagccc 360

gacaggaacg agtgcttcct ggcgcacaag gacgacaacc cgggcttccc cccgctggtg 420

gcccccgagc ccgacgcgct gtgcgccgcc ttccaggaca acgagcagct gttcctgggg 480

aagtacctgt acgaaattgc cagaagacat ccgtacttct acgccccaga actcctgtac 540

tatgctcaac agtataaagg agtctttgcg gagtgctgcc aggccgcaga caaggccgcc 600

tgcctgggac ccaagattga ggctttgagg gaaaaagtac tgctttcatc tgccaaggag 660

agattcaagt gtgccagcct ccaaaaattc ggagatagag cctttaaagc ctggtcagta 720

gctcgcctga gccagcgatt tcccaaagct gactttgcag agatctccaa ggtggtgaca 780

gatcttacca aagtccacaa ggaatgctgc catggtgacc tgctggagtg tgcagatgac 840

agggcggatc ttgccaagta tatgtgtgaa aatcaagatt caatctccac taaactgaag 900

gaatgctgtg ataagcctgt gttggaaaaa tcccagtgtc ttgctgaggt ggaaagagat 960

gagttacctg gtgacctgcc ctcattagct gctgattttg ttgaagataa ggaggtttgc 1020

aaaaactatc aggaggcaaa ggatgtgttc ctgggcacgt ttttgtatga atacgcaaga 1080

aggcatccag agtactctgt ctcattgctt ttgagactcg ccaaggaata tgaagccaca 1140

ctagagaaat gctgtgccac cgatgatcct cctacatgct atgccaaagt gcttgatgaa 1200

tttaaacctc ttgtggatga gcctcagaat ttagtcaaaa caaactgtga actttttgaa 1260

aaacttggag agtatggctt ccaaaatgcg ctcttagttc gttacaccaa gaaagcaccc 1320

caagtgtcaa ctccaactct cgtggaggtc tcaagaaaac taggaaaagt gggcaccaaa 1380

tgttgtaaga aacctgaatc agagagaatg tcctgtgctg aagactttct gtccgtggtc 1440

ctgaaccggt tgtgtgtgtt gcacgagaag accccagtga gcgagagagt taccaaatgc 1500

tgctcagagt ccttggtgaa cagacgacca tgcttttctg gtctggaagt cgatgagacc 1560

tatgttccca aagagtttaa tgctgaaaca ttcactttcc atgcagattt atgcacactt 1620

cctgaggctg agaaacaagt caagaaacaa actgcacttg ttgaactgct gaaacacaag 1680

cccaaggcaa cagatgaaca actgaaaact gttatgggag attttggagc ctttgtagag 1740

aagtgctgcg cagctgaaaa taaagagggc tgcttttctg aagagggtcc aaaactcgtt 1800

gctgctgctc aagctgcctt agtcggtggt ggtggttctg gtggtggtgg ttctatgaat 1860

tatacaagct atatcttagc ttttcagctt tgcgtgattt tgtgttcttc tggctgtaac 1920

tgtcaggcca tgttttttaa agaaatagaa aacctaaagg aatattttaa tgcaagtaat 1980

ccagatgtat cggacggtgg gtctcttttc gtagatattt tgaagaaatg gagagaggag 2040

agtgacaaaa caatcattca gagccaaatt gtctctttct acttgaaact gtttgacaac 2100

tttaaagata accagatcat tcaaaggagc atggatacca tcaaggaaga catgcttggc 2160

aagttcttaa atagcagcac cagtaagagg gaggacttcc ttaagctgat tcaaattcct 2220

gtgaacgatc tgcaggtcca gcgcaaggcg ataaatgaac tcatcaaagt gatgaatgat 2280

ctctcaccaa gatccaacct aaggaagcgg aaaaggagtc agaatctgtt tcgaggccgc 2340

agagcatcga aa 2352

<210> 3

<211> 2352

<212> DNA

<213>Canine recombinant long-acting interferon γ genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgttc ttcctgttct cttctgctta ctctcgtggt 60

ctggttcgtc gtgaagctta caaatctgaa atcgctcacc gttacaacga cctgggtgaa 120

gaacacttcc gtggtctggt tctggttgct ttctctcagt acctgcagca gtgcccgttc 180

gaagaccacg ttaaactggc taaagaagtt accgaattcg ctaaagcttg cgctgctgaa 240

gaatctggtg ctaactgcga caaatctctg cacaccctgt tcggtgacaa actgtgcacc 300

gttgcttctc tgcgtgacaa atacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaccgtaacg aatgcttcct ggctcacaaa gacgacaacc cgggtttccc gccgctggtt 420

gctccggaac cggatgctct gtgcgctgcg ttccaggaca acgagcagct gttcctgggt 480

aaatacctgt acgaaatcgc tcgtcgtcac ccgtacttct acgctccgga actgctgtac 540

tacgctcagc agtacaaagg tgttttcgct gaatgctgcc aggctgctga caaagctgct 600

tgcctgggtc cgaaaatcga agctctgcgt gaaaaagttc tgctgtcttc tgctaaagaa 660

cgtttcaaat gcgcttctct gcagaaattc ggtgaccgtg ctttcaaagc ttggtctgtt 720

gctcgtctgt cgcagaggtt cccgaaagct gacttcgctg aaatctctaa agttgttacc 780

gacctgacca aagttcacaa agaatgctgc cacggtgacc tgctggaatg cgctgacgac 840

cgtgctgacc tggctaaata catgtgcgaa aaccaggact ctatctctac caaactgaaa 900

gaatgctgcg acaaaccggt tctggaaaaa tctcagtgcc tggctgaagt tgaacgtgac 960

gaactgccgg gtgacctgcc gtctctggct gctgacttcg ttgaagataa ggaagtgtgc 1020

aagaactacc aggaagctaa agacgttttc ctgggtacct tcctgtacga atacgctcgt 1080

cgtcacccgg aatactctgt ttctctgctg ctgcgtctgg ctaaagaata cgaagctacc 1140

ctggaaaaat gctgcgctac cgacgacccg ccgacctgct acgctaaagt tctggacgaa 1200

ttcaaaccgc tggttgacga accgcagaac ctggttaaaa ccaactgcga actgttcgaa 1260

aaactgggtg aatacggttt ccagaacgct ctgctggttc gttacaccaa aaaagctccg 1320

caggtttcta ccccgaccct ggttgaagtt tctcgtaaac tgggtaaagt tggtaccaaa 1380

tgctgcaaaa aaccggaatc tgaacgtatg tcttgcgctg aagacttcct gtctgttgtt 1440

ctgaaccgtc tgtgcgttct gcacgaaaaa accccggttt ctgaacgtgt taccaaatgc 1500

tgctctgaat ctctggttaa ccgtcgtccg tgcttctctg gtctggaagt tgacgaaacc 1560

tacgttccga aagaattcaa cgctgaaacc ttcaccttcc acgctgacct gtgcaccctg 1620

ccggaagctg aaaaacaggt taaaaaacag accgctctgg ttgaactgct gaaacacaaa 1680

ccgaaagcta ccgacgaaca gctgaaaacc gttatgggtg acttcggtgc tttcgttgaa 1740

aaatgctgcg ctgctgaaaa caaagaaggt tgcttctctg aagaaggtcc gaaactggtt 1800

gctgctgctc aggctgctct ggttggtggt ggtggttctg gtggtggtgg ttctatgaac 1860

tacacctctt acatcctggc tttccagctg tgcgttatcc tgtgctcttc tggttgcaac 1920

tgccaggcta tgttcttcaa agaaatcgaa aacctgaaag aatacttcaa cgcttctaac 1980

ccggacgttt ctgacggtgg ttctctgttc gttgacatcc tgaaaaaatg gcgtgaagaa 2040

tctgacaaaa ccatcatcca gtctcagatc gtttctttct acctgaaact gttcgacaac 2100

ttcaaagaca accagatcat ccagcgttct atggacacca tcaaagaaga catgctgggt 2160

aaattcctga actcttctac ctctaaacgt gaagacttcc tgaaactgat ccagatcccg 2220

gttaacgacc tgcaggttca gcgtaaagct atcaacgaac tgatcaaagt tatgaacgac 2280

ctgtctccgc gttctaacct gcgtaaacgt aaacgttctc agaacctgtt ccgtggtcgt 2340

cgtgcttcta aa 2352

<210> 4

<211> 1824

<212> DNA

<213>Dog albumin

<400> 4

atgaagtggg taacttttat ttccctcttc tttctcttta gctctgctta ttccaggggc 60

ttggttcgac gagaagcata taagagtgag attgctcatc ggtacaatga tttgggagaa 120

gaacatttca gaggcctggt gctggttgcc ttttctcagt atctccagca gtgtccattt 180

gaggatcatg tgaaactagc caaggaagtg actgagtttg caaaagcctg tgctgctgaa 240

gagtcagggg ccaactgtga caaatccctt cacaccctgt tcggggacaa gctgtgcacg 300

gtggcctccc tccgggacaa gtacggggac atggccgact gctgcgagaa gcaggagccc 360

gacaggaacg agtgcttcct ggcgcacaag gacgacaacc cgggcttccc cccgctggtg 420

gcccccgagc ccgacgcgct gtgcgccgcc ttccaggaca acgagcagct gttcctgggg 480

aagtacctgt acgaaattgc cagaagacat ccgtacttct acgccccaga actcctgtac 540

tatgctcaac agtataaagg agtctttgcg gagtgctgcc aggccgcaga caaggccgcc 600

tgcctgggac ccaagattga ggctttgagg gaaaaagtac tgctttcatc tgccaaggag 660

agattcaagt gtgccagcct ccaaaaattc ggagatagag cctttaaagc ctggtcagta 720

gctcgcctga gccagcgatt tcccaaagct gactttgcag agatctccaa ggtggtgaca 780

gatcttacca aagtccacaa ggaatgctgc catggtgacc tgctggagtg tgcagatgac 840

agggcggatc ttgccaagta tatgtgtgaa aatcaagatt caatctccac taaactgaag 900

gaatgctgtg ataagcctgt gttggaaaaa tcccagtgtc ttgctgaggt ggaaagagat 960

gagttacctg gtgacctgcc ctcattagct gctgattttg ttgaagataa ggaggtttgc 1020

aaaaactatc aggaggcaaa ggatgtgttc ctgggcacgt ttttgtatga atacgcaaga 1080

aggcatccag agtactctgt ctcattgctt ttgagactcg ccaaggaata tgaagccaca 1140

ctagagaaat gctgtgccac cgatgatcct cctacatgct atgccaaagt gcttgatgaa 1200

tttaaacctc ttgtggatga gcctcagaat ttagtcaaaa caaactgtga actttttgaa 1260

aaacttggag agtatggctt ccaaaatgcg ctcttagttc gttacaccaa gaaagcaccc 1320

caagtgtcaa ctccaactct cgtggaggtc tcaagaaaac taggaaaagt gggcaccaaa 1380

tgttgtaaga aacctgaatc agagagaatg tcctgtgctg aagactttct gtccgtggtc 1440

ctgaaccggt tgtgtgtgtt gcacgagaag accccagtga gcgagagagt taccaaatgc 1500

tgctcagagt ccttggtgaa cagacgacca tgcttttctg gtctggaagt cgatgagacc 1560

tatgttccca aagagtttaa tgctgaaaca ttcactttcc atgcagattt atgcacactt 1620

cctgaggctg agaaacaagt caagaaacaa actgcacttg ttgaactgct gaaacacaag 1680

cccaaggcaa cagatgaaca actgaaaact gttatgggag attttggagc ctttgtagag 1740

aagtgctgcg cagctgaaaa taaagagggc tgcttttctg aagagggtcc aaaactcgtt 1800

gctgctgctc aagctgcctt agtc 1824

<210> 5

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 5

atgaattata caagctatat cttagctttt cagctttgcg tgattttgtg ttcttctggc 60

tgtaactgtc aggccatgtt ttttaaagaa atagaaaacc taaaggaata ttttaatgca 120

agtaatccag atgtatcgga cggtgggtct cttttcgtag atattttgaa gaaatggaga 180

gaggagagtg acaaaacaat cattcagagc caaattgtct ctttctactt gaaactgttt 240

gacaacttta aagataacca gatcattcaa aggagcatgg ataccatcaa ggaagacatg 300

cttggcaagt tcttaaatag cagcaccagt aagagggagg acttccttaa gctgattcaa 360

attcctgtga acgatctgca ggtccagcgc aaggcgataa atgaactcat caaagtgatg 420

aatgatctct caccaagatc caacctaagg aagcggaaaa ggagtcagaa tctgtttcga 480

ggccgcagag catcgaaa 498

<210> 6

<211> 1824

<212> DNA

<213>Dog albumin

<400> 6

atgaaatggg ttaccttcat ctctctgttc ttcctgttct cttctgctta ctctcgtggt 60

ctggttcgtc gtgaagctta caaatctgaa atcgctcacc gttacaacga cctgggtgaa 120

gaacacttcc gtggtctggt tctggttgct ttctctcagt acctgcagca gtgcccgttc 180

gaagaccacg ttaaactggc taaagaagtt accgaattcg ctaaagcttg cgctgctgaa 240

gaatctggtg ctaactgcga caaatctctg cacaccctgt tcggtgacaa actgtgcacc 300

gttgcttctc tgcgtgacaa atacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaccgtaacg aatgcttcct ggctcacaaa gacgacaacc cgggtttccc gccgctggtt 420

gctccggaac cggatgctct gtgcgctgcg ttccaggaca acgagcagct gttcctgggt 480

aaatacctgt acgaaatcgc tcgtcgtcac ccgtacttct acgctccgga actgctgtac 540

tacgctcagc agtacaaagg tgttttcgct gaatgctgcc aggctgctga caaagctgct 600

tgcctgggtc cgaaaatcga agctctgcgt gaaaaagttc tgctgtcttc tgctaaagaa 660

cgtttcaaat gcgcttctct gcagaaattc ggtgaccgtg ctttcaaagc ttggtctgtt 720

gctcgtctgt cgcagaggtt cccgaaagct gacttcgctg aaatctctaa agttgttacc 780

gacctgacca aagttcacaa agaatgctgc cacggtgacc tgctggaatg cgctgacgac 840

cgtgctgacc tggctaaata catgtgcgaa aaccaggact ctatctctac caaactgaaa 900

gaatgctgcg acaaaccggt tctggaaaaa tctcagtgcc tggctgaagt tgaacgtgac 960

gaactgccgg gtgacctgcc gtctctggct gctgacttcg ttgaagataa ggaagtgtgc 1020

aagaactacc aggaagctaa agacgttttc ctgggtacct tcctgtacga atacgctcgt 1080

cgtcacccgg aatactctgt ttctctgctg ctgcgtctgg ctaaagaata cgaagctacc 1140

ctggaaaaat gctgcgctac cgacgacccg ccgacctgct acgctaaagt tctggacgaa 1200

ttcaaaccgc tggttgacga accgcagaac ctggttaaaa ccaactgcga actgttcgaa 1260

aaactgggtg aatacggttt ccagaacgct ctgctggttc gttacaccaa aaaagctccg 1320

caggtttcta ccccgaccct ggttgaagtt tctcgtaaac tgggtaaagt tggtaccaaa 1380

tgctgcaaaa aaccggaatc tgaacgtatg tcttgcgctg aagacttcct gtctgttgtt 1440

ctgaaccgtc tgtgcgttct gcacgaaaaa accccggttt ctgaacgtgt taccaaatgc 1500

tgctctgaat ctctggttaa ccgtcgtccg tgcttctctg gtctggaagt tgacgaaacc 1560

tacgttccga aagaattcaa cgctgaaacc ttcaccttcc acgctgacct gtgcaccctg 1620

ccggaagctg aaaaacaggt taaaaaacag accgctctgg ttgaactgct gaaacacaaa 1680

ccgaaagcta ccgacgaaca gctgaaaacc gttatgggtg acttcggtgc tttcgttgaa 1740

aaatgctgcg ctgctgaaaa caaagaaggt tgcttctctg aagaaggtcc gaaactggtt 1800

gctgctgctc aggctgctct ggtt 1824

<210> 7

<211> 498

<212> DNA

<213>Canine IFN-γ

<400> 7

atgaactaca cctcttacat cctggctttc cagctgtgcg ttatcctgtg ctcttctggt 60

tgcaactgcc aggctatgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgtttctga cggtggttct ctgttcgttg acatcctgaa aaaatggcgt 180

gaagaatctg acaaaaccat catccagtct cagatcgttt ctttctacct gaaactgttc 240

gacaacttca aagacaacca gatcatccag cgttctatgg acaccatcaa agaagacatg 300

ctgggtaaat tcctgaactc ttctacctct aaacgtgaag acttcctgaa actgatccag 360

atcccggtta acgacctgca ggttcagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaaa 498

Claims (10)

1. a kind of fusion protein being made of dog albumin and dog interferon γ, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of canine recombinant long-acting interferon γ, which is characterized in that the canine recombinant long-acting interferon γ is as described in claim 1 Fusion protein and freeze drying protectant mixture after, it is freeze-dried to form.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ, preparation method are：

(1) design primer, is obtained or the dog albumin of the flexible linker sequence of artificial synthesized connection and dog by reverse transcription The target gene of interferon gamma；The target gene of dog albumin and dog interferon γ is connected by flexible linker, mesh Gene nucleotides sequence list as shown in 400 < of SEQUENCE LISTING, 2 > or such as 400 < of SEQUENCE LISTING, 3 > It is shown；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained γ。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of canine recombinant long-acting interferon γ according to claim 5, which is characterized in that the canine recombinant is long-acting The long half time of interferon gamma had broad-spectrum disease resistance toxic action and can improve the immune response of dog itself up to 53 hours or more.