CN108794640A

CN108794640A - A kind of Recombinant Swine long-acting interferon γ and the fusion protein and preparation method thereof for preparing this long-acting interferon γ

Info

Publication number: CN108794640A
Application number: CN201810725703.9A
Authority: CN
Inventors: 杨建伟; 徐文俊; 徐慕珍; 付超; 赵雨; 高耀辉; 周炜; 王红朵; 郭志燕
Original assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Current assignee: ANHUI JIUCHUAN BIOTECHNOLOGY Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-04
Publication date: 2018-11-13
Also published as: CN107266586A

Abstract

The invention discloses a kind of Recombinant Swine long-acting interferon γ and prepare the fusion protein and preparation method thereof of this long-acting interferon γ; the fusion protein is connect through flexible linker with Porcine interferon-gamma by pig interleukin 2 and 6 and is formed, through being freeze-dried to obtain Recombinant Swine long-acting interferon γ after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon γ is remarkably improved the half-life period of pig interferon, and the half-life period of more common Porcine interferon-gamma improves 13 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of Recombinant Swine long-acting interferon γ and the fusion protein for preparing this long-acting interferon γ And preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of Recombinant Swine long-acting interferon γ and prepare this The fusion protein and preparation method thereof of long-acting interferon γ.

Background technology

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease control method is far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, in addition original animal epidemic, causes aquaculture industry of China huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.

By vaccine inoculation and antibiotic mainly is used to the prevention and treatment approach of porcine viral diseases at present, but by It is not perfect in breeding environment, virus variation and Abwehrkraft des Koepers variation etc. reasons, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament, due to medicament residue problem, to health It brings a negative impact；And traditional vaccine, the high specific due to it and side effect, virus variation and novel disease can not be resisted The significant damage brought to pig aquaculture continuously emerges in poison.

IFN is that the infection induced body of a viroid is generated with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, mainly by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.According to the generation cell of IFN, biochemical character and The difference to be played a role in terms of immunity of organism, is divided into γ, β, γ three classes.It is existing it is known that γ types IFN be T cell by activating and NK cells generate, and have relatively strong antiviral and immunoloregulation function.Numerous studies show interferon gamma in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of type can mediated cell to virus infection reaction, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocytes activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease is treated.In addition, IL-2 can also influence the metabolism of drug, make the metabolism time lengthening of drug, action time increases, to improve Curative effect of medication.With other cell factors according to gene constructed, composition fusion protein, the antibody to enhance vaccine is generated and is carried IL-2 High cellular immune level.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the layer of molecular weight Partly solve the problems, such as that interferon molecule amount is small and leads to half-life short on face, while polyethylene glycol fused interferon cost is non- Chang Gao is unfavorable for clinically applying.

Invention content

In order to solve the above technical problems, the present invention provides a kind of Recombinant Swine long-acting interferon γ and preparing this long-acting interference The fusion protein and preparation method thereof of plain γ, the Recombinant Swine long-acting interferon γ are remarkably improved the half-life period of pig interferon, The half-life period of more common Porcine interferon-gamma improves 13 times or more, and with broad-spectrum disease resistance toxic action and can improve the immune of pig itself Response.

The technical solution that the present invention takes is：

A kind of fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma, the amino acid sequence of the fusion protein List is denoted as fusion protein 1 as shown in 400 < of SEQUENCE LISTING, 1 >；Or such as 400 < of SEQUENCE LISTING, 2 > institutes Show, is denoted as fusion protein 2.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 3 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 4 >, it is denoted as genome 2.

Fusion protein 1 described in 1 codified of the genome；2 codified fusion protein 2 of the genome.Genome 2 is pair The nucleotide sequence of genome 1 optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the base Because being optimal high efficient expression state in the expression system, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution ranging from 30~70% can influence translation and transcriptional efficiency in any region more than the range. The codon of pig IL-2 and IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is found using software detection Respectively 0.23,0.24, GC percentages are 38.7%, 39.2%；And by being obtained after pig IL-2 and IFN-γ gene optimization Recombination genome 2 in Escherichia coli codon adaptation indexI (CAI) be 0.97,1.0, GC percentages 47.6%, 45.4%.The utilization rate that low codon is significantly reduced by gene optimization avoids shadow of the rare codon to protein expression It rings, improves the G/C content of gene, improve transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

The present invention also provides a kind of Recombinant Swine long-acting interferon γ, the Recombinant Swine long-acting interferon γ is melted by described It is freeze-dried to form after hop protein and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, can be obtained fusion protein after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ, and preparation method is：

(1) design primer, is obtained or the pig leucocyte of the flexible linker sequences of artificial synthesized connection by reverse transcription The target gene of interleukin 2 and Porcine interferon-gamma；By flexible linker by the purpose base of pig interleukin 2 and 6 and Porcine interferon-gamma Because connecting, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 3 > or such as SEQUENCE Shown in 400 < of LISTING, 4 >；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2- IFNγ。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F1：ATAGAATTCATGTATAAGATGCAGCTCTTGC carries EcoRI restriction enzyme sites；

Downstream IL-2-R1：CCAGAACCACCTCCAGAACCTCCACCAGTCAGTGTTGAGTAGATGCTT, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：CTGGAGGTGGTTCTGGAGGTGGATCTATGAGTTATACAACTTATTTCTT is carried Flexible linker；

Downstream IFN-γ-R1：CCAAGCTTTTTTGATGCTCTCTGGCCTTG carries III restriction enzyme sites of Hind；

B. RNA is extracted from pig liver, and the target gene of IL-2 and IFN-γ, the gene sequence of the two are obtained by reverse transcription Row are respectively as shown in 400 < of SEQUENCE LISTING 400 <, 5 > and SEQUENCE LISTING, 6 >；

Respectively using IL-2 and the target gene of IFN-γ as template, and it is utilized respectively the upstream and downstream primer of IL-2 and IFN-γ PCR amplification is carried out, the target gene of the IL-2 and IFN-γ of the flexible linker of connection have been respectively obtained.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. IL-2 genes and IFN-γ gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene templates DNA, 1 μ L, IL-2 sense primer of IFN-γ template DNA, the 0.5 μ L of flexible linker are connected, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is that 9.0 μ L add RNase Free water to 25 μ L； Connecting PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F2：CATGCCATGGTATGTACAAAATGCAGC carries NcoI restriction enzyme sites；

Downstream IL-2-R2：ACCACCACCAGAACCACCACCACCGGTCAGGGTAGAGTAG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGTCTTACACCACCT, with flexible linker；

Downstream IFN-γ-R2：CCCTCGAGTTTAGAAGCACGCTG carries XhoI restriction enzyme sites；

B. the target gene of the IL-2 and IFN-γ, the gene order of the two is respectively such as SEQUENCE LISTING 400 Shown in 7 > and SEQUENCE LISTING of <, 400 <, 8 >；

Respectively using IL-2 and the target gene of IFN-γ as template, and it is utilized respectively the upstream and downstream primer of IL-2 and IFN-γ PCR amplification is carried out, the target gene of IL-2 and IFN-γ after the optimization of the flexible linker of connection have been respectively obtained.

PCR reaction systems and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into cycle；95 DEG C of denaturation 45S, 60 DEG C of annealing 45S, 72 DEG C extend 1kb/min, follow Ring 35 times, last 72 DEG C of extensions 10min.

C. IL-2 genes and IFN-γ gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene templates DNA, 1 μ L, IL-2 sense primer of IFN-γ template DNA, the 0.5 μ L of flexible linker are connected, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 9.0 μ L, adds RNase Free water to 25 μ L； Connecting PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The present invention also provides the application of the Recombinant Swine long-acting interferon γ, long half time was up to 55 hours or more, tool There is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig IL-2 and Porcine interferon-gamma gene are realized fusion by flexible linker, interferon half-life period is improved, Compared with plain interferon, 13 times or more are improved；Compared with common polyethylene glycol fused interferon, cost is significantly reduced.

2. by being optimized to pig IL-2 and Porcine interferon-gamma gene, IL-2 and Porcine interferon-gamma fusion protein are improved Expression quantity.

3. using recombination bacillus coli BL21/pET-32a-IL2-IFN γ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids do not generate inclusion body in protein expression, form soluble protein, avoid the mistake of inclusion body denaturation and renaturation Journey substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of pig IL-2 and Porcine interferon-gamma is not only wide with interferon gamma Antivirus action is composed, while significantly improving the immune response of pig itself.

Description of the drawings

Fig. 1 is the result of the pig IL-2 genes and the RT-PCR amplifications of Porcine interferon-gamma gene in embodiment 1；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Porcine interferon-gamma gene RT-PCR amplified productions；Swimming lane 2：The RT-PCR amplification productions of pig IL2 genes Object；

Fig. 2 is the result of the PCR amplification after the pig IFN γ in embodiment 1 is connected with the target gene of pig IL-2；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Porcine interferon-gamma gene and 2 gene ligation amplification product of porcine interleukin；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：Empty bacterium Control；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：It is precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 is that the Recombinant Swine long-acting interferon γ made from the fusion protein in embodiment 1 causes carefully VSV in embodiment 5 The inhibiting effect of born of the same parents' lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from dextrad It is left) human interferon standard items handle hole；B3-12 is the Recombinant Swine long-acting interferon γ processing of gradient dilution (from right to left) Hole；

Fig. 7 is the Recombinant Swine long-acting interferon γ intramuscular injection blood made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Specific implementation mode

Embodiment 1

A kind of fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma, preparation method are as follows：

1. the acquisition and amplification of pig interleukin 2 and 6 (IL-2) and Porcine interferon-gamma (IFN-γ) target gene

Design of primers：

It is shown in Table 1 according to the objective gene sequence design synthetic primer reported in Genebank, in the upstream of porcine interleukin 2 EcoRI restriction enzyme sites and Linker sequences are introduced in primer and downstream primer respectively, Porcine interferon-gamma sense primer and under III restriction enzyme site of Linker sequences and Hind is introduced respectively in trip primer.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, and the target gene of IL-2 and IFN-γ, the gene of the two are obtained by reverse transcription Sequence is respectively as shown in 400 < of SEQUENCE LISTING 400 <, 5 > and SEQUENCE LISTING, 6 >；

RT-PCR reaction systems (25 μ L) are shown in Table 2

2 RT-PCR reaction systems of table

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 490bp and 530bp or so in RT-PCR amplified productions, and result is such as Shown in Fig. 1.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

3 PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 990bp or so in pcr amplification product, and the results are shown in Figure 2, figure Occurs the band of porcine interleukin 2 amplified production and Porcine interferon-gamma amplified production in 2, this is because in 2 gene of porcine interleukin During being connected with Porcine interferon-gamma gene PCR, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in 400 < of SEQUENCE LISTING, 3 >.

3. expression vector establishment

The glue recovery product of target gene PCR errorless after sequencing after selection connection is used with pET-32a plasmids EcoRI and III restriction enzymes of Hind carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 4：

4 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through EcoRI and III double digestions of Hind, is accredited as positive and indicates expression vector establishment success, obtained engineering bacteria pET- 32a/rIL2-IFNγ；There is single band through agarose gel electrophoresis at the places 990bp or so in PCR amplification and double digestion product, The results are shown in Figure 3 for it.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN γ shake for 37 DEG C in the LB culture mediums of the 100 μ g/ml containing ampicillin Bacterium 1h recoveries engineering bacteria activity is surveyed OD values and is reached in LB culture mediums (the 100 μ g/ml containing ampicillin) after amplification culture 4h When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of induced expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, the results are shown in Figure 4, it can be seen from the figure that supernatant precipitates after the bacterial cell disruption after recombinant bacterium induction 5h In the visible predominant expression band in the places 54.6KD or so, illustrate precipitating and the fusion protein of equal successful expression in supernatant.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifuges 15min, Supernatant, inclusion body (inclusion body is through dissolving, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ protein peaks.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purifications displacement to (the 50mM trihydroxy methyls of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After crossing column to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ protein peaks.

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced 200 molecular sieve chromatographies of Superdex, with Binding Buffer III elution, collects rIL2-IFN γ protein peaks.

5.4 sample identification

Measure rIL2-IFN γ potency and specific activity, specific activity >=1.0 × 10⁶U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma is can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma, other are with embodiment 1, only by it In e. coli bl21 (DE3) competent cell replace for BL21 (DE3) competent cell with pGro7 plasmids.Its The SDS-PAGE electrophoresis results of fusion protein are compareed with embodiment 1, and 54.6KD or so place's predominant expression bands are thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in expressing bacterial strain White correct folding, reaches solubility expression of protein.

Embodiment 3

To in embodiment 1 IL-2 and IFN-γ optimize, artificial synthesized IL-2 and IFN-γ target gene, optimization Afterwards, the nucleotide sequence of the two is respectively such as 400 < of SEQUENCE LISTING 400 <, 7 > and SEQUENCE LISTING, 8 > institutes Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common each biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the profit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 of pig and IFN-γ in the present embodiment Gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution ranging from 30 in gene~ 70%, in any region translation and transcriptional efficiency can be influenced more than the range.Using software detection find pig IL-2 and The codon of IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.23,0.24, GC percentages It is 38.7%, 39.2%；And by obtaining recombination password in Escherichia coli after pig IL-2 and IFN-γ gene optimization Sub- adaptation index (CAI) is 0.97,1.0, GC percentages 47.6%, 45.4%.Low password is significantly reduced by gene optimization The utilization rate of son, avoids influence of the rare codon to protein expression, improves the G/C content of gene, improve transcription and translation Efficiency, and then improve the expression quantity of recombinant protein.

1.3 design of primers：

6 PCR amplification primer of table

The genomic DNA of IL-2 and IFN-γ after optimization are diluted to 0.05mg/mL respectively.It is obtained using PCR amplification Target gene, 25 μ L reaction systems are as shown in table 7：

7 PCR reaction systems of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

IL-2 and the pcr amplification product of IFN-γ occur in 490bp and 530bp or so special respectively through agarose gel electrophoresis Different band illustrates the target gene for the IL-2 and IFN-γ being prepared after the optimization of the flexible linker of connection.

2. the connection of target gene

Target gene is diluted to 10ug/mL, target gene, 25 μ L reaction systems such as 8 institute of table are connected using over-lap PCR Show：

8 PCR reaction systems of table

Response parameter is：95 DEG C of pre-degeneration 4min, into cycle：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 990bp or so in pcr amplification product, illustrates successfully to have obtained IL-2 Target gene after being connected with IFN-γ, nucleotide sequence such as 400 < of SEQUENCE LISTING, 4 > of obtained target gene It is shown.

3. expression vector establishment

The glue recovery product of target gene PCR errorless after sequencing after selection connection is used with pET-32a plasmids NcoI, XhoI restriction enzyme carry out double digestion and recycling, and double digestion is done by 20 μ L systems in table 9：

9 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmids after connection is attached by the system in table 10,4 DEG C overnight connection：

Table 10

It converts in connection product to e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB tablets is taken to identify target gene, positive colony bacteria plasmid through PCR It is identified through NcoI, XhoI double digestion, is accredited as positive and indicates expression vector establishment success, PCR amplification and double digestion product warp There is single band at the places 990bp or so in agarose gel electrophoresis, illustrates the target gene after being connected with IFN-γ containing IL-2 Expression vector establishment success, obtained engineering bacteria pET-32a/rIL2-IFN γ.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN γ shake for 37 DEG C in the LB culture mediums of the 100 μ g/ml containing ampicillin Bacterium 1h recoveries engineering bacteria activity；In LB culture mediums (the 100 μ g/ml containing ampicillin) after amplification culture 4h, surveys OD values and reach When 1.0；IPTG, the final concentration of 100 μ g/mL, 32 DEG C of induced expression 5h of IPTG is added；Bacterium is collected, through SDS-PAGE Electrophoresis detection, recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the visible predominant expression band in the places 54.6KD or so, Illustrate to have obtained recombinant protein in supernatant precipitates.

Mass volume ratio 1 is added:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasounds are split Bacterial precipitation is solved, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifugations 15min takes supernatant, inclusion body (inclusion body is through dissolving, refolding strategy), obtains crude fusion protein respectively.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

5.4 sample identification

Measure rIL2-IFN γ potency and specific activity, specific activity >=1.0 × 10⁶U/mg albumen is qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma is can be obtained, amino acid sequence is such as Shown in 400 < of SEQUENCE LISTING, 2 >.

Embodiment 4

A kind of fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma, other are with embodiment 3, only by it In e. coli bl21 (DE3) competent cell replace for BL21 (DE3) competent cell with pGro7 plasmids.Its The SDS-PAGE electrophoresis results of fusion protein are compareed with embodiment 3, and 54.6KD or so place's predominant expression bands are thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in expressing bacterial strain White correct folding, reaches solubility expression of protein.Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Offshore Science and Technology Ltd./glad hundred promise biology, article No. V205.

Embodiment 5

A kind of Recombinant Swine long-acting interferon γ is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 It is freeze-dried to form with later.The freeze drying protectant is glycerine, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the identification for the fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, measures embodiment 1~4 obtained fusion protein concentration is all higher than 1.2mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 54.6KD or so, such as Fig. 4, shown.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected respectively, with the anti-pig gamma interferon of abcam companies mouse (1:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon γ samples can be dry with anti-pig It disturbs plain γ monoclonal antibodies and specific reaction occurs, specific band occur in the places 54.6KD or so, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of Recombinant Swine long-acting interferon γ in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO2 culture for 24 hours, the Recombinant Swine that various dose is added is long Interferon gamma is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100TCID respectively₅₀VSV viruses.

Test result

The result shows that the Recombinant Swine long-acting interferon γ obtained causes the lesion of HEp-2 cells to have apparent suppression VSV It makes and uses.The lesions such as occurs cell rounding after untreated cell inoculation virus, falls off, is disintegrated.And the Recombinant Swine obtained After long-acting interferon γ treated cell inoculation viruses, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur Any lesion, measures potency >=1.0 × 10⁶U/ml, as shown in Figure 6.

Embodiment 8

The four parts of Recombinant Swine long-acting interferon γ freeze-dryings obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 The measurement of half-life period of the agent (being denoted as A, B, C, D respectively) in pig body

Cytopathic-effect inhibition assay measures the blood concentration and time relationship of rIL2-IFN γ

Take the piglet (half male and half female) that six weight are roughly the same, the long-acting Porcine interferon-gamma freeze-drying of intramuscular injection 2mg/ml pigs Agent 2ml, respectively 1h, 2h, 4h, 8h, 16h, for 24 hours, 36h, 48h, 60h, 88h venous blood collection, the solidification of 4 DEG C of blood sample, 3500rpm is low Temperature centrifugation 10min detaches serum, and every pig blood sample of each time point is to be measured in -20 DEG C of preservations.Blood is measured using cytopathic-effect inhibition assay The concentration of rIL2-IFN γ in final proof product is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Matched curve such as Fig. 7 It is shown；Parameter result of calculation is shown in Table 11.

Dominant dynamic parameters in serum after 11 Recombinant Swine long-acting interferon γ intramuscular injection of table

The result shows that Recombinant Swine long-acting interferon γ has longer half-life period.Half-life period can reach 55h or so after measured, compared with Plain interferon improves about 13 times.

Embodiment 9

The freeze-dried measurement that pig cell immune response is influenced of four parts of Recombinant Swine long-acting interferon γ in embodiment 5

It takes six roughly the same piglets of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml Recombinant Swine long-acting interferon freeze-dried 2ml of γ are penetrated, the PBS of 2mL is subcutaneously injected in control group neck, takes pig after injecting 4 weeks Peripheral blood takes weekly a blood later, detaches lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out by kit specification, and testing result is as shown in table 12：

Table 12ELISA detection each group pig cell immune responses are horizontal

The result shows that after injection Recombinant Swine long-acting interferon γ, cell factor IL-4 in pig peripheral blood can be significantly improved Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned with reference to embodiment to Recombinant Swine long-acting interferon γ and prepare this long-acting interferon γ fusion protein and its The detailed description that preparation method carries out is illustrative without being restrictive, and can enumerate several according to limited range Embodiment, therefore the change and modification in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Anhui Jiuchuan Biotechnology Co., Ltd.

<120>A kind of Recombinant Swine long-acting interferon γ and the fusion protein and preparation method thereof for preparing this long-acting interferon γ

<130> 1

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 332

<212> PRT

<213>Recombinant Swine long-acting interferon γ fusion proteins 1

<400> 1

Met Tyr Lys Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Met Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys Lys

20 25 30

Gln Leu Glu Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu Val

35 40 45

Lys Asn Tyr Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys Phe

50 55 60

Tyr Met Pro Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu Val

65 70 75 80

Glu Glu Leu Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser Lys

85 90 95

Asn Ser Asp Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn Val

100 105 110

Thr Val Leu Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu Tyr

115 120 125

Asp Asp Glu Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile Thr

130 135 140

Phe Cys Gln Ser Ile Tyr Ser Thr Leu Thr Arg Ser Thr Ser Arg Thr

145 150 155 160

Thr Ser Arg Thr Ser Thr Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe

165 170 175

Gln Leu Cys Val Thr Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro

180 185 190

Phe Phe Lys Glu Ile Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr

195 200 205

Ser Gly Val Pro Asn Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn

210 215 220

Trp Lys Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser

225 230 235 240

Phe Tyr Phe Lys Phe Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln

245 250 255

Arg Ser Met Asp Val Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn

260 265 270

Gly Ser Ser Gly Lys Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro

275 280 285

Val Asp Asn Leu Gln Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys

290 295 300

Val Met Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg

305 310 315 320

Ser Gln Thr Met Phe Gln Gly Gln Arg Ala Ser Lys

325 330

<210> 2

<211> 330

<212> PRT

<213>Recombinant Swine long-acting interferon γ fusion proteins 2

<400> 2

Met Tyr Lys Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Met Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys Lys

20 25 30

Gln Leu Glu Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu Val

35 40 45

Lys Asn Tyr Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys Phe

50 55 60

Tyr Met Pro Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu Val

65 70 75 80

Glu Glu Leu Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser Lys

85 90 95

Asn Ser Asp Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn Val

100 105 110

Thr Val Leu Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu Tyr

115 120 125

Asp Asp Glu Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile Thr

130 135 140

Phe Cys Gln Ser Ile Tyr Ser Thr Leu Thr Gly Gly Gly Gly Ser Gly

145 150 155 160

Gly Gly Gly Ser Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu

165 170 175

Cys Val Thr Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe

180 185 190

Lys Glu Ile Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly

195 200 205

Val Pro Asn Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys

210 215 220

Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr

225 230 235 240

Phe Lys Phe Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser

245 250 255

Met Asp Val Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser

260 265 270

Ser Gly Lys Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp

275 280 285

Asn Leu Gln Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met

290 295 300

Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln

305 310 315 320

Thr Met Phe Gln Gly Gln Arg Ala Ser Lys

325 330

<210> 3

<211> 996

<212> DNA

<213>Recombinant Swine long-acting interferon γ genomes 1

<400> 3

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ctagatccac ctccagaacc 480

acctccagaa cctccaccat gagttataca acttatttct tagcttttca gctttgcgtg 540

actttgtgtt tttctggctc ttactgccag gcgccctttt ttaaagaaat aacgatccta 600

aaggactatt ttaatgcaag tacctcaggt gtacctaatg gtggacctct tttcttagaa 660

attttggaga attggaaaga ggagagtgac aaaaaaataa ttcagagcca aattgtctcc 720

ttctacttca aattctttga aatcttcaaa gataaccagg ccattcaaag gagcatggat 780

gtgatcaagc aagacatgtt tcagaggttc ctaaatggta gctctgggaa actgaatgac 840

ttcgaaaagc tggttaaaat tccggtagat aatctgcaga tccagcgcaa agccatcagt 900

gaactcatca aagtgatgaa tgatctgtca ccaagatcta acctaagaaa gcggaagaga 960

agtcagacta tgttccaagg ccagagagca tcaaaa 996

<210> 4

<211> 990

<212> DNA

<213>Recombinant Swine long-acting interferon γ genomes 2

<400> 4

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga ccggtggtgg tggttctggt 480

ggtggtggtt ctatgtctta caccacctac ttcctggctt tccagctgtg cgttaccctg 540

tgcttctctg gttcttactg ccaggctccg ttcttcaaag aaatcaccat cctgaaagac 600

tacttcaacg cttctacctc tggtgttccg aacggtggtc cgctgttcct ggaaatcctg 660

gaaaactgga aagaagaatc tgacaaaaaa atcatccagt ctcagatcgt ttctttctac 720

ttcaaattct tcgaaatctt caaagacaac caggctatcc agcgttctat ggacgttatc 780

aaacaggaca tgttccagcg tttcctgaac ggttcttctg gtaaactgaa cgacttcgaa 840

aaactggtta aaatcccggt tgacaacctg cagatccagc gtaaagctat ctctgaactg 900

atcaaagtta tgaacgacct gtctccgcgt tctaacctgc gtaaacgtaa acgttctcag 960

accatgttcc agggtcagcg tgcttctaaa 990

<210> 5

<211> 462

<212> DNA

<213>Pig IL-2

<400> 5

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ct 462

<210> 6

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 6

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 7

<211> 462

<212> DNA

<213>Pig IL-2

<400> 7

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga cc 462

<210> 8

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 8

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

Claims

1. a kind of fusion protein being made of pig interleukin 2 and 6 and Porcine interferon-gamma, it is characterised in that：The fusion protein Amino acid sequence table is denoted as fusion protein 1 as shown in 400 < of SEQUENCE LISTING, 1 >；Or such as SEQUENCE LISTING Shown in 400 <, 2 >, it is denoted as fusion protein 2.

2. a kind of gene of coding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 3 >；Or as shown in 400 < of SEQUENCE LISTING, 4 >, It is denoted as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of Recombinant Swine long-acting interferon γ, which is characterized in that the Recombinant Swine long-acting interferon γ is described in claim 1 Fusion protein and freeze drying protectant mixture after, it is freeze-dried to form.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, can be obtained fusion protein after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ, preparation method are：

(1) design primer, is obtained or the pig interleukin 2 and 6 of the flexible linker sequences of artificial synthesized connection by reverse transcription With the target gene of Porcine interferon-gamma；The target gene of pig interleukin 2 and 6 and Porcine interferon-gamma is connected by flexible linker It picks up and, the nucleotides sequence list of target gene is as shown in 400 < of SEQUENCE LISTING, 3 > or such as SEQUENCE Shown in 400 < of LISTING, 4 >；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2-IFN γ。

8. the preparation method described according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method described according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively purified through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of Recombinant Swine long-acting interferon γ according to claim 5, which is characterized in that the Recombinant Swine is long-acting The long half time of interferon gamma had broad-spectrum disease resistance toxic action and can improve the immune response of pig itself up to 55 hours or more.