CN107353347A

CN107353347A - A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof

Info

Publication number: CN107353347A
Application number: CN201710676594.1A
Authority: CN
Inventors: 王明丽; 韩国祥; 汪良青; 王利利; 夏兵兵; 何志远; 梅志强; 刘家炉
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2017-08-09
Publication date: 2017-11-17
Also published as: CN108840951A

Abstract

The invention discloses a kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof; the fusion protein is connected by pig albumin, Porcine interferon-gamma and porcine interferon alpha and formed through flexible linker, through being freeze-dried to obtain Recombinant Swine long-acting interferon after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves more than 24 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and Its preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to be disturbed by pig albumin, Porcine interferon-gamma and pig Fusion protein of plain α compositions and preparation method thereof.

Background technology

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease prevention and controls are far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, plus original animal epidemic, aquaculture industry of China is caused huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.

The prevention and treatment approach to porcine viral diseases mainly passes through vaccine inoculation and using antibiotic at present, but by In breeding environment imperfection, virus variation and Abwehrkraft des Koepers change etc. reason, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament, due to medicament residue problem, to the mankind Health is negatively affected；And traditional vaccine, high specific and side effect due to it, virus variation and new can not be resisted The significant damage brought to pig aquaculture continuously emerges in type virus.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and produce more species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA is come the activity that suppresses the growth and breeding of virus and play antitumor grade.Now, it is known that α types IFN in vivo can be selectively The infection cells such as virus are acted on, by suppressing the biosynthesis of the virus protein in infected cell, play wide spectrum and efficiently Antivirus action.It is but faint without acting on or acting on to normal host cell.IFN-α main physiological activity is with suppression virus Duplication, anti parasitic, the killing activity for suppressing various kinds of cell propagation, stimulating immunocyte.

γ types IFN is the T cell and the generation of NK cells by activating, and has relatively strong antiviral and immunoloregulation function.Largely Research shows that interferon gamma also plays the adjustment effect of key in addition to broad-spectrum antiviral function, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to virus infection it is anti- Should, but the immunoregulatory activity of interferon gamma is coordinating immune response and is determining to play more in the long-term antiviral state of body Important effect, therefore interferon gamma has particularly important clinical value.

Seralbumin is the important component of blood plasma, is not easy to pass through glomerulus under normal circumstances, internal distributed pole it is wide and There is no zymetology and immunologic competence, be preferable pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg Linked in the cell through protein translation system by peptide bond in vain, be not required to extra extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after being merged with it；Albumin is one stable " inert protein ", after being merged with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein medicine It can be expected to improve half-life period in blood with Albumin fusion.At present, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period are generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the aspect of molecular weight Part solves the problems, such as that interferon molecule amount is small and causes half-life short, while polyethylene glycol fused interferon cost is very Height, it is unfavorable for clinically applying.

The content of the invention

In order to solve the above technical problems, the invention provides one kind by pig albumin, Porcine interferon-gamma and porcine interferon alpha group Into fusion protein and preparation method thereof, and thus fusion protein with after freeze drying protectant mixture, it is freeze-dried to be prepared into To a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, more commonly The half-life period of pig interferon improves more than 24 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, the amino of the fusion protein Acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of SEQUENCE LISTING400 ＜ 3, it is designated as genome 2.

Fusion protein described in 2 equal codified of the genome 1 and the genome.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after result, be considered as the gene in the expression system during usual codon adaptation indexI CAI=1.0 In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection Existing pig albumin, porcine IFN γ, the codon of pig IFN-α original gene codon adaptation indexI (CAI) point in Escherichia coli Not Wei 0.24,0.24,0.22, GC percentages be 43.7%, 39.2%, 59.1%；And by pig albumin, porcine IFN γ, Obtained after pig IFN-α gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 0.98,1.0,1.0, GC hundred Divide ratio 50.3%, 45.4%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, is avoided rare close Influence of the numeral to protein expression, the G/C content of gene is improved, improves transcription and translation efficiency.

Present invention also offers the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IFN α.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Present invention also offers a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is by described fusion egg In vain with after freeze drying protectant mixture, it is freeze-dried to form.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, the final concentration of three For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, fusion protein is can obtain after purified.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IFN α, and its preparation method is：

(1) primer is designed, obtained by reverse transcription or be manually respectively synthesized the pig albumin with flexible linker sequences, The target gene of Porcine interferon-gamma, porcine interferon alpha；By flexible linker by pig albumin, Porcine interferon-gamma, porcine interferon alpha Target gene connect, the nucleotides sequence list such as ＞ institutes of 400 ＜ of SEQUENCE LISTING 2 of the target gene after connection Show or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb- IFNγ-IFNα。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F1：CATGCCATGGGATACATACAAGAGTGA, with NcoI restriction enzyme sites；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGATCCCTCG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAGTTATACAACTTA, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCTTTTGATGCTCTCTG, with flexible linker；

The primer sequence of porcine interferon alpha (IFN-α) is：

Upstream IFN-α-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGTTCCTATTTAAG, with flexible linker；

Downstream IFN-α-R1：CCCTCGAGCTCCTTCCTCCTG, with XhoI restriction enzyme sites；

B. RNA is extracted from pig liver, the target gene of pig Alb, porcine IFN γ and pig IFN-α is obtained by reverse transcription, The gene order of three respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 4, the ＞ of 400 ＜ of SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

Respectively using pig Alb, porcine IFN γ and pig IFN-α target gene as template, and it is utilized respectively pig Alb, pig IFN- The upstream and downstream primer of γ and pig IFN-α enter performing PCR amplification, respectively obtain the pig Alb for connecting flexible linker, porcine IFN γ and Pig IFN-α gene.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The reaction of the RT-PCR reactions Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is circulated 35 times, last 72 DEG C of extensions 10min.

C. rAlb-IFN γ genes are obtained using flexible linker connection pig Alb and porcine IFN γ target gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IFN are obtained using flexible linker connections rAlb-IFN γ genes and pig IFN-α target gene α genes

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates The μ L of DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-α template DNA 0.5 μ L, the μ of IFN-α anti-sense primer 0.5 L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95 DEG C pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulate；Finally 72 DEG C of extension 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F2：CATGCCATGGTGACACCTACAAATCTG, with NcoI restriction enzyme sites；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGGATACCACG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTCTTACACCACCT, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGCTG, with flexible linker；

Porcine interferon alpha (IFN-α)：

Upstream IFN-α-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTGCTCTTACCTG, with flexible linker；

Downstream IFN-α-R2：

CCCTCGAGTTCTTTACGACGCAG, with XhoI restriction enzyme sites.

B. the target gene of the pig Alb, porcine IFN γ and pig IFN-α, the gene order of three is respectively such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 7, the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9；

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. using flexible linker connections rAlb-IFN γ genes and pig IFN-α target gene obtain rAlb-IFN γ- IFN-α gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates The μ L of DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-α template DNA 0.5 μ L, the μ of IFN-α anti-sense primer 0.5 L, Taq archaeal dna polymerase 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction conditions is：95 DEG C pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulate；Finally 72 DEG C of extension 10min.

Present invention also offers the application of the Recombinant Swine long-acting interferon, its long half time had up to more than 98 hours Broad-spectrum disease resistance toxic action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig Alb, porcine IFN γ and pig IFN-α gene are realized into amalgamation and expression by flexible linker, interference is improved Plain half-life period, compared with plain interferon, improve more than 24 times；

2. by being optimized to pig Alb, porcine IFN γ and pig IFN-α gene, pig Alb, porcine IFN γ and pig are improved The expression quantity of IFN-α fusion protein.

3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IFN α as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduce the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of pig Alb, porcine IFN γ and pig IFN-α not only has IFN-α Broad-spectrum disease resistance toxic action, while significantly improve the immune response of pig itself.

Brief description of the drawings

Fig. 1 is that pig albumin gene, porcine interferon alpha gene and Porcine interferon-gamma gene RT-PCR in embodiment 1 are expanded Result；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Porcine interferon-gamma gene RT-PCR amplified productions；Swimming lane 2：Pig does Disturb plain α genes RT-PCR amplified productions；Swimming lane 3：Pig albumin gene RT-PCR amplified productions；

Fig. 2 is the result of the PCR amplifications after pig Alb, the IFN-γ in embodiment 1 connect with the target gene of IFN-α； Swimming lane M：DNA Marker DL10000；Swimming lane 1：Pig albumin gene, Porcine interferon-gamma gene are connected with porcine interferon alpha gene Amplified production；

Fig. 3 is PCR amplifications and the double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations results of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Precipitated after recombinant bacterium induction is broken；Swimming lane 2：Supernatant after recombinant bacterium induction is broken；

Fig. 6 is that the Recombinant Swine long-acting interferon α as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 is that the Recombinant Swine long-acting interferon α of gradient dilution (from right to left) handles hole；

Fig. 7 is the Recombinant Swine long-acting interferon α intramuscular injection blood as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time changing curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, its preparation method are as follows：

1. the acquisition of pig albumin (Alb), Porcine interferon-gamma (IFN-γ) and porcine interferon alpha (IFN-α) target gene with Amplification

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upstream of pig albumin NcoI restriction enzyme sites and Linker sequences are introduced in primer and anti-sense primer respectively, sense primer and downstream in Porcine interferon-gamma Linker sequences are introduced in primer respectively, Linker sequences are introduced respectively in the sense primer and anti-sense primer of porcine interferon alpha With XhoI restriction enzyme sites.

Table 1PCR amplimers

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, the purpose base of pig Alb, porcine IFN γ and pig IFN-α is obtained by reverse transcription Cause, the gene order of three respectively such as the ＞ of 400 ＜ of SEQUENCE LISTING 4, the ＞ of 400 ＜ of SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

RT-PCR reaction systems (25 μ L) are shown in Table 2

Table 2RT-PCR reaction systems

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1780bp, 560bp and 710bp or so in RT-PCR amplified productions, Its result as shown in figure 1, explanation be prepared respectively the pig Alb for being connected to flexible linker sequences, porcine IFN γ and The target gene of pig IFN-α.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

Table 3rAlb-IFN γ PCR reaction systems

Table 4rAlb-IFN γ-IFN α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2990bp or so in pcr amplification product, its result as shown in Fig. 2 Occur rAlb-IFN γ and IFN-α amplified production band in Fig. 2, because being connected in rAlb-IFN γ with IFN-α gene During, there is non-specific responding.The nucleotide sequence of the obtained target gene such as ＞ of 400 ＜ of SEQUENCE LISTING 2 It is shown.

3. expression vector establishment

For target gene after selection connection after sequencing is errorless, PCR glue reclaims product uses NcoI with pET-32a plasmids Double digestion and recovery are carried out with XhoI restriction enzymes, double digestion is done by 20 μ L systems in table 5：

The double digestion system of table 5

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recovery fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 6,4 DEG C overnight connection：

The enzyme disjunctor system of table 6

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plates of penicillin are incubated overnight；Single bacterium colony on picking LB flat boards carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through NcoI and XhoI double digestions, is accredited as positive and is represented that engineering bacteria successfully constructs, PCR amplifications and double digestion production Thing detects single band through agarose gel electrophoresis at 2990bp or so places, and its result is as shown in figure 3, illustrate successfully to obtain PET-32a/rAlb-IFN γ-IFN α engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, its result is as shown in figure 4, it can be seen that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in 127.8KD or so places after leading the bacterial cell disruption after 5h, illustrates in precipitation and supernatant In equal successful expression fusion proteins.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns that have been balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IFN α protein peak.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, DEAE anion exchange chromatography that loading has balanced by using Binding Buffer II, then After crossing post to A280nm value stabilizations with Binding Buffer II, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IFN α protein peak.

5.3 sieve chromatography

Loading is by using (the 50mM of Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, washed with Binding Buffer III It is de-, collect rAlb-IFN γ-IFN α protein peak.

5.4 sample identification

Determine rAlb-IFN γ-IFN α potency and specific activity, specific activity >=10⁵IU/mg, albumen are qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.The i.e. available fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, its amino acid sequence As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, other are with embodiment 1 E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmids is thin Born of the same parents.The SDS-PAGE electrophoresis results of its fusion protein compare with embodiment 1,127.8KD or so places predominant expression bar in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in bacterial strain is expressed, collaboration Expressing protein correctly folds, and reaches solubility expression of protein.

Embodiment 3

Pig Alb in embodiment 1, porcine IFN γ and pig IFN-α are optimized, artificially synthesized pig Alb, porcine IFN γ and Pig IFN-α target gene, after optimization, the nucleotide sequence of three is respectively such as 400 ＜ of SEQUENCE LISTING 7 ＞, SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to pig Alb, porcine IFN γ and Pig IFN-α gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered as the gene during usual codon adaptation indexI (CAI)=1.0 Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, it can influence translation and transcriptional efficiency more than the scope in any region.Pig Alb, pig are found using software detection The codon of IFN-γ and pig IFN-α original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24, 0.24th, 0.22, GC percentages are 43.7%, 39.2%, 59.1%；And by pig Alb, porcine IFN γ and pig IFN-α gene Obtained after optimization recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.98,1.0,1.0, GC percentages 50.3%th, 45.4%, 55.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression, the G/C content of gene is improved, improve transcription and translation efficiency.

1.3 design of primers：

Table 7PCR amplimers

The genomic DNA of pig Alb after optimization, porcine IFN γ and pig IFN-α is diluted to 0.05mg/mL respectively.Utilize PCR amplifications obtain target gene, and 25 μ L reaction systems are as shown in table 8：

Table 8PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Pig Alb, porcine IFN γ and pig IFN-α pcr amplification product through agarose gel electrophoresis respectively 1780bp, There is specific band in 560bp and 710bp or so, illustrate the pig for being connected to flexible linker after optimization has been prepared Alb, porcine IFN γ and pig IFN-α target gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

Table 9rAlb-IFN γ PCR reaction systems

Table 10rAlb-IFN γ-IFN-α PCR reaction systems

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band in 2990bp or so through agarose gel electrophoresis and illustrates successfully to be connected in pcr amplification product RAlb-IFN γ-IFN-α gene afterwards.The nucleotide sequence of the obtained target gene such as ＞ of 400 ＜ of SEQUENCE LISTING 3 It is shown.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids NcoI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 11：

The double digestion system of table 11

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB flat boards of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid warp through PCR NcoI, XhoI double digestion are identified, are accredited as positive and are represented expression vector establishment success, PCR amplifications and double digestion product are through fine jade There is single band at 2990bp or so places in sepharose electrophoresis, illustrates containing rAlb-IFN γ-IFN α fusion gene engineering bacterium PET-32a/rAlb-IFN γ-IFN α successfully constructs.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, in LB culture mediums Amplification culture 4h (OD=1.0) in (the μ g/ml containing ampicillin 100), adds final concentration of 100 μ g/ml IPTG, 32 DEG C lure Lead expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in 127.8KD or so places, illustrate to have obtained recombinant protein in supernatant precipitates.

5. fusion protein purification

5.1His affinity chromatography

5.2DEAE anion-exchange chromatography

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, with Binding Buffer III elution, collects rAlb-IFN γ-IFN α protein peak.

5.4 sample identification

Determine rAlb-IFN γ-IFN α potency and specific activity, specific activity >=10⁵IU/mg, albumen are qualified；Sterile point Dress, -80 DEG C of preservations.The i.e. available fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, its amino acid Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 4

A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, other are with embodiment 3 E. coli bl21 therein (DE3) competent cell is replaced in order to which BL21 (DE3) competence with pGro7 plasmids is thin Born of the same parents.The SDS-PAGE electrophoresis results of its fusion protein compare with embodiment 3,127.8KD or so places predominant expression bar in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein amount It is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in bacterial strain is expressed, collaboration Expressing protein correctly folds, and reaches solubility expression of protein.

Embodiment 5

A kind of Recombinant Swine long-acting interferon α, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 obtains the identification for the fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha

The quantitative detection of 6.1 protein contents

With Lowry methods, the standard protein that institute is examined and determine with Chinese food pharmaceutical biological product is made standard test, determines embodiment 1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 127.8KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-porcine alpha-IFN (1 of abcam companies mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon α samples can be with anti-pig interferon Alpha monoclonal antibodies occur specific reaction, 127.8KD or so place and specific band occur, as shown in Figure 5.

Embodiment 7

Bioactivity freeze-dried four parts of Recombinant Swine long-acting interferon α in embodiment 5

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, adds the Recombinant Swine length of various dose Interferon-' alpha ' is imitated, inhales and abandons after 24h, then is inoculated with 100TCID50VSV viruses respectively.

Result of the test

As a result the Recombinant Swine long-acting interferon α for showing to obtain causes the lesion of HEp-2 cells to have obvious suppress to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the Recombinant Swine length obtained After imitating the cell virus inoculation after interferon-' alpha ' processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not go out incumbent What lesion, measures potency >=10⁵IU/ml, as shown in Figure 6.

Embodiment 8

The four parts of Recombinant Swine long-acting interferon α obtained respectively by the fusion protein of embodiment 1~4 in embodiment 5 are freezed The measure of half-life period of the agent (being designated as A, B, C, D respectively) in pig body

The blood concentration and time relationship of cytopathic-effect inhibition assay measure rAlb-IFN γ-IFN α

The pig (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml Recombinant Swine long-acting interferons α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 2h, 4h, 8h, 16h, 26h, 44h, 79h, 144h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm Low-temperature centrifugation 10min separates serum, and each every pig blood sample of time point is to be measured in -20 DEG C of preservations.Determined using cytopathic-effect inhibition assay The concentration of rAlb-IFN γ-IFN α in blood serum sample, carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter meter Calculation the results are shown in Table 13.

Dominant dynamic parameters in serum after the Recombinant Swine long-acting interferon α intramuscular injection of table 13

As a result show that Recombinant Swine long-acting interferon α has longer half-life period.Half-life period can reach 98h or so after measured, compared with Plain interferon improves about 24 times.

Embodiment 9

The freeze-dried measure influenceed on pig cell immune response of four parts of Recombinant Swine long-acting interferon α in embodiment 5

Take six roughly the same pork pigs of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml Recombinant Swine long-acting interferon freeze-dried 2ml of α are penetrated, 2mL PBS is subcutaneously injected in control group neck, takes after injecting 4 weeks outside pig All blood, take a blood weekly afterwards, separate lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI After 1640 culture mediums wash 2 times, it is resuspended with complete medium, adjusts cell concentration as 2 × 10⁶Individual/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-2, IL-4 content, is carried out, testing result is as shown in table 14 by kit specification：

Table 14ELISA detection each group pig cell immune responses are horizontal

As a result show after injecting Recombinant Swine long-acting interferon α, can significantly improve cell factor IL-2 in pig peripheral blood, IL-4 content, cellullar immunologic response level is enhanced, significantly improves immunity level.

It is above-mentioned with reference to embodiment to a kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and The detailed description that its preparation method is carried out, is illustrative rather than limited, can be included according to limited scope some Individual embodiment, therefore changing and modifications in the case where not departing from present general inventive concept, should belong within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 995

<212> PRT

<213>Pig albumin-interferon gamma-interferon alpha fusion protein

<400> 1

Asp Thr Tyr Lys Ser Glu Ile Ala His Arg Phe Lys Asp Leu Gly Glu

1 5 10 15

Gln Tyr Phe Lys Gly Leu Val Leu Ile Ala Phe Ser Gln His Leu Gln

20 25 30

Gln Cys Pro Tyr Glu Glu His Val Lys Leu Val Arg Glu Val Thr Glu

35 40 45

Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys

50 55 60

Ser Ile His Thr Leu Phe Gly Asp Lys Leu Cys Ala Ile Pro Ser Leu

65 70 75 80

Arg Glu His Tyr Gly Asp Leu Ala Asp Cys Cys Glu Lys Glu Glu Pro

85 90 95

Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asn Asp Asn Pro Asp Ile

100 105 110

Pro Lys Leu Lys Pro Asp Pro Val Ala Leu Cys Ala Asp Phe Gln Glu

115 120 125

Asp Glu Gln Lys Phe Trp Gly Lys Tyr Leu Tyr Glu Ile Ala Arg Arg

130 135 140

His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Tyr Tyr Ala Ile Ile Tyr

145 150 155 160

Lys Asp Val Phe Ser Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys

165 170 175

Leu Leu Pro Lys Ile Glu His Leu Arg Glu Lys Val Leu Thr Ser Ala

180 185 190

Ala Lys Gln Arg Leu Lys Cys Ala Ser Ile Gln Lys Phe Gly Glu Arg

195 200 205

Ala Phe Lys Ala Trp Ser Leu Ala Arg Leu Ser Gln Arg Phe Pro Lys

210 215 220

Ala Asp Phe Thr Glu Ile Ser Lys Ile Val Thr Asp Leu Ala Lys Val

225 230 235 240

His Lys Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg

245 250 255

Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Thr Ile Ser Thr

260 265 270

Lys Leu Lys Glu Cys Cys Asp Lys Pro Leu Leu Glu Lys Ser His Cys

275 280 285

Ile Ala Glu Ala Lys Arg Asp Glu Leu Pro Ala Asp Leu Asn Pro Leu

290 295 300

Glu His Asp Phe Val Glu Asp Lys Glu Val Cys Lys Asn Tyr Lys Glu

305 310 315 320

Ala Lys His Val Phe Leu Gly Thr Phe Leu Tyr Glu Tyr Ser Arg Arg

325 330 335

His Pro Asp Tyr Ser Val Ser Leu Leu Leu Arg Ile Ala Lys Ile Tyr

340 345 350

Glu Ala Thr Leu Glu Asp Cys Cys Ala Lys Glu Asp Pro Pro Ala Cys

355 360 365

Tyr Ala Thr Val Phe Asp Lys Phe Gln Pro Leu Val Asp Glu Pro Lys

370 375 380

Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Lys Leu Gly Glu Tyr

385 390 395 400

Gly Phe Gln Asn Ala Leu Ile Val Arg Tyr Thr Lys Lys Val Pro Gln

405 410 415

Val Ser Thr Pro Thr Leu Val Glu Val Ala Arg Lys Leu Gly Leu Val

420 425 430

Gly Ser Arg Cys Cys Lys Arg Pro Glu Glu Glu Arg Leu Ser Cys Ala

435 440 445

Glu Asp Tyr Leu Ser Leu Val Leu Asn Arg Leu Cys Val Leu His Glu

450 455 460

Lys Thr Pro Val Ser Glu Lys Val Thr Lys Cys Cys Thr Glu Ser Leu

465 470 475 480

Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Thr Pro Asp Glu Thr Tyr

485 490 495

Lys Pro Lys Glu Phe Val Glu Gly Thr Phe Thr Phe His Ala Asp Leu

500 505 510

Cys Thr Leu Pro Glu Asp Glu Lys Gln Ile Lys Lys Gln Thr Ala Leu

515 520 525

Val Glu Leu Leu Lys His Lys Pro His Ala Thr Glu Glu Gln Leu Arg

530 535 540

Thr Val Leu Gly Asn Phe Ala Ala Phe Val Gln Lys Cys Cys Ala Ala

545 550 555 560

Pro Asp His Glu Ala Cys Phe Ala Val Glu Gly Pro Lys Phe Val Ile

565 570 575

Glu Ile Arg Gly Ile Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly

580 585 590

Ser Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu Cys Val Thr

595 600 605

Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe Lys Glu Ile

610 615 620

Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly Val Pro Asn

625 630 635 640

Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys Glu Glu Ser

645 650 655

Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe

660 665 670

Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser Met Asp Val

675 680 685

Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Gly Lys

690 695 700

Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp Asn Leu Gln

705 710 715 720

Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met Asn Asp Leu

725 730 735

Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Thr Met Phe

740 745 750

Gln Gly Gln Arg Ala Ser Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly

755 760 765

Ser Met Cys Ser Tyr Leu Arg His Arg Pro Glu Gly Arg Ser Ser Asn

770 775 780

Ile Leu Glu Ser Arg Val Thr Glu Ser Pro Thr Ser Ala Arg Thr Ala

785 790 795 800

Ala Ser Ala Arg Ser Pro Met Ala Pro Thr Ser Ala Phe Leu Thr Ala

805 810 815

Leu Val Leu Leu Ser Cys Asn Ala Ile Cys Ser Leu Gly Cys Asp Leu

820 825 830

Pro Gln Thr His Ser Leu Ala His Thr Arg Ala Leu Arg Leu Leu Ala

835 840 845

Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Asp His Arg Arg Asp

850 855 860

Phe Gly Phe Pro Gln Glu Ala Leu Gly Gly Asn Gln Val Gln Lys Ala

865 870 875 880

Gln Ala Met Ala Leu Val His Glu Met Leu Gln Gln Thr Phe Gln Leu

885 890 895

Phe Ser Thr Glu Gly Ser Ala Ala Ala Trp Asp Glu Ser Leu Leu His

900 905 910

Gln Phe Cys Thr Gly Leu Asp Gln Gln Leu Arg Asp Leu Glu Ala Cys

915 920 925

Val Met Gln Glu Ala Gly Leu Glu Gly Thr Pro Leu Leu Glu Glu Asp

930 935 940

Ser Ile Leu Ala Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr Leu

945 950 955 960

Gln Glu Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val Arg Ala Glu

965 970 975

Val Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp Arg Leu Arg

980 985 990

Arg Lys Glu

995

<210> 2

<211> 2985

<212> DNA

<213>Genome 1

<400> 2

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagccg gtggtggtgg ttctggtggt ggtggttcta tgagttatac aacttatttc 1800

ttagcttttc agctttgcgt gactttgtgt ttttctggct cttactgcca ggcgcccttt 1860

tttaaagaaa taacgatcct aaaggactat tttaatgcaa gtacctcagg tgtacctaat 1920

ggtggacctc ttttcttaga aattttggag aattggaaag aggagagtga caaaaaaata 1980

attcagagcc aaattgtctc cttctacttc aaattctttg aaatcttcaa agataaccag 2040

gccattcaaa ggagcatgga tgtgatcaag caagacatgt ttcagaggtt cctaaatggt 2100

agctctggga aactgaatga cttcgaaaag ctggttaaaa ttccggtaga taatctgcag 2160

atccagcgca aagccatcag tgaactcatc aaagtgatga atgatctgtc accaagatct 2220

aacctaagaa agcggaagag aagtcagact atgttccaag gccagagagc atcaaaaggt 2280

ggtggtggtt ctggtggtgg tggttctatg tgttcctatt taagacacag gcctgaggga 2340

aggtcttcaa acatcctaga gagcagggtc acagagtcac ccacctcagc caggacagca 2400

gcatctgcaa ggtccccaat ggccccaacc tcagccttcc tcacggccct ggtgctgctc 2460

agctgcaatg ccatctgctc tctgggctgc gacctgcctc agacccacag cctggctcac 2520

accagggccc tgaggctcct ggcacaaatg aggagaatct cccccttctc ctgcctggac 2580

cacagaaggg actttggatt cccccaagag gccttggggg gcaaccaggt ccagaaggct 2640

caagccatgg ctctggtgca tgagatgctc cagcagacct tccagctctt cagcacagag 2700

ggctcggctg ctgcctggga tgagagcctc ctgcaccagt tctgcactgg actggatcag 2760

cagctcaggg acctggaagc ctgtgtcatg caggaggccg ggctggaagg gacccccctg 2820

ctggaggagg actccatcct ggctgtgagg aaatacttcc acagactcac cctctatctg 2880

caagagaaga gctacagccc ctgtgcctgg gagatcgtca gggcagaagt catgagagcc 2940

ttctcttcct ccacaaacct gcaagacaga ctcaggagga aggag 2985

<210> 3

<211> 2985

<212> DNA

<213>Genome 2

<400> 3

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggctg gtggtggtgg ttctggtggt ggtggttcta tgtcttacac cacctacttc 1800

ctggctttcc agctgtgcgt taccctgtgc ttctctggtt cttactgcca ggctccgttc 1860

ttcaaagaaa tcaccatcct gaaagactac ttcaacgctt ctacctctgg tgttccgaac 1920

ggtggtccgc tgttcctgga aatcctggaa aactggaaag aagaatctga caaaaaaatc 1980

atccagtctc agatcgtttc tttctacttc aaattcttcg aaatcttcaa agacaaccag 2040

gctatccagc gttctatgga cgttatcaaa caggacatgt tccagcgttt cctgaacggt 2100

tcttctggta aactgaacga cttcgaaaaa ctggttaaaa tcccggttga caacctgcag 2160

atccagcgta aagctatctc tgaactgatc aaagttatga acgacctgtc tccgcgttct 2220

aacctgcgta aacgtaaacg ttctcagacc atgttccagg gtcagcgtgc ttctaaaggt 2280

ggtggtggtt ctggtggtgg tggttctatg tgctcttacc tgcgtcaccg tccggaaggt 2340

cgttcttcta acatcctgga atctcgtgtt accgaatctc cgacctctgc tcgtaccgct 2400

gcttctgctc gttctccgat ggctccgacc tctgctttcc tgaccgctct ggttctgctg 2460

tcttgcaacg ctatctgctc tctgggttgc gacctgccgc agacccactc tctggctcac 2520

acccgtgctc tgcgtctgct ggctcagatg cgtcgtatct ctccgttctc ttgcctggac 2580

caccgtcgtg acttcggttt cccgcaggaa gctctgggtg gtaaccaggt tcagaaagct 2640

caggctatgg ctctggttca cgaaatgctg cagcagacct tccagctgtt ctctaccgaa 2700

ggttctgctg ctgcttggga cgaatctctg ctgcaccagt tctgcaccgg tctggaccag 2760

cagctgcgtg acctggaagc ttgcgttatg caggaagctg gtctggaagg taccccgctg 2820

ctggaagaag actctatcct ggctgttcgt aaatacttcc accgtctgac cctgtacctg 2880

caggaaaaat cttactctcc gtgcgcttgg gaaatcgttc gtgctgaagt tatgcgtgct 2940

ttctcttctt ctaccaacct gcaggaccgt ctgcgtcgta aagaa 2985

<210> 4

<211> 1749

<212> DNA

<213>Pig albumin

<400> 4

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagcc 1749

<210> 5

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 5

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 6

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 6

atgtgttcct atttaagaca caggcctgag ggaaggtctt caaacatcct agagagcagg 60

gtcacagagt cacccacctc agccaggaca gcagcatctg caaggtcccc aatggcccca 120

acctcagcct tcctcacggc cctggtgctg ctcagctgca atgccatctg ctctctgggc 180

tgcgacctgc ctcagaccca cagcctggct cacaccaggg ccctgaggct cctggcacaa 240

atgaggagaa tctccccctt ctcctgcctg gaccacagaa gggactttgg attcccccaa 300

gaggccttgg ggggcaacca ggtccagaag gctcaagcca tggctctggt gcatgagatg 360

ctccagcaga ccttccagct cttcagcaca gagggctcgg ctgctgcctg ggatgagagc 420

ctcctgcacc agttctgcac tggactggat cagcagctca gggacctgga agcctgtgtc 480

atgcaggagg ccgggctgga agggaccccc ctgctggagg aggactccat cctggctgtg 540

aggaaatact tccacagact caccctctat ctgcaagaga agagctacag cccctgtgcc 600

tgggagatcg tcagggcaga agtcatgaga gccttctctt cctccacaaa cctgcaagac 660

agactcagga ggaaggag 678

<210> 7

<211> 1749

<212> DNA

<213>Pig albumin

<400> 7

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggct 1749

<210> 8

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 8

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

<210> 9

<211> 678

<212> DNA

<213>Pig IFN-α

<400> 9

atgtgctctt acctgcgtca ccgtccggaa ggtcgttctt ctaacatcct ggaatctcgt 60

gttaccgaat ctccgacctc tgctcgtacc gctgcttctg ctcgttctcc gatggctccg 120

acctctgctt tcctgaccgc tctggttctg ctgtcttgca acgctatctg ctctctgggt 180

tgcgacctgc cgcagaccca ctctctggct cacacccgtg ctctgcgtct gctggctcag 240

atgcgtcgta tctctccgtt ctcttgcctg gaccaccgtc gtgacttcgg tttcccgcag 300

gaagctctgg gtggtaacca ggttcagaaa gctcaggcta tggctctggt tcacgaaatg 360

ctgcagcaga ccttccagct gttctctacc gaaggttctg ctgctgcttg ggacgaatct 420

ctgctgcacc agttctgcac cggtctggac cagcagctgc gtgacctgga agcttgcgtt 480

atgcaggaag ctggtctgga aggtaccccg ctgctggaag aagactctat cctggctgtt 540

cgtaaatact tccaccgtct gaccctgtac ctgcaggaaa aatcttactc tccgtgcgct 600

tgggaaatcg ttcgtgctga agttatgcgt gctttctctt cttctaccaa cctgcaggac 660

cgtctgcgtc gtaaagaa 678

Claims

A kind of 1. fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha, it is characterised in that：The fusion The amino acid sequence table of albumen is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.
A kind of 2. gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3, It is designated as genome 2.
3. the expression vector containing gene as claimed in claim 2.
4. the genetic engineering bacterium containing gene as claimed in claim 2.
5. a kind of Recombinant Swine long-acting interferon, it is characterised in that the Recombinant Swine long-acting interferon is as melting described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.
6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, and fusion protein is can obtain after purified.
7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IFN α, its preparation method are：

(1) primer is designed, is obtained by reverse transcription or is manually respectively synthesized the pig albumin with flexible linker sequences, pig does Disturb the target gene of plain γ, porcine interferon alpha；By flexible linker by pig albumin, Porcine interferon-gamma, porcine interferon alpha mesh Gene connect, the nucleotides sequence list of the target gene after connection as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2 or As shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-IFN γ-IFNα。
8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.
9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Product successively purify through affinity chromatography, anion-exchange chromatography and sieve chromatography.
10. the application of Recombinant Swine long-acting interferon according to claim 5, it is characterised in that the Recombinant Swine is long-acting dry The long half time of element is disturbed up to more than 98 hours, there is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.