CN107383206A - A kind of recombinant bovine long-acting interferon γ and prepare this long-acting interferon γ fusion protein and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of recombinant bovine long-acting interferon γ and the fusion protein for preparing this long-acting interferon γ and preparation method thereof; the fusion protein is connected by cattle interleukins-2 2 with Bov IFN γ and formed through flexible linker, through being freeze-dried to obtain recombinant bovine long-acting interferon γ after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon γ is remarkably improved the half-life period of Bov IFN, and more common Bov IFN γ half-life period improves more than 11 times, and with broad-spectrum disease resistance toxic action and can improve Niu Zishen immune response.

Description

A kind of recombinant bovine long-acting interferon γ and the fusion protein for preparing this long-acting interferon γ And preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of recombinant bovine long-acting interferon γ and prepare this Long-acting interferon γ fusion protein and preparation method thereof.

Background technology

Ox is one of important herding species in China, with intensive and large-scale cultivation continuous development, bovine viral The incidence of disease of communicable disease improves year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease propagation is fast, the high serious sound development that govern China's ox aquaculture of the incidence of disease, the death rate；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

The prevention and treatment approach to ox communicable disease mainly by vaccine inoculation and uses antibiotic at present.Big portion Divide antibiotics and traditional oral antiviral medicament, due to medicament residue problem, be negatively affected to health；And Traditional vaccine, high specific and side effect due to it, can not resist virus variation and new virus is continuously emerged to pig The significant damage that aquaculture is brought.Interferon determines its tool with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical practice potentiality, can be used for preventing and treating bovine viral bacterial infection disease.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and produce more species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA is come the activity that suppresses the growth and breeding of virus and play antitumor grade.According to IFN generation cell, biochemical character and The difference to be played a role in terms of immunity of organism, is divided into the class of γ, β, γ tri-.It is existing, it is known that γ types IFN be T cell by activating and NK cells produce, and have relatively strong antiviral and immunoloregulation function.Numerous studies show that interferon gamma is except with broad-spectrum disease resistance Outside malicious function, the adjustment effect of key is also played to immune system, so IFN-γ is also known as immunological regulation interferon.It is although each The interferon of type can mediated cell to virus infection reaction, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease is reacted and determines to play even more important effect in the long-term antiviral state of body, thus interferon gamma have it is particularly important Clinical value.

Cell factor IL-2 is interleukin 2, also known as SCIF.Mainly produced by the T lymphocytes activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, strengthen immunologic function, and can restricted T is thin Born of the same parents react and strengthen the immune tolerance of body, therefore available for treatment tumour, infectious diseases and autoimmune disease.In animal doctor In, because IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy Strengthen the immune level of body, improve the resistance against diseases of body, thus exempt from for bacillary, viral and parasitic diseases Epidemic disease is treated.In addition, IL-2 can also influence the metabolism of medicine, make the metabolism time lengthening of medicine, action time increase, so as to improve Curative effect of medication.IL-2 and other cell factors form fusion protein, produce and carry to strengthen the antibody of vaccine according to gene constructed High cellular immune level.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, the layer only in molecular weight Face upper part solves the problems, such as that interferon molecule amount is small and causes half-life short, while polyethylene glycol fused interferon cost is non- Chang Gao, it is unfavorable for clinically applying.

The content of the invention

In order to solve the above technical problems, the invention provides a kind of recombinant bovine long-acting interferon γ and prepare this long-acting interference Plain γ fusion protein and preparation method thereof, the recombinant bovine long-acting interferon γ are remarkably improved the half-life period of Bov IFN, More common Bov IFN γ half-life period improves more than 11 times, and with broad-spectrum disease resistance toxic action and can improve the immune of Niu Zishen Response.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, the amino acid sequence of the fusion protein List is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, it is designated as genome 2.

Fusion protein described in genome 1 and the genome 2 codified.Genome 2 is the nucleotides to genome 1 Sequence optimize after result, be considered as the gene in the expression system during usual codon adaptation indexI CAI=1.0 For optimal high efficient expression state, CAI values are lower to show that expression is lower in host.G/C content most ideal distribution in gene Scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Found using software detection The codon of ox IL-2 and IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19,0.24, GC percentages are 39.1%, 39.8%；And by existing to obtaining recombination genome 2 after ox IL-2 and IFN-γ gene optimization Codon adaptation indexI (CAI) is 0.94,1.0, GC percentages 48.2%, 44.8% in Escherichia coli.Shown by gene optimization Writing reduces the utilization rate of low codon, avoids influence of the rare codon to protein expression, improves the G/C content of gene, Improve transcription and translation efficiency.

Present invention also offers the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers a kind of recombinant bovine long-acting interferon γ, the recombinant bovine long-acting interferon γ is melted by described It is freeze-dried to form after hop protein and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, the final concentration of three For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, fusion protein is can obtain after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ, and its preparation method is：

(1) primer is designed, is obtained by reverse transcription or the bovine leukocyte of the flexible linker sequences of artificial synthesized connection The target gene of interleukin 2 and Bov IFN γ；By flexible linker by cattle interleukins-2 2 and Bov IFN γ purpose base Because connecting, the nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2- IFNγ。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of cattle interleukins-2 2 (IL-2) is：

Upstream IL-2-F1：CCGGAATTCATGTACAAGATACAACTCT, with EcoRI restriction enzyme sites；

Downstream IL-2-R1：

ACCACCACCAGAACCACCACCACCAGTCATTGTTGAGTAGAT, with flexible linker；

Bov IFN γ (IFN-γ) primer sequence is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATATACAAGCTATTT, with flexible linker；

Downstream IFN-γ-R1：CCCTCGAGCGTTGATGCTCTCC, with XhoI restriction enzyme sites；

B. RNA is extracted from cattle liver, the target gene of IL-2 and IFN-γ, both gene sequences are obtained by reverse transcription Row are respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞ and SEQUENCE LISTING 5；

Respectively using the target gene of IL-2 and IFN-γ as template, and it is utilized respectively the upstream and downstream primer of IL-2 and IFN-γ Enter performing PCR amplification, respectively obtain the flexible linker of connection IL-2 and the target gene of IFN-γ.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. IL-2 genes and IFN-γ gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's μ L of IL-2 gene templates DNA 1, flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5 are connected, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ anti-sense primer 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of cattle interleukins-2 2 (IL-2) is：

Upstream IL-2-F2：CGGGATCCATGTACAAAATCCAGCT, with BamHI restriction enzyme sites；

Downstream IL-2-R2：

ACCACCACCAGAACCACCACCACCGGTCATGGTAGAGTAGA, with flexible linker；

Bov IFN γ (IFN-γ) primer sequence is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTAC, with flexible linker；

Downstream IFN-γ-R2：CCCTCGAGGGTCATGGTAGAGTAGA, with XhoI restriction enzyme sites；

B. the target gene of the IL-2 and IFN-γ, both gene orders are respectively such as SEQUENCE LISTING 400 Shown in the ＞ of 6 ＞ and SEQUENCE LISTING of ＜, 400 ＜ 7；

Respectively using the target gene of IL-2 and IFN-γ as template, and it is utilized respectively the upstream and downstream primer of IL-2 and IFN-γ Enter performing PCR amplification, respectively obtain the target gene of IL-2 and IFN-γ after the flexible linker of connection optimization.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.0, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. IL-2 genes and IFN-γ gene are connected using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's μ L of IL-2 gene templates DNA 1, flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5 are connected, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ anti-sense primer 2.5 μ L, dNTP Mix is 9 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Present invention also offers the application of the recombinant bovine long-acting interferon γ, its long half time was up to more than 45 hours, tool There is broad-spectrum disease resistance toxic action and Niu Zishen immune response can be improved.

Compared with prior art, the present invention has the advantages that：

1. ox IL-2 and Bov IFN γ genes are realized into fusion by flexible linker, interferon half-life period is improved, Compared with plain interferon, more than 11 times are improved；

2. by being optimized to ox IL-2 and Bov IFN γ genes, IL-2 and Bov IFN γ fusion proteins are improved Expression quantity.

3. using recombination bacillus coli BL21/pET-32a-IL-2-IFN γ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, inclusion body is not produced in protein expression, form soluble protein, avoid the mistake of inclusion body denaturation and renaturation Journey, substantially reduce the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of ox IL-2 and Bov IFN γ is not only wide with interferon gamma Antivirus action is composed, while significantly improves Niu Zishen immune response.

Brief description of the drawings

Fig. 1 is ox IL-2 genes and the result of Bov IFN γ genes RT-PCR amplifications in embodiment 1；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Ox IL-2 gene RT-PCR amplified productions；Swimming lane 2：Bov IFN γ genes RT-PCR amplification productions Thing；

Fig. 2 is the result of the PCR amplifications after the ox IFN γ in embodiment 1 connects with ox IL-2 target gene；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Bov IFN γ genes and ox interleukin-22 gene ligation amplification product；

Fig. 3 is PCR amplifications and the double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium compares；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：Precipitated after being crushed for recombinant bacterium induction；

Fig. 6 is that the recombinant bovine long-acting interferon γ as made from the fusion protein in embodiment 1 is caused carefully to VSV in embodiment 5 The inhibitory action of born of the same parents' lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from dextrad It is left) human interferon standard items processing hole；B3-12 is the recombinant bovine long-acting interferon γ processing of gradient dilution (from right to left) Hole；

Fig. 7 is the recombinant bovine long-acting interferon γ intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, its preparation method are as follows：

1. the acquisition of cattle interleukins-2 2 (IL-2) and Bov IFN γ (IFN-γ) target gene is set with amplimer Meter：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upstream of ox interleukin-22 EcoRI restriction enzyme sites and Linker sequences are introduced in primer and anti-sense primer respectively, Bov IFN γ sense primer and under Linker sequences and XhoI restriction enzyme sites are introduced respectively in trip primer.

The pcr amplification primer thing of table 1

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, the target gene of IL-2 and IFN-γ, both genes are obtained by reverse transcription Sequence is respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞ and SEQUENCE LISTING 5；

RT-PCR reaction systems (25 μ L) are shown in Table 2

The RT-PCR reaction systems of table 2

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 490bp and 530bp or so in RT-PCR amplified productions, and its result is such as Shown in Fig. 1, illustrate to have obtained the Bov IFN IL-2 target gene for being connected to flexible linker and Bov IFN γ purposes Gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects even section target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3：

The PCR reaction systems of table 3

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 990bp or so in pcr amplification product, and its result is as shown in Fig. 2 figure Occurs the band of ox interleukin-22 amplified production and Bov IFN γ amplified productions in 2, because in ox interleukin-22 gene During being connected with Bov IFN γ gene PCRs, there is non-specific responding.The nucleotide sequence of obtained target gene is such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2.

3. expression vector establishment

The PCR glue reclaims product for selecting the target gene after connection errorless after sequencing uses with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 4：

The double digestion system of table 4

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 5,4 DEG C overnight connection：

Table 5

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through EcoRI and XhoI double digestions, be accredited as positive and represent expression vector establishment success, obtained engineering bacteria pET-32a/ rIL2-IFNγ；PCR is expanded and double digestion product single band occurs through agarose gel electrophoresis at 990bp or so places, and it is tied Fruit is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN γ shake for 37 DEG C in the LB culture mediums of the μ g/mL containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity；In LB culture mediums (the μ g/mL containing ampicillin 100) after amplification culture 4h, survey OD values and reach When 1.0；Add IPTG, IPTG final concentration of 100 μ g/mL, 32 DEG C of induced expression 5h；Bacterium is collected, through SDS-PAGE Electrophoresis detection, its result as shown in figure 4, it can be seen that recombinant bacterium induction 5h after bacterial cell disruption after supernatant precipitate In the visible predominant expression band in 54.7KD or so places, illustrate precipitating with equal successful expression in supernatant fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns that have been balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ protein peaks.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, DEAE anion exchange chromatography that loading has balanced by using Binding Buffer II, then After crossing post to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ protein peaks.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, with Binding Buffer III elution, collects rIL2-IFN γ protein peaks.

5.4 sample identification

Determine rIL2-IFN γ potency and specific activity, specific activity >=1.0 × 10⁷IU/mg albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.The i.e. available fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, its amino acid sequence is such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, other are with embodiment 1, simply by it In e. coli bl21 (DE3) competent cell replace for BL21 (DE3) competent cell with pGro7 plasmids.Its The SDS-PAGE electrophoresis results of fusion protein compare with embodiment 1, and 54.7KD or so places predominant expression band is thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in bacterial strain is expressed White correct folding, reaches solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, its preparation method are as follows：

1. the acquisition and amplification of cattle interleukins-2 2 (IL-2) and Bov IFN γ (IFN-γ) target gene

IL-2 in embodiment 1 and IFN-γ are optimized, artificial synthesized IL-2 and IFN-γ target gene, optimized Afterwards, both nucleotide sequences are respectively such as the ＞ institutes of 400 ＜ of SEQUENCE LISTING 400 ＜, 6 ＞ and SEQUENCE LISTING 7 Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 and IFN-γ of ox in the present embodiment Gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered as the gene during usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, it can influence translation and transcriptional efficiency more than the scope in any region.Using software detection find ox IL-2 and The codon of IFN-γ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.19,0.24, GC percentages For 39.1%, 39.8%；And by obtaining recombination password in Escherichia coli after ox IL-2 and IFN-γ gene optimization Sub- adaptation index (CAI) is 0.94,1.0, GC percentages 48.2%, 44.8%.Low password is significantly reduced by gene optimization The utilization rate of son, avoids influence of the rare codon to protein expression, improves the G/C content of gene, improve transcription and translation Efficiency.

1.3 design of primers：

The pcr amplification primer thing of table 6

IL-2 after optimization and the genomic DNA of IFN-γ are diluted to 0.05mg/mL respectively.Expanded and obtained using PCR Target gene, 25 μ L reaction systems are as shown in table 7：

The PCR reaction systems of table 7

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

The pcr amplification product of IL-2 and IFN-γ occurs special in 490bp and 530bp or so respectively through agarose gel electrophoresis Different band, illustrate the purpose base for being connected to the ox IL-2 after flexible linker optimization and ox IFN-γ has been prepared Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, target gene, the 25 μ L reaction systems such as institute of table 8 are connected using over-lap PCR Show：

The PCR reaction systems of table 8

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 990bp or so in pcr amplification product, illustrates successfully to have obtained IL-2 Target gene after being connected with IFN-γ, the nucleotide sequence such as ＞ of 400 ＜ of SEQUENCE LISTING 3 of obtained target gene It is shown.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 9：

The double digestion system of table 9

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recovery fragment	2μL
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 10,4 DEG C overnight connection：

Table 10

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through BamHI, XhoI double digestion, be accredited as positive and represent expression vector establishment success, PCR amplifications and double digestion product warp There is single band at 990bp or so places in agarose gel electrophoresis, illustrates the target gene after being connected containing IL-2 with IFN-γ Expression vector establishment success, obtained engineering bacteria pET-32a/rIL2-IFN γ.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIL2-IFN γ shake for 37 DEG C in the LB culture mediums of the μ g/mL containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity, in LB culture mediums (the μ g/mL containing ampicillin 100) after amplification culture 4h, survey OD values and reach When 1.0；Add IPTG, IPTG final concentration of 100 μ g/mL, 32 DEG C of induced expression 5h；Bacterium is collected, through SDS-PAGE Electrophoresis detection, recombinant bacterium induction 5h after bacterial cell disruption after supernatant be deposited in the visible predominant expression band in 54.7KD or so places, Illustrate to have obtained recombinant protein in supernatant precipitates.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns that have been balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ protein peaks.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, DEAE anion exchange chromatography that loading has balanced by using Binding Buffer II, then After crossing post to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ protein peaks.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, with Binding Buffer III elution, collects rIL2-IFN γ protein peaks.

5.4 sample identification

Determine rIL2-IFN γ potency and specific activity, specific activity >=1.0 × 10⁷IU/mg albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.The i.e. available fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, its amino acid sequence is such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 4

A kind of fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, other are with embodiment 3, simply by it In e. coli bl21 (DE3) competent cell replace for BL21 (DE3) competent cell with pGro7 plasmids.Its The SDS-PAGE electrophoresis results of fusion protein compare with embodiment 3, and 54.7KD or so places predominant expression band is thicker in supernatant, Illustrate after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, and obtained fusion protein amount is higher.Greatly The albumen of enterobacteria expression is mostly present in inclusion body；By introducing molecular chaperones, coordinate expression egg in bacterial strain is expressed White correct folding, reaches solubility expression of protein.Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Offshore Science and Technology Ltd./glad hundred promise biology, article No. V205.

Embodiment 5

A kind of recombinant bovine long-acting interferon γ, mixed respectively with freeze drying protectant by the fusion protein in embodiment 1,2,3,4 It is freeze-dried to form with afterwards.The freeze drying protectant is glycerine, mannitol and sucrose, is buffering with 10mmol/L PBS Liquid, final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 is obtained by the identification of cattle interleukins-2 2 and Bov IFN the γ fusion protein formed

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, determines embodiment 1~4 obtained fusion protein concentration is all higher than 1.4mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 54.7KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-moggy gamma interferon (1 of abcam companies mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon γ samples can be done with anti-ox Disturb plain γ monoclonal antibodies generation specific reaction, 54.7KD or so place and specific band occur, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of recombinant bovine long-acting interferon γ in embodiment 5

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/mL cells suspend Liquid, per hole, inoculation 0.1mL moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, adds the recombinant bovine length of various dose Interferon gamma is imitated, inhales and abandons after 24h, then be inoculated with 100TCID respectively₅₀VSV viruses.

Result of the test

As a result the recombinant bovine long-acting interferon γ for showing to obtain causes the lesion of HEp-2 cells to have obvious suppression to VSV Make and use.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the recombinant bovine obtained After cell virus inoculation after long-acting interferon γ processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not occur Any lesion, measures potency >=1.0 × 10⁷IU/mL, as shown in Figure 6.

Embodiment 8

The four parts of recombinant bovine long-acting interferon γ obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed The measure of half-life period of the agent (being designated as A, B, C, D respectively) in ox body

Cytopathic-effect inhibition assay measure rIL2-IFN γ blood concentration and time relationship

Take the ox (male and female half and half) that six body weight are roughly the same, intramuscular injection 2mg/mL ox long-acting interferons γ is freeze-dried 2mL, respectively in 1h, 2h, 4h, 8h, 16h, 24h, 36h, 48h, 60h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm low-temperature centrifugations 10min separates serum, and each every ox blood sample of time point is to be measured in -20 DEG C of preservations.Blood serum sample is determined using cytopathic-effect inhibition assay Middle rIL2-IFN γ concentration, carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Matched curve is as shown in Figure 7；Ginseng Number result of calculation is shown in Table 11.

Dominant dynamic parameters in serum after the recombinant bovine long-acting interferon γ intramuscular injection of table 11

As a result show that recombinant bovine long-acting interferon γ has longer half-life period.Half-life period can reach 45h or so after measured, compared with Plain interferon improves about 11 times.

Embodiment 9

The freeze-dried measure influenceed on ox cellullar immunologic response of four parts of recombinant bovine long-acting interferon γ in embodiment 5

Take six roughly the same beef cattles of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/mL recombinant bovine long-acting interferon freeze-dried 2mL of γ are penetrated, 2mL PBS is subcutaneously injected in control group neck, takes 4 Zhou Houniu of injection Peripheral blood, take a blood weekly afterwards, separate lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI After 1640 culture mediums wash 2 times, it is resuspended with complete medium, adjusts cell concentration as 2 × 10⁶Individual/mL, 24 porocyte culture plates are every Hole addition 1mL lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out, testing result is as shown in table 12 by kit specification：

The ELISA of table 12 detection each group ox cellullar immunologic responses are horizontal

As a result show after injecting recombinant bovine long-acting interferon γ, can significantly improve ox Evaluation of Cytokines in Peripheral Blood IL-4's Content, cellullar immunologic response level is enhanced, significantly improves immunity level.

It is above-mentioned with reference to embodiment to recombinant bovine long-acting interferon γ and prepare this long-acting interferon γ fusion protein and its The detailed description that preparation method is carried out, is illustrative rather than limited, can include several according to limited scope Embodiment, therefore changing and modifications in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of recombinant bovine long-acting interferon γ and prepare this long-acting interferon γ fusion protein and preparation method thereof

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 331

<212> PRT

<213>Recombinant bovine long-acting interferon γ fusion proteins

<400> 1

Met Tyr Lys Ile Gln Leu Leu Ser Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Val Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Gly Asn Thr Met Lys

20 25 30

Glu Val Lys Ser Leu Leu Leu Asp Leu Gln Leu Leu Leu Glu Lys Val

35 40 45

Lys Asn Pro Glu Asn Leu Lys Leu Ser Arg Met His Thr Phe Asp Phe

50 55 60

Tyr Val Pro Lys Val Asn Ala Thr Glu Leu Lys His Leu Lys Cys Leu

65 70 75 80

Leu Glu Glu Leu Lys Leu Leu Glu Glu Val Leu Asn Leu Ala Pro Ser

85 90 95

Lys Asn Leu Asn Pro Arg Glu Ile Lys Asp Ser Met Asp Asn Ile Lys

100 105 110

Arg Ile Val Leu Glu Leu Gln Gly Ser Glu Thr Arg Phe Thr Cys Glu

115 120 125

Tyr Asp Asp Ala Thr Val Asn Ala Val Glu Phe Leu Asn Lys Trp Ile

130 135 140

Thr Phe Cys Gln Ser Ile Tyr Ser Thr Met Thr Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Tyr Phe Leu Ala Leu Leu

165 170 175

Leu Cys Gly Leu Leu Gly Phe Ser Gly Ser Tyr Gly Gln Gly Gln Phe

180 185 190

Phe Arg Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn Ala Ser Ser Pro

195 200 205

Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp

210 215 220

Lys Asp Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe

225 230 235 240

Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg

245 250 255

Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly

260 265 270

Ser Ser Glu Lys Leu Glu Asp Phe Lys Lys Leu Ile Gln Ile Pro Val

275 280 285

Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val

290 295 300

Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser

305 310 315 320

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Thr

325 330

<210> 2

<211> 993

<212> DNA

<213>Recombinant bovine long-acting interferon γ genomes 1

<400> 2

atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120

ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180

acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300

cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgactggtgg tggtggttct 480

ggtggtggtg gttctatgaa atatacaagc tatttcttag ctttactgct ctgtgggctt 540

ttgggttttt ctggttctta tggccagggc caatttttta gagaaataga aaacttaaag 600

gagtatttta atgcaagtag cccagatgta gctaagggtg ggcctctctt ctcagaaatt 660

ttgaagaatt ggaaagatga aagtgacaaa aaaattattc agagccaaat tgtctccttc 720

tacttcaaac tctttgaaaa cctcaaagat aaccaggtca ttcaaaggag catggatatc 780

atcaagcaag acatgtttca gaagttcttg aatggcagct ctgagaaact ggaggacttc 840

aaaaagctga ttcaaattcc ggtggatgat ctgcagatcc agcgcaaagc cataaatgaa 900

ctcatcaaag tgatgaatga cctgtcacca aaatctaacc tcagaaagcg gaagagaagt 960

cagaatctct ttcgaggccg gagagcatca acg 993

<210> 3

<211> 993

<212> DNA

<213>Recombinant bovine long-acting interferon γ genomes 2

<400> 3

atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300

ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgaccggtgg tggtggttct 480

ggtggtggtg gttctatgaa atacacctct tacttcctgg ctctgctgct gtgcggtctg 540

ctgggtttct ctggttctta cggtcagggt cagttcttcc gtgaaatcga aaacctgaaa 600

gaatacttca acgcttcttc tccggacgtt gctaaaggtg gtccgctgtt ctctgaaatc 660

ctgaaaaact ggaaagacga atctgacaaa aaaatcatcc agtctcagat cgtttctttc 720

tacttcaaac tgttcgaaaa cctgaaagac aaccaggtta tccagcgttc tatggacatc 780

atcaaacagg acatgttcca gaaattcctg aacggttctt ctgaaaaact ggaagacttc 840

aaaaaactga tccagatccc ggttgacgac ctgcagatcc agcgtaaagc tatcaacgaa 900

ctgatcaaag ttatgaacga cctgtctccg aaatctaacc tgcgtaaacg taaacgttct 960

cagaacctgt tccgtggtcg tcgtgcttct acc 993

<210> 4

<211> 465

<212> DNA

<213>Ox IL-2

<400> 4

atgtacaaga tacaactctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctggat 120

ttacagttgc ttttggagaa agttaaaaat cctgagaacc tcaagctctc caggatgcat 180

acatttgact tttacgtgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctaaatttag ctccaagcaa aaacctgaac 300

cccagagaga tcaaggattc aatggacaat atcaagagaa tcgttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcaacag taaacgctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 5

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 5

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacg 498

<210> 6

<211> 465

<212> DNA

<213>Ox IL-2

<400> 6

atgtacaaaa tccagctgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcgact tctacgttcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctgaacctgg ctccgtctaa aaacctgaac 300

ccgcgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaacgctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

<210> 7

<211> 498

<212> DNA

<213>Ox IFN-γ

<400> 7

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctacc 498

Claims (10)

1. A kind of 1. fusion protein being made up of cattle interleukins-2 2 and Bov IFN γ, it is characterised in that：The fusion protein Amino acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
2. A kind of 2. gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, It is designated as genome 2.
3. 3. the expression vector containing gene as claimed in claim 2.
4. 4. the genetic engineering bacterium containing gene as claimed in claim 2.
5. 5. a kind of recombinant bovine long-acting interferon γ, it is characterised in that the recombinant bovine long-acting interferon γ is as described in claim 1 Fusion protein and freeze drying protectant mixture after, it is freeze-dried to form.
6. 6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, and fusion protein is can obtain after purified.
7. 7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ, its preparation method are：

   (1) primer is designed, is obtained by reverse transcription or the cattle interleukins-2 2 of the flexible linker sequences of artificial synthesized connection With Bov IFN γ target gene；Cattle interleukins-2 2 and Bov IFN γ target gene are connected by flexible linker Pick up and, the nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 3；

   (2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

   (3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2-IFN γ。
8. 8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.
9. 9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Product successively purify through affinity chromatography, anion-exchange chromatography and sieve chromatography.
10. 10. recombinant bovine long-acting interferon γ according to claim 5 application, it is characterised in that the recombinant bovine is long-acting The long half time of interferon gamma had broad-spectrum disease resistance toxic action and can improve Niu Zishen immune response up to more than 45 hours.