CN108840947A - Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon - Google Patents

Abstract

The invention discloses bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding genes, a kind of ox long-acting interferon, bovine albumin, Bov IFN α and ox interleukin-22 are connected by flexibility linker, obtain bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, recombinant bovine long-acting interferon is finally prepared, it is remarkably improved the half-life period of Bov IFN, the half-life period of more common Bov IFN improves 20 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of Niu Zishen.

Description

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its coding base Cause, a kind of ox long-acting interferon

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to bovine albumin-interferon-' alpha '-interleukin-22 merges egg White, preparation method and its encoding gene, a kind of ox long-acting interferon.Bovine albumin, Bov IFN α and ox interleukin-22 are passed through Flexible flexibility linker connection, obtains bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, most Recombinant bovine long-acting interferon is prepared eventually.

Background technique

Ox is important one of the herding type in China, with intensive and large-scale cultivation continuous development, bovine viral The disease incidence of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease infects fastly, and disease incidence, the death rate are high seriously to restrict the sound development of China's ox aquaculture；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

Mainly pass through vaccine inoculation to the prevention and treatment approach of ox communicable disease at present and uses antibiotic.Big portion Antibiotics and traditional oral antiviral medicament is divided to bring a negative impact due to medicament residue problem to health；And Traditional vaccine, high specific and side effect due to it, can not resist virus variation and new virus continuously emerges to pig Aquaculture bring significant damage.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical application potentiality, can be used to prevent and treat bovine viral bacterial infection disease.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor In conjunction with rear, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation disease Malicious RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selective Ground acts on the infection cells such as virus, by inhibiting the biosynthesis of the virus protein in infected cell, plays wide spectrum and height Imitate antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition disease Malicious duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve Curative effect of medication.IL-2, according to gene constructed, composition fusion protein, is generated and is mentioned to enhance the antibody of vaccine with other cell factors High cellular immune level.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, the purpose of the present invention is to provide bovine albumin-interferon-' alpha '-interleukin-22s to merge egg Bovine albumin, Bov IFN α and ox interleukin-22 are connected by flexibility flexibility linker, obtain Niu Bai by bletilla preparation method Albumen-interferon-' alpha '-interleukin-22 fusion protein.

Another object of the present invention is to provide the encoding gene of above-mentioned bovine albumin-interferon-' alpha '-interleukin-22 fusion protein.

It is also an object of the present invention to provide a kind of long-acting Bov IFNs, utilize above-mentioned bovine albumin-interferon-' alpha '- It is freeze-dried that a kind of ox long-acting interferon, the ox is prepared after interleukin-22 fusion protein is mixed with freeze drying protectant Long-acting interferon is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN improves 20 times or more, and has There is broad-spectrum disease resistance toxic action and the immune response of Niu Zishen can be improved.

The technical scheme adopted by the invention is as follows：

A kind of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides coding bovine albumin-interferon-' alpha '-interleukin-22 fusion protein gene, the core of the gene Nucleotide sequence table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as SEQUENCE LISTING 400 Shown in 3 > of <, it is denoted as genome 2.

The genome 1 and the equal codified fusion protein of the genome 2.Genome 2 is the nucleotides sequence to genome 1 Column optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene and be in the expression system Optimal high efficient expression state, CAI value is lower to show that expression is lower in host.G/C content most ideal distribution model in gene Enclosing is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.Ox is found using software detection Albumin, ox IFN-α, ox IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.22,0.25,0.19, GC percentage is 42.9%, 58.2%, 39.1%；And by bovine albumin, ox IFN-α, ox IL-2 It is 0.99,0.97,0.94, GC percentage that each gene codon adaptation indexI (CAI) in Escherichia coli is obtained after gene optimization 49.9%, 54.6%, 48.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides bovine albumin-interferon-' alpha '-interleukin-22 fusion protein preparation method, the preparation methods Include the following steps：Expression vector containing genome 1 or genome 2 is imported into e. coli host cell, base is obtained Because of engineering bacteria, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, can be obtained and melts after purified Hop protein.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, and preparation method is：

(1) design primer obtains by reverse transcription or is manually respectively synthesized the synthesis ox for connecting flexible linker sequence The target gene of albumin, Bov IFN α and cattle interleukins-2 2；By flexible linker by bovine albumin, Bov IFN α, The target gene of cattle interleukins-2 2 connects, the nucleotides sequence list such as SEQUENCE of the target gene after connection Shown in 400 < of LISTING, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained IFNα-IL2。

Further, the e. coli host cell is for BL21 (DE3) competent cell or with pGro7 plasmid BL21 (DE3) competent cell.BL21 (DE3) competent cell with pGro7 plasmid has purchased from Shanghai offshore science and technology Limit company/glad hundred promise biology, article No. V205.

Further, the method for the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography And molecular sieve chromatography purification.

Further, the acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of bovine albumin (Alb) is：

Upstream Alb-F1：

CCGGAATTCATGAAGTGGGTGACTT has EcoRI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGGCTGTTTG, with flexible linker；

The primer sequence of Bov IFN α (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCTC, with flexible linker；

Downstream IFN-α-R1：

ACCACCACCAGAACCACCACCACCGTCCTTTCTCCTGAAAC, with flexible linker；

The primer sequence of cattle interleukins-2 2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAGATACAACTCT, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCATTGTTGAGTAGAT has XhoI restriction enzyme site；

B. RNA is extracted from cattle liver, by reverse transcription obtain ox Alb, ox IFN-α and ox IL-2 target gene, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of ox Alb, ox IFN-α and ox IL-2 as template, and be utilized respectively ox Alb, ox IFN-α and The upstream and downstream primer of ox IL-2 carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of geneome RNA, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection ox Alb and ox IFN α gene are utilized, Alb-IFN α gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects each 0.5 μ L of 1 μ L, Alb upstream primer of IFN-α template DNA of flexible linker, IFN-α 0.5 μ L, Taq DNA polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN α gene and ox IL2 gene are utilized, rAlb-IFN α-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of bovine albumin (Alb) is：

Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCTT has BamHI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGAGCGGTC, with flexible linker；

The primer sequence of Bov IFN α (IFN-α) is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCG, with flexible linker；

Downstream IFN-α-R2：

ACCACCACCAGAACCACCACCACCGTCTTTACGACGGAAA, with flexible linker；

Cattle interleukins-2 2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATCCAGCT, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCATGGTAGAGTAGA has XhoI restriction enzyme site.

B. the ox Alb, ox IFN-α and ox IL-2 target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

Respectively using the target gene of ox Alb, ox IFN-α and ox IL-2 as template, and be utilized respectively ox Alb, ox IFN-α and The upstream and downstream primer of ox IL-2 carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq DNA polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition be：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, Circulation 35 times, 10 min of last 72 DEG C of extensions.

C. flexibility linker connection ox Alb and ox IFN α gene are utilized, Alb-IFN α gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L, Alb upstream primer of IFN-α template DNA, the 0.5 μ L of 1 μ L of Alb gene template DNA, the flexible linker of connection, IFN-α 0.5 μ L, Taq DNA polymerase of downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connect PCR Reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN α gene and ox IL2 gene are utilized, rAlb-IFN α-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of 1 μ L of DNA, the flexible linker of connection, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95 DEG C initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Finally 72 DEG C of extension 10min.

The present invention also provides a kind of ox long-acting interferon, the ox long-acting interferon is by the bovine albumin-interference It is freeze-dried to form after plain α-interleukin-22 fusion protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The present invention also provides the application of the ox long-acting interferon, long half time had wide spectrum up to 82 hours or more Antivirus action and the immune response that Niu Zishen can be improved.

Compared with prior art, the present invention has the advantages that：

1. ox Alb, ox IFN-α and ox IL-2 gene are realized amalgamation and expression by flexibility linker, interferon is improved Half-life period improves 20 times compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving ox Alb, ox IFN-α and ox IL-2 by optimizing to ox Alb, ox IFN-α and ox IL-2 gene The expression quantity of fusion protein.

3. using recombination bacillus coli pET-32a/Alb-IFN α-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of ox Alb, ox IFN-α and ox IL-2 not only has the wide of IFN-α Antivirus action is composed, while significantly improving the immune response of Niu Zishen.

Detailed description of the invention

Fig. 1 is that bovine albumin gene, Bov IFN α gene and the 2 gene RT-PCR of cattle interleukins-2 in embodiment 1 expand The result of increasing；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Ox interleukin-22 gene RT-PCR amplified production；Swimming lane 2：Niu Gan Disturb plain α gene RT-PCR amplified production；Swimming lane 3：Bovine albumin gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in ox Alb, IFN-α connected with the target gene of IL-2 after PCR amplification result；Swimming Road M：DNA Marker DL10000；Swimming lane 1：Bovine albumin gene, Bov IFN α gene connect expansion with ox interleukin-22 gene Increase production object；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：After bacterial cell disruption after recombinant bacterium induction Precipitating；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the recombinant bovine long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombinant long-acting Bov IFN α of gradient dilution (from right to left) handles hole；

Fig. 7 is the recombinant bovine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein preparation method, includes the following steps：

1. the acquisition of bovine albumin (Alb), Bov IFN α (IFN-α) and cattle interleukins-2 2 (IL-2) target gene with Amplimer design：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of bovine albumin In primer introduce EcoRI restriction enzyme site, in downstream primer introduce Linker sequence, Bov IFN α upstream primer and under Linker sequence is introduced respectively in trip primer, Linker sequence is introduced in the upstream primer of cattle interleukins-2 2, in downstream primer Middle introducing XhoI restriction enzyme site.

Table 1PCR amplimer

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, the target gene of ox Alb, ox IFN-α and ox IL-2 are obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

Table 2RT-PCR reaction system

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1850bp, 560bp and 500bp or so through agarose gel electrophoresis in RT-PCR amplified production, Its result illustrates the target gene that ox Alb, ox IFN-α and ox IL-2 has been prepared as shown in Fig. 1.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

Table 3Alb-IFN- α PCR reaction system

Table 4Alb-IFN- α-IL-2PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2840bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs Alb-IFN α and IL-2 amplified product band in Fig. 2, this is because the process connected in Alb-IFN α with IL-2 gene In, there is non-specific responding.The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion Product detects single band at the place 2840bp or so through agarose gel electrophoresis, and result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, result is such as Shown in Fig. 4, it can be seen from the figure that recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the place 122.6KD or so can See predominant expression band, illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN α-IL2 protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino of Elution Buffer II Methane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN α-IL2 protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C It saves.The fusion protein being made of bovine albumin, Bov IFN α and cattle interleukins-2 2 can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 2

A kind of preparation method of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, the preparation method is the same as that of Example 1, only E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmid is thin Born of the same parents.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,122.6KD or so place's predominant expression item in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with Expression albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 3

A kind of preparation method of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method are as follows：

1. the acquisition of bovine albumin (Alb), Bov IFN α (IFN-α) and cattle interleukins-2 2 (IL-2) target gene with Amplification

Ox Alb, ox IFN-α and ox IL-2 in embodiment 1 is optimized, artificial synthesized ox Alb, ox IFN-α and ox IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to ox Alb, ox IFN-α and Ox IL-2 gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Bovine albumin, ox are found using software detection IFN-α, ox IL-2 original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.22,0.25, 0.19, GC percentage is 42.9%, 58.2%, 39.1%；And by after to bovine albumin, ox IFN-α, ox IL-2 gene optimization Obtain each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,0.97,0.94, GC percentage 49.9%, 54.6%, 48.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to albumen table The influence reached improves the G/C content of gene, improves transcription and translation efficiency, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

Table 7PCR amplimer

The genomic DNA of ox Alb, ox IFN-α and ox IL-2 after optimization are diluted to 0.05mg/mL respectively.Utilize PCR Amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

Table 8PCR reaction system

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of ox Alb, ox IFN-α and ox IL-2 are through agarose gel electrophoresis respectively in 1850bp, 560bp There is specific band with 500bp or so, the purpose base of ox Alb, ox IFN-α and ox IL-2 after illustrating to be prepared optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

Table 9Alb-IFN α PCR reaction system

Table 10rAlb-IFN α-IL2PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2840bp or so through agarose gel electrophoresis in pcr amplification product, is Alb-IFN α and IL-2 Amplified product band, this is because there is non-specific responding during Alb-IFN α is connected with IL-2 gene.It obtains The nucleotide sequence of target gene is as shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 2840bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN α-IL2 fusion carries Body constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium is lured Supernatant is deposited in the visible predominant expression band in the place 122.6KD or so after bacterial cell disruption after leading 5h, illustrates to precipitate in supernatant In obtained recombinant protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN α-IL2 protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, After being stablized again with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino of Elution Buffer II Methane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN α-IL2 protein peak.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, use Binding Buffer III is eluted, and collects rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of bovine albumin, Bov IFN α and cattle interleukins-2 2, amino acid sequence can be obtained As shown in 400 < of SEQUENCE LISTING, 1 >.

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 4

A kind of preparation method of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, other are with embodiment 3, only by it In e. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.Its The SDS-PAGE electrophoresis result of fusion protein is compareed with embodiment 3, in supernatant 122.6KD or so place's predominant expression band compared with Slightly, illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher. The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression in expression bacterial strain Albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 5

A kind of ox long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively and after freeze drying protectant mixture, It is freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, three with 10mmol/L PBS Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Embodiment 6

Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein identification that Examples 1 to 4 obtains

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration difference 2.5mg/ml, 2.4mg/ml, 2.6mg/ml, 2.6mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 122.6KD or so, as shown in Figure 4.

6.3Western Blot result

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-ox alpha interferon (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting Bov IFN sample can be with anti-Bov IFN α Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 122.6KD or so, as shown in Figure 5.

Embodiment 7

The freeze-dried bioactivity of four parts of long-acting Bov IFNs of ox in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant long-acting of various dose is added in culture Bov IFN is inhaled afterwards abandon for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the recombinant long-acting Bov IFN obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant long-acting obtained After Bov IFN treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant long-acting Bov IFNs obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried The measurement of (being denoted as A, B, C, D respectively) in ox intracorporal half-life period

A be embodiment 1 prepare freeze-dried, B be embodiment 2 prepare freeze-dried, C be embodiment 3 prepare it is freeze-dried, D is the freeze-dried of the preparation of embodiment 4.

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN α-IL2

The beef cattle (half male and half female) that six weight are roughly the same is taken, 2mg/ml recombinant bovine long-acting interferon is subcutaneously injected in neck The freeze-dried 2ml of α, respectively 1h, 3h, 6h, 12h, for 24 hours, 48h, 72h, 96h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low temperature It is centrifuged 10min and separates serum, every ox blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN α-IL2 in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculated result It is shown in Table 13.

Dominant dynamic parameters in serum after 13 recombinant long-acting Bov IFN α intramuscular injection of table

The result shows that recombinant long-acting Bov IFN has longer half-life period.Half-life period can reach 82h or so after measured, more general Logical interferon improves about 20 times.

Embodiment 9

The freeze-dried measurement that ox cellullar immunologic response is influenced of four parts of recombinant long-acting Bov IFNs in embodiment 5

It takes six roughly the same beef cattles of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml freeze-dried 2ml of recombinant long-acting Bov IFN is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside ox All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IFN γ, IL-4 content, are carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that table 14ELISA detects each group ox cellullar immunologic response

The result shows that injection recombinant long-acting Bov IFN after, can significantly improve ox Evaluation of Cytokines in Peripheral Blood IFN γ, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned that a kind of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein and preparation method thereof is carried out referring to embodiment Detailed description, be illustrative without being restrictive, can enumerate several embodiments according to limited range, thus The change and modification under present general inventive concept are not departed from, should be belonged within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox are long-acting dry Disturb element

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 948

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Lys Asp Leu Gly Glu Glu His Phe Lys Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Asn Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Glu Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Ser Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Ser

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Asp Pro Asn

130 135 140

Thr Leu Cys Asp Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Glu Thr Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Glu Phe Val Glu Val Thr Lys

245 250 255

Leu Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp Asn Gln Asp Thr Ile Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Lys Asp Ala

305 310 315 320

Ile Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Asp Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Ala Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Glu Cys Cys

370 375 380

Ala Lys Asp Asp Pro His Ala Cys Tyr Ser Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Asp

405 410 415

Gln Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Val Ser Arg Ser Leu Gly Lys Val Gly Thr Arg Cys Cys Thr Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Ala Leu Thr Pro Asp Glu Thr Tyr Val Pro Lys Ala Phe Asp Glu Lys

515 520 525

Leu Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Glu Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Ala Cys Phe Ala

580 585 590

Val Glu Gly Pro Lys Leu Val Val Ser Thr Gln Thr Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Cys His Leu Pro His Thr His

610 615 620

Ser Leu Ala Asn Arg Arg Val Leu Met Leu Leu Gly Gln Leu Arg Arg

625 630 635 640

Val Ser Pro Ser Ser Cys Leu Gln Asp Arg Asn Asp Phe Ala Phe Pro

645 650 655

Gln Glu Ala Leu Gly Gly Ser Gln Leu Gln Lys Ala Gln Ala Ile Ser

660 665 670

Val Leu His Glu Val Thr Gln His Thr Phe Gln Leu Phe Ser Thr Glu

675 680 685

Gly Ser Ala Thr Thr Trp Asp Glu Ser Leu Leu Asp Lys Leu Arg Ala

690 695 700

Ala Leu Asp Gln Gln Leu Thr Asp Leu Gln Ala Cys Leu Arg Gln Glu

705 710 715 720

Glu Glu Leu Gln Gly Ala Pro Leu Leu Lys Glu Asp Ser Ser Leu Ala

725 730 735

Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr Leu Gln Glu Lys Lys

740 745 750

His Ser Pro Cys Ala Trp Glu Val Val Arg Ala Gln Val Met Arg Ala

755 760 765

Phe Ser Ser Ser Thr Asn Leu Gln Glu Ser Phe Arg Arg Lys Asp Gly

770 775 780

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Tyr Lys Ile Gln Leu Leu

785 790 795 800

Ser Cys Ile Ala Leu Thr Leu Ala Leu Val Ala Asn Gly Ala Pro Thr

805 810 815

Ser Ser Ser Thr Gly Asn Thr Met Lys Glu Val Lys Ser Leu Leu Leu

820 825 830

Asp Leu Gln Leu Leu Leu Glu Lys Val Lys Asn Pro Glu Asn Leu Lys

835 840 845

Leu Ser Arg Met His Thr Phe Asp Phe Tyr Val Pro Lys Val Asn Ala

850 855 860

Thr Glu Leu Lys His Leu Lys Cys Leu Leu Glu Glu Leu Lys Leu Leu

865 870 875 880

Glu Glu Val Leu Asn Leu Ala Pro Ser Lys Asn Leu Asn Pro Arg Glu

885 890 895

Ile Lys Asp Ser Met Asp Asn Ile Lys Arg Ile Val Leu Glu Leu Gln

900 905 910

Gly Ser Glu Thr Arg Phe Thr Cys Glu Tyr Asp Asp Ala Thr Val Asn

915 920 925

Ala Val Glu Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile Tyr

930 935 940

Ser Thr Met Thr

945

<210> 2

<211> 2844

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120

gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180

gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240

gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420

ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780

ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840

gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900

tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960

atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020

aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260

cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320

gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380

tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560

gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800

tcaactcaaa cagccttagc cggtggtggt ggttctggtg gtggtggttc ttgccacctg 1860

cctcacaccc acagcctggc caacaggagg gtcctgatgc tcctgggaca actgaggagg 1920

gtctcccctt cctcctgcct gcaggacaga aatgacttcg cattccccca ggaggcgctg 1980

ggtggcagcc agttgcagaa ggctcaagcc atctctgtgc tccacgaggt gacccagcac 2040

accttccagc ttttcagcac agagggctcg gccactacgt gggatgagag cctcctggac 2100

aagctccgcg ctgcactgga tcagcagctc actgacctgc aagcctgtct gaggcaggag 2160

gaggagctgc aaggagctcc cctgctcaag gaggactcca gcctggctgt gaggaaatac 2220

ttccacagac tcactctcta tctgcaagag aagaaacaca gcccttgtgc ctgggaggtt 2280

gtcagagcac aagtcatgag agccttctct tcctcaacaa acttgcagga gagtttcagg 2340

agaaaggacg gtggtggtgg ttctggtggt ggtggttcta tgtacaagat acaactcttg 2400

tcttgcattg cactaactct tgcactcgtt gcaaacggtg cacctacttc aagctctacg 2460

gggaacacaa tgaaagaagt gaagtcattg ctgctggatt tacagttgct tttggagaaa 2520

gttaaaaatc ctgagaacct caagctctcc aggatgcata catttgactt ttacgtgccc 2580

aaggttaacg ctacagaatt gaaacatctt aagtgtttac tagaagaact caaacttcta 2640

gaggaagtgc taaatttagc tccaagcaaa aacctgaacc ccagagagat caaggattca 2700

atggacaata tcaagagaat cgttttggaa ctacagggat ctgaaacaag attcacatgt 2760

gaatatgatg atgcaacagt aaacgctgta gaatttctga acaaatggat taccttttgt 2820

caaagcatct actcaacaat gact 2844

<210> 3

<211> 2844

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc ttgccacctg 1860

ccgcacaccc actctctggc taaccgtcgt gttctgatgc tgctgggtca gttacgtcgt 1920

gtaagcccgt cttcttgcct gcaggaccgt aacgacttcg ctttcccgca ggaagctctg 1980

ggtggttctc agctgcagaa agctcaggct atctctgttc tgcacgaagt tacccagcac 2040

accttccagc tgttctctac cgaaggttct gctaccacct gggacgaatc tctgctggac 2100

aaactgcgtg ctgctctgga ccagcagctg accgacctgc aggcttgcct gcgtcaggaa 2160

gaagaactgc agggtgctcc gctgctgaaa gaagactctt ctctggctgt tcgtaaatac 2220

ttccaccgtc tgaccctgta cctgcaggaa aaaaaacact ctccgtgcgc ttgggaagtt 2280

gttcgtgctc aggttatgcg tgctttctct tcttctacca acctgcagga atctttccgt 2340

cgtaaagacg gtggtggtgg ttctggtggt ggtggttcta tgtacaaaat ccagctgctg 2400

tcttgcatcg ctctgaccct ggctctggtt gctaacggtg ctccgacctc ttcttctacc 2460

ggtaacacca tgaaagaagt taaatctctg ctgctggacc tgcagctgct gctggaaaaa 2520

gttaaaaacc cggaaaacct gaaactgtct cgtatgcaca ccttcgactt ctacgttccg 2580

aaagttaacg ctaccgaact gaaacacctg aaatgcctgc tggaagaact gaaactgctg 2640

gaagaagttc tgaacctggc tccgtctaaa aacctgaacc cgcgtgaaat caaagactct 2700

atggacaaca tcaaacgtat cgttctggaa ctgcagggtt cggagaccag gttcacctgc 2760

gaatacgacg acgctaccgt taacgctgtt gaattcctga acaaatggat caccttctgc 2820

cagtctatct actctaccat gacc 2844

<210> 4

<211> 1821

<212> DNA

<213>Bovine albumin gene order before optimizing

<400> 4

atgaagtggg tgacttttat ttctcttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaaaga tttgggagaa 120

gaacatttta aaggcctggt actgattgcc ttttctcagt atctccagca gtgtccattt 180

gatgagcatg taaaattagt gaacgaacta actgagtttg caaaaacatg tgttgctgat 240

gagtcccatg ccggctgtga aaagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcatccc ttcgtgaaac ctatggtgac atggctgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gagccacaaa gatgatagcc cagacctccc taaattgaaa 420

ccagacccca atactttgtg tgatgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aaattgctag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctgctaccaa agattgaaac tatgagagaa aaggtactag cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaatttgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgag tttgtagaag ttaccaagct agtgacagat 780

ctcacaaaag tccacaagga atgctgccat ggtgacctac ttgaatgcgc agatgacagg 840

gcagatcttg ccaagtacat atgtgataat caagatacaa tctccagtaa actgaaggaa 900

tgctgtgata agcctttgtt ggaaaaatcc cactgcattg ctgaggtaga aaaagatgcc 960

atacctgaaa acctgccccc attaactgct gactttgctg aagataagga tgtttgcaaa 1020

aactatcagg aagcaaaaga tgccttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgaat atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggaatgct gtgccaaaga tgatccacat gcatgctatt ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaacaaa actgtgacca attcgaaaaa 1260

cttggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agtaccccaa 1320

gtgtcaactc caactctcgt ggaggtttca agaagcctag gaaaagtggg tactaggtgt 1380

tgtacaaagc cggaatcaga aagaatgccc tgtactgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgctgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acagagtcat tggtgaacag acggccatgt ttctctgctc tgacacctga tgaaacatat 1560

gtacccaaag cctttgatga gaaattgttc accttccatg cagatatatg cacacttccc 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag aggaacaact gaaaaccgtc atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaagcctgc tttgctgtgg agggtccaaa acttgttgtt 1800

tcaactcaaa cagccttagc c 1821

<210> 5

<211> 498

<212> DNA

<213>Ox IFN-α gene order before optimizing

<400> 5

tgccacctgc ctcacaccca cagcctggcc aacaggaggg tcctgatgct cctgggacaa 60

ctgaggaggg tctccccttc ctcctgcctg caggacagaa atgacttcgc attcccccag 120

gaggcgctgg gtggcagcca gttgcagaag gctcaagcca tctctgtgct ccacgaggtg 180

acccagcaca ccttccagct tttcagcaca gagggctcgg ccactacgtg ggatgagagc 240

ctcctggaca agctccgcgc tgcactggat cagcagctca ctgacctgca agcctgtctg 300

aggcaggagg aggagctgca aggagctccc ctgctcaagg aggactccag cctggctgtg 360

aggaaatact tccacagact cactctctat ctgcaagaga agaaacacag cccttgtgcc 420

tgggaggttg tcagagcaca agtcatgaga gccttctctt cctcaacaaa cttgcaggag 480

agtttcagga gaaaggac 498

<210> 6

<211> 465

<212> DNA

<213>Ox IL-2 gene order before optimizing

<400> 6

atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120

ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180

acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300

cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 7

<211> 1821

<212> DNA

<213>Bovine albumin gene order after optimization

<400> 7

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc t 1821

<210> 8

<211> 498

<212> DNA

<213>Ox IFN-α gene order after optimization

<400> 8

tgccacctgc cgcacaccca ctctctggct aaccgtcgtg ttctgatgct gctgggtcag 60

ttacgtcgtg taagcccgtc ttcttgcctg caggaccgta acgacttcgc tttcccgcag 120

gaagctctgg gtggttctca gctgcagaaa gctcaggcta tctctgttct gcacgaagtt 180

acccagcaca ccttccagct gttctctacc gaaggttctg ctaccacctg ggacgaatct 240

ctgctggaca aactgcgtgc tgctctggac cagcagctga ccgacctgca ggcttgcctg 300

cgtcaggaag aagaactgca gggtgctccg ctgctgaaag aagactcttc tctggctgtt 360

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aaaaacactc tccgtgcgct 420

tgggaagttg ttcgtgctca ggttatgcgt gctttctctt cttctaccaa cctgcaggaa 480

tctttccgtc gtaaagac 498

<210> 9

<211> 465

<212> DNA

<213>Ox IL-2 gene order after optimization

<400> 9

atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300

ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

Claims (10)

1. bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, it is characterised in that：The amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >, it is denoted as fusion protein 1.

2. a kind of gene for encoding bovine albumin-interferon-' alpha '-interleukin-22 fusion protein as described in claim 1, feature It is, the nucleotides sequence list of the gene is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as Shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. the preparation method of bovine albumin-interferon-' alpha '-interleukin-22 fusion protein described in claim 1, which is characterized in that institute Preparation method is stated to include the following steps：Nucleotides sequence list gene as shown in 400 < of SEQUENCE LISTING, 2 > will be contained The expression vector of group 1 or nucleotides sequence list genome 2 as shown in 400 < of SEQUENCE LISTING, 3 > imported into large intestine bar In bacterium host cell, genetic engineering bacterium is obtained, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, Fusion protein can be obtained after purified.

6. preparation method according to claim 5, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, preparation method are：

(1) design primer obtains by reverse transcription or is manually respectively synthesized the white egg of synthesis ox for connecting flexible linker sequence White, Bov IFN α and cattle interleukins-2 2 target gene；By flexible linker by bovine albumin, Bov IFN α, Niu Bai The target gene of cytokine 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained α-IL2。

7. preparation method according to claim 5 or 6, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

8. preparation method according to claim 5, which is characterized in that the method for the purifying is：The crude product of fusion protein Successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

9. a kind of ox long-acting interferon, which is characterized in that the ox long-acting interferon by fusion protein described in claim 1 with It is freeze-dried to form after freeze drying protectant mixture.

10. ox long-acting interferon according to claim 9, which is characterized in that the freeze drying protectant is glycerol, mannitol And sucrose.