CN107286255A - It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof - Google Patents
It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof Download PDFInfo
- Publication number
- CN107286255A CN107286255A CN201710676299.6A CN201710676299A CN107286255A CN 107286255 A CN107286255 A CN 107286255A CN 201710676299 A CN201710676299 A CN 201710676299A CN 107286255 A CN107286255 A CN 107286255A
- Authority
- CN
- China
- Prior art keywords
- chicken
- ifn
- interferon
- fusion protein
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/57—IFN-gamma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention discloses a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof; the fusion protein is formed by OVA, chicken interferon gamma and chicken interferon α through flexible linker connections, through being freeze-dried to obtain recombination chicken long-acting interferon after fusion protein and freeze drying protectant mixture.The recombination chicken long-acting interferon is remarkably improved the half-life period of chicken interferon, and the half-life period of more common chicken interferon improves more than 22 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of chicken itself.
Description
Technical field
The invention belongs to technical field of biological genetic engineering, and in particular to be disturbed by OVA, chicken interferon gamma and chicken
Fusion protein of plain α compositions and preparation method thereof.
Background technology
In recent years, with aquaculture scale and livestock and poultry and products thereof circulation industry rapidly develop, and China's domestic fowl farming takes
Tremendous development is obtained, the huge industry that annual value of production exceedes hundred billion yuan is formd.Yet with the animal epidemic prevention system that China is weak, poultry diease
It is still the serious problems that China's poultry production faces, this has become the key factor of restriction China poultry cultivation industry development.
Poultry diease is more, loss is big, and the death rate is higher than 15%, and death and culling rate is up to 20%~25% (developed country is less than 5%), and China's poultry husbandry is every
Chicken The dead quantity year caused by infectious disease is about 300,000,000, about 3,000,000,000 yuan of the economic loss directly contributed, between causing
Connect about 10,000,000,000 yuan of loss.
The prevention and treatment for chicken viral diseases mainly use vaccine immunity and drug therapy at present, due to epidemic disease
The immune serotype of seedling is single, and virus serotype is numerous and virus stain speed of mutation is fast, so as to frequently result in vaccine immunity mistake
Lose.Although some antibiotic and the antiviral drugs of chemical synthesis have some effects to a small number of viruses, due to medicament residue warp
Food chain is negatively affected to mankind's health care belt, and China prohibited some antibiotic and antiseptic in aquaculture since 16 years
In application.Therefore, be actively developed production have no toxic side effect, drug residue free and the interferon formulation for not producing drug resistance, it is right
Current chicken viral diseases prevention and treatment predicament has important clinical meaning.
IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect
Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is the multi-functional cell factor of a class, with cell receptor knot
After conjunction, it can induce body and produce many species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus
RNA suppresses the growth and breeding of virus and plays the activity of antitumor grade.Now, it is known that α types IFN in vivo can be selectively
The infection cells such as virus are acted on, by suppressing the biosynthesis of the virus protein in infected cell, wide spectrum are played and efficient
Antivirus action.But to normal host cell without acting on or act on faint.IFN-α main physiological activity is with suppression virus
Duplication, anti parasitic, suppression various kinds of cell propagation, the killing activity of stimulation immunocyte.
γ types IFN is that T cell and NK cells by activating are produced, with relatively strong antiviral and immunoloregulation function.Largely
Research shows that interferon gamma also plays the adjustment effect of key in addition to broad-spectrum antiviral function, to immune system, so
IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti-
Answer, but the immunoregulatory activity of interferon gamma is coordinating immune response and is determining to play more in the long-term antiviral state of body
Important effect, therefore interferon gamma has particularly important clinical value.
Seralbumin is the important component of blood plasma, is difficult to pass through glomerulus under normal circumstances, internal distributed pole it is wide and
There is no zymetology and immunologic competence, be preferable pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg
Linked in the cell through protein translation system by peptide bond in vain, be not required to extra extracorporeal treatment；The expression of albumin is higher,
The expression of destination protein can be improved after being merged with it；Albumin is one stable " inert protein ", after being merged with it
The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein medicine
It can be expected to improve half-life period in blood with Albumin fusion.At present, in experimental animal after multiple protein and Albumin fusion
The extension of Half-life in vivo is confirmed.
The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period is generally 2-4
Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment
Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main cause of half-life short
There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from
Epidemic disease system is removed.
And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the aspect of molecular weight
Part solve interferon molecule amount it is small and the problem of cause half-life short, while polyethylene glycol fused interferon cost is very
Height, is unfavorable for clinically applying.
The content of the invention
In order to solve the above technical problems, the invention provides one kind by OVA, chicken interferon gamma and chicken interferon α groups
Into fusion protein and preparation method thereof, and thus fusion protein with after freeze drying protectant mixture, it is freeze-dried to be prepared into
To a kind of recombination chicken long-acting interferon, the recombination chicken long-acting interferon is remarkably improved the half-life period of chicken interferon, more commonly
The half-life period of chicken interferon improves more than 22 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of chicken itself.
The technical scheme that the present invention takes is：
A kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, the amino of the fusion protein
Acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene
Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, it is designated as genome 2.
Fusion protein described in the equal codified of the genome 1 and the genome 2.Genome 2 is the nucleosides to genome 1
Acid sequence optimize after result, be considered as the gene during usual codon adaptation indexI CAI=1.0 in the expression system
In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene
Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection
Now the codon of OVA, chicken IFN-γ, chicken IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli divides
Not Wei 0.27,0.25,0.31, GC percentages be 43.1%, 42.9%, 61.7%；And by OVA, chicken IFN-γ,
Obtained after chicken IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC hundred
Divide ratio 49.2%, 47.6%, 58.5%.The utilization rate of low codon is significantly reduced by gene optimization, it is to avoid rare close
Influence of the numeral to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.
Present invention also offers the expression vector containing genome 1 or genome 2.
Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.
Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.
Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IFN α.
Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place
Chief cell is e. coli host cell, further, and the e. coli host cell is BL21 (DE3) competent cell
Or BL21 (DE3) competent cell with pGro7 plasmids.
Present invention also offers a kind of recombination chicken long-acting interferon, the recombination chicken long-acting interferon is by described fusion egg
In vain with after freeze drying protectant mixture, it is freeze-dried to form.
The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS
For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.
The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain
The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium
The crude product of the fusion protein is obtained after IPTG induced expressions, it is purified to can obtain fusion protein afterwards.
The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；
The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IFN α, and its preparation method is：
(1) primer is designed, obtained by reverse transcription or be manually respectively synthesized the OVA with flexible linker sequences,
The target gene of chicken interferon gamma, chicken interferon α；By flexible linker by OVA, chicken interferon gamma, chicken interferon α
Target gene connect, the nucleotides sequence list such as ＞ institutes of 400 ＜ of SEQUENCE LISTING 2 of the target gene after connection
Show or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；
(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；
(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-
IFNγ-IFNα。
The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids
By state cell.
The method of the purifying is：Through affinity chromatography, anion-exchange chromatography and molecular sieve after the crude product elder generation of fusion protein
Chromatographic purifying.
Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. is V205.
The acquisition methods of the genome 1 are：
A. design of primers
The primer sequence of OVA (Alb) is：
Upstream Alb-F1：CCGGAATTCATGAAGTGGGTAACATTA, with EcoRI restriction enzyme sites；
Downstream Alb-R1：
ACCACCACCAGAACCACCACCACCAGCACCAATTCCTAATG, with flexible linker；
The primer sequence of chicken interferon gamma (IFN-γ) is：
Upstream IFN-γ-F1：
GGTGGTTCTGGTGGTGGTGGTTCTATGACTTGCCAGACTT, with flexible linker；
Downstream IFN-γ-R1：
ACCACCACCAGAACCACCACCACCGCAATTGCATCTCCTC, with flexible linker；
Chicken interferon α (IFN-α) primer sequence is：
Upstream IFN-α-F1：
GGTGGTTCTGGTGGTGGTGGTTCTCCCACCATGGCTGT, with flexible linker；
Downstream IFN-α-R1：CCCTCGAGAGTGCGCGTGTTG, with XhoI restriction enzyme sites；
B. RNA is extracted from chicken liver, the target gene of chicken Alb, chicken IFN-γ and chicken IFN-α is obtained by reverse transcription,
The gene order of three respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and
Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；
Respectively using chicken Alb, chicken IFN-γ and chicken IFN-α target gene as template, and it is utilized respectively chicken Alb, chicken IFN-
The upstream and downstream primer of γ and chicken IFN-α enter performing PCR amplification, respectively obtain the chicken Alb for connecting flexible linker, chicken IFN-γ and
Chicken IFN-α gene.
PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each
0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix are 10 μ L, plus RNase Free water is to 25 μ L；The reaction of the RT-PCR reactions
Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged
1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.
C. rAlb-IFN γ genes are obtained using flexible linker connection chicken Alb and chicken IFN-γ target gene
The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's
The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN-
0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connection
PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/
Min, totally 35 circulations；Last 72 DEG C of extensions 10min.
D. using flexible linker connections rAlb-IFN γ genes and chicken IFN-α target gene obtain rAlb-IFN γ-
IFN-α gene
The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates
The μ L of DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-α template DNA 0.5 μ L, the μ of IFN-α anti-sense primer 0.5
L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95
DEG C pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Finally
72 DEG C of extension 10min.
Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2
For：
A. design of primers
The primer sequence of OVA (Alb) is：
Upstream Alb-F2：CGGGATCCATGAAATGGGTTACCC, with BamHI restriction enzyme sites；
Downstream Alb-R2：
ACCACCACCAGAACCACCACCACCAGCACCGATACCCA, with flexible linker；
The primer sequence of chicken interferon gamma (IFN-γ) is：
Upstream IFN-γ-F2：
GGTGGTTCTGGTGGTGGTGGTTCTATGACCTGCCAGAC, with flexible linker；
Downstream IFN-γ-R2：
ACCACCACCAGAACCACCACCACCGCAGTTGCAACGAC, with flexible linker；
Chicken interferon α (IFN-α)：
Upstream IFN-α-F2：
GGTGGTTCTGGTGGTGGTGGTTCTCCGACCATGGCTG, with flexible linker；
Downstream IFN-α-R2：
CCCTCGAGGGTACGGGTGTTACC, with XhoI restriction enzyme sites.
B. the target gene of the chicken Alb, chicken IFN-γ and chicken IFN-α, the gene order of three is respectively such as SEQUENCE
Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 7 ＞, SEQUENCE LISTING, 400 ＜, 8 ＞ and SEQUENCE LISTING 9；
Respectively using chicken Alb, chicken IFN-γ and chicken IFN-α target gene as template, and it is utilized respectively chicken Alb, chicken IFN-
The upstream and downstream primer of γ and chicken IFN-α enter performing PCR amplification, respectively obtain the chicken Alb for connecting flexible linker, chicken IFN-γ and
Chicken IFN-α gene.
PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.5, upstream and downstream primer is each
0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；The RT-PCR reactions
Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed
Ring 35 times, last 72 DEG C of extensions 10min.
C. rAlb-IFN γ genes are obtained using flexible linker connection chicken Alb and chicken IFN-γ target gene
The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's
The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN-
0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connection
PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/
Min, totally 35 circulations；Last 72 DEG C of extensions 10min.
D. using flexible linker connections rAlb-IFN γ genes and chicken IFN-α target gene obtain rAlb-IFN γ-
IFN-α gene
The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates
The μ L of DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-α template DNA 0.5 μ L, the μ of IFN-α anti-sense primer 0.5
L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95
DEG C pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Finally
72 DEG C of extension 10min.
Present invention also offers the application of the recombination chicken long-acting interferon, its long half time had up to more than 89 hours
Broad-spectrum disease resistance toxic action and the immune response that chicken itself can be improved.
Compared with prior art, the present invention has the advantages that：
1. chicken Alb, chicken IFN-γ and chicken IFN-α gene are realized into amalgamation and expression by flexible linker, interference is improved
Plain half-life period, compared with plain interferon, improve more than 22 times；
2. by being optimized to chicken Alb, chicken IFN-γ and chicken IFN-α gene, improve chicken Alb, chicken IFN-γ and chicken
The expression quantity of IFN-α fusion protein.
3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones
PGro7 plasmids, it is less to produce inclusion body in protein expression, forms great amount of soluble albumen, it is to avoid inclusion body denaturation and multiple
The process of property, substantially reduces the time of expressing fusion protein；
4. the fusion protein disclosed by the invention being made up of chicken Alb, chicken IFN-γ and chicken IFN-α not only has IFN-α
Broad-spectrum disease resistance toxic action, while significantly improving the immune response of chicken itself.
Brief description of the drawings
Fig. 1 is that OVA gene, chicken interferon α genes and chicken interferon gamma gene RT-PCR in embodiment 1 are expanded
Result；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Chicken interferon gamma gene RT-PCR amplified productions；Swimming lane 2：Chicken does
Disturb plain α genes RT-PCR amplified productions；Swimming lane 3：OVA gene RT-PCR amplified productions；
The result that Fig. 2 expands for the PCR after the target gene connection of the chicken Alb in embodiment 1, IFN-γ and IFN-α；
Swimming lane M：DNA Marker DL10000；Swimming lane 1：OVA gene, chicken interferon gamma gene are connected with chicken interferon α genes
Amplified production；
PCR amplifications and double digestion qualification result of the Fig. 3 for the positive colony plasmid in embodiment 1；Swimming lane M：DNA
Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；
Fig. 4 be embodiment 1 in recombinant protein SDS-PAGE electrophoretic examinations results；Swimming lane M：Albumen Marker；Swimming lane
1：Zero load control；Swimming lane 2：Precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction
Supernatant；
Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 is obtained；Swimming lane M：Albumen Marker；Swimming
Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；
Fig. 6 causes cell for the recombination chicken long-acting interferon as made from the fusion protein in embodiment 1 in embodiment 5 to VSV
The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left)
Human interferon standard items processing hole；B3-12 handles hole for the recombination chicken long-acting interferon α of gradient dilution (from right to left)；
Fig. 7 is the recombination chicken long-acting interferon intramuscular injection blood medicine as made from the fusion protein in embodiment 1 in embodiment 8
Concentration-time change curve.
Embodiment
Embodiment 1
A kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, its preparation method is as follows：
1. the acquisition of OVA (Alb), chicken interferon gamma (IFN-γ) and chicken interferon α (IFN-α) target gene with
Amplification
Design of primers：
Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upstream of OVA
EcoRI restriction enzyme sites and Linker sequences are introduced in primer and anti-sense primer respectively, chicken interferon gamma sense primer and under
Linker sequences are introduced respectively in trip primer, and Linker sequences are introduced respectively in chicken interferon α sense primer and anti-sense primer
Row and XhoI restriction enzyme sites.
The pcr amplification primer thing of table 1
RT-PCR obtains target gene：
RNA is extracted from chicken liver tissue, the purpose base of chicken Alb, chicken IFN-γ and chicken IFN-α is obtained by reverse transcription
Cause, the gene order of three respectively such as the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and
Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；
RT-PCR reaction systems (25 μ L) are shown in Table 2
The RT-PCR reaction systems of table 2
| RNase Free water | 10μL |
| dNTP Mix | 10μL |
| Reverse transcriptase | 2.5μL |
| Upstream and downstream primer | Each 0.5 μ L |
| Geneome RNA | 1.5μL |
Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back
Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.
There is specific band through agarose gel electrophoresis in 1870bp, 550bp and 610bp or so in RT-PCR amplified productions,
Its result as shown in figure 1, explanation prepared respectively the chicken Alb for being connected to flexible linker sequences, chicken IFN-γ and
The target gene of chicken IFN-α.
2. the connection of target gene
Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as
Shown in table 3, table 4：
The rAlb-IFN γ PCR reaction systems of table 3
The rAlb-IFN γ of table 4-IFN α PCR reaction systems
Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.
There is specific band through agarose gel electrophoresis in 2980bp or so in pcr amplification product, its result as shown in Fig. 2
RAlb-IFN γ and IFN-α amplified production band are occurred in that in Fig. 2, because being connected in rAlb-IFN γ and IFN-α gene
During, occur in that non-specific responding.The nucleotide sequence of the obtained target gene such as ＞ of 400 ＜ of SEQUENCE LISTING 2
It is shown.
3. expression vector establishment
Selection connection after target gene through be sequenced it is errorless after, PCR glue reclaims product is used with pET-32a plasmids
EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 5：
The double digestion system of table 5
| General buffer | 2μL |
| Restriction enzyme (a pair) | 1μL+1μL |
| Carrier reclaims fragment | 2ul |
| RNase Free water | 14μL |
The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 6,4
DEG C overnight connect：
The enzyme disjunctor system of table 6
| Purpose fragment DNA | 10μL |
| Expression vector | 3μL |
| buffer | 2μL |
| Ligase | 1μL |
| RNase Free water | 4μL |
Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia
The LB culture medium flat plate incubated overnights of penicillin；Single bacterium colony on picking LB flat boards carries out target gene PCR identifications, positive colony
Bacteria plasmid is identified through EcoRI and XhoI double digestions, is accredited as positive and is represented that engineering bacteria is successfully constructed, PCR amplifications and double digestion
Product detects single band through agarose gel electrophoresis at 2980bp or so places, and its result is as shown in figure 3, illustrate successfully to obtain
PET-32a/rAlb-IFN γ-IFN α engineering bacteria.
4. the expression of recombinant protein
Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums
Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure
Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, its result as shown in figure 4, it can be seen that recombinant bacterium is lured
Lead supernatant after the bacterial cell disruption after 5h and be deposited in the visible predominant expression band in 127.6KD or so places, illustrate in precipitation and supernatant
In equal successful expression fusion proteins.
Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations
Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min,
Supernatant, precipitation are taken respectively, obtain rough fusion protein.
5. fusion protein purification
5.1His affinity chromatography
After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100
On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS
With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM
Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IFN α protein peak.
5.2DEAE anion-exchange chromatography
(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement
Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, then
Crossed with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl amino first of Elution Buffer II
Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IFN α protein peak.
5.3 sieve chromatography
Loading is by using (the 50mM of Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into
Na2HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, washed with Binding Buffer III
It is de-, collect rAlb-IFN γ-IFN α protein peak.
5.4 sample identification
Determine rAlb-IFN γ-IFN α potency and specific activity, specific activity >=107IU/mg, albumen is qualified；It is aseptic subpackaged ,-
80 DEG C of preservations.It can obtain the fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, its amino acid sequence
As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
Embodiment 2
A kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, other be the same as Examples 1, simply
E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmids is thin
Born of the same parents.The SDS-PAGE electrophoresis results be the same as Example 1 of its fusion protein is compareed, 127.6KD or so places predominant expression bar in supernatant
Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount
It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with
Expressing protein is correctly folded, and reaches solubility expression of protein.
Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. V205.
Embodiment 3
A kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, its preparation method is as follows：
1. the acquisition of OVA (Alb), chicken interferon gamma (IFN-γ) and chicken interferon α (IFN-α) target gene with
Amplification
Chicken Alb in embodiment 1, chicken IFN-γ and chicken IFN-α are optimized, artificial synthesized chicken Alb, chicken IFN-γ and
Chicken IFN-α target gene, after optimization, the nucleotide sequence of three is respectively such as 400 ＜ of SEQUENCE LISTING 7 ＞, SEQUENCE
Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9.
1.1 codon optimization
Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those
By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes
The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production
(including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree
Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing
The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely
On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilize rare codon
Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to chicken Alb, chicken IFN-γ and
Chicken IFN-α gene codon is optimized.
Interpretation of result after 1.2 codon optimizations
It is considered as the gene during usual codon adaptation indexI (CAI)=1.0 optimal efficient in the expression system
Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~
70%, the scope is exceeded in any region can influence to translate and transcriptional efficiency.Chicken Alb, chicken are found using software detection
The codon of IFN-γ and chicken IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.27,
0.25th, 0.31, GC percentages are 43.1%, 42.9%, 61.7%；And by chicken Alb, chicken IFN-γ and chicken IFN-α gene
Obtained after optimization recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.99,1.0,1.0, GC percentages
49.2%th, 47.6%, 58.5%.Significantly reduce the utilization rate of low codon by gene optimization, it is to avoid rare codon
Influence to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.
1.3 design of primers：
Table 7PCR amplimers
The genomic DNA of chicken Alb after optimization, chicken IFN-γ and chicken IFN-α is diluted to 0.05mg/mL respectively.Utilize
PCR amplifications obtain target gene, and 25 μ L reaction systems are as shown in table 8：
Table 8PCR reaction systems
| RNase Free water | 10.5μL |
| dNTP Mix | 10.0μL |
| Taq archaeal dna polymerases | 2.5μL |
| Upstream and downstream primer | Each 0.5 μ L |
| Genomic DNA | 1.0μL |
Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.
Chicken Alb, chicken IFN-γ and chicken IFN-α pcr amplification product through agarose gel electrophoresis respectively 1870bp,
There is specific band in 550bp and 460bp or so, illustrate to have prepared the chicken for being connected to flexible linker after optimization
Alb, chicken IFN-γ and chicken IFN-α target gene.
2. the connection of target gene
Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as
Shown in table 9, table 10：
The rAlb-IFN γ PCR reaction systems of table 9
The rAlb-IFN γ of table 10-IFN α PCR reaction systems
Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions
1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.
There is specific band through agarose gel electrophoresis in 2980bp or so in pcr amplification product, illustrates successfully to be connected
RAlb-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400
Shown in the ＞ of ＜ 3.
3. expression vector establishment
The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids
BamHI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 11：
The double digestion system of table 11
| General buffer | 2μL |
| Restriction enzyme (a pair) | 1μL+1μL |
| Carrier reclaims fragment | 2ul |
| RNase Free water | 14μL |
The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 12,4
DEG C overnight connect：
Table 12
| Purpose fragment DNA | 10μL |
| Expression vector | 3μL |
| buffer | 2μL |
| Ligase | 1μL |
| RNase Free water | 4μL |
Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia
Incubated overnight in the LB flat boards of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid warp through PCR
BamHI, XhoI double digestion are identified, are accredited as positive and are represented expression vector establishment success, PCR amplifications and double digestion product are through fine jade
There is single band at 2980bp or so places in sepharose electrophoresis, illustrates containing rAlb-IFN γ-IFN α fusion gene engineering bacterium
PET-32a/rAlb-IFN γ-IFN α is successfully constructed.
4. the expression of recombinant protein
Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums
Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure
Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h
The visible predominant expression band in 127.6KD or so places, illustrates to have obtained recombinant protein in supernatant is precipitated.
Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations
Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min,
Supernatant, precipitation are taken respectively, obtain rough fusion protein.
5. fusion protein purification
5.1His affinity chromatography
After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100
On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS
With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM
Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IFN α protein peak.
5.2DEAE anion-exchange chromatography
(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement
Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, then
Crossed with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl amino first of Elution Buffer II
Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IFN α protein peak.
5.3 sieve chromatography
Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into
(50mMNa2HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, use Binding Buffer
III elution, collects rAlb-IFN γ-IFN α protein peak.
5.4 sample identification
Determine rAlb-IFN γ-IFN α potency and specific activity, specific activity >=107IU/mg, albumen is qualified；Sterile point
Dress, -80 DEG C of preservations.It can obtain the fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, its amino acid
Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
Embodiment 4
A kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, other be the same as Examples 3, simply
E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmids is thin
Born of the same parents.The SDS-PAGE electrophoresis results be the same as Example 3 of its fusion protein is compareed, 127.6KD or so places predominant expression bar in supernatant
Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount
It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, cooperate with
Expressing protein is correctly folded, and reaches solubility expression of protein.
Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise
Biology, article No. V205.
Embodiment 5
A kind of recombination chicken long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture
Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS,
Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.
Embodiment 6
Embodiment 1~4 is obtained by the identification of OVA, chicken interferon gamma and chicken interferon the α fusion protein constituted
The quantitative detection of 6.1 protein contents
Lowry methods are used, the standard protein for examining and determine institute with Chinese food pharmaceutical biological product makees standard test, determine embodiment
1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.
6.2SDS-PAGE electrophoresis detection
Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 127.6KD or so, as shown in Figure 4.
6.3Western Blot results
Fusion protein in embodiment 1~4 is detected respectively, with the anti-chicken alpha interferon (1 of abcam companies mouse:5000 dilutions) it is one
It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombination chicken long-acting interferon α samples can be with anti-chicken interferon
Specific reaction occurs for alpha monoclonal antibodies, and specific band occurs in 127.6KD or so place, as shown in Figure 5.
Embodiment 7
Bioactivity freeze-dried four parts of recombination chicken long-acting interferon α in embodiment 5
Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium5Cell/ml cells suspend
Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO224h is cultivated, the recombination chicken for adding various dose is long
Imitate to inhale after interferon-' alpha ', 24h and abandon, then inoculation 100TCID50VSV viruses respectively.
Result of the test
As a result show that the recombination chicken long-acting interferon α obtained causes the lesion of HEp-2 cells to have obvious suppression to VSV
Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the recombination chicken obtained is long
Imitate after the cell virus inoculation after interferon-' alpha ' processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not go out incumbent
What lesion, measures potency >=107IU/ml, as shown in Figure 6.
Embodiment 8
The four parts of recombination chicken long-acting interferon α obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed
The measure of half-life period of the agent (being designated as A, B, C, D respectively) in chicken body
Cytopathic-effect inhibition assay determines the blood concentration and time relationship of rAlb-IFN γ-IFN α
The broiler chicken (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml recombination chicken long-acting interferons are subcutaneously injected in neck
The freeze-dried 2ml of α, respectively in 1h, 2h, 4h, 8h, 16h, 32h, 48h, 72h, 96h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm
Low-temperature centrifugation 10min separates serum, and each every chicken blood sample of time point is to be measured in -20 DEG C of preservations.Determined using cytopathic-effect inhibition assay
The concentration of rAlb-IFN γ-IFN α in blood serum sample, is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter meter
Calculation the results are shown in Table 13.
Dominant dynamic parameters in serum after the recombination chicken long-acting interferon α intramuscular injection of table 13
As a result show that recombination chicken long-acting interferon α has longer half-life period.Half-life period can reach 89h or so after measured, compared with
Plain interferon improves about 22 times.
Embodiment 9
The freeze-dried measure influenceed on chicken cell immune response of four parts of recombination chicken long-acting interferon α in embodiment 5
Take six roughly the same broiler chicken of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted
The 2mg/ml recombination chicken long-acting interferon freeze-dried 2ml of α are penetrated, 2mL PBS is subcutaneously injected in control group neck, taken after injecting 4 weeks outside chicken
All blood, takes weekly a blood afterwards, and lymphocyte is separated using lymphocyte separation medium, and lymphocyte passes through serum-free RPMI
1640 culture mediums are washed after 2 times, and it is 2 × 10 to be resuspended with complete medium, adjust cell concentration6Individual/ml, 24 porocyte culture plates are every
Hole adds 1ml lymphocytes, 37 DEG C, 5%CO272h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant
Middle IL-2, IL-4 content, is carried out, testing result is as shown in table 14 by kit specification：
The ELISA of table 14 detects each group chicken cell immune response level
As a result show after injection recombination chicken long-acting interferon α, can significantly improve chicken Evaluation of Cytokines in Peripheral Blood IL-2,
IL-4 content, enhances cellullar immunologic response level, significantly improves immunity level.
It is above-mentioned with reference to embodiment to it is a kind of by OVA, chicken interferon gamma and chicken interferon the α fusion protein constituted and
The detailed description that its preparation method is carried out, is illustrative rather than limited, can be included according to limited scope some
Individual embodiment, therefore changing and modifications in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.
SEQUENCE LISTING
<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute
<120>It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof
<130> 1
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 994
<212> PRT
<213>OVA-interferon gamma-interferon alpha fusion protein
<400> 1
Met Lys Trp Val Thr Leu Ile Ser Phe Ile Phe Leu Phe Ser Ser Ala
1 5 10 15
Thr Ser Arg Asn Leu Gln Arg Phe Ala Arg Asp Ala Glu His Lys Ser
20 25 30
Glu Ile Ala His Arg Tyr Asn Asp Leu Lys Glu Glu Thr Phe Lys Ala
35 40 45
Val Ala Met Ile Thr Phe Ala Gln Tyr Leu Gln Arg Cys Ser Tyr Glu
50 55 60
Gly Leu Ser Lys Leu Val Lys Asp Val Val Asp Leu Ala Gln Lys Cys
65 70 75 80
Val Ala Asn Glu Asp Ala Pro Glu Cys Ser Lys Pro Leu Pro Ser Ile
85 90 95
Ile Leu Asp Glu Ile Cys Gln Val Glu Lys Leu Arg Asp Ser Tyr Gly
100 105 110
Ala Met Ala Asp Cys Cys Ser Lys Ala Asp Pro Glu Arg Asn Glu Cys
115 120 125
Phe Leu Ser Phe Lys Val Ser Gln Pro Asp Phe Val Gln Pro Tyr Gln
130 135 140
Arg Pro Ala Ser Asp Val Ile Cys Gln Glu Tyr Gln Asp Asn Arg Val
145 150 155 160
Ser Phe Leu Gly His Phe Ile Tyr Ser Val Ala Arg Arg His Pro Phe
165 170 175
Leu Tyr Ala Pro Ala Ile Leu Ser Phe Ala Val Asp Phe Glu His Ala
180 185 190
Leu Gln Ser Cys Cys Lys Glu Ser Asp Val Gly Ala Cys Leu Asp Thr
195 200 205
Lys Glu Ile Val Met Arg Glu Lys Ala Lys Gly Val Ser Val Lys Gln
210 215 220
Gln Tyr Phe Cys Gly Ile Leu Lys Gln Phe Gly Asp Arg Val Phe Gln
225 230 235 240
Ala Arg Gln Leu Ile Tyr Leu Ser Gln Lys Tyr Pro Lys Ala Pro Phe
245 250 255
Ser Glu Val Ser Lys Phe Val His Asp Ser Ile Gly Val His Lys Glu
260 265 270
Cys Cys Glu Gly Asp Met Val Glu Cys Met Asp Asp Met Ala Arg Met
275 280 285
Met Ser Asn Leu Cys Ser Gln Gln Asp Val Phe Ser Gly Lys Ile Lys
290 295 300
Asp Cys Cys Glu Lys Pro Ile Val Glu Arg Ser Gln Cys Ile Met Glu
305 310 315 320
Ala Glu Phe Asp Glu Lys Pro Ala Asp Leu Pro Ser Leu Val Glu Lys
325 330 335
Tyr Ile Glu Asp Lys Glu Val Cys Lys Ser Phe Glu Ala Gly His Asp
340 345 350
Ala Phe Met Ala Glu Phe Val Tyr Glu Tyr Ser Arg Arg His Pro Glu
355 360 365
Phe Ser Ile Gln Leu Ile Met Arg Ile Ala Lys Gly Tyr Glu Ser Leu
370 375 380
Leu Glu Lys Cys Cys Lys Thr Asp Asn Pro Ala Glu Cys Tyr Ala Asn
385 390 395 400
Ala Gln Glu Gln Leu Asn Gln His Ile Lys Glu Thr Gln Asp Val Val
405 410 415
Lys Thr Asn Cys Asp Leu Leu His Asp His Gly Glu Ala Asp Phe Leu
420 425 430
Lys Ser Ile Leu Ile Arg Tyr Thr Lys Lys Met Pro Gln Val Pro Thr
435 440 445
Asp Leu Leu Leu Glu Thr Gly Lys Lys Met Thr Thr Ile Gly Thr Lys
450 455 460
Cys Cys Gln Leu Pro Glu Asp Arg Arg Met Ala Cys Ser Glu Gly Tyr
465 470 475 480
Leu Ser Ile Val Ile His Asp Thr Cys Arg Lys Gln Glu Thr Thr Pro
485 490 495
Ile Asn Asp Asn Val Ser Gln Cys Cys Ser Ser Ser Tyr Ala Asn Arg
500 505 510
Arg Pro Cys Phe Thr Ala Met Gly Val Asp Thr Lys Tyr Val Pro Pro
515 520 525
Pro Phe Asn Pro Asp Met Phe Ser Phe Asp Glu Lys Leu Cys Ser Ala
530 535 540
Pro Ala Glu Glu Arg Glu Val Gly Gln Met Lys Leu Leu Ile Asn Leu
545 550 555 560
Ile Lys Arg Lys Pro Gln Met Thr Glu Glu Gln Ile Lys Thr Ile Ala
565 570 575
Asp Gly Phe Thr Ala Met Val Asp Lys Cys Cys Lys Gln Ser Asp Ile
580 585 590
Asn Thr Cys Phe Gly Glu Glu Gly Ala Asn Leu Ile Val Gln Ser Arg
595 600 605
Ala Thr Leu Gly Ile Gly Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly
610 615 620
Ser Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Leu Ser Val Ile Met
625 630 635 640
Ile Tyr Tyr Gly His Thr Ala Ser Ser Leu Ile Leu Val Gln Leu Gln
645 650 655
Asp Asp Ile Ala Lys Leu Lys Ala Asp Phe Asn Ser Ser His Ser Asp
660 665 670
Val Ala Asp Gly Gly Pro Ile Ile Ala Glu Lys Leu Lys Asn Trp Thr
675 680 685
Glu Arg Asn Gln Lys Arg Ile Ile Leu Ser Gln Ile Val Ser Met Tyr
690 695 700
Leu Glu Met Leu Ala Asn Thr Asp Lys Thr Lys Pro His Thr Lys His
705 710 715 720
Ile Ser Glu Glu Leu Tyr Thr Leu Lys Asn Asn Leu Pro Asp Gly Val
725 730 735
Lys Lys Val Lys Asp Ile Met Asp Leu Ala Lys Leu Pro Met Asn Asp
740 745 750
Leu Arg Val Gln Leu Lys Ala Ala Asn Glu Leu Phe Ser Ile Leu Gln
755 760 765
Lys Leu Val Asn Pro Pro Ser Phe Lys Arg Asn Met Ser Gln Ser Gln
770 775 780
Arg Arg Cys Asn Cys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro
785 790 795 800
Thr Met Ala Val Pro Ala Ser Pro Gln His Pro Arg Gly Tyr Gly Ile
805 810 815
Leu Leu Leu Thr Leu Leu Leu Lys Ala Leu Ala Thr Thr Ala Ser Ala
820 825 830
Cys Asn His Leu Arg Pro Gln Asp Ala Thr Phe Ser His Asp Ser Leu
835 840 845
Gln Leu Leu Arg Asp Met Ala Pro Thr Leu Pro Gln Leu Cys Pro Gln
850 855 860
His Asn Ala Ser Cys Ser Phe Asn Asp Thr Ile Leu Asp Thr Ser Asn
865 870 875 880
Thr Arg Gln Ala Asp Lys Thr Thr His Asp Ile Leu Gln His Leu Phe
885 890 895
Lys Ile Leu Ser Ser Pro Ser Thr Pro Ala His Trp Asn Asp Ser Gln
900 905 910
Arg Gln Ser Leu Leu Asn Arg Ile His Arg Tyr Thr Gln His Leu Glu
915 920 925
Gln Cys Leu Asp Ser Ser Asp Thr Arg Ser Arg Thr Arg Trp Pro Arg
930 935 940
Asn Leu His Leu Thr Ile Lys Lys His Phe Ser Cys Leu His Thr Phe
945 950 955 960
Leu Gln Asp Asn Asp Tyr Ser Ala Cys Ala Trp Glu His Val Arg Leu
965 970 975
Gln Ala Arg Ala Trp Phe Leu His Ile His Asn Leu Thr Gly Asn Thr
980 985 990
Arg Thr
<210> 2
<211> 2982
<212> DNA
<213>Genome 1
<400> 2
atgaagtggg taacattaat ttcattcatt ttcctcttca gttcagcaac atccaggaat 60
ctgcaaagat ttgctcgtga tgcagagcac aagagtgaaa ttgcccatcg ctacaatgat 120
ttgaaagaag aaacatttaa ggcagttgcc atgatcacat ttgcccagta tctccagagg 180
tgctcttatg aaggactgtc taagcttgtg aaggatgttg ttgatctggc acaaaaatgt 240
gtagccaatg aagatgctcc tgaatgctca aaaccactgc cttccattat cctggatgaa 300
atctgccaag tggaaaagct ccgtgactct tatggtgcaa tggccgactg ctgtagcaaa 360
gctgatcctg aaagaaatga gtgtttcctg tcatttaaag tttcccaacc agacttcgtt 420
cagccatacc aaagaccagc ttctgatgtg atatgccagg aataccagga caacagagtg 480
tcatttctgg gacatttcat ctattctgtt gcaagaagac accccttctt gtatgcccct 540
gcaatcctta gttttgctgt tgattttgaa catgcacttc aaagctgttg caaagagagt 600
gatgtcggtg cttgcctgga caccaaggaa attgttatga gagaaaaagc caagggagta 660
agtgtgaagc agcagtattt ttgtggaatc ttgaagcagt tcggagatag agttttccaa 720
gcacgacaac ttatttacct aagccaaaaa taccccaagg ctccattctc agaggtttct 780
aaatttgtac atgattctat cggcgtccac aaagagtgct gtgaagggga catggtggag 840
tgcatggatg acatggcacg tatgatgagc aatctgtgct ctcaacaaga tgttttctca 900
ggtaaaatca aagactgctg tgagaagcct attgtggaac gaagccagtg cattatggag 960
gcagaatttg atgagaaacc tgcagatctt ccttcattag ttgaaaagta catagaagat 1020
aaggaagtgt gtaaaagttt tgaagcaggc cacgatgcat tcatggcaga gttcgtttat 1080
gaatactcac gaagacaccc tgagttctcc atacagctta ttatgagaat tgccaaagga 1140
tatgaatcac ttctggaaaa gtgctgcaaa actgataacc ctgctgagtg ctacgcaaat 1200
gctcaagagc aactgaacca acatatcaaa gaaactcagg atgttgtgaa gacaaactgt 1260
gatcttctcc atgaccatgg cgaggcagac ttcctcaagt ccatcctgat ccgctacact 1320
aagaaaatgc ctcaagtacc aactgatctc ctgcttgaaa ctggaaagaa aatgacaact 1380
attggtacta agtgctgcca gcttcctgaa gacagacgca tggcttgttc tgagggttat 1440
ctgagcattg tgattcatga tacgtgcagg aaacaggaga ccacacctat aaatgacaac 1500
gtttcacaat gctgcagcag ctcctatgct aacagaagac catgtttcac tgctatggga 1560
gtagatacca aatatgttcc tccaccattt aatcctgata tgttcagctt tgatgaaaaa 1620
ttgtgcagtg ctcctgctga agaacgagaa gtaggccaga tgaaattgct aatcaacctc 1680
attaaacgca agccccagat gacagaagaa caaataaaga caattgctga tggtttcact 1740
gccatggttg acaagtgctg caagcagtcg gacatcaata catgctttgg agaagagggt 1800
gccaacctaa tagtccaaag cagagccaca ttaggaattg gtgctggtgg tggtggttct 1860
ggtggtggtg gttctatgac ttgccagact tacaacttgt ttgttctgtc cgtcatcatg 1920
atttattatg gacatactgc aagtagtcta attcttgttc aacttcaaga tgatatagcc 1980
aaactgaaag ctgactttaa ctcaagtcat tcagatgtag ctgacggtgg acctattatt 2040
gcagagaaac tgaagaactg gacagagaga aatcagaaaa ggatcatact gagccagatt 2100
gtttcgatgt acttggaaat gcttgcaaac actgacaaga caaagccgca caccaaacac 2160
atatctgagg agctctatac tctgaaaaac aaccttcctg atggcgtgaa gaaggtgaaa 2220
gatatcatgg acctggccaa gctcccgatg aacgacttga gagtccagct caaagccgcg 2280
aatgaactct tcagcatctt acagaagctg gtgaatcctc cgagtttcaa aaggaacatg 2340
agccagtctc agaggagatg caattgcggt ggtggtggtt ctggtggtgg tggttctccc 2400
accatggctg tgcctgcaag cccacagcac ccacgggggt acggcatcct gctgctcacg 2460
ctccttctga aagctctcgc caccaccgcc tccgcctgca accaccttcg cccccaggat 2520
gccaccttct ctcacgacag cctccagctc ctccgggaca tggctcccac actaccccag 2580
ctgtgcccac agcacaacgc gtcttgctcc ttcaacgaca ccatcctgga caccagcaac 2640
acccggcaag ccgacaaaac cacccacgac atccttcagc acctcttcaa aatcctcagc 2700
agccccagca ctccagccca ctggaacgac agccaacgcc aaagcctcct caaccggatc 2760
caccgctaca cccagcacct cgagcaatgc ttggacagca gcgacacgcg ctcccggacg 2820
cgatggcctc gcaaccttca cctcaccatc aaaaaacact tcagctgcct ccacaccttc 2880
ctccaagaca acgattacag cgcctgcgcc tgggaacacg tccgcctgca agctcgtgcc 2940
tggttcctgc acatccacaa cctcacaggc aacacgcgca ct 2982
<210> 3
<211> 2982
<212> DNA
<213>Genome 2
<400> 3
atgaagtggg taacattaat ttcattcatt ttcctcttca gttcagcaac atccaggaat 60
ctgcaaagat ttgctcgtga tgcagagcac aagagtgaaa ttgcccatcg ctacaatgat 120
ttgaaagaag aaacatttaa ggcagttgcc atgatcacat ttgcccagta tctccagagg 180
tgctcttatg aaggactgtc taagcttgtg aaggatgttg ttgatctggc acaaaaatgt 240
gtagccaatg aagatgctcc tgaatgctca aaaccactgc cttccattat cctggatgaa 300
atctgccaag tggaaaagct ccgtgactct tatggtgcaa tggccgactg ctgtagcaaa 360
gctgatcctg aaagaaatga gtgtttcctg tcatttaaag tttcccaacc agacttcgtt 420
cagccatacc aaagaccagc ttctgatgtg atatgccagg aataccagga caacagagtg 480
tcatttctgg gacatttcat ctattctgtt gcaagaagac accccttctt gtatgcccct 540
gcaatcctta gttttgctgt tgattttgaa catgcacttc aaagctgttg caaagagagt 600
gatgtcggtg cttgcctgga caccaaggaa attgttatga gagaaaaagc caagggagta 660
agtgtgaagc agcagtattt ttgtggaatc ttgaagcagt tcggagatag agttttccaa 720
gcacgacaac ttatttacct aagccaaaaa taccccaagg ctccattctc agaggtttct 780
aaatttgtac atgattctat cggcgtccac aaagagtgct gtgaagggga catggtggag 840
tgcatggatg acatggcacg tatgatgagc aatctgtgct ctcaacaaga tgttttctca 900
ggtaaaatca aagactgctg tgagaagcct attgtggaac gaagccagtg cattatggag 960
gcagaatttg atgagaaacc tgcagatctt ccttcattag ttgaaaagta catagaagat 1020
aaggaagtgt gtaaaagttt tgaagcaggc cacgatgcat tcatggcaga gttcgtttat 1080
gaatactcac gaagacaccc tgagttctcc atacagctta ttatgagaat tgccaaagga 1140
tatgaatcac ttctggaaaa gtgctgcaaa actgataacc ctgctgagtg ctacgcaaat 1200
gctcaagagc aactgaacca acatatcaaa gaaactcagg atgttgtgaa gacaaactgt 1260
gatcttctcc atgaccatgg cgaggcagac ttcctcaagt ccatcctgat ccgctacact 1320
aagaaaatgc ctcaagtacc aactgatctc ctgcttgaaa ctggaaagaa aatgacaact 1380
attggtacta agtgctgcca gcttcctgaa gacagacgca tggcttgttc tgagggttat 1440
ctgagcattg tgattcatga tacgtgcagg aaacaggaga ccacacctat aaatgacaac 1500
gtttcacaat gctgcagcag ctcctatgct aacagaagac catgtttcac tgctatggga 1560
gtagatacca aatatgttcc tccaccattt aatcctgata tgttcagctt tgatgaaaaa 1620
ttgtgcagtg ctcctgctga agaacgagaa gtaggccaga tgaaattgct aatcaacctc 1680
attaaacgca agccccagat gacagaagaa caaataaaga caattgctga tggtttcact 1740
gccatggttg acaagtgctg caagcagtcg gacatcaata catgctttgg agaagagggt 1800
gccaacctaa tagtccaaag cagagccaca ttaggaattg gtgctggtgg tggtggttct 1860
ggtggtggtg gttctatgac ttgccagact tacaacttgt ttgttctgtc cgtcatcatg 1920
atttattatg gacatactgc aagtagtcta attcttgttc aacttcaaga tgatatagcc 1980
aaactgaaag ctgactttaa ctcaagtcat tcagatgtag ctgacggtgg acctattatt 2040
gcagagaaac tgaagaactg gacagagaga aatcagaaaa ggatcatact gagccagatt 2100
gtttcgatgt acttggaaat gcttgcaaac actgacaaga caaagccgca caccaaacac 2160
atatctgagg agctctatac tctgaaaaac aaccttcctg atggcgtgaa gaaggtgaaa 2220
gatatcatgg acctggccaa gctcccgatg aacgacttga gagtccagct caaagccgcg 2280
aatgaactct tcagcatctt acagaagctg gtgaatcctc cgagtttcaa aaggaacatg 2340
agccagtctc agaggagatg caattgcggt ggtggtggtt ctggtggtgg tggttctccc 2400
accatggctg tgcctgcaag cccacagcac ccacgggggt acggcatcct gctgctcacg 2460
ctccttctga aagctctcgc caccaccgcc tccgcctgca accaccttcg cccccaggat 2520
gccaccttct ctcacgacag cctccagctc ctccgggaca tggctcccac actaccccag 2580
ctgtgcccac agcacaacgc gtcttgctcc ttcaacgaca ccatcctgga caccagcaac 2640
acccggcaag ccgacaaaac cacccacgac atccttcagc acctcttcaa aatcctcagc 2700
agccccagca ctccagccca ctggaacgac agccaacgcc aaagcctcct caaccggatc 2760
caccgctaca cccagcacct cgagcaatgc ttggacagca gcgacacgcg ctcccggacg 2820
cgatggcctc gcaaccttca cctcaccatc aaaaaacact tcagctgcct ccacaccttc 2880
ctccaagaca acgattacag cgcctgcgcc tgggaacacg tccgcctgca agctcgtgcc 2940
tggttcctgc acatccacaa cctcacaggc aacacgcgca ct 2982
<210> 4
<211> 1845
<212> DNA
<213>OVA
<400> 4
atgaagtggg taacattaat ttcattcatt ttcctcttca gttcagcaac atccaggaat 60
ctgcaaagat ttgctcgtga tgcagagcac aagagtgaaa ttgcccatcg ctacaatgat 120
ttgaaagaag aaacatttaa ggcagttgcc atgatcacat ttgcccagta tctccagagg 180
tgctcttatg aaggactgtc taagcttgtg aaggatgttg ttgatctggc acaaaaatgt 240
gtagccaatg aagatgctcc tgaatgctca aaaccactgc cttccattat cctggatgaa 300
atctgccaag tggaaaagct ccgtgactct tatggtgcaa tggccgactg ctgtagcaaa 360
gctgatcctg aaagaaatga gtgtttcctg tcatttaaag tttcccaacc agacttcgtt 420
cagccatacc aaagaccagc ttctgatgtg atatgccagg aataccagga caacagagtg 480
tcatttctgg gacatttcat ctattctgtt gcaagaagac accccttctt gtatgcccct 540
gcaatcctta gttttgctgt tgattttgaa catgcacttc aaagctgttg caaagagagt 600
gatgtcggtg cttgcctgga caccaaggaa attgttatga gagaaaaagc caagggagta 660
agtgtgaagc agcagtattt ttgtggaatc ttgaagcagt tcggagatag agttttccaa 720
gcacgacaac ttatttacct aagccaaaaa taccccaagg ctccattctc agaggtttct 780
aaatttgtac atgattctat cggcgtccac aaagagtgct gtgaagggga catggtggag 840
tgcatggatg acatggcacg tatgatgagc aatctgtgct ctcaacaaga tgttttctca 900
ggtaaaatca aagactgctg tgagaagcct attgtggaac gaagccagtg cattatggag 960
gcagaatttg atgagaaacc tgcagatctt ccttcattag ttgaaaagta catagaagat 1020
aaggaagtgt gtaaaagttt tgaagcaggc cacgatgcat tcatggcaga gttcgtttat 1080
gaatactcac gaagacaccc tgagttctcc atacagctta ttatgagaat tgccaaagga 1140
tatgaatcac ttctggaaaa gtgctgcaaa actgataacc ctgctgagtg ctacgcaaat 1200
gctcaagagc aactgaacca acatatcaaa gaaactcagg atgttgtgaa gacaaactgt 1260
gatcttctcc atgaccatgg cgaggcagac ttcctcaagt ccatcctgat ccgctacact 1320
aagaaaatgc ctcaagtacc aactgatctc ctgcttgaaa ctggaaagaa aatgacaact 1380
attggtacta agtgctgcca gcttcctgaa gacagacgca tggcttgttc tgagggttat 1440
ctgagcattg tgattcatga tacgtgcagg aaacaggaga ccacacctat aaatgacaac 1500
gtttcacaat gctgcagcag ctcctatgct aacagaagac catgtttcac tgctatggga 1560
gtagatacca aatatgttcc tccaccattt aatcctgata tgttcagctt tgatgaaaaa 1620
ttgtgcagtg ctcctgctga agaacgagaa gtaggccaga tgaaattgct aatcaacctc 1680
attaaacgca agccccagat gacagaagaa caaataaaga caattgctga tggtttcact 1740
gccatggttg acaagtgctg caagcagtcg gacatcaata catgctttgg agaagagggt 1800
gccaacctaa tagtccaaag cagagccaca ttaggaattg gtgct 1845
<210> 5
<211> 492
<212> DNA
<213>Chicken IFN-γ
<400> 5
atgacttgcc agacttacaa cttgtttgtt ctgtccgtca tcatgattta ttatggacat 60
actgcaagta gtctaattct tgttcaactt caagatgata tagccaaact gaaagctgac 120
tttaactcaa gtcattcaga tgtagctgac ggtggaccta ttattgcaga gaaactgaag 180
aactggacag agagaaatca gaaaaggatc atactgagcc agattgtttc gatgtacttg 240
gaaatgcttg caaacactga caagacaaag ccgcacacca aacacatatc tgaggagctc 300
tatactctga aaaacaacct tcctgatggc gtgaagaagg tgaaagatat catggacctg 360
gccaagctcc cgatgaacga cttgagagtc cagctcaaag ccgcgaatga actcttcagc 420
atcttacaga agctggtgaa tcctccgagt ttcaaaagga acatgagcca gtctcagagg 480
agatgcaatt gc 492
<210> 6
<211> 585
<212> DNA
<213>Chicken IFN-α
<400> 6
cccaccatgg ctgtgcctgc aagcccacag cacccacggg ggtacggcat cctgctgctc 60
acgctccttc tgaaagctct cgccaccacc gcctccgcct gcaaccacct tcgcccccag 120
gatgccacct tctctcacga cagcctccag ctcctccggg acatggctcc cacactaccc 180
cagctgtgcc cacagcacaa cgcgtcttgc tccttcaacg acaccatcct ggacaccagc 240
aacacccggc aagccgacaa aaccacccac gacatccttc agcacctctt caaaatcctc 300
agcagcccca gcactccagc ccactggaac gacagccaac gccaaagcct cctcaaccgg 360
atccaccgct acacccagca cctcgagcaa tgcttggaca gcagcgacac gcgctcccgg 420
acgcgatggc ctcgcaacct tcacctcacc atcaaaaaac acttcagctg cctccacacc 480
ttcctccaag acaacgatta cagcgcctgc gcctgggaac acgtccgcct gcaagctcgt 540
gcctggttcc tgcacatcca caacctcaca ggcaacacgc gcact 585
<210> 7
<211> 1845
<212> DNA
<213>OVA
<400> 7
atgaaatggg ttaccctgat ctctttcatc ttcctgttct cttctgctac ctctcgtaac 60
ctgcagcgtt tcgctcgtga cgctgaacac aaatctgaaa tcgctcaccg ttacaacgac 120
ctgaaagaag aaaccttcaa agctgttgct atgatcacct tcgctcagta cctgcagcgt 180
tgctcttacg aaggtctgtc taaactggtt aaagacgttg ttgacctggc tcagaaatgc 240
gttgctaacg aagacgctcc ggaatgctct aaaccgctgc cgtctatcat cctggacgaa 300
atctgccagg ttgaaaaact gcgtgactct tacggtgcta tggctgactg ctgctctaaa 360
gctgacccgg aacgtaacga atgcttcctg tctttcaaag tttctcagcc ggacttcgtt 420
cagccgtacc agcgtccggc ttctgacgtt atctgccagg aataccagga caaccgtgtt 480
tctttcctgg gtcacttcat ctactctgtt gctcgtcgtc acccgttcct gtacgctccg 540
gctatcctgt ctttcgctgt tgacttcgaa cacgctctgc agtcttgctg caaagaatct 600
gacgttggtg cttgcctgga caccaaagaa atcgttatgc gtgaaaaagc taaaggtgtt 660
tctgttaaac agcagtactt ctgcggtatc ctgaaacagt tcggtgaccg tgttttccag 720
gctcgtcagc tgatctacct gtctcagaaa tacccgaaag ctccgttctc tgaagtttct 780
aaattcgttc acgactctat cggtgttcac aaagaatgct gcgaaggtga catggttgaa 840
tgcatggacg acatggctcg tatgatgtct aacctgtgct ctcagcagga cgttttctct 900
ggtaaaatca aagactgctg cgaaaaaccg atcgttgaac gttctcagtg catcatggaa 960
gctgaattcg acgaaaaacc ggctgacctg ccgtctctgg ttgaaaaata catcgaagac 1020
aaagaagttt gcaaatcttt cgaagctggt cacgacgctt tcatggctga attcgtttac 1080
gaatactctc gtcgtcaccc ggaattctct atccagctga tcatgcgtat cgctaaaggt 1140
tacgaatctc tgctggaaaa atgctgcaaa accgacaacc cggctgaatg ctacgctaac 1200
gctcaggaac agctgaacca gcacatcaaa gaaacccagg acgttgttaa aaccaactgc 1260
gacctgctgc acgaccacgg tgaagctgac ttcctgaaat ctatcctgat ccgttacacc 1320
aaaaaaatgc cgcaggttcc gaccgacctg ctgctggaaa ccggtaaaaa aatgaccacc 1380
atcggtacca aatgctgcca gctgccggaa gaccgtcgta tggcttgctc tgaaggttac 1440
ctgtctatcg ttatccacga cacctgccgt aaacaggaaa ccaccccgat caacgacaac 1500
gtttctcagt gctgctcttc ttcttacgct aaccgtcgtc cgtgcttcac cgctatgggt 1560
gttgacacca aatacgttcc gccgccgttc aacccggaca tgttctcttt cgacgaaaaa 1620
ctgtgctctg ctccggctga agaacgtgaa gttggtcaga tgaaactgct gatcaacctg 1680
atcaaacgta aaccgcagat gaccgaagaa cagatcaaaa ccatagcgga cggcttcacc 1740
gctatggttg acaaatgctg caaacagtct gacatcaaca cctgcttcgg tgaagaaggt 1800
gctaacctga tcgttcagtc tcgtgctacc ctgggtatcg gtgct 1845
<210> 8
<211> 492
<212> DNA
<213>Chicken IFN-γ
<400> 8
atgacctgcc agacctacaa cctgttcgtt ctgtctgtta tcatgatcta ctacggtcac 60
accgcttctt ctctgatcct ggttcagctg caggacgaca tcgctaaact gaaagctgac 120
ttcaactctt ctcactctga cgttgctgac ggtggtccga tcatcgctga aaaactgaaa 180
aactggaccg aacgtaacca gaaacgtatc atcctgtctc agatcgtttc tatgtacctg 240
gaaatgctgg ctaacaccga caaaaccaaa ccgcacacca aacacatctc tgaagaactg 300
tacaccctga aaaacaacct gccggacggt gttaaaaaag ttaaagacat catggacctg 360
gctaaactgc cgatgaacga cctgcgtgtt cagctgaaag ctgctaacga actgttctct 420
atcctgcaga aactggttaa cccgccgtct ttcaaacgta acatgtctca gtctcagcgt 480
cgttgcaact gc 492
<210> 9
<211> 585
<212> DNA
<213>Chicken IFN-α
<400> 9
ccgaccatgg ctgttccggc ttctccgcag cacccgcgtg gttacggtat cctgctgctg 60
accctgctgc tgaaagctct ggctaccacc gcttctgctt gcaaccacct gcgtccgcag 120
gacgctacct tctctcacga ctctctgcag ctgctgcgtg acatggctcc gaccctgccg 180
cagctgtgcc cgcagcacaa cgcttcttgc tctttcaacg acaccatcct ggacacctct 240
aacacccgtc aggctgacaa aaccacccac gacatcctgc agcacctgtt caaaatcctg 300
tcttctccgt ctaccccggc tcactggaac gactctcagc gtcagtctct gctgaaccgt 360
atccaccgtt acacccagca cctggaacag tgcctggact cttctgacac ccgttctcgt 420
acccgttggc cgcgtaacct gcacctgacc atcaaaaaac acttctcttg cctgcacacc 480
ttcctgcagg acaacgacta ctctgcttgc gcttgggaac acgttcgtct gcaggctcgt 540
gcttggttcc tgcacatcca caacctgacc ggtaacaccc gtacc 585
Claims (10)
1. a kind of fusion protein being made up of OVA, chicken interferon gamma and chicken interferon α, it is characterised in that：The fusion
The amino acid sequence table of albumen is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
2. a kind of gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene
Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3,
It is designated as genome 2.
3. the expression vector containing gene as claimed in claim 2.
4. the genetic engineering bacterium containing gene as claimed in claim 2.
5. a kind of recombination chicken long-acting interferon, it is characterised in that the recombination chicken long-acting interferon is as melting described in claim 1
It is freeze-dried to form after hop protein and freeze drying protectant mixture.
6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step
Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering is obtained
Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, purified to can obtain fusion protein afterwards.
7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium is pET-32a/rAlb-IFN
γ-IFN α, its preparation method is：
(1) design primer, obtained by reverse transcription or be manually respectively synthesized the OVA with flexible linker sequences, chicken do
Disturb plain γ, chicken interferon α target gene；By flexible linker by OVA, chicken interferon gamma, chicken interferon α mesh
Gene connect, the nucleotides sequence list of the target gene after connection as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or
As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；
(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；
(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-IFN
γ-IFNα。
8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21
(DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.
9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick
Purified after product elder generation through affinity chromatography, anion-exchange chromatography and sieve chromatography.
10. the application of recombination chicken long-acting interferon according to claim 5, it is characterised in that the recombination chicken is long-acting dry
The long half time of element is disturbed up to more than 89 hours, with broad-spectrum disease resistance toxic action and the immune response of chicken itself can be improved.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710676299.6A CN107286255A (en) | 2017-08-09 | 2017-08-09 | It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof |
| CN201810768631.6A CN108840952A (en) | 2017-08-09 | 2018-07-13 | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710676299.6A CN107286255A (en) | 2017-08-09 | 2017-08-09 | It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107286255A true CN107286255A (en) | 2017-10-24 |
Family
ID=60105591
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710676299.6A Pending CN107286255A (en) | 2017-08-09 | 2017-08-09 | It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof |
| CN201810768631.6A Withdrawn CN108840952A (en) | 2017-08-09 | 2018-07-13 | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810768631.6A Withdrawn CN108840952A (en) | 2017-08-09 | 2018-07-13 | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN107286255A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108576399A (en) * | 2018-03-22 | 2018-09-28 | 中国农业科学院生物技术研究所 | Composite interference promotor composition and its preparation and application |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455006B (en) * | 2020-04-10 | 2021-09-07 | 天津生机集团股份有限公司 | Recombinant chicken interferon alpha product expressed by escherichia coli and preparation method and application thereof |
| CN115850514A (en) * | 2022-10-26 | 2023-03-28 | 山东迅达康兽药有限公司 | Recombinant chicken interferon alpha protein, preparation method and application thereof |
-
2017
- 2017-08-09 CN CN201710676299.6A patent/CN107286255A/en active Pending
-
2018
- 2018-07-13 CN CN201810768631.6A patent/CN108840952A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108576399A (en) * | 2018-03-22 | 2018-09-28 | 中国农业科学院生物技术研究所 | Composite interference promotor composition and its preparation and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108840952A (en) | 2018-11-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
| CN108840952A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α | |
| CN108794638A (en) | A kind of recombinant bovine long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon | |
| CN107286254A (en) | Dog albumin interferon-' alpha ' interleukin-22 fusion protein, preparation method and its encoding gene, a kind of dog long-acting interferon | |
| CN107353347A (en) | A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof | |
| CN108794645A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and Bov IFN α | |
| CN108864300A (en) | Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a breeder long-acting interferon | |
| CN107383202A (en) | A kind of fusion protein being made up of OVA, chicken interferon gamma and recombinant chIL-2 and preparation method thereof | |
| CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
| CN108864295A (en) | A kind of recombinant bovine long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof | |
| CN107245110A (en) | A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interferon-tau and preparation method thereof | |
| CN107254000A (en) | A kind of fusion protein being made up of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of restructuring sheep long-acting interferon γ | |
| CN107353348A (en) | A kind of restructuring sheep long-acting interferon τ and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107253994A (en) | A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof | |
| CN107383207A (en) | A kind of canine recombinant long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107337738A (en) | A kind of canine recombinant long-acting interferon and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107286252A (en) | A kind of recombination chicken long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107286253A (en) | A kind of fusion protein being made up of OVA and chicken interferon gamma and preparation method thereof and a kind of recombination chicken long-acting interferon γ | |
| CN107365391A (en) | A kind of recombination chicken long-acting interferon and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107266590A (en) | A kind of fusion protein being made up of dog albumin, dog interferon γ and dog interferon alpha and preparation method thereof | |
| CN107286256A (en) | A kind of recombination chicken long-acting interferon γ and prepare this long-acting interferon γ fusion protein and preparation method thereof | |
| CN109053897A (en) | A kind of fusion protein and preparation method thereof being made of recombinant chIL-2, chicken interferon gamma and chicken interferon α | |
| CN107286257A (en) | A kind of Recombinant Swine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107353350A (en) | A kind of fusion protein being made up of bovine albumin and Bov IFN γ and preparation method thereof and a kind of recombinant bovine long-acting interferon γ | |
| CN107266589A (en) | A kind of fusion protein being made up of dog albumin, dog interferon γ and canine leucocyte interleukin 2 and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171024 |
|
| WD01 | Invention patent application deemed withdrawn after publication |