CN108864300A

CN108864300A - Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a breeder long-acting interferon

Info

Publication number: CN108864300A
Application number: CN201810750992.8A
Authority: CN
Inventors: 高耀辉; 鲍可兵; 徐慕珍; 杨建伟; 付超; 周炜; 蒋敏之; 刘家炉
Original assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Current assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-10
Publication date: 2018-11-23
Also published as: CN107400170A

Abstract

The invention discloses Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding genes, a breeder long-acting interferon, Chicken Albumin, chicken interferon α and chicken interleukin-2 2 are connected by flexibility linker, obtain Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, recombination chicken long-acting interferon is finally prepared, it is remarkably improved the half-life period of chicken interferon, the half-life period of more common chicken interferon improves 20 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of chicken itself.

Description

Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its coding base Cause, a breeder long-acting interferon

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to Chicken Albumin-interferon-' alpha '-interleukin-22 merges egg White, preparation method and its encoding gene, a breeder long-acting interferon.Chicken Albumin, chicken interferon α and chicken interleukin-2 2 are passed through Flexible flexibility linker connection, obtains Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, its encoding gene of design optimization, most Recombination chicken long-acting interferon is prepared eventually.

Background technique

In recent years, as the scale of aquaculture and livestock and poultry and products thereof circulation industry rapidly develop, China's domestic fowl farming is taken Tremendous development is obtained, the huge industry that annual value of production exceedes hundred billion yuan is formd.However due to the animal epidemic prevention system of China's weakness, poultry diease It is still the serious problems that China's poultry production faces, this has become an important factor for restricting the development of China's poultry cultivation industry. Poultry diease is more, loss is big, and the death rate is higher than 15%, and for death and culling rate up to 20%~25% (developed country is less than 5%), China's poultry husbandry is every Year chicken The dead quantity caused by infectious disease is about 300,000,000, about 3,000,000,000 yuan of the economic loss directly contributed, caused by between Connect about 10,000,000,000 yuan of loss.

At present for the prevention and treatment of chicken viral diseases mainly using vaccine immunity and drug therapy, due to epidemic disease The immune serotype of seedling is single, and virus serotype is numerous and virus stain speed of mutation is fast, to frequently result in vaccine immunity mistake It loses.Although some antibiotic and chemically synthesized antiviral drugs have some effects to a small number of viruses, since medicament residue passes through Food chain is brought a negative impact to human health, and China prohibited some antibiotic and antibacterial agent in aquaculture since 16 years In application.Therefore, be actively developed production have no toxic side effect, drug residue free and the interferon formulation for not generating drug resistance, it is right Chicken viral diseases, which prevent and treat predicament, at present important clinical meaning.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.Now it is known that α type IFN in vivo can be selectively Act on the infection cells such as virus, by inhibit infected cell in virus protein biosynthesis, play wide spectrum and efficiently Antivirus action.But it is faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with inhibition virus Duplication, anti parasitic, the killing activity for inhibiting various kinds of cell proliferation, stimulation immunocyte.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly produced by the T lymphocyte activated The raw cell factor with extensive bioactivity can both promote lymphopoiesis, enhance immune function, and can restricted T Cell effect and the immune tolerance for enhancing body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In beast In doctor, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level that body can be enhanced improves the disease resistance of body, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to mention High curative effect of medication.IL-2 and other cell factors form fusion protein according to gene constructed, with enhance the antibody of vaccine generate and Improve cellular immune level.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

In order to solve the above technical problems, the purpose of the present invention is to provide Chicken Albumin-interferon-' alpha '-interleukin-22s to merge egg Chicken Albumin, chicken interferon α and chicken interleukin-2 2 are connected by flexibility flexibility linker, it is white to obtain chicken by bletilla preparation method Albumen-interferon-' alpha '-interleukin-22 fusion protein.

Another object of the present invention is to provide the encoding gene of above-mentioned Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein.

It is also an object of the present invention to provide a kind of long-acting chicken interferons, utilize above-mentioned Chicken Albumin-interferon-' alpha '- It is freeze-dried that a breeder long-acting interferon, the chicken is prepared after interleukin-22 fusion protein is mixed with freeze drying protectant Long-acting interferon is remarkably improved the half-life period of chicken interferon, and the half-life period of more common chicken interferon improves 20 times or more, and has There is broad-spectrum disease resistance toxic action and the immune response of chicken itself can be improved.

The technical scheme adopted by the invention is as follows：

A kind of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, the amino acid sequence table of the fusion protein is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides coding Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein gene, the core of the gene Nucleotide sequence table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as SEQUENCE LISTING 400 Shown in 3 > of <, it is denoted as genome 2.

The genome 1 and the equal codified fusion protein of the genome 2.Genome 2 is the nucleotides sequence to genome 1 Column optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene and be in the expression system Optimal high efficient expression state, CAI value is lower to show that expression is lower in host.G/C content most ideal distribution model in gene Enclosing is 30~70%, is more than that the range will affect translation and rate of rotation efficiency in any region.Chicken is found using software detection Albumin, chicken IFN-α, chicken IL-2 gene original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.27,0.31,0.27, GC percentage is 43.1%, 61.7%, 36.1%；And by Chicken Albumin, chicken IFN-α, chicken IL-2 gene It is 0.99,1.0,1.0, GC percentage that each gene codon adaptation indexI (CAI) in Escherichia coli is obtained after gene optimization 49.2%, 58.5%, 46.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein preparation method, the preparation methods Include the following steps：Expression vector containing genome 1 or genome 2 is imported into e. coli host cell, base is obtained Because of engineering bacteria, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, can be obtained and melts after purified Hop protein.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, and preparation method is：

(1), design primer obtains by reverse transcription or is manually respectively synthesized the white egg of chicken for connecting flexible linker sequence White, chicken interferon α and recombinant chIL-2 target gene；It is by flexible linker that Chicken Albumin, chicken interferon α, chicken is white The target gene of cytokine 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2), the target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/ can be obtained rAlb-IFNα-IL2。

Further, the e. coli host cell is for BL21 (DE3) competent cell or with pGro7 plasmid BL21 (DE3) competent cell.BL21 (DE3) competent cell with pGro7 plasmid has purchased from Shanghai offshore science and technology Limit company/glad hundred promise biology, article No. V205.

Further, the method for the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography And molecular sieve chromatography purification.

Further, the acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of Chicken Albumin (Alb) is：

Upstream Alb-F1：

CCGGAATTCATGAAGTGGGTAACATTA has EcoRI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCAGCACCAATTCCTAATG, with flexible linker；

The primer sequence of chicken interferon α (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTCCCACCATGGCTGT, with flexible linker；

Downstream IFN-α-R1：

ACCACCACCAGAACCACCACCACCGCGCGTGTTGCCT, with flexible linker；

The primer sequence of recombinant chIL-2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGATGTGCAAAGTACT, with flexible linker；

Downstream IL-2-R1：CCCTCGAGTTTTTGCAGATATC has XhoI restriction enzyme site；

B. RNA is extracted from chicken liver, by reverse transcription obtain chicken Alb, chicken IFN-α and chicken IL-2 gene target gene, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of chicken Alb, chicken IFN-α and chicken IL-2 gene as template, and be utilized respectively chicken Alb, chicken IFN-α and The upstream and downstream primer of chicken IL-2 gene carries out PCR amplification.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of geneome RNA, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection chicken Alb and chicken IFN α gene are utilized, Alb-IFN α gene is obtained:

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L, Alb upstream primer of IFN-α template DNA, the 0.5 μ L of Alb gene template DNA1 μ L, the flexible linker of connection, under IFN-α Trip 0.5 μ L, Taq archaeal dna polymerase of primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；It is anti-to connect PCR The condition is answered to be：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 A circulation；Last 72 DEG C of extensions 10min.

D. flexibility linker connection Alb-IFN α gene and chicken interleukin-2 gene are utilized, rAlb-IFN α-IL2 gene is obtained：

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of DNA1 μ L, the flexible linker of connection, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95℃ Initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of Chicken Albumin (Alb) is：

Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCC has BamHI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCACCGATACCCA, with flexible linker；

The primer sequence of chicken interferon α (IFN-α) is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTCCGACCATGGCTG, with flexible linker；

Downstream IFN-α-R2：

ACCACCACCAGAACCACCACCACCGGTACGGGTGTTACC, with flexible linker；

Recombinant chIL-2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGATGTGCAAAGTTCT, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGTTTCTGCAGGTAACG has XhoI restriction enzyme site.

B. the chicken Alb, chicken IFN-α and chicken IL-2 gene target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L, Alb upstream primer of IFN-α template DNA, the 0.5 μ L of Alb gene template DNA1 μ L, the flexible linker of connection, under IFN-α Trip 0.5 μ L, Taq archaeal dna polymerase of primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；It is anti-to connect PCR The condition is answered to be：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 A circulation；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, Alb-IFN α gene template 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of DNA1 μ L, the flexible linker of connection, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95℃ Initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

The present invention also provides a breeder long-acting interferon, the chicken long-acting interferon is by the Chicken Albumin-interference It is freeze-dried to form after plain α-interleukin-22 fusion protein and freeze drying protectant mixture.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The present invention also provides the application of the chicken long-acting interferon, long half time had wide spectrum up to 80 hours or more Antivirus action and the immune response that chicken itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. chicken Alb, chicken IFN-α and chicken IL-2 gene gene are realized amalgamation and expression by flexibility linker, interferon is improved Half-life period improves 20 times compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce into This.

2. improving chicken Alb, chicken IFN-α and chicken IL-2 gene by optimizing to chicken Alb, chicken IFN-α and chicken IL-2 gene gene The expression quantity of fusion protein.

3. using recombination bacillus coli pET-32a/Alb-IFN α-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of chicken Alb, chicken IFN-α and chicken IL-2 gene not only has the wide of IFN-α Antivirus action is composed, while significantly improving the immune response of chicken itself.

Detailed description of the invention

Fig. 1 is that Chicken Albumin gene, chicken interferon α gene and the recombinant chIL-2 gene RT-PCR in embodiment 1 expand The result of increasing；Swimming lane M：DNA Marker DL2000；Swimming lane 1：2 gene RT-PCR amplified production of chicken interleukin-2；Swimming lane 2：Chicken is dry Disturb plain α gene RT-PCR amplified production；Swimming lane 3：Chicken Albumin gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in chicken Alb, IFN-α connected with the target gene of IL-2 after PCR amplification result；Swimming Road M：DNA MarkerDL10000；Swimming lane 1：2 gene ligation amplification of Chicken Albumin gene, chicken interferon α gene and chicken interleukin-2 Product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：After bacterial cell disruption after recombinant bacterium induction Precipitating；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the recombination chicken long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A 3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B 3-12 is that the recombinant long-acting chicken interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the recombination chicken long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific embodiment

Embodiment 1

Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein preparation method, includes the following steps：

1. the acquisition of Chicken Albumin (Alb), chicken interferon α (IFN-α) and recombinant chIL-2 (IL-2) target gene with Amplification

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of Chicken Albumin In primer introduce EcoRI restriction enzyme site, in downstream primer introduce Linker sequence, chicken interferon α upstream primer and under Linker sequence is introduced respectively in trip primer, Linker sequence is introduced in the upstream primer of recombinant chIL-2, in downstream primer Middle introducing XhoI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from chicken liver tissue, the target gene of chicken Alb, chicken IFN-α and chicken IL-2 gene are obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1870bp, 640bp and 460bp or so through agarose gel electrophoresis in RT-PCR amplified production, Its result is as shown in Figure 1, the target gene of chicken Alb, chicken IFN-α and chicken IL-2 gene has been prepared in explanation.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 Alb-IFN- α PCR reaction system of table

4 Alb-IFN- α-IL-2PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2920bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs Alb-IFN α and IL-2 amplified product band in Fig. 2, this is because the process connected in Alb-IFN α with IL-2 gene In, there is non-specific responding.The nucleotide sequence of obtained target gene is as shown in 400 < of SEQUENCE LISTING, 2 >.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion Product detects single band through agarose gel electrophoresis at 2920bp, and result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as schemed Shown in 4, it can be seen from the figure that be deposited in the place 125.3KD or so visible for supernatant after bacterial cell disruption after recombinant bacterium induction 5h Predominant expression band illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to 100 egg of AKTAexplorer On white purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away with PBS buffer solution and is not tied The albumen of conjunction, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM miaow Azoles, PH8.0) elution, collect rAlb-IFN α-IL2 protein peak.

5.2DEAE anion-exchange chromatography

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN α-IL2 protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C It saves.The fusion protein being made of Chicken Albumin, chicken interferon α and recombinant chIL-2 can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein is prepared using the above method.

Embodiment 2

A kind of preparation method of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, the preparation method is the same as that of Example 1, only E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmid is thin Born of the same parents.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,125.3KD or so place's predominant expression item in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with Expression albumen correctly folds, and reaches solubility expression of protein.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of preparation method of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method are as follows：

Chicken Alb, chicken IFN-α and chicken IL-2 gene in embodiment 1 is optimized, artificial synthesized chicken Alb, chicken IFN-α and chicken IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, the chicken Alb in the present embodiment couple, chicken IFN-α It is optimized with chicken IL-2 gene gene codon.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and rate of rotation efficiency in any region.Chicken Alb, chicken are found using software detection The codon of IFN-α and chicken IL-2 gene original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.27,0.31, 0.27, GC percentage is 43.1%, 61.7%, 36.1%；And by being obtained to after chicken Alb, chicken IFN-α and chicken IL-2 gene gene optimization To recombination in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC percentage 49.2%, 58.5%, 46.2%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon to albumen table The influence reached improves the G/C content of gene, improves transcription and translation efficiency, and then improves the expression quantity of recombinant protein.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of chicken Alb, chicken IFN-α and chicken IL-2 gene after optimization are diluted to 0.05mg/mL respectively.Utilize PCR Amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of chicken Alb, chicken IFN-α and chicken IL-2 gene are through agarose gel electrophoresis respectively in 1870bp, 640bp There is specific band with 460bp or so, the purpose base of chicken Alb, chicken IFN-α and chicken IL-2 gene after illustrating to be prepared optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 Alb-IFN α PCR reaction system of table

10 rAlb-IFN α-IL2PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2920bp or so through agarose gel electrophoresis in pcr amplification product, is Alb-IFN α and IL-2 Amplified product band, this is because there is non-specific responding during Alb-IFN α is connected with IL-2 gene.It obtains The nucleotide sequence of target gene is as shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 2920bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN α-IL2 fusion carries Body constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNα-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in the place 125.3KD or so after bacterial cell disruption after 5h, illustrates in supernatant precipitating Recombinant protein is obtained.

5. fusion protein purification

5.1 His affinity chromatographys

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rAlb-IFN α-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN α-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of Chicken Albumin, chicken interferon α and recombinant chIL-2, amino acid sequence can be obtained As shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of preparation method of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, other are with embodiment 3, only by it In e. coli bl21 (DE3) competent cell replacement in order to have pGro7 plasmid BL21 (DE3) competent cell.Its The SDS-PAGE electrophoresis result of fusion protein is compareed with embodiment 3, in supernatant 125.3KD or so place's predominant expression band compared with Slightly, illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher. The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression in expression bacterial strain Albumen correctly folds, and reaches solubility expression of protein.

Embodiment 5

One breeder long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively and after freeze drying protectant mixture, It is freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, three with 10mmol/L PBS Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

Embodiment 6

Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein identification that Examples 1 to 4 obtains

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration difference 2.5mg/ml, 2.4mg/ml, 2.6mg/ml, 2.6mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 125.3KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-chicken alpha interferon (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant long-acting chicken interferon sample can be with anti-chicken interferon α Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 125.3KD or so, as shown in Figure 5.

Embodiment 7

The freeze-dried bioactivity of four parts of long-acting chicken interferons of chicken in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombinant long-acting of various dose is added in culture Chicken interferon is inhaled afterwards abandon for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the recombinant long-acting chicken interferon obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombinant long-acting obtained After chicken interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

The four parts of recombinant long-acting chicken interferons obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried The measurement of (being denoted as A, B, C, D respectively) in chicken intracorporal half-life period

A be embodiment 1 prepare freeze-dried, B be embodiment 2 prepare freeze-dried, C be embodiment 3 prepare it is freeze-dried, D is the freeze-dried of the preparation of embodiment 4.

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN α-IL2

The broiler chicken (half male and half female) that six weight are roughly the same is taken, 2mg/ml recombination chicken long-acting interferon is subcutaneously injected in neck The freeze-dried 2ml of α, respectively in 1h, 2h, 4h, 8h, 16h, 26h, 44h, 79h, 144h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm Low-temperature centrifugation 10min separates serum, and every chicken blood sample of each time point is to be measured in -20 DEG C of preservations.It is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN α-IL2 in blood serum sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculates It the results are shown in Table 13.

Dominant dynamic parameters in serum after 13 recombinant long-acting chicken interferon α intramuscular injection of table

The result shows that recombinant long-acting chicken interferon has longer half-life period.Half-life period can reach 80h or so after measured, more general Logical interferon improves about 20 times.

Embodiment 9

The freeze-dried measurement that chicken cell immune response is influenced of four parts of recombinant long-acting chicken interferons in embodiment 5

It takes six roughly the same broiler chicken of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml freeze-dried 2ml of recombinant long-acting chicken interferon is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside chicken All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IFN γ, IL-4 content, are carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group chicken cell immune response

The result shows that injection recombinant long-acting chicken interferon after, can significantly improve chicken Evaluation of Cytokines in Peripheral Blood IFN γ, The content of IL-4 enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned that a kind of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein and preparation method thereof is carried out referring to embodiment Detailed description, be illustrative without being restrictive, can enumerate several embodiments according to limited range, thus The change and modification under present general inventive concept are not departed from, should be belonged within protection scope of the present invention.

SEQUENCE LISTING

<110>Anhui Jiuchuan Biotechnology Co., Ltd.

<120>Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a breeder are long

Imitate interferon

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 973

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Leu Ile Ser Phe Ile Phe Leu Phe Ser Ser Ala

1 5 10 15

Thr Ser Arg Asn Leu Gln Arg Phe Ala Arg Asp Ala Glu His Lys Ser

20 25 30

Glu Ile Ala His Arg Tyr Asn Asp Leu Lys Glu Glu Thr Phe Lys Ala

35 40 45

Val Ala Met Ile Thr Phe Ala Gln Tyr Leu Gln Arg Cys Ser Tyr Glu

50 55 60

Gly Leu Ser Lys Leu Val Lys Asp Val Val Asp Leu Ala Gln Lys Cys

65 70 75 80

Val Ala Asn Glu Asp Ala Pro Glu Cys Ser Lys Pro Leu Pro Ser Ile

85 90 95

Ile Leu Asp Glu Ile Cys Gln Val Glu Lys Leu Arg Asp Ser Tyr Gly

100 105 110

Ala Met Ala Asp Cys Cys Ser Lys Ala Asp Pro Glu Arg Asn Glu Cys

115 120 125

Phe Leu Ser Phe Lys Val Ser Gln Pro Asp Phe Val Gln Pro Tyr Gln

130 135 140

Arg Pro Ala Ser Asp Val Ile Cys Gln Glu Tyr Gln Asp Asn Arg Val

145 150 155 160

Ser Phe Leu Gly His Phe Ile Tyr Ser Val Ala Arg Arg His Pro Phe

165 170 175

Leu Tyr Ala Pro Ala Ile Leu Ser Phe Ala Val Asp Phe Glu His Ala

180 185 190

Leu Gln Ser Cys Cys Lys Glu Ser Asp Val Gly Ala Cys Leu Asp Thr

195 200 205

Lys Glu Ile Val Met Arg Glu Lys Ala Lys Gly Val Ser Val Lys Gln

210 215 220

Gln Tyr Phe Cys Gly Ile Leu Lys Gln Phe Gly Asp Arg Val Phe Gln

225 230 235 240

Ala Arg Gln Leu Ile Tyr Leu Ser Gln Lys Tyr Pro Lys Ala Pro Phe

245 250 255

Ser Glu Val Ser Lys Phe Val His Asp Ser Ile Gly Val His Lys Glu

260 265 270

Cys Cys Glu Gly Asp Met Val Glu Cys Met Asp Asp Met Ala Arg Met

275 280 285

Met Ser Asn Leu Cys Ser Gln Gln Asp Val Phe Ser Gly Lys Ile Lys

290 295 300

Asp Cys Cys Glu Lys Pro Ile Val Glu Arg Ser Gln Cys Ile Met Glu

305 310 315 320

Ala Glu Phe Asp Glu Lys Pro Ala Asp Leu Pro Ser Leu Val Glu Lys

325 330 335

Tyr Ile Glu Asp Lys Glu Val Cys Lys Ser Phe Glu Ala Gly His Asp

340 345 350

Ala Phe Met Ala Glu Phe Val Tyr Glu Tyr Ser Arg Arg His Pro Glu

355 360 365

Phe Ser Ile Gln Leu Ile Met Arg Ile Ala Lys Gly Tyr Glu Ser Leu

370 375 380

Leu Glu Lys Cys Cys Lys Thr Asp Asn Pro Ala Glu Cys Tyr Ala Asn

385 390 395 400

Ala Gln Glu Gln Leu Asn Gln His Ile Lys Glu Thr Gln Asp Val Val

405 410 415

Lys Thr Asn Cys Asp Leu Leu His Asp His Gly Glu Ala Asp Phe Leu

420 425 430

Lys Ser Ile Leu Ile Arg Tyr Thr Lys Lys Met Pro Gln Val Pro Thr

435 440 445

Asp Leu Leu Leu Glu Thr Gly Lys Lys Met Thr Thr Ile Gly Thr Lys

450 455 460

Cys Cys Gln Leu Pro Glu Asp Arg Arg Met Ala Cys Ser Glu Gly Tyr

465 470 475 480

Leu Ser Ile Val Ile His Asp Thr Cys Arg Lys Gln Glu Thr Thr Pro

485 490 495

Ile Asn Asp Asn Val Ser Gln Cys Cys Ser Ser Ser Tyr Ala Asn Arg

500 505 510

Arg Pro Cys Phe Thr Ala Met Gly Val Asp Thr Lys Tyr Val Pro Pro

515 520 525

Pro Phe Asn Pro Asp Met Phe Ser Phe Asp Glu Lys Leu Cys Ser Ala

530 535 540

Pro Ala Glu Glu Arg Glu Val Gly Gln Met Lys Leu Leu Ile Asn Leu

545 550 555 560

Ile Lys Arg Lys Pro Gln Met Thr Glu Glu Gln Ile Lys Thr Ile Ala

565 570 575

Asp Gly Phe Thr Ala Met Val Asp Lys Cys Cys Lys Gln Ser Asp Ile

580 585 590

Asn Thr Cys Phe Gly Glu Glu Gly Ala Asn Leu Ile Val Gln Ser Arg

595 600 605

Ala Thr Leu Gly Ile Gly Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly

610 615 620

Ser Pro Thr Met Ala Val Pro Ala Ser Pro Gln His Pro Arg Gly Tyr

625 630 635 640

Gly Ile Leu Leu Leu Thr Leu Leu Leu Lys Ala Leu Ala Thr Thr Ala

645 650 655

Ser Ala Cys Asn His Leu Arg Pro Gln Asp Ala Thr Phe Ser His Asp

660 665 670

Ser Leu Gln Leu Leu Arg Asp Met Ala Pro Thr Leu Pro Gln Leu Cys

675 680 685

Pro Gln His Asn Ala Ser Cys Ser Phe Asn Asp Thr Ile Leu Asp Thr

690 695 700

Ser Asn Thr Arg Gln Ala Asp Lys Thr Thr His Asp Ile Leu Gln His

705 710 715 720

Leu Phe Lys Ile Leu Ser Ser Pro Ser Thr Pro Ala His Trp Asn Asp

725 730 735

Ser Gln Arg Gln Ser Leu Leu Asn Arg Ile His Arg Tyr Thr Gln His

740 745 750

Leu Glu Gln Cys Leu Asp Ser Ser Asp Thr Arg Ser Arg Thr Arg Trp

755 760 765

Pro Arg Asn Leu His Leu Thr Ile Lys Lys His Phe Ser Cys Leu His

770 775 780

Thr Phe Leu Gln Asp Asn Asp Tyr Ser Ala Cys Ala Trp Glu His Val

785 790 795 800

Arg Leu Gln Ala Arg Ala Trp Phe Leu His Ile His Asn Leu Thr Gly

805 810 815

Asn Thr Arg Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Met

820 825 830

Cys Lys Val Leu Ile Phe Gly Cys Ile Ser Val Ala Met Leu Met Thr

835 840 845

Thr Ala Tyr Gly Ala Ser Leu Ser Ser Glu Lys Trp Lys Thr Leu Gln

850 855 860

Thr Leu Ile Lys Asp Leu Glu Ile Leu Glu Asn Ile Lys Asn Lys Ile

865 870 875 880

His Leu Glu Leu Tyr Thr Pro Thr Glu Thr Gln Glu Cys Thr Gln Gln

885 890 895

Thr Leu Gln Cys Tyr Leu Gly Glu Val Val Thr Leu Lys Lys Glu Thr

900 905 910

Glu Asp Asp Thr Glu Ile Lys Glu Glu Phe Val Thr Ala Ile Gln Asn

915 920 925

Ile Glu Lys Asn Leu Lys Ser Leu Thr Gly Leu Asn His Thr Gly Ser

930 935 940

Glu Cys Lys Ile Cys Glu Ala Asn Asn Lys Lys Lys Phe Pro Asp Phe

945 950 955 960

Leu His Glu Leu Thr Asn Phe Val Arg Tyr Leu Gln Lys

965 970

<210> 2

<211> 2919

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg taacattaat ttcattcatt ttcctcttca gttcagcaac atccaggaat 60

ctgcaaagat ttgctcgtga tgcagagcac aagagtgaaa ttgcccatcg ctacaatgat 120

ttgaaagaag aaacatttaa ggcagttgcc atgatcacat ttgcccagta tctccagagg 180

tgctcttatg aaggactgtc taagcttgtg aaggatgttg ttgatctggc acaaaaatgt 240

gtagccaatg aagatgctcc tgaatgctca aaaccactgc cttccattat cctggatgaa 300

atctgccaag tggaaaagct ccgtgactct tatggtgcaa tggccgactg ctgtagcaaa 360

gctgatcctg aaagaaatga gtgtttcctg tcatttaaag tttcccaacc agacttcgtt 420

cagccatacc aaagaccagc ttctgatgtg atatgccagg aataccagga caacagagtg 480

tcatttctgg gacatttcat ctattctgtt gcaagaagac accccttctt gtatgcccct 540

gcaatcctta gttttgctgt tgattttgaa catgcacttc aaagctgttg caaagagagt 600

gatgtcggtg cttgcctgga caccaaggaa attgttatga gagaaaaagc caagggagta 660

agtgtgaagc agcagtattt ttgtggaatc ttgaagcagt tcggagatag agttttccaa 720

gcacgacaac ttatttacct aagccaaaaa taccccaagg ctccattctc agaggtttct 780

aaatttgtac atgattctat cggcgtccac aaagagtgct gtgaagggga catggtggag 840

tgcatggatg acatggcacg tatgatgagc aatctgtgct ctcaacaaga tgttttctca 900

ggtaaaatca aagactgctg tgagaagcct attgtggaac gaagccagtg cattatggag 960

gcagaatttg atgagaaacc tgcagatctt ccttcattag ttgaaaagta catagaagat 1020

aaggaagtgt gtaaaagttt tgaagcaggc cacgatgcat tcatggcaga gttcgtttat 1080

gaatactcac gaagacaccc tgagttctcc atacagctta ttatgagaat tgccaaagga 1140

tatgaatcac ttctggaaaa gtgctgcaaa actgataacc ctgctgagtg ctacgcaaat 1200

gctcaagagc aactgaacca acatatcaaa gaaactcagg atgttgtgaa gacaaactgt 1260

gatcttctcc atgaccatgg cgaggcagac ttcctcaagt ccatcctgat ccgctacact 1320

aagaaaatgc ctcaagtacc aactgatctc ctgcttgaaa ctggaaagaa aatgacaact 1380

attggtacta agtgctgcca gcttcctgaa gacagacgca tggcttgttc tgagggttat 1440

ctgagcattg tgattcatga tacgtgcagg aaacaggaga ccacacctat aaatgacaac 1500

gtttcacaat gctgcagcag ctcctatgct aacagaagac catgtttcac tgctatggga 1560

gtagatacca aatatgttcc tccaccattt aatcctgata tgttcagctt tgatgaaaaa 1620

ttgtgcagtg ctcctgctga agaacgagaa gtaggccaga tgaaattgct aatcaacctc 1680

attaaacgca agccccagat gacagaagaa caaataaaga caattgctga tggtttcact 1740

gccatggttg acaagtgctg caagcagtcg gacatcaata catgctttgg agaagagggt 1800

gccaacctaa tagtccaaag cagagccaca ttaggaattg gtgctggtgg tggtggttct 1860

ggtggtggtg gttctcccac catggctgtg cctgcaagcc cacagcaccc acgggggtac 1920

ggcatcctgc tgctcacgct ccttctgaaa gctctcgcca ccaccgcctc cgcctgcaac 1980

caccttcgcc cccaggatgc caccttctct cacgacagcc tccagctcct ccgggacatg 2040

gctcccacac taccccagct gtgcccacag cacaacgcgt cttgctcctt caacgacacc 2100

atcctggaca ccagcaacac ccggcaagcc gacaaaacca cccacgacat ccttcagcac 2160

ctcttcaaaa tcctcagcag ccccagcact ccagcccact ggaacgacag ccaacgccaa 2220

agcctcctca accggatcca ccgctacacc cagcacctcg agcaatgctt ggacagcagc 2280

gacacgcgct cccggacgcg atggcctcgc aaccttcacc tcaccatcaa aaaacacttc 2340

agctgcctcc acaccttcct ccaagacaac gattacagcg cctgcgcctg ggaacacgtc 2400

cgcctgcaag ctcgtgcctg gttcctgcac atccacaacc tcacaggcaa cacgcgcact 2460

ggtggtggtg gttctggtgg tggtggttct atgatgtgca aagtactgat ctttggctgt 2520

atttcggtag caatgctaat gactacagct tatggagcat ctctatcatc agaaaaatgg 2580

aaaactcttc aaacattaat aaaggattta gaaatattgg aaaatatcaa gaataagatt 2640

catctcgagc tctacacacc aactgagacc caggagtgca cccagcaaac tctgcagtgt 2700

tacctgggag aagtggttac tctgaagaaa gaaactgaag atgacactga aattaaagaa 2760

gaatttgtaa ctgctattca aaatatcgaa aagaacctca agagtcttac gggtctaaat 2820

cacaccggaa gtgaatgcaa gatctgtgaa gctaacaaca agaaaaaatt tcctgatttt 2880

ctccatgaac tgaccaactt tgtgagatat ctgcaaaaa 2919

<210> 3

<211> 2919

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccctgat ctctttcatc ttcctgttct cttctgctac ctctcgtaac 60

ctgcagcgtt tcgctcgtga cgctgaacac aaatctgaaa tcgctcaccg ttacaacgac 120

ctgaaagaag aaaccttcaa agctgttgct atgatcacct tcgctcagta cctgcagcgt 180

tgctcttacg aaggtctgtc taaactggtt aaagacgttg ttgacctggc tcagaaatgc 240

gttgctaacg aagacgctcc ggaatgctct aaaccgctgc cgtctatcat cctggacgaa 300

atctgccagg ttgaaaaact gcgtgactct tacggtgcta tggctgactg ctgctctaaa 360

gctgacccgg aacgtaacga atgcttcctg tctttcaaag tttctcagcc ggacttcgtt 420

cagccgtacc agcgtccggc ttctgacgtt atctgccagg aataccagga caaccgtgtt 480

tctttcctgg gtcacttcat ctactctgtt gctcgtcgtc acccgttcct gtacgctccg 540

gctatcctgt ctttcgctgt tgacttcgaa cacgctctgc agtcttgctg caaagaatct 600

gacgttggtg cttgcctgga caccaaagaa atcgttatgc gtgaaaaagc taaaggtgtt 660

tctgttaaac agcagtactt ctgcggtatc ctgaaacagt tcggtgaccg tgttttccag 720

gctcgtcagc tgatctacct gtctcagaaa tacccgaaag ctccgttctc tgaagtttct 780

aaattcgttc acgactctat cggtgttcac aaagaatgct gcgaaggtga catggttgaa 840

tgcatggacg acatggctcg tatgatgtct aacctgtgct ctcagcagga cgttttctct 900

ggtaaaatca aagactgctg cgaaaaaccg atcgttgaac gttctcagtg catcatggaa 960

gctgaattcg acgaaaaacc ggctgacctg ccgtctctgg ttgaaaaata catcgaagac 1020

aaagaagttt gcaaatcttt cgaagctggt cacgacgctt tcatggctga attcgtttac 1080

gaatactctc gtcgtcaccc ggaattctct atccagctga tcatgcgtat cgctaaaggt 1140

tacgaatctc tgctggaaaa atgctgcaaa accgacaacc cggctgaatg ctacgctaac 1200

gctcaggaac agctgaacca gcacatcaaa gaaacccagg acgttgttaa aaccaactgc 1260

gacctgctgc acgaccacgg tgaagctgac ttcctgaaat ctatcctgat ccgttacacc 1320

aaaaaaatgc cgcaggttcc gaccgacctg ctgctggaaa ccggtaaaaa aatgaccacc 1380

atcggtacca aatgctgcca gctgccggaa gaccgtcgta tggcttgctc tgaaggttac 1440

ctgtctatcg ttatccacga cacctgccgt aaacaggaaa ccaccccgat caacgacaac 1500

gtttctcagt gctgctcttc ttcttacgct aaccgtcgtc cgtgcttcac cgctatgggt 1560

gttgacacca aatacgttcc gccgccgttc aacccggaca tgttctcttt cgacgaaaaa 1620

ctgtgctctg ctccggctga agaacgtgaa gttggtcaga tgaaactgct gatcaacctg 1680

atcaaacgta aaccgcagat gaccgaagaa cagatcaaaa ccatagcgga cggcttcacc 1740

gctatggttg acaaatgctg caaacagtct gacatcaaca cctgcttcgg tgaagaaggt 1800

gctaacctga tcgttcagtc tcgtgctacc ctgggtatcg gtgctggtgg tggtggttct 1860

ggtggtggtg gttctccgac catggctgtt ccggcttctc cgcagcaccc gcgtggttac 1920

ggtatcctgc tgctgaccct gctgctgaaa gctctggcta ccaccgcttc tgcttgcaac 1980

cacctgcgtc cgcaggacgc taccttctct cacgactctc tgcagctgct gcgtgacatg 2040

gctccgaccc tgccgcagct gtgcccgcag cacaacgctt cttgctcttt caacgacacc 2100

atcctggaca cctctaacac ccgtcaggct gacaaaacca cccacgacat cctgcagcac 2160

ctgttcaaaa tcctgtcttc tccgtctacc ccggctcact ggaacgactc tcagcgtcag 2220

tctctgctga accgtatcca ccgttacacc cagcacctgg aacagtgcct ggactcttct 2280

gacacccgtt ctcgtacccg ttggccgcgt aacctgcacc tgaccatcaa aaaacacttc 2340

tcttgcctgc acaccttcct gcaggacaac gactactctg cttgcgcttg ggaacacgtt 2400

cgtctgcagg ctcgtgcttg gttcctgcac atccacaacc tgaccggtaa cacccgtacc 2460

ggtggtggtg gttctggtgg tggtggttct atgatgtgca aagttctgat cttcggttgc 2520

atctctgttg ctatgctgat gaccaccgct tacggtgctt ctctgtcttc tgaaaaatgg 2580

aaaaccctgc agaccctgat caaagacctg gaaatcctgg aaaacatcaa aaacaaaatc 2640

cacctggaac tgtacacccc gaccgaaacc caggaatgca cccagcagac cctgcagtgc 2700

tacctgggtg aagttgttac cctgaaaaaa gaaaccgaag acgacaccga aatcaaagaa 2760

gaattcgtta ccgctatcca gaacatcgaa aaaaacctga aatctctgac cggtctgaac 2820

cacaccggtt ctgaatgcaa aatctgcgaa gctaacaaca aaaaaaaatt cccggacttc 2880

ctgcacgaac tgaccaactt cgttcgttac ctgcagaaa 2919

<210> 4

<211> 1845

<212> DNA

<213>Chicken Albumin gene order before optimizing

<400> 4

atgaagtggg taacattaat ttcattcatt ttcctcttca gttcagcaac atccaggaat 60

ctgcaaagat ttgctcgtga tgcagagcac aagagtgaaa ttgcccatcg ctacaatgat 120

ttgaaagaag aaacatttaa ggcagttgcc atgatcacat ttgcccagta tctccagagg 180

tgctcttatg aaggactgtc taagcttgtg aaggatgttg ttgatctggc acaaaaatgt 240

gtagccaatg aagatgctcc tgaatgctca aaaccactgc cttccattat cctggatgaa 300

atctgccaag tggaaaagct ccgtgactct tatggtgcaa tggccgactg ctgtagcaaa 360

gctgatcctg aaagaaatga gtgtttcctg tcatttaaag tttcccaacc agacttcgtt 420

cagccatacc aaagaccagc ttctgatgtg atatgccagg aataccagga caacagagtg 480

tcatttctgg gacatttcat ctattctgtt gcaagaagac accccttctt gtatgcccct 540

gcaatcctta gttttgctgt tgattttgaa catgcacttc aaagctgttg caaagagagt 600

gatgtcggtg cttgcctgga caccaaggaa attgttatga gagaaaaagc caagggagta 660

agtgtgaagc agcagtattt ttgtggaatc ttgaagcagt tcggagatag agttttccaa 720

gcacgacaac ttatttacct aagccaaaaa taccccaagg ctccattctc agaggtttct 780

aaatttgtac atgattctat cggcgtccac aaagagtgct gtgaagggga catggtggag 840

tgcatggatg acatggcacg tatgatgagc aatctgtgct ctcaacaaga tgttttctca 900

ggtaaaatca aagactgctg tgagaagcct attgtggaac gaagccagtg cattatggag 960

gcagaatttg atgagaaacc tgcagatctt ccttcattag ttgaaaagta catagaagat 1020

aaggaagtgt gtaaaagttt tgaagcaggc cacgatgcat tcatggcaga gttcgtttat 1080

gaatactcac gaagacaccc tgagttctcc atacagctta ttatgagaat tgccaaagga 1140

tatgaatcac ttctggaaaa gtgctgcaaa actgataacc ctgctgagtg ctacgcaaat 1200

gctcaagagc aactgaacca acatatcaaa gaaactcagg atgttgtgaa gacaaactgt 1260

gatcttctcc atgaccatgg cgaggcagac ttcctcaagt ccatcctgat ccgctacact 1320

aagaaaatgc ctcaagtacc aactgatctc ctgcttgaaa ctggaaagaa aatgacaact 1380

attggtacta agtgctgcca gcttcctgaa gacagacgca tggcttgttc tgagggttat 1440

ctgagcattg tgattcatga tacgtgcagg aaacaggaga ccacacctat aaatgacaac 1500

gtttcacaat gctgcagcag ctcctatgct aacagaagac catgtttcac tgctatggga 1560

gtagatacca aatatgttcc tccaccattt aatcctgata tgttcagctt tgatgaaaaa 1620

ttgtgcagtg ctcctgctga agaacgagaa gtaggccaga tgaaattgct aatcaacctc 1680

attaaacgca agccccagat gacagaagaa caaataaaga caattgctga tggtttcact 1740

gccatggttg acaagtgctg caagcagtcg gacatcaata catgctttgg agaagagggt 1800

gccaacctaa tagtccaaag cagagccaca ttaggaattg gtgct 1845

<210> 5

<211> 585

<212> DNA

<213>Chicken IFN-α gene order before optimizing

<400> 5

cccaccatgg ctgtgcctgc aagcccacag cacccacggg ggtacggcat cctgctgctc 60

acgctccttc tgaaagctct cgccaccacc gcctccgcct gcaaccacct tcgcccccag 120

gatgccacct tctctcacga cagcctccag ctcctccggg acatggctcc cacactaccc 180

cagctgtgcc cacagcacaa cgcgtcttgc tccttcaacg acaccatcct ggacaccagc 240

aacacccggc aagccgacaa aaccacccac gacatccttc agcacctctt caaaatcctc 300

agcagcccca gcactccagc ccactggaac gacagccaac gccaaagcct cctcaaccgg 360

atccaccgct acacccagca cctcgagcaa tgcttggaca gcagcgacac gcgctcccgg 420

acgcgatggc ctcgcaacct tcacctcacc atcaaaaaac acttcagctg cctccacacc 480

ttcctccaag acaacgatta cagcgcctgc gcctgggaac acgtccgcct gcaagctcgt 540

gcctggttcc tgcacatcca caacctcaca ggcaacacgc gcact 585

<210> 6

<211> 429

<212> DNA

<213>Chicken IL-2 gene gene order before optimizing

<400> 6

atgatgtgca aagtactgat ctttggctgt atttcggtag caatgctaat gactacagct 60

tatggagcat ctctatcatc agaaaaatgg aaaactcttc aaacattaat aaaggattta 120

gaaatattgg aaaatatcaa gaataagatt catctcgagc tctacacacc aactgagacc 180

caggagtgca cccagcaaac tctgcagtgt tacctgggag aagtggttac tctgaagaaa 240

gaaactgaag atgacactga aattaaagaa gaatttgtaa ctgctattca aaatatcgaa 300

aagaacctca agagtcttac gggtctaaat cacaccggaa gtgaatgcaa gatctgtgaa 360

gctaacaaca agaaaaaatt tcctgatttt ctccatgaac tgaccaactt tgtgagatat 420

ctgcaaaaa 429

<210> 7

<211> 1845

<212> DNA

<213>Chicken Albumin gene order after optimization

<400> 7

atgaaatggg ttaccctgat ctctttcatc ttcctgttct cttctgctac ctctcgtaac 60

ctgcagcgtt tcgctcgtga cgctgaacac aaatctgaaa tcgctcaccg ttacaacgac 120

ctgaaagaag aaaccttcaa agctgttgct atgatcacct tcgctcagta cctgcagcgt 180

tgctcttacg aaggtctgtc taaactggtt aaagacgttg ttgacctggc tcagaaatgc 240

gttgctaacg aagacgctcc ggaatgctct aaaccgctgc cgtctatcat cctggacgaa 300

atctgccagg ttgaaaaact gcgtgactct tacggtgcta tggctgactg ctgctctaaa 360

gctgacccgg aacgtaacga atgcttcctg tctttcaaag tttctcagcc ggacttcgtt 420

cagccgtacc agcgtccggc ttctgacgtt atctgccagg aataccagga caaccgtgtt 480

tctttcctgg gtcacttcat ctactctgtt gctcgtcgtc acccgttcct gtacgctccg 540

gctatcctgt ctttcgctgt tgacttcgaa cacgctctgc agtcttgctg caaagaatct 600

gacgttggtg cttgcctgga caccaaagaa atcgttatgc gtgaaaaagc taaaggtgtt 660

tctgttaaac agcagtactt ctgcggtatc ctgaaacagt tcggtgaccg tgttttccag 720

gctcgtcagc tgatctacct gtctcagaaa tacccgaaag ctccgttctc tgaagtttct 780

aaattcgttc acgactctat cggtgttcac aaagaatgct gcgaaggtga catggttgaa 840

tgcatggacg acatggctcg tatgatgtct aacctgtgct ctcagcagga cgttttctct 900

ggtaaaatca aagactgctg cgaaaaaccg atcgttgaac gttctcagtg catcatggaa 960

gctgaattcg acgaaaaacc ggctgacctg ccgtctctgg ttgaaaaata catcgaagac 1020

aaagaagttt gcaaatcttt cgaagctggt cacgacgctt tcatggctga attcgtttac 1080

gaatactctc gtcgtcaccc ggaattctct atccagctga tcatgcgtat cgctaaaggt 1140

tacgaatctc tgctggaaaa atgctgcaaa accgacaacc cggctgaatg ctacgctaac 1200

gctcaggaac agctgaacca gcacatcaaa gaaacccagg acgttgttaa aaccaactgc 1260

gacctgctgc acgaccacgg tgaagctgac ttcctgaaat ctatcctgat ccgttacacc 1320

aaaaaaatgc cgcaggttcc gaccgacctg ctgctggaaa ccggtaaaaa aatgaccacc 1380

atcggtacca aatgctgcca gctgccggaa gaccgtcgta tggcttgctc tgaaggttac 1440

ctgtctatcg ttatccacga cacctgccgt aaacaggaaa ccaccccgat caacgacaac 1500

gtttctcagt gctgctcttc ttcttacgct aaccgtcgtc cgtgcttcac cgctatgggt 1560

gttgacacca aatacgttcc gccgccgttc aacccggaca tgttctcttt cgacgaaaaa 1620

ctgtgctctg ctccggctga agaacgtgaa gttggtcaga tgaaactgct gatcaacctg 1680

atcaaacgta aaccgcagat gaccgaagaa cagatcaaaa ccatagcgga cggcttcacc 1740

gctatggttg acaaatgctg caaacagtct gacatcaaca cctgcttcgg tgaagaaggt 1800

gctaacctga tcgttcagtc tcgtgctacc ctgggtatcg gtgct 1845

<210> 8

<211> 585

<212> DNA

<213>Chicken IFN-α gene order after optimization

<400> 8

ccgaccatgg ctgttccggc ttctccgcag cacccgcgtg gttacggtat cctgctgctg 60

accctgctgc tgaaagctct ggctaccacc gcttctgctt gcaaccacct gcgtccgcag 120

gacgctacct tctctcacga ctctctgcag ctgctgcgtg acatggctcc gaccctgccg 180

cagctgtgcc cgcagcacaa cgcttcttgc tctttcaacg acaccatcct ggacacctct 240

aacacccgtc aggctgacaa aaccacccac gacatcctgc agcacctgtt caaaatcctg 300

tcttctccgt ctaccccggc tcactggaac gactctcagc gtcagtctct gctgaaccgt 360

atccaccgtt acacccagca cctggaacag tgcctggact cttctgacac ccgttctcgt 420

acccgttggc cgcgtaacct gcacctgacc atcaaaaaac acttctcttg cctgcacacc 480

ttcctgcagg acaacgacta ctctgcttgc gcttgggaac acgttcgtct gcaggctcgt 540

gcttggttcc tgcacatcca caacctgacc ggtaacaccc gtacc 585

<210> 9

<211> 429

<212> DNA

<213>Chicken IL-2 gene gene order after optimization

<400> 9

atgatgtgca aagttctgat cttcggttgc atctctgttg ctatgctgat gaccaccgct 60

tacggtgctt ctctgtcttc tgaaaaatgg aaaaccctgc agaccctgat caaagacctg 120

gaaatcctgg aaaacatcaa aaacaaaatc cacctggaac tgtacacccc gaccgaaacc 180

caggaatgca cccagcagac cctgcagtgc tacctgggtg aagttgttac cctgaaaaaa 240

gaaaccgaag acgacaccga aatcaaagaa gaattcgtta ccgctatcca gaacatcgaa 300

aaaaacctga aatctctgac cggtctgaac cacaccggtt ctgaatgcaa aatctgcgaa 360

gctaacaaca aaaaaaaatt cccggacttc ctgcacgaac tgaccaactt cgttcgttac 420

ctgcagaaa 429

Claims

1. Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, it is characterised in that：The amino acid sequence table of the fusion protein As shown in 400 < of SEQUENCE LISTING, 1 >, it is denoted as fusion protein 1.

2. a kind of gene for encoding Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein as described in claim 1, feature It is, the nucleotides sequence list of the gene is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or such as Shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. the preparation method of Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein described in claim 1, which is characterized in that institute Preparation method is stated to include the following steps：Nucleotides sequence list gene as shown in 400 < of SEQUENCE LISTING, 2 > will be contained The expression vector of group 1 or nucleotides sequence list genome 2 as shown in 400 < of SEQUENCE LISTING, 3 > imported into large intestine bar In bacterium host cell, genetic engineering bacterium is obtained, genetic engineering bacterium obtains the crude product of the fusion protein after IPTG inducing expression, Fusion protein can be obtained after purified.

6. preparation method according to claim 5, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN α-IL2, preparation method are：

(1), design primer, by reverse transcription obtain or manually be respectively synthesized connect flexible linker sequence Chicken Albumin, The target gene of chicken interferon α and recombinant chIL-2；It is by flexible linker that Chicken Albumin, chicken interferon α, chicken is white thin The target gene of born of the same parents' interleukin 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3), expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained α-IL2。

7. preparation method according to claim 5 or 6, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

8. preparation method according to claim 5, which is characterized in that the method for the purifying is：The crude product of fusion protein Successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

9. a breeder long-acting interferon, which is characterized in that the chicken long-acting interferon by fusion protein described in claim 1 with It is freeze-dried to form after freeze drying protectant mixture.

10. chicken long-acting interferon according to claim 9, which is characterized in that the freeze drying protectant is glycerol, mannitol And sucrose.