CN107266587A - A kind of recombinant bovine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of recombinant bovine long-acting interferon α and the fusion protein for preparing this long-acting interferon and preparation method thereof; the fusion protein is connected by Bov IFN γ with Bov IFN α and formed through flexible linker, through being freeze-dried to obtain recombinant bovine long-acting interferon α after fusion protein and freeze drying protectant mixture.The recombinant bovine long-acting interferon α is remarkably improved the half-life period of Bov IFN, and the half-life period of more common Bov IFN improves more than 11 times, and with broad-spectrum disease resistance toxic action and can improve Niu Zishen immune response.

Description

A kind of recombinant bovine long-acting interferon α and prepare this long-acting interferon fusion protein and Its preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to a kind of recombinant bovine long-acting interferon α and prepare this Fusion protein of long-acting interferon and preparation method thereof.

Background technology

Ox is one of important herding species of China, with continuing to develop for intensive and large-scale cultivation, bovine viral The incidence of disease of communicable disease is improved year by year.Large-scale pasture is popular for a long time at home for the communicable disease of many oxen, because Disease propagation is fast, the high serious sound development that govern China's ox aquaculture of the incidence of disease, the death rate；More seriously some Poultry suffers from the life and health that brucellosis, tuberculosis of infectious disease such as ox etc. directly threaten the mankind altogether.

The prevention and treatment approach to ox communicable disease mainly by vaccine inoculation and uses antibiotic at present.Big portion Divide antibiotics and traditional oral antiviral medicament, due to medicament residue problem, be negatively affected to health；And Traditional vaccine, high specific and side effect due to it, it is impossible to resist virus variation and new virus is continuously emerged to pig The significant damage that aquaculture is brought.Interferon determines that it has with the antiviral activity of its wide spectrum and extensive immunoregulation capability There are huge clinical practice potentiality, can be for prevention and treatment bovine viral bacterial infection disease.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is the multi-functional cell factor of a class, with cell receptor knot After conjunction, it can induce body and produce many species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA suppresses the growth and breeding of virus and plays the activity of antitumor grade.According to IFN generation cell, biochemical character and The difference played a role in terms of immunity of organism, is divided into the class of α, β, γ tri-.Now, it is known that α types IFN can selectively make in vivo For infection cells such as viruses, by suppressing the biosynthesis of the virus protein in infected cell, wide spectrum is played and efficiently anti- Virus function.IFN-α main physiological activity is with suppressing virus replication, anti parasitic, suppresses various kinds of cell propagation, stimulation The killing activity of immunocyte.

γ types IFN is that T cell and NK cells by activating are produced, with relatively strong antiviral and immunoloregulation function.Largely Research shows that interferon gamma also plays the adjustment effect of key in addition to broad-spectrum antiviral function, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- Answer, but the immunoregulatory activity of interferon gamma is coordinating immune response and is determining to play more in the long-term antiviral state of body Important effect, therefore interferon gamma has particularly important clinical value.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period is generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main cause of half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, the layer only in molecular weight Partly solved on face interferon molecule amount it is small and the problem of cause half-life short, while polyethylene glycol fused interferon cost is non- Chang Gao, is unfavorable for clinically applying in domestic animal.

The content of the invention

In order to solve the above technical problems, the invention provides a kind of recombinant bovine long-acting interferon α and preparing this long-acting interference Fusion protein of element and preparation method thereof, the recombinant bovine long-acting interferon is remarkably improved the half-life period of Bov IFN, more general The half-life period of logical Bov IFN improves more than 11 times, and with broad-spectrum disease resistance toxic action and can improve Niu Zishen immune response.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of Bov IFN γ and Bov IFN α, the amino acid sequence table of the fusion protein As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of SEQUENCE LISTING400 ＜ 3, it is designated as genome 2.

Fusion protein described in the equal codified of the genome 1 and the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after result, be considered as the gene during usual codon adaptation indexI CAI=1.0 in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection The codon of existing ox IFN-γ and IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24, 0.25, GC percentage is 39.8%, 58.2%；And by existing to obtaining recombination after ox IFN-γ and IFN-α gene optimization Codon adaptation indexI (CAI) is 1.0,0.97, GC percentages 44.8%, 54.6% in Escherichia coli.It is aobvious by gene optimization Write and reduce the utilization rate of low codon, it is to avoid influence of the rare codon to protein expression, improve the G/C content of gene, Improve transcription and translation efficiency.

The present invention also provides the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIFN γ-IFN α.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, further, and the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers a kind of recombinant bovine long-acting interferon α, the recombinant bovine long-acting interferon α is by described fusion It is freeze-dried to form after albumen and freeze drying protectant mixture.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, it is purified to can obtain fusion protein afterwards.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIFN γ-IFN α, and its preparation method is：

(1) primer is designed, is obtained by reverse transcription or the artificial synthesized Bov IFN for connecting flexible linker sequences γ and Bov IFN α target gene；Bov IFN γ and Bov IFN α target gene are connected by flexible linker Come, the nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE LISTING Shown in the ＞ of 400 ＜ 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rIFN γ-IFNα。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. is V205.

The acquisition methods of the genome 1 are：

A. design of primers

Bov IFN γ (IFN-γ) primer sequence is：

Upstream IFN-γ-F1：CCGGAATTCATGAAATATACAAGCTATTT, with EcoRI restriction enzyme sites；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCCGTTGATGCTCTCCG, with flexible linker；

Bov IFN α (IFN-α) primer sequence is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCTC, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGGTCCTTTCTCCTGAAAC, with XhoI restriction enzyme sites；

B. RNA is extracted from cattle liver, the target gene of IFN-γ and IFN-α, both genes are obtained by reverse transcription Sequence is respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞ and SEQUENCE LISTING 5；

Respectively using the target gene of IFN-γ and IFN-α as template, and it is utilized respectively the upstream and downstream of IFN-γ and IFN-α and draws Thing enters performing PCR amplification, respectively obtains the IFN-γ and IFN-α target gene for connecting flexible linker.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix are 10 μ L, plus RNase Free water is to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene is connected with IFN-α gene using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IFN-γ template DNA 1, connect the flexible linker μ L of IFN-α template DNA I 1, IFN-γ sense primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of α anti-sense primers 2.5 μ L, dNTP Mix is 9 μ L, plus RNase Free water is to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

Bov IFN γ (IFN-γ) primer sequence is：

Upstream IFN-γ-F2：CGGGATCCATGAAATACACCTCTTAC, with BamHI restriction enzyme sites；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCGGTAGAAGCACGACG；With flexible linker；

Bov IFN α (IFN-α) primer sequence is：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTTGCCACCTGCCG, with flexible linker；

Downstream IFN-α-R2：CCCTCGAGGTCTTTACGACGGAAA, with XhoI restriction enzyme sites；

B. the target gene of the IFN-γ and IFN-α, both gene orders are respectively such as SEQUENCE LISTING Shown in the ＞ of 400 ＜, 6 ＞ and SEQUENCE LISTING, 400 ＜ 7；

Respectively using the target gene of IFN-γ and IFN-α as template, and it is utilized respectively the upstream and downstream of IFN-γ and IFN-α and draws Thing enters performing PCR amplification, respectively obtains IFN-γ and IFN-α target gene after the optimization for connecting flexible linker.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1.0, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. IFN-γ gene is connected with IFN-α gene using flexible linker

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of IFN-γ template DNA 1, connect the flexible linker μ L of IFN-α template DNA 1, IFN-γ sense primer 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of α anti-sense primers 2.5 μ L, dNTP Mix is 9 μ L, plus RNase Free water is to 25 μ L；Connect PCR Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, altogether 35 circulations；Last 72 DEG C of extensions 10min.

Present invention also offers the application of the recombinant bovine long-acting interferon α, its long half time had up to more than 45 hours Broad-spectrum disease resistance toxic action and the immune response that Niu Zishen can be improved.

Compared with prior art, the present invention has the advantages that：

Merged 1. being realized Bov IFN γ and Bov IFN-α genes by flexible linker, improve interferon and partly decline Phase, compared with plain interferon, improve more than 11 times；

2. by being optimized to Bov IFN γ and Bov IFN-α genes, improve interferon gamma and Bov IFN-α The expression quantity of fusion protein；

3. using recombination bacillus coli BL21/pET-32a-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, do not produce inclusion body in protein expression, form soluble protein, it is to avoid the mistake of inclusion body denaturation and renaturation Journey, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of Bov IFN γ and Bov IFN-α not only has interferon-' alpha ' Broad-spectrum disease resistance toxic action, while significantly improving Niu Zishen immune response.

Brief description of the drawings

The result that Fig. 1 expands for the Bov IFN γ genes in embodiment 1 with Bov IFN α genes RT-PCR；Swimming lane M： DNA Marker DL2000；Swimming lane 1：Bov IFN γ gene RT-PCR amplified productions；Swimming lane 2：Bov IFN α genes RT- Pcr amplification product；

The result that Fig. 2 expands for the PCR after the target gene connection of the ox IFN-γ in embodiment 1 and ox IFN-α；Swimming Road M：DNA Marker DL2000；Swimming lane 1：Bov IFN γ genes and Bov IFN α gene ligation amplification products；

PCR amplifications and double digestion qualification result of the Fig. 3 for the positive colony plasmid in embodiment 1；Swimming lane M：DNAMarker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 be embodiment 1 in recombinant protein SDS-PAGE electrophoretic examinations results；Swimming lane M：Albumen Marker；Swimming lane 1：Empty bacterium is compareed；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Precipitation；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 is obtained；Swimming lane M：Albumen Marker；Swimming Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：For the broken rear supernatant of recombinant bacterium induction；

Fig. 6 causes cell for the recombinant bovine long-acting interferon α as made from the fusion protein in embodiment 1 in embodiment 5 to VSV The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 handles hole for the recombinant bovine long-acting interferon α of gradient dilution (from right to left)；

Fig. 7 is the recombinant bovine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of Bov IFN γ and Bov IFN α, its preparation method is as follows：

1. Bov IFN γ (IFN-γ) and Bov IFN α (IFN-α) target gene acquisition and amplification

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upper of Bov IFN γ Trip primer and anti-sense primer in introduce EcoRI restriction enzyme sites and Linker sequences respectively, Bov IFN α sense primer and under Linker sequences and XhoI restriction enzyme sites are introduced respectively in trip primer.

The pcr amplification primer thing of table 1

RT-PCR obtains target gene：

RNA is extracted from cattle liver tissue, the target gene of IFN-γ and IFN-α, both bases are obtained by reverse transcription Because sequence is respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING, 4 ＞ and SEQUENCE LISTING400 ＜ 5；

RT-PCR reaction systems (25 μ L) are shown in Table 2

The RT-PCR reaction systems of table 2

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45S, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 530bp or so in RT-PCR amplified productions, and its result is such as Shown in Fig. 1, illustrate successfully to have obtained the Bov IFN γ target gene for being connected to flexible linker and Bov IFN α purposes Gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, using over-lap PCR connection even section target gene, 25 μ L reaction systems are such as Shown in table 3：

The PCR reaction systems of table 3

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45S, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1030bp or so in pcr amplification product, its result as shown in Fig. 2 The nucleotide sequence of obtained target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2.

3. expression vector establishment

The PCR glue reclaims product for selecting the target gene after connection errorless after sequencing is used with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 4：

The double digestion system of table 4

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2uL
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 5,4 DEG C overnight connect：

Table 5

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through EcoRI and XhoI double digestions, be accredited as positive and represent expression vector establishment success, obtain engineering bacteria pET-32a/ RIFN γ-IFN α, PCR are expanded and double digestion product single band occurs through agarose gel electrophoresis at 1030bp or so places, its As a result it is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture mediums of the μ g/ml containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity, in LB culture mediums (the μ g/ml containing ampicillin 100) after amplification culture 4h, surveys OD values and reaches When 1.0；Add IPTG, 32 DEG C of induced expression (the μ g/ml of final concentration 100) 5h；Bacterium is collected, is examined through SDS-PAGE electrophoresis Survey, supernatant is deposited in the visible predominant expression band in 56KD or so places after the bacterial cell disruption after recombinant bacterium induction 5h, and its result is such as Shown in Fig. 4, it can be seen that after bacterial cell disruption after recombinant bacterium induction 5h supernatant to be deposited in 56KD or so places visible excellent Gesture band of expression, illustrates in precipitation and supernatant equal successful expression fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rIFN γ-IFN α protein peak.

5.2 DEAE anion-exchange chromatographies

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, then Crossed with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, uses Binding Buffer III elution, collects rIFN γ-IFN α protein peak

5.4 sample identification：Determine rIFN γ-IFN α potency and specific activity, specific activity >=1.0 × 10⁷IU/mg albumen is conjunction Lattice；It is aseptic subpackaged, -80 DEG C of preservations.It can obtain the fusion protein being made up of Bov IFN γ and Bov IFN α, its amino acid Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of Bov IFN γ and Bov IFN α, other be the same as Examples 1 simply will be therein E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results be the same as Example 1 of albumen is compareed, and 56KD or so places predominant expression band is thicker in supernatant, and explanation is drawn Enter after molecular chaperones pGro7, more preferably, obtained fusion protein amount is higher for expression of the destination protein in supernatant.Escherichia coli The albumen of expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is correct Fold, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made up of Bov IFN γ and Bov IFN α, its preparation method is as follows：

1. Bov IFN γ (IFN-γ) and Bov IFN α (IFN-α) target gene acquisition and amplification

IFN-γ and IFN-α in embodiment 1 is optimized, artificial synthesized IFN-γ and IFN-α target gene, optimized Afterwards, both nucleotide sequences are respectively such as the ＞ institutes of 400 ＜ of SEQUENCE LISTING 400 ＜, 6 ＞ and SEQUENCE LISTING 7 Show.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilize rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IFN-γ and IFN- of ox in the present embodiment α gene codons are optimized.

Interpretation of result after 1.2 codon optimizations

It is considered as the gene during usual codon adaptation indexI (CAI)=1.0 optimal efficient in the expression system Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, the scope is exceeded in any region can influence to translate and transcriptional efficiency.Using software detection find ox IFN-γ and The codon of IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24,0.25, GC percentages For 39.8%, 58.2%；And by obtaining recombination password in Escherichia coli after ox IFN-γ and IFN-α gene optimization Sub- adaptation index (CAI) is 1.0,0.97, GC percentages 44.8%, 54.6%.Low password is significantly reduced by gene optimization The utilization rate of son, it is to avoid influence of the rare codon to protein expression, improves the G/C content of gene, improves transcription and translation Efficiency.

1.3 design of primers：

The pcr amplification primer thing of table 6

IFN-γ and the genomic DNA of IFN-α after optimization is diluted to 0.05mg/mL respectively.Expanded and obtained using PCR Target gene, 25 μ L reaction systems are as shown in table 7：

The PCR reaction systems of table 7

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45S, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 530bp and 530bp or so in pcr amplification product, and explanation is prepared into To the IFN-γ and the target gene of IFN-α being connected to after flexible linker optimization.

2. the connection of target gene

Target gene is diluted to 10ug/mL, using over-lap PCR connection even section target gene, 25 μ L reaction systems are such as Shown in table 8：

The PCR reaction systems of table 8

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1030bp or so in pcr amplification product, illustrates successfully to obtain Target gene after IFN-γ and IFN-α connection.The nucleotide sequence of obtained target gene such as SEQUENCE LISTING Shown in the ＞ of 400 ＜ 3.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids BamHI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 9：

The double digestion system of table 9

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 10,4 DEG C overnight connect：

Table 10

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia The LB culture medium flat plate overnight incubations of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid through PCR Identified through BamHI, XhoI double digestion, be accredited as positive and represent expression vector establishment success, obtain engineering bacteria pET-32a/ RIFN γ-IFN α, PCR are expanded and double digestion product single band occurs through agarose gel electrophoresis at 1030bp, and explanation contains There is the expression vector establishment success of the target gene after IFN-γ and IFN-α connection.

4. the expression of recombinant protein

Picking engineering bacteria pET-32a/rIFN γ-IFN α shakes for 37 DEG C in the LB culture mediums of the μ g/ml containing ampicillin 100 Bacterium 1h recoveries engineering bacteria activity, in LB culture mediums (the μ g/ml containing ampicillin 100) after amplification culture 4h, surveys OD values and reaches When 1.0；Add IPTG, 32 DEG C of induced expression (the μ g/ml of final concentration 100) 5h；Bacterium is collected, is examined through SDS-PAGE electrophoresis Survey, supernatant is deposited in the visible predominant expression band in 56KD or so places after the bacterial cell disruption after recombinant bacterium induction 5h, illustrates upper Recombinant protein has been obtained in cleer and peaceful precipitation.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the rough recombinant bovine interferon-' alpha ' with 0.22 μm of aperture, loading is by being connected to AKTA On the protein purification systems of explorer 100, the His affinity columns balanced with Binding Buffer I (PBS) use PBS Buffer solution washes away uncombined albumen, until A280nm is stable, then with (the 50mM trihydroxy methyl amino first of Elution buffer I Alkane, 20~500mM imidazoles, PH8.0) elution, collect rIFN γ-IFN α protein peak.

5.2 DEAE anion-exchange chromatographies

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, then Crossed with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa2HPO4,0.15M NaCl, PH7.4) has balanced the molecular sieve chromatographies of Superdex 200, uses Binding Buffer III elution, collects rIFN γ-IFN α protein peak.

5.4 sample identification

Determine rIFN γ-IFN α potency and specific activity, specific activity >=1 × 10⁷IU/mg albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.It can obtain the fusion protein being made up of Bov IFN γ and Bov IFN α, its amino acid sequence such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 1.

Embodiment 4

A kind of fusion protein being made up of Bov IFN γ and Bov IFN α, other be the same as Examples 3 simply will be therein E. coli bl21 (DE3) competent cell is replaced for BL21 (DE3) competent cell with pGro7 plasmids.It is merged The SDS-PAGE electrophoresis results be the same as Example 3 of albumen is compareed, and 56KD or so places predominant expression band is thicker in supernatant, and explanation is drawn Enter after molecular chaperones pGro7, more preferably, obtained fusion protein amount is higher for expression of the destination protein in supernatant.Escherichia coli The albumen of expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, coordinate expression albumen is correct Fold, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 5

A kind of recombinant bovine long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 is obtained by the identification of Bov IFN γ and Bov IFN the α fusion protein constituted

The quantitative detection of 6.1 protein contents

Lowry methods are used, the standard protein for examining and determine institute with Chinese food pharmaceutical biological product makees standard test, determine embodiment 1~4 obtained fusion protein concentration is all higher than 1.0mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 56KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-ox alpha interferon (1 of abcam companies mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant bovine long-acting interferon α samples can be with anti-Bov IFN Specific reaction occurs for alpha monoclonal antibodies, and specific band occurs in 56KD or so place, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of recombinant bovine long-acting interferon α in embodiment 5

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, the recombinant bovine for adding various dose is long Imitate to inhale after interferon-' alpha ', 24h and abandon, then inoculation 100TCID50VSV viruses respectively.

Result of the test

As a result show that the recombinant bovine long-acting interferon α obtained causes the lesion of HEp-2 cells to have obvious suppression to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the recombinant bovine obtained is long Imitate after the cell virus inoculation after interferon-' alpha ' processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=1.0 × 10⁷IU/ml, as shown in Figure 6.

Embodiment 8

The measure of half-life period of the recombinant bovine long-acting interferon α in ox body

The four parts of recombinant bovine long-acting interferon α obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed The measure of half-life period of the agent (being designated as A, B, C, D respectively) in ox body

Cytopathic-effect inhibition assay determines the blood concentration and time relationship of rIFN γ-IFN α

The ox (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml recombinant bovine long-acting interferons α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 24h, 48h, 72h venous blood collection, the solidification of 4 DEG C of blood sample, 3500rpm low temperature from Heart 10min separates serum, and each every ox blood sample of time point is to be measured in -20 DEG C of preservations.Serum sample is determined using cytopathic-effect inhibition assay The concentration of rIFN γ-IFN α in product, is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.A matched curve such as Fig. 7 It is shown；Parameter result of calculation is shown in Table 11.

Dominant dynamic parameters in serum after the recombinant bovine long-acting interferon α intramuscular injection of table 11

As a result show that recombinant bovine long-acting interferon α has longer half-life period.Half-life period can reach 45h or so after measured, compared with Plain interferon improves 11 times.

Embodiment 9

The freeze-dried measure influenceed on ox cellullar immunologic response of four parts of recombinant bovine long-acting interferon α in embodiment 5

The young ox for taking six body weight roughly the same is divided into two groups, is designated as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml recombinant bovine long-acting interferon freeze-dried 2ml of α are penetrated, 2mL PBS is subcutaneously injected in control group neck, taken after injecting 4 weeks outside ox All blood, takes weekly a blood afterwards, and lymphocyte is separated using lymphocyte separation medium, and lymphocyte passes through serum-free RPMI 1640 culture mediums are washed after 2 times, and it is 2 × 10 to be resuspended with complete medium, adjust cell concentration⁶Individual/ml, 24 porocyte culture plates are every Hole adds 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out, testing result is as shown in table 12 by kit specification：

The ELISA of table 12 detects each group ox cellullar immunologic response level

As a result show after injection recombinant bovine long-acting interferon α, can significantly improve ox Evaluation of Cytokines in Peripheral Blood IL-2, IL-4 content, enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned to recombinant bovine long-acting interferon α and to prepare fusion protein and its preparation of this long-acting interferon with reference to embodiment The detailed description that method is carried out, is illustrative rather than limited, and several implementations can be included according to limited scope Example, therefore changing and modifications in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of recombinant bovine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof

<130> 1

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 342

<212> PRT

<213>Recombinant bovine long-acting interferon alpha fusion protein

<400> 1

Met Lys Tyr Thr Ser Tyr Phe Leu Ala Leu Leu Leu Cys Gly Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Gln Phe Phe Arg Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Ser Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Asp Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Lys Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

165 170 175

Cys His Leu Pro His Thr His Ser Leu Ala Asn Arg Arg Val Leu Met

180 185 190

Leu Leu Gly Gln Leu Arg Arg Val Ser Pro Ser Ser Cys Leu Gln Asp

195 200 205

Arg Asn Asp Phe Ala Phe Pro Gln Glu Ala Leu Gly Gly Ser Gln Leu

210 215 220

Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu Val Thr Gln His Thr

225 230 235 240

Phe Gln Leu Phe Ser Thr Glu Gly Ser Ala Thr Thr Trp Asp Glu Ser

245 250 255

Leu Leu Asp Lys Leu Arg Ala Ala Leu Asp Gln Gln Leu Thr Asp Leu

260 265 270

Gln Ala Cys Leu Arg Gln Glu Glu Glu Leu Gln Gly Ala Pro Leu Leu

275 280 285

Lys Glu Asp Ser Ser Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr

290 295 300

Leu Tyr Leu Gln Glu Lys Lys His Ser Pro Cys Ala Trp Glu Val Val

305 310 315 320

Arg Ala Gln Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Glu

325 330 335

Ser Phe Arg Arg Lys Asp

340

<210> 2

<211> 1026

<212> DNA

<213>Recombinant bovine long-acting interferon α genomes 1

<400> 2

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacggg tggtggtggt tctggtggtg gtggttcttg ccacctgcct 540

cacacccaca gcctggccaa caggagggtc ctgatgctcc tgggacaact gaggagggtc 600

tccccttcct cctgcctgca ggacagaaat gacttcgcat tcccccagga ggcgctgggt 660

ggcagccagt tgcagaaggc tcaagccatc tctgtgctcc acgaggtgac ccagcacacc 720

ttccagcttt tcagcacaga gggctcggcc actacgtggg atgagagcct cctggacaag 780

ctccgcgctg cactggatca gcagctcact gacctgcaag cctgtctgag gcaggaggag 840

gagctgcaag gagctcccct gctcaaggag gactccagcc tggctgtgag gaaatacttc 900

cacagactca ctctctatct gcaagagaag aaacacagcc cttgtgcctg ggaggttgtc 960

agagcacaag tcatgagagc cttctcttcc tcaacaaact tgcaggagag tttcaggaga 1020

aaggac 1026

<210> 3

<211> 1026

<212> DNA

<213>Recombinant bovine long-acting interferon α genomes 2

<400> 3

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctaccgg tggtggtggt tctggtggtg gtggttcttg ccacctgccg 540

cacacccact ctctggctaa ccgtcgtgtt ctgatgctgc tgggtcagtt acgtcgtgta 600

agcccgtctt cttgcctgca ggaccgtaac gacttcgctt tcccgcagga agctctgggt 660

ggttctcagc tgcagaaagc tcaggctatc tctgttctgc acgaagttac ccagcacacc 720

ttccagctgt tctctaccga aggttctgct accacctggg acgaatctct gctggacaaa 780

ctgcgtgctg ctctggacca gcagctgacc gacctgcagg cttgcctgcg tcaggaagaa 840

gaactgcagg gtgctccgct gctgaaagaa gactcttctc tggctgttcg taaatacttc 900

caccgtctga ccctgtacct gcaggaaaaa aaacactctc cgtgcgcttg ggaagttgtt 960

cgtgctcagg ttatgcgtgc tttctcttct tctaccaacc tgcaggaatc tttccgtcgt 1020

aaagac 1026

<210> 4

<211> 498

<212> DNA

<213>Bov IFN γ

<400> 4

atgaaatata caagctattt cttagcttta ctgctctgtg ggcttttggg tttttctggt 60

tcttatggcc agggccaatt ttttagagaa atagaaaact taaaggagta ttttaatgca 120

agtagcccag atgtagctaa gggtgggcct ctcttctcag aaattttgaa gaattggaaa 180

gatgaaagtg acaaaaaaat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaatgg cagctctgag aaactggagg acttcaaaaa gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccataa atgaactcat caaagtgatg 420

aatgacctgt caccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaacg 498

<210> 5

<211> 498

<212> DNA

<213>Bov IFN α

<400> 5

tgccacctgc ctcacaccca cagcctggcc aacaggaggg tcctgatgct cctgggacaa 60

ctgaggaggg tctccccttc ctcctgcctg caggacagaa atgacttcgc attcccccag 120

gaggcgctgg gtggcagcca gttgcagaag gctcaagcca tctctgtgct ccacgaggtg 180

acccagcaca ccttccagct tttcagcaca gagggctcgg ccactacgtg ggatgagagc 240

ctcctggaca agctccgcgc tgcactggat cagcagctca ctgacctgca agcctgtctg 300

aggcaggagg aggagctgca aggagctccc ctgctcaagg aggactccag cctggctgtg 360

aggaaatact tccacagact cactctctat ctgcaagaga agaaacacag cccttgtgcc 420

tgggaggttg tcagagcaca agtcatgaga gccttctctt cctcaacaaa cttgcaggag 480

agtttcagga gaaaggac 498

<210> 6

<211> 498

<212> DNA

<213>Bov IFN γ

<400> 6

atgaaataca cctcttactt cctggctctg ctgctgtgcg gtctgctggg tttctctggt 60

tcttacggtc agggtcagtt cttccgtgaa atcgaaaacc tgaaagaata cttcaacgct 120

tcttctccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gacgaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaaaa actgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctacc 498

<210> 7

<211> 498

<212> DNA

<213>Bov IFN α

<400> 7

tgccacctgc cgcacaccca ctctctggct aaccgtcgtg ttctgatgct gctgggtcag 60

ttacgtcgtg taagcccgtc ttcttgcctg caggaccgta acgacttcgc tttcccgcag 120

gaagctctgg gtggttctca gctgcagaaa gctcaggcta tctctgttct gcacgaagtt 180

acccagcaca ccttccagct gttctctacc gaaggttctg ctaccacctg ggacgaatct 240

ctgctggaca aactgcgtgc tgctctggac cagcagctga ccgacctgca ggcttgcctg 300

cgtcaggaag aagaactgca gggtgctccg ctgctgaaag aagactcttc tctggctgtt 360

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aaaaacactc tccgtgcgct 420

tgggaagttg ttcgtgctca ggttatgcgt gctttctctt cttctaccaa cctgcaggaa 480

tctttccgtc gtaaagac 498

Claims (10)

1. a kind of fusion protein being made up of Bov IFN γ and Bov IFN α, it is characterised in that：The amino of the fusion protein Acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

2. a kind of gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, It is designated as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. a kind of recombinant bovine long-acting interferon α, it is characterised in that the recombinant bovine long-acting interferon α is as described in claim 1 It is freeze-dried to form after fusion protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering is obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, purified to can obtain fusion protein afterwards.

7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium be pET-32a/rIFN γ- IFN α, its preparation method is：

(1) design primer, obtained by reverse transcription or the flexible linker sequences of artificial synthesized connection Bov IFN γ and Bov IFN α target gene；Bov IFN γ and Bov IFN α target gene are connected by flexible linker, The nucleotides sequence list of target gene is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or such as SEQUENCE LISTING 400 Shown in the ＞ of ＜ 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/r IFN γs- IFNα。

8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Purified after product elder generation through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. recombinant bovine long-acting interferon α according to claim 5 application, it is characterised in that the recombinant bovine is long-acting dry Plain α long half time is disturbed up to more than 45 hours, with broad-spectrum disease resistance toxic action and Niu Zishen immune response can be improved.