CN107253994A - A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof; the fusion protein is formed by pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha through flexible linker connections, through being freeze-dried to obtain Recombinant Swine long-acting interferon after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves more than 19 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of fusion being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by pig interleukin 2 and 6, Porcine interferon-gamma and pig Fusion protein of interferon-' alpha ' composition and preparation method thereof.

Background technology

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease prevention and controls are far from the control for adapting to infectious disease in extensive intensive pig production production.I State newly occurs in that nearly 20 kinds of livestock and poultry infectious diseases over nearly 20 years, add original animal epidemic, China's aquaculture is caused huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock up to 15%-20%, Economic loss reaches billions of members.

The prevention and treatment approach to porcine viral diseases mainly by vaccine inoculation and uses antibiotic at present, but by In breeding environment imperfection, virus variation and Abwehrkraft des Koepers change etc. reason, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament, due to medicament residue problem, give people Health is negatively affected；And traditional vaccine, high specific and side effect due to it, it is impossible to resist virus variation and new The significant damage brought to pig aquaculture continuously emerges in type virus.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is the multi-functional cell factor of a class, with cell receptor knot After conjunction, it can induce body and produce many species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA suppresses the growth and breeding of virus and plays the activity of antitumor grade.Now, it is known that α types IFN in vivo can be selectively The infection cells such as virus are acted on, by suppressing the biosynthesis of the virus protein in infected cell, wide spectrum are played and efficient Antivirus action.But to normal host cell without acting on or act on faint.IFN-α main physiological activity is with suppression virus Duplication, anti parasitic, suppression various kinds of cell propagation, the killing activity of stimulation immunocyte.

γ types IFN is that T cell and NK cells by activating are produced, with relatively strong antiviral and immunoloregulation function.Largely Research shows that interferon gamma also plays the adjustment effect of key in addition to broad-spectrum antiviral function, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- Answer, but the immunoregulatory activity of interferon gamma is coordinating immune response and is determining to play more in the long-term antiviral state of body Important effect, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2 is interleukin 2, also known as SCIF.The main T lymphocytes by activating are produced The raw cell factor with extensive bioactivity, can both promote lymphopoiesis, strengthen immunologic function, and can restricted T Cell effect and the immune tolerance for strengthening body, therefore available for treatment tumour, infectious diseases and autoimmune disease.In beast In doctor, because IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 because The immune level of body can be strengthened, the resistance against diseases of body is improved, thus for bacillary, viral and parasitic diseases Immunization therapy.In addition, IL-2 can also influence the metabolism of medicine, make the metabolism time lengthening of medicine, action time increase, so as to put forward High curative effect of medication.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period is generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main cause of half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the aspect of molecular weight Part solve interferon molecule amount it is small and the problem of cause half-life short, while polyethylene glycol fused interferon cost is very Height, is unfavorable for clinically applying.

The content of the invention

In order to solve the above technical problems, being disturbed the invention provides one kind by pig interleukin 2 and 6, Porcine interferon-gamma and pig Fusion protein of plain α composition and preparation method thereof, and thus fusion protein with after freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, compared with The half-life period of common pig interferon improves more than 19 times, and with broad-spectrum disease resistance toxic action and can improve the immune of pig itself and answer Answer.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, the fusion protein Amino acid sequence table as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, it is designated as genome 2.

Fusion protein described in the equal codified of the genome 1 and the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after result, be considered as the gene during usual codon adaptation indexI CAI=1.0 in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection Existing pig interleukin 2 and 6, porcine IFN γ, pig IFN-α original gene codon in Escherichia coli codon adaptation indexI (CAI) be respectively 0.23,0.24,0.22, GC percentages be 38.7%, 39.2%, 59.1%；And by pig interleukin 2nd, obtained after porcine IFN γ, pig IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.97, 1.0th, 1.0, GC percentages 47.6%, 45.4%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, transcription and translation efficiency is improved.

Present invention also offers the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, further, and the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is by described fusion egg In vain with after freeze drying protectant mixture, it is freeze-dried to form.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, it is purified to can obtain fusion protein afterwards.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, and its preparation method is：

(1) design primer, obtained by reverse transcription or the flexible linker sequences of artificial synthesized band pig interleukin 2nd, the target gene of Porcine interferon-gamma, porcine interferon alpha；By flexible linker by pig interleukin 2 and 6, Porcine interferon-gamma, pig The target gene of interferon-' alpha ' is connected, the nucleotides sequence list such as SEQUENCE LISTING of the target gene after connection Shown in the ＞ of 400 ＜ 2 or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2- IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：Through affinity chromatography, anion-exchange chromatography and molecular sieve after the crude product elder generation of fusion protein Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. is V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F1：CATGCCATGGATGTATAAGATGCAGCT, with NcoI restriction enzyme sites；

Downstream IL-2-R1：

ACCACCACCAGAACCACCACCACCAGTCAGTGTTGAGTAG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAGTTATACAACTT, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCTTTTGATGCTCTCTG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGTTCCTATTTA, with flexible linker；

Downstream IFN-α-R1：

CCCTCGAGCTCCTTCCTCCTGAG, with XhoI restriction enzyme sites；

B. RNA is extracted from pig liver, the target gene of pig IL-2, porcine IFN γ and pig IFN-α is obtained by reverse transcription, The gene order of three respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

Respectively using pig IL-2, porcine IFN γ and pig IFN-α target gene as template, and it is utilized respectively pig IL-2, pig The upstream and downstream primer of IFN-γ and pig IFN-α enters performing PCR amplification, respectively obtains the pig IL-2 for connecting flexible linker, pig IFN-γ and pig IFN-α gene.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix are 10 μ L, plus RNase Free water is to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ genes are obtained using flexible linker connection pig IL-2 and porcine IFN γ target gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IL-2 gene templates DNA 1, connect the flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ anti-sense primer 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Even Connecing PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN are obtained using flexible linker connections rIL2-IFN γ genes and pig IFN-α target gene α genes

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rIL2-IFN γ gene templates The μ L of DNA 1, connect the flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-α template DNA 0.5, IFN-α anti-sense primer 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is： 95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Most 72 DEG C extend 10min afterwards.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F2：CATGCCATGGATGTACAAAATGCAGC, with NcoI restriction enzyme sites；

Downstream IL-2-R2：

ACCACCACCAGAACCACCACCACCGGTCAGGGTAGAGTAG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTCTTACACCACCT, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGCTG, with flexible linker；

Porcine interferon alpha (IFN-α)：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGCTCTTACCTG, with flexible linker；

Downstream IFN-α-R2：

CCCTCGAGTTCTTTACGACGCAG, with XhoI restriction enzyme sites.

B. the target gene of the pig IL-2, porcine IFN γ and pig IFN-α, the gene order of three is respectively such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 7 ＞, SEQUENCE LISTING, 400 ＜, 8 ＞ and SEQUENCE LISTING 9；

Respectively using pig IL-2, porcine IFN γ and pig IFN-α target gene as template, and it is utilized respectively pig IL-2, pig The upstream and downstream primer of IFN-γ and pig IFN-α enters performing PCR amplification, respectively obtains the pig IL-2 for connecting flexible linker, pig IFN-γ and pig IFN-α gene.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.0, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ genes are obtained using flexible linker connection pig IL-2 and porcine IFN γ target gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IL-2 gene templates DNA 1, connect the flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-γ template DNA 0.5, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ anti-sense primer 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Even Connecing PCR reaction conditions is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN are obtained using flexible linker connections rIL2-IFN γ genes and pig IFN-α target gene α genes

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rIL2-IFN γ gene templates The μ L of DNA 1, connect the flexible linker μ L of 1 μ L, IL-2 sense primer of IFN-α template DNA 0.5, IFN-α anti-sense primer 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is： 95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Most 72 DEG C extend 10min afterwards.

Present invention also offers the application of the Recombinant Swine long-acting interferon, its long half time had up to more than 76 hours Broad-spectrum disease resistance toxic action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig IL-2, porcine IFN γ and pig IFN-α gene are realized into amalgamation and expression by flexible linker, interference is improved Plain half-life period, compared with plain interferon, improve more than 19 times；

2. by being optimized to pig IL-2, porcine IFN γ and pig IFN-α gene, improve pig IL-2, porcine IFN γ and The expression quantity of pig IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, it is less to produce inclusion body in protein expression, forms great amount of soluble albumen, it is to avoid inclusion body denaturation and multiple The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of pig IL-2, porcine IFN γ and pig IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improving the immune response of pig itself.

Brief description of the drawings

Fig. 1 is pig interleukin 2 and 6 gene, porcine interferon alpha gene and the Porcine interferon-gamma gene RT-PCR in embodiment 1 The result of amplification；Swimming lane M：DNA Marker DL2000；Swimming lane 1：The gene RT-PCR amplified productions of porcine interleukin 2；Swimming lane 2：Pig Interferon-gamma gene RT-PCR amplified productions；Swimming lane 3：Porcine interferon alpha gene RT-PCR amplified productions；

The knot that Fig. 2 expands for the PCR after the target gene connection of the pig IL-2 in embodiment 1, IFN-γ and IFN-α Really；Swimming lane M：DNA Marker DL2000；Swimming lane 1：The gene of porcine interleukin 2, Porcine interferon-gamma gene and porcine interferon alpha gene Ligation amplification product；

PCR amplifications and double digestion qualification result of the Fig. 3 for the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 be embodiment 1 in recombinant protein SDS-PAGE electrophoretic examinations results；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 2：Precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 is obtained；Swimming lane M：Albumen Marker；Swimming Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 causes cell for the Recombinant Swine long-acting interferon α as made from the fusion protein in embodiment 1 in embodiment 5 to VSV The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 handles hole for the Recombinant Swine long-acting interferon α of gradient dilution (from right to left)；

Fig. 7 is the Recombinant Swine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, its preparation method is as follows：

1. pig interleukin 2 and 6 (IL-2), Porcine interferon-gamma (IFN-γ) and porcine interferon alpha (IFN-α) target gene Obtain and amplification

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in pig interleukin 2 and 6 NcoI restriction enzyme sites and Linker sequences are introduced in sense primer and anti-sense primer respectively, Porcine interferon-gamma sense primer and Linker sequences are introduced in anti-sense primer respectively, Linker is introduced respectively in the sense primer and anti-sense primer of porcine interferon alpha Sequence and XhoI restriction enzyme sites.

Table 1PCR amplimers

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, the purpose base of pig IL-2, porcine IFN γ and pig IFN-α is obtained by reverse transcription Cause, the gene order of three respectively such as the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

RT-PCR reaction systems (25 μ L) are shown in Table 2

Table 2RT-PCR reaction systems

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 490bp, 560bp and 710bp or so in RT-PCR amplified productions, its As a result as shown in figure 1, explanation has prepared pig IL-2, porcine IFN γ and the pig for being connected to flexible linker sequences respectively The target gene of IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

Table 3rIL2-IFN γ PCR reaction systems

Table 4rIL2-IFN γ-IFN α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1700bp or so in pcr amplification product, its result as shown in Fig. 2 RIL2-IFN γ and IFN-α amplified production band are occurred in that in Fig. 2, because being connected in rIL2-IFN γ and IFN-α gene During, occur in that non-specific responding.The nucleotide sequence of the obtained target gene such as ＞ of 400 ＜ of SEQUENCE LISTING 2 It is shown.

3. expression vector establishment

Target gene after selection connection through be sequenced it is errorless after, PCR glue reclaims product and pET-32a plasmids use NcoI Double digestion and recovery are carried out with XhoI restriction enzymes, double digestion is done by 20 μ L systems in table 5：

The double digestion system of table 5

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 6,4 DEG C overnight connect：

The enzyme disjunctor system of table 6

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate incubated overnights of penicillin；Single bacterium colony on picking LB flat boards carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through NcoI and XhoI double digestions, is accredited as positive and is represented that engineering bacteria is successfully constructed, PCR amplifications and double digestion production Thing detects single band through agarose gel electrophoresis at 1700bp or so places, and its result is as shown in figure 3, illustrate successfully to obtain PET-32a/rIL2-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, its result as shown in figure 4, it can be seen that recombinant bacterium is lured Lead supernatant after the bacterial cell disruption after 5h and be deposited in the visible predominant expression band in 80.6KD or so places, illustrate in precipitation and supernatant Equal successful expression fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by using (the 50mM of Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Determine rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷IU/mg, albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.It can obtain the fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, its amino acid Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, other be the same as Examples 1, simply e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmids experiences State cell.The SDS-PAGE electrophoresis results be the same as Example 1 of its fusion protein is compareed, 80.6KD or so places predominant expression in supernatant Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Amount is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist Correctly folded with expressing protein, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, its preparation method is such as Under：

1. pig interleukin 2 and 6 (IL-2), Porcine interferon-gamma (IFN-γ) and porcine interferon alpha (IFN-α) target gene Obtain and amplification

Pig IL-2 in embodiment 1, porcine IFN γ and pig IFN-α are optimized, artificially synthesized pig IL-2, porcine IFN γ With pig IFN-α target gene, after optimization, the nucleotide sequence of three respectively as the ＞ of 400 ＜ of SEQUENCE LISTING 7, Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilize rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, IL-2, pig IFN- in the present embodiment to pig γ and pig IFN-α gene codon are optimized.

Interpretation of result after 1.2 codon optimizations

It is considered as the gene during usual codon adaptation indexI (CAI)=1.0 optimal efficient in the expression system Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, the scope is exceeded in any region can influence to translate and transcriptional efficiency.Pig IL-2, pig are found using software detection The codon of IFN-γ and pig IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.23, 0.24th, 0.22, GC percentages are 38.7%, 39.2%, 59.1%；And by pig IL-2, porcine IFN γ and pig IFN-α gene Obtained after optimization recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.97,1.0,1.0, GC percentages 47.6%th, 45.4%, 55.6%.Significantly reduce the utilization rate of low codon by gene optimization, it is to avoid rare codon Influence to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.

1.3 design of primers：

Table 7PCR amplimers

The genomic DNA of pig IL-2 after optimization, porcine IFN γ and pig IFN-α is diluted to 0.05mg/mL respectively.Utilize PCR amplifications obtain target gene, and 25 μ L reaction systems are as shown in table 8：

Table 8PCR reaction systems

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Pig IL-2, porcine IFN γ and pig IFN-α pcr amplification product through agarose gel electrophoresis respectively 490bp, There is specific band in 560bp and 710bp or so, illustrate to have prepared the pig for being connected to flexible linker after optimization IL-2, porcine IFN γ and pig IFN-α target gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

Table 9rIL2-IFN γ PCR reaction systems

Table 10rIL2-IFN γ-IFN-α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1700bp or so in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN-α gene after connecing.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING 400 Shown in the ＞ of ＜ 3.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids NcoI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 11：

The double digestion system of table 11

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 12,4 DEG C overnight connect：

Table 12

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia Incubated overnight in the LB flat boards of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid warp through PCR NcoI, XhoI double digestion are identified, are accredited as positive and are represented expression vector establishment success, PCR amplifications and double digestion product are through fine jade There is single band at 1700bp or so places in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN α is successfully constructed.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in 80.6KD or so places, illustrates to have obtained recombinant protein in supernatant is precipitated.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, use Binding Buffer III elution, collects rIL2-IFN γ-IFN α protein peak.

5.4 sample identification

Determine rIL2-IFN γ-IFN α potency and specific activity, specific activity >=10⁷IU/mg, albumen is qualified；Sterile point Dress, -80 DEG C of preservations.It can obtain the fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, its ammonia Base acid sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 4

A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, other be the same as Examples 3, simply e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmids experiences State cell.The SDS-PAGE electrophoresis results be the same as Example 3 of its fusion protein is compareed, 80.6KD or so places predominant expression in supernatant Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Amount is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist Correctly folded with expressing protein, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 5

A kind of Recombinant Swine long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 obtains the mirror for the fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha It is fixed

The quantitative detection of 6.1 protein contents

Lowry methods are used, the standard protein for examining and determine institute with Chinese food pharmaceutical biological product makees standard test, determine embodiment 1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 80.6KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-porcine alpha-IFN (1 of abcam companies mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon sample can be with anti-porcine interferon alpha Specific reaction occurs for monoclonal antibody, and specific band occurs in 80.6KD or so place, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of Recombinant Swine long-acting interferon α in embodiment 5

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, the Recombinant Swine for adding various dose is long Imitate to inhale after interferon-' alpha ', 24h and abandon, then inoculation 100TCID50VSV viruses respectively.

Result of the test

As a result show that the Recombinant Swine long-acting interferon α obtained causes the lesion of HEp-2 cells to have obvious suppression to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the Recombinant Swine obtained is long Imitate after the cell virus inoculation after interferon-' alpha ' processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=10⁷IU/ml, as shown in Figure 6.

Embodiment 8

The four parts of Recombinant Swine long-acting interferon α obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed The measure of half-life period of the agent (being designated as A, B, C, D respectively) in pig body

Cytopathic-effect inhibition assay determines the blood concentration and time relationship of rIL2-IFN γ-IFN α

The pig (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml Recombinant Swine long-acting interferons α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 36h, 72h, 96h venous blood collection, the solidification of 4 DEG C of blood sample, 3500rpm low temperature from Heart 10min separates serum, and each every pig blood sample of time point is to be measured in -20 DEG C of preservations.Serum sample is determined using cytopathic-effect inhibition assay The concentration of rIL2-IFN γ-IFN α in product, is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter result of calculation It is shown in Table 13.

Dominant dynamic parameters in serum after the Recombinant Swine long-acting interferon α intramuscular injection of table 13

As a result show that Recombinant Swine long-acting interferon α has longer half-life period.Half-life period can reach 76h or so after measured, compared with Plain interferon improves more than 19 times.

Embodiment 9

The freeze-dried measure influenceed on pig cell immune response of four parts of Recombinant Swine long-acting interferon α in embodiment 5

Take six roughly the same pigs of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously injected 2mL PBS is subcutaneously injected in the 2mg/ml Recombinant Swine long-acting interferon freeze-dried 2ml of α, control group neck, takes pig periphery after injecting 4 weeks Blood, takes weekly a blood afterwards, and lymphocyte is separated using lymphocyte separation medium, and lymphocyte passes through serum-free RPMI 1640 culture mediums are washed after 2 times, and it is 2 × 10 to be resuspended with complete medium, adjust cell concentration⁶Individual/ml, 24 porocyte culture plates are every Hole adds 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out, testing result is as shown in table 14 by kit specification：

Table 14ELISA detects each group pig cell immune response level

As a result show after injection Recombinant Swine long-acting interferon α, cell factor IL-4 in pig peripheral blood can be significantly improved Content, enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned with reference to embodiment to a kind of fusion egg being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha The detailed description that bletilla its preparation method is carried out, is illustrative rather than limited, can be included according to limited scope Several embodiments, therefore changing and modifications in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 566

<212> PRT

<213>Pig IL2-IFN γ-IFN α fusion protein

<400> 1

Met Tyr Lys Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Met Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys Lys

20 25 30

Gln Leu Glu Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu Val

35 40 45

Lys Asn Tyr Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys Phe

50 55 60

Tyr Met Pro Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu Val

65 70 75 80

Glu Glu Leu Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser Lys

85 90 95

Asn Ser Asp Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn Val

100 105 110

Thr Val Leu Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu Tyr

115 120 125

Asp Asp Glu Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile Thr

130 135 140

Phe Cys Gln Ser Ile Tyr Ser Thr Leu Thr Gly Gly Gly Gly Ser Gly

145 150 155 160

Gly Gly Gly Ser Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu

165 170 175

Cys Val Thr Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe

180 185 190

Lys Glu Ile Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly

195 200 205

Val Pro Asn Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys

210 215 220

Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr

225 230 235 240

Phe Lys Phe Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser

245 250 255

Met Asp Val Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser

260 265 270

Ser Gly Lys Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp

275 280 285

Asn Leu Gln Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met

290 295 300

Asn Asp Leu Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln

305 310 315 320

Thr Met Phe Gln Gly Gln Arg Ala Ser Lys Gly Gly Gly Gly Ser Gly

325 330 335

Gly Gly Gly Ser Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg

340 345 350

Ser Ser Asn Ile Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala

355 360 365

Arg Thr Ala Ala Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe

370 375 380

Leu Thr Ala Leu Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly

385 390 395 400

Cys Asp Leu Pro Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg

405 410 415

Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His

420 425 430

Arg Arg Asp Phe Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val

435 440 445

Gln Lys Ala Gln Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr

450 455 460

Phe Gln Leu Phe Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser

465 470 475 480

Leu Leu His Gln Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu

485 490 495

Glu Ala Cys Val Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu

500 505 510

Glu Glu Asp Ser Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr

515 520 525

Leu Tyr Leu Gln Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val

530 535 540

Arg Ala Glu Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp

545 550 555 560

Arg Leu Arg Arg Lys Glu

565

<210> 2

<211> 1698

<212> DNA

<213>Genome 1

<400> 2

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ctggtggtgg tggttctggt 480

ggtggtggtt ctatgagtta tacaacttat ttcttagctt ttcagctttg cgtgactttg 540

tgtttttctg gctcttactg ccaggcgccc ttttttaaag aaataacgat cctaaaggac 600

tattttaatg caagtacctc aggtgtacct aatggtggac ctcttttctt agaaattttg 660

gagaattgga aagaggagag tgacaaaaaa ataattcaga gccaaattgt ctccttctac 720

ttcaaattct ttgaaatctt caaagataac caggccattc aaaggagcat ggatgtgatc 780

aagcaagaca tgtttcagag gttcctaaat ggtagctctg ggaaactgaa tgacttcgaa 840

aagctggtta aaattccggt agataatctg cagatccagc gcaaagccat cagtgaactc 900

atcaaagtga tgaatgatct gtcaccaaga tctaacctaa gaaagcggaa gagaagtcag 960

actatgttcc aaggccagag agcatcaaaa ggtggtggtg gttctggtgg tggtggttct 1020

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 1080

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 1140

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 1200

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 1260

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 1320

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 1380

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 1440

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 1500

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 1560

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 1620

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 1680

agactcagga ggaaggag 1698

<210> 3

<211> 1698

<212> DNA

<213>Genome 2

<400> 3

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga ccggtggtgg tggttctggt 480

ggtggtggtt ctatgtctta caccacctac ttcctggctt tccagctgtg cgttaccctg 540

tgcttctctg gttcttactg ccaggctccg ttcttcaaag aaatcaccat cctgaaagac 600

tacttcaacg cttctacctc tggtgttccg aacggtggtc cgctgttcct ggaaatcctg 660

gaaaactgga aagaagaatc tgacaaaaaa atcatccagt ctcagatcgt ttctttctac 720

ttcaaattct tcgaaatctt caaagacaac caggctatcc agcgttctat ggacgttatc 780

aaacaggaca tgttccagcg tttcctgaac ggttcttctg gtaaactgaa cgacttcgaa 840

aaactggtta aaatcccggt tgacaacctg cagatccagc gtaaagctat ctctgaactg 900

atcaaagtta tgaacgacct gtctccgcgt tctaacctgc gtaaacgtaa acgttctcag 960

accatgttcc agggtcagcg tgcttctaaa ggtggtggtg gttctggtgg tggtggttct 1020

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 1080

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 1140

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 1200

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 1260

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 1320

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 1380

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 1440

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 1500

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 1560

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 1620

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 1680

cgtctgcgtc gtaaagaa 1698

<210> 4

<211> 462

<212> DNA

<213>Pig IL-2

<400> 4

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ct 462

<210> 5

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 5

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 6

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 6

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 60

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 120

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 180

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 240

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 300

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 360

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 420

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 480

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 540

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 600

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 660

agactcagga ggaaggag 678

<210> 7

<211> 462

<212> DNA

<213>Pig IL-2

<400> 7

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga cc 462

<210> 8

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 8

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

<210> 9

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 9

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 60

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 120

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 180

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 240

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 300

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 360

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 420

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 480

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 540

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 600

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 660

cgtctgcgtc gtaaagaa 678

Claims (10)

1. a kind of fusion protein being made up of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

2. a kind of gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, It is designated as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of Recombinant Swine long-acting interferon, it is characterised in that the Recombinant Swine long-acting interferon is as melting described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering is obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, purified to can obtain fusion protein afterwards.

7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN α, its preparation method is：

(1) design primer, obtained by reverse transcription or the flexible linker sequences of artificial synthesized band pig interleukin 2 and 6, pig The target gene of interferon gamma, porcine interferon alpha；Pig interleukin 2 and 6, Porcine interferon-gamma, pig are disturbed by flexible linker Plain α target gene is connected, the nucleotides sequence list such as ＞ of 400 ＜ of SEQUENCE LISTING 2 of the target gene after connection It is shown or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIL2-IFN γ-IFNα。

8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Purified after product elder generation through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of Recombinant Swine long-acting interferon according to claim 5, it is characterised in that the Recombinant Swine is long-acting dry The long half time of element is disturbed up to more than 76 hours, with broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.