CN107245109A - A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 and preparation method thereof - Google Patents

Abstract

The invention discloses a kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 and preparation method thereof; the fusion protein is formed by sheep albumin, sheep interferon gamma and sheep interleukin 2 through flexible linker connections, and fusion protein through being freeze-dried to obtain after freeze drying protectant mixture with recombinating sheep long-acting interferon.The restructuring sheep long-acting interferon is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon improves more than 17 times, and with broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

A kind of fusion egg being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 Bletilla its preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to thin in vain by sheep albumin, sheep interferon gamma and sheep Fusion protein that born of the same parents' interleukin 2 is constituted and preparation method thereof.

Background technology

The animal infectious disease as caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the most country of sheep breeding stock, the amount of delivering for sale, Mutton yield in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry.With the sustainable development of sheep aquaculture, the problem of inevitably facing disease caused by virus, domestic animals disease Huge economic loss is not only caused to sheep culturist, more seriously, some Zoonosis communicable diseases return the mankind Health care belt carrys out potential threat.

The preventing and treating of current sheep class communicable disease mainly uses vaccine immunity and drug therapy, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling can use, and some viruses may also directly jeopardize the health of the mankind.

Conventional drug therapy is mainly treated using antibiotic, but extensive and a large amount of due to antibiotic in recent years Use, cause endurance strain largely to produce, and given people by food chain infection, bigger threat is carried out to mankind's health care belt.It is existing In some countries, oneself prohibites the application of some antibiotic and antiseptic in aquaculture.Therefore, using interferon actively It will be the problem of mankind pay close attention to the most to treat and prevent domestic animal, the viral disease of poultry.

IFN is that the infection induced body of a viroid is produced with broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven, Issacs and Lindeman had found first, and it is the multi-functional cell factor of a class, with cell receptor knot After conjunction, it can induce body and produce many species-specific proteins and enzyme, mainly by suppressing viral gene transcription and degraded virus RNA suppresses the growth and breeding of virus and plays the activity of antitumor grade.It is existing, it is known that γ types IFN be T cell by activating and NK cells are produced, with relatively strong antiviral and immunoloregulation function.Numerous studies show that interferon gamma is except with broad-spectrum disease resistance Outside malicious function, the adjustment effect of key is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of type can mediated cell to virus infection reaction, but interferon gamma immunoregulatory activity coordinate exempt from Epidemic disease is reacted and determines to play even more important effect in the long-term antiviral state of body, thus interferon gamma have it is particularly important Clinical value.

Cell factor IL-2 is interleukin 2, also known as SCIF.The main T lymphocytes by activating are produced The cell factor with extensive bioactivity, can both promote lymphopoiesis, strengthen immunologic function, but can restricted T it is thin Born of the same parents react and strengthen the immune tolerance of body, therefore available for treatment tumour, infectious diseases and autoimmune disease.In animal doctor In, because IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy Strengthen the immune level of body, improve the resistance against diseases of body, thus exempt from for bacillary, viral and parasitic diseases Epidemic disease is treated.In addition, IL-2 can also influence the metabolism of medicine, make the metabolism time lengthening of medicine, action time increase, so as to improve Curative effect of medication.IL-2, according to gene constructed, constitutes fusion protein with other cell factors, is produced and is carried with the antibody for strengthening vaccine High cellular immune level.

Seralbumin is the important component of blood plasma, is difficult to pass through glomerulus under normal circumstances, internal distributed pole it is wide and There is no zymetology and immunologic competence, be preferable pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg Linked in the cell through protein translation system by peptide bond in vain, be not required to extra extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after being merged with it；Albumin is one stable " inert protein ", after being merged with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein medicine It can be expected to improve half-life period in blood with Albumin fusion.At present, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

The limitation of natural interferon and the current generally existing half-life short of artificial recombination interferon, half-life period is generally 2-4 Individual hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and financial cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for causing adverse reaction.The main cause of half-life short There are two：The too small tachytrophism in vivo of molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, the layer only in molecular weight Partly solved on face interferon molecule amount it is small and the problem of cause half-life short.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the aspect of molecular weight Part solve interferon molecule amount it is small and the problem of cause half-life short, while polyethylene glycol fused interferon cost is very Height, is unfavorable for clinically applying.

The content of the invention

In order to solve the above technical problems, being situated between the invention provides one kind by sheep albumin, sheep interferon gamma and sheep leucocyte Fusion proteins and preparation method thereof of the composition of element 2, and thus fusion protein with after freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of restructuring sheep long-acting interferon, the restructuring sheep long-acting interferon is remarkably improved the half-life period of sheep interferon, compared with The half-life period of common sheep interferon improves more than 17 times, and with broad-spectrum disease resistance toxic action and can improve the immune of sheep itself and answer Answer.

The technical scheme that the present invention takes is：

A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, the fusion protein Amino acid sequence table is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Present invention also offers the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in the ＞ of 400 ＜ of LISTING 2, genome 1 is designated as；Or as shown in the ＞ of SEQUENCE LISTING400 ＜ 3, it is designated as genome 2.

Fusion protein described in the equal codified of the genome 1 and the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after result, be considered as the gene during usual codon adaptation indexI CAI=1.0 in the expression system In be optimal high efficient expression state, CAI values are lower to show that expression is lower in host.Most preferable point of G/C content in gene Cloth scope is 30~70%, and the scope is exceeded in any region can influence translation and transcriptional efficiency.Sent out using software detection Now the codon of sheep albumin, sheep IFN-γ, sheep IL-2 original genes codon adaptation indexI (CAI) in Escherichia coli is distinguished It is 44.0%, 40.9%, 54.0% for 0.23,0.25,0.27, GC percentages；And by sheep albumin, sheep IFN-γ, sheep Obtained after IL-2 gene optimizations each gene in Escherichia coli codon adaptation indexI (CAI) be 0.99,1.0,1.0, GC percentages Than 50.1%, 44.1%, 53.0%.Significantly reduce the utilization rate of low codon by gene optimization, it is to avoid rare codon Influence of the son to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.

Present invention also offers the expression vector containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2.

Present invention also offers the genetic engineering bacterium containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2.

Host cell containing genome 1 or genome 2 falls within protection scope of the present invention, further, the place Chief cell is e. coli host cell, further, and the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmids.

Sheep long-acting interferon is recombinated present invention also offers one kind, the restructuring sheep long-acting interferon is by described fusion egg In vain with after freeze drying protectant mixture, it is freeze-dried to form.

The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution, the final concentration of three with 10mmol/L PBS For glycerine 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation method of the fusion protein, the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG induced expressions, it is purified to can obtain fusion protein afterwards.

The expression vector is the pET-32a coli expression carriers containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, and its preparation method is：

(1) primer is designed, the white egg of sheep for connecting flexible linker sequences is obtained or be manually respectively synthesized by reverse transcription In vain, sheep interferon gamma, the target gene of sheep interleukin 2；By flexible linker by sheep albumin, sheep interferon gamma, sheep The target gene of interleukin 2 is connected, the nucleotides sequence list such as SEQUENCE of the target gene after connection Shown in the ＞ of 400 ＜ of LISTING 2 or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb- IFNγ-IL2。

The e. coli host cell is BL21 (DE3) competent cells or BL21 (DE3) senses with pGro7 plasmids By state cell.

The method of the purifying is：Through affinity chromatography, anion-exchange chromatography and molecular sieve after the crude product elder generation of fusion protein Chromatographic purifying.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. is V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F1：CCGGAATTCATGAAGTGGGTGACT, with EcoRI restriction enzyme sites；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGGCTGCTT, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACAAGCTC, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCCATTGATGCTCTCCG, with flexible linker；

The primer sequence of sheep interleukin 2 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAGATACAACCC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCATTGTTGAGTAGAT, with XhoI restriction enzyme sites；

B. RNA is extracted from sheep liver, sheep Alb, sheep IFN-γ and sheep IL-2 target gene, three are obtained by reverse transcription The gene order of person respectively as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 and Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 6；

Respectively using sheep Alb, sheep IFN-γ and sheep IL-2 target gene as template, and it is utilized respectively sheep Alb, sheep IFN-γ Enter performing PCR amplification with sheep IL-2 upstream and downstream primer.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of template ribonucleic acid 1.5, upstream and downstream primer each 0.5 μ L, reverse transcriptase 2.5 μ L, dNTP Mix are 10 μ L, plus RNase Free water is to 25 μ L；The reaction condition of the RT-PCR reactions For：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, is circulated 35 times, last 72 DEG C of extensions 10min.

C. rAlb-IFN γ genes are obtained using flexible linker connection sheep Alb and sheep IFN-γ target gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IL2 are obtained using flexible linker connections rAlb-IFN γ genes and sheep IL-2 target gene Gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates The μ L of DNA 1, connect the flexible linker μ L of 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 anti-sense primer 0.5, Taq archaeal dna polymerases 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C extension 10min.

Genome 2 is artificial synthesized gene after being optimized to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep albumin (Alb) is：

Upstream Alb-F2：CCGGAATTCATGAAATGGGTTACCTT, with EcoRI restriction enzyme sites；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGAGCAGCC, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTCT, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCCATAGAAGCACGACG, with flexible linker；

Sheep interleukin 2 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATCCAGCC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCATGGTAGAGTAGA, with XhoI restriction enzyme sites.

B. the sheep Alb, sheep IFN-γ and sheep IL-2 target gene, the gene order of three is respectively such as SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 7 ＞, SEQUENCE LISTING, 400 ＜, 8 ＞ and SEQUENCE LISTING 9；

Respectively using sheep Alb, sheep IFN-γ and sheep IL-2 target gene as template, and it is utilized respectively sheep Alb, sheep IFN-γ Enter performing PCR amplification with sheep IL-2 upstream and downstream primer.

PCR reaction systems and condition are：In 25 μ L overall reaction system, the μ L of genomic DNA 1, upstream and downstream primer is each 0.5 μ L, reverse transcriptase 2.5 μ L, Taq archaeal dna polymerase is 10 μ L, plus RNase Free water is to 25 μ L；The RT-PCR reactions Reaction condition is：95 DEG C of pre-degeneration 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, are followed Ring 35 times, last 72 DEG C of extensions 10min.

C. flexibility linker connection sheep Alb and sheep IFN-γ target gene rAlb-IFN γ genes are utilized

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, connect flexible linker's The μ L of Alb gene templates DNA 1, connect flexible linker 1 μ L, Alb sense primer of IFN-γ template DNA 0.5 μ L, IFN- 0.5 μ L, Taq archaeal dna polymerase of γ anti-sense primers 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connection PCR reaction conditions are：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 circulations；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IL2 are obtained using flexible linker connections rAlb-IFN γ genes and sheep IL-2 target gene Gene

The PCR reaction systems and reaction condition of connection be：In 25 μ L overall reaction system, rAlb-IFN γ gene templates The μ L of DNA 1, connect the flexible linker μ L of 1 μ L, Alb sense primer of IL-2 template DNAs, 0.5 μ L, IL-2 anti-sense primer 0.5, Taq archaeal dna polymerases 2.5 μ L, dNTP Mix is 10 μ L, plus RNase Free water is to 25 μ L；Connecting PCR reaction conditions is：95℃ Pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C extension 10min.

Present invention also offers the application of the restructuring sheep long-acting interferon, its long half time had up to more than 70 hours Broad-spectrum disease resistance toxic action and the immune response that sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep Alb, sheep IFN-γ and sheep IL-2 genes are realized into amalgamation and expression by flexible linker, interferon is improved Half-life period, compared with plain interferon, improve more than 17 times；

2. by being optimized to sheep Alb, sheep IFN-γ and sheep IL-2 genes, improve sheep Alb, sheep IFN-γ and sheep The expression quantity of IL-2 fusion proteins.

3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmids, it is less to produce inclusion body in protein expression, forms great amount of soluble albumen, it is to avoid inclusion body denaturation and multiple The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made up of sheep Alb, sheep IFN-γ and sheep IL-2 not only has IFN-γ Broad-spectrum disease resistance toxic action, while significantly improving the immune response of sheep itself.

Brief description of the drawings

Fig. 1 is that sheep albumin gene, sheep interleukin-22 gene and sheep Interferon-gamma gene RT-PCR in embodiment 1 are expanded Result；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep interleukin-22 gene RT-PCR amplified productions；Swimming lane 2：Sheep disturbs Plain γ genes RT-PCR amplified productions；Swimming lane 3：Sheep albumin gene RT-PCR amplified productions；

The knot that Fig. 2 expands for the PCR after the sheep Alb in embodiment 1, sheep IFN-γ and sheep IL-2 target gene connection Really；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Sheep albumin gene, sheep Interferon-gamma gene and sheep interleukin-22 gene Ligation amplification product；

PCR amplifications and double digestion qualification result of the Fig. 3 for the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 be embodiment 1 in recombinant protein SDS-PAGE electrophoretic examinations results；Swimming lane M：Albumen Marker；Swimming lane 1：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Western Blot qualification results for the fusion protein that embodiment 1 is obtained；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：Precipitated after recombinant bacterium induction is broken；

Fig. 6 causes cell to recombinate sheep long-acting interferon in embodiment 5 as made from the fusion protein in embodiment 1 to VSV The inhibitory action of lesion；1 is VSV virus control wells；2 be HEp-2 cell control wells；A3-12 is gradient dilution (from right to left) Human interferon standard items processing hole；B3-12 handles hole for the restructuring sheep long-acting interferon of gradient dilution (from right to left)；

Fig. 7 is the restructuring sheep long-acting interferon intramuscular injection blood medicine as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time change curve.

Embodiment

Embodiment 1

A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, its preparation method is such as Under：

1. the acquisition of sheep albumin (Alb), sheep interferon gamma (IFN-γ) and sheep interleukin 2 (IL-2) target gene With amplification

Design of primers：

Objective gene sequence design synthetic primer according to having been reported in Genebank is shown in Table 1, in the upstream of sheep albumin EcoRI restriction enzyme sites and Linker sequences are introduced in primer and anti-sense primer respectively, sheep interferon gamma sense primer and under Linker sequences are introduced respectively in trip primer, are introduced respectively in the sense primer and anti-sense primer of sheep interleukin 2 Linker sequences and XhoI restriction enzyme sites.

The pcr amplification primer thing of table 1

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, sheep Alb, sheep IFN-γ and sheep IL-2 target gene are obtained by reverse transcription, The gene order of three is respectively such as the ＞ and SEQUENCE of 400 ＜ of SEQUENCE LISTING 400 ＜, 4 ＞, SEQUENCE LISTING 5 Shown in the ＞ of 400 ＜ of LISTING 6；

RT-PCR reaction systems (25 μ L) are shown in Table 2

The RT-PCR reaction systems of table 2

RNase Free water	10μL
		dNTP Mix	10μL
Reverse transcriptase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Geneome RNA	1.5μL

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 1850bp, 560bp and 490bp or so in RT-PCR amplified productions, Its result is as shown in figure 1, explanation has prepared sheep Alb, sheep IFN-γ and sheep IL-2 target gene.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

The rAlb-IFN γ PCR reaction systems of table 3

RAlb-IFN γ-IL2PCR the reaction systems of table 4

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2840bp or so in pcr amplification product, its result as shown in Fig. 2 RAlb-IFN γ and IL-2 amplified production bands are occurred in that in Fig. 2, because connected in rAlb-IFN γ and IL-2 gene During, occur in that non-specific responding.The nucleotide sequence of the obtained target gene such as ＞ institutes of 400 ＜ of SEQUENCE LISTING 2 Show.

3. expression vector establishment

Selection connection after target gene through be sequenced it is errorless after, PCR glue reclaims product is used with pET-32a plasmids EcoRI and XhoI restriction enzymes carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 5：

The double digestion system of table 5

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 6,4 DEG C overnight connect：

The enzyme disjunctor system of table 6

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate incubated overnights of penicillin；Single bacterium colony on picking LB flat boards carries out target gene PCR identifications, positive colony Bacteria plasmid is identified through EcoRI and XhoI double digestions, is accredited as positive and is represented that engineering bacteria is successfully constructed, PCR amplifications and double digestion Product detects single band through agarose gel electrophoresis at 2840bp or so places, and its result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, engineering bacteria is designated as pET-32a/rAlb-IFNγ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the μ g/ml containing ampicillin 100), Add final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, its result is as schemed Shown in 4, it can be seen that after bacterial cell disruption after recombinant bacterium induction 5h supernatant to be deposited in 122.6KD or so places visible Predominant expression band, illustrates in precipitation and supernatant equal successful expression fusion protein.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peaks.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by using (the 50mM of Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, washed with Binding Buffer III It is de-, collect rAlb-IFN γ-IL2 protein peaks.

5.4 sample identification

Determine rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁶IU/mg, albumen is qualified；It is aseptic subpackaged, -80 DEG C preserve.It can obtain the fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, its amino acid sequence Row are as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 2

A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, other be the same as Examples 1, Simply e. coli bl21 therein (DE3) competent cell is replaced for BL21 (DE3) competence with pGro7 plasmids Cell.The SDS-PAGE electrophoresis results be the same as Example 1 of its fusion protein is compareed, 122.6KD or so places predominant expression in supernatant Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Amount is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist Correctly folded with expressing protein, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 3

A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, its preparation method is such as Under：

1. the acquisition of sheep albumin (Alb), sheep interferon gamma (IFN-γ) and sheep interleukin 2 (IL-2) target gene With amplification

Sheep Alb in embodiment 1, sheep IFN-γ and sheep IL-2 are optimized, artificial synthesized sheep Alb, sheep IFN-γ and Sheep IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 ＜ of SEQUENCE LISTING 7 ＞, SEQUENCE Shown in the ＞ of 400 ＜ of LISTING 400 ＜, 8 ＞ and SEQUENCE LISTING 9.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing the part in these codons.Those By the most frequent referred to as optimal codon (optimal codons) utilized, what those were not frequently utilized that is referred to as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, conventional do protein expression or every kind of biology of production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows codon profit to a certain degree Difference or preference.In Escherichia coli, yeast and drosophila to the expression efficiency of the gene containing optimal codon apparently higher than containing The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On have impact on the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilize rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to sheep Alb, sheep IFN-γ and Sheep IL-2 gene codons are optimized.

Interpretation of result after 1.2 codon optimizations

It is considered as the gene during usual codon adaptation indexI (CAI)=1.0 optimal efficient in the expression system Expression status, CAI values are lower to show that expression is lower in host.In gene G/C content most ideal distribution scope be 30~ 70%, the scope is exceeded in any region can influence to translate and transcriptional efficiency.Sheep Alb, sheep are found using software detection The codon of IFN-γ and sheep IL-2 original genes codon adaptation indexI (CAI) in Escherichia coli is respectively 0.23,0.25, 0.27, GC percentage is 44.0%, 40.9%, 54.0%；And by after to sheep Alb, sheep IFN-γ and sheep IL-2 gene optimizations Obtain recombination codon adaptation indexI (CAI) in Escherichia coli be respectively 0.99,1.0,1.0, GC percentages 50.1%, 44.1%th, 53.0%.The utilization rate of low codon is significantly reduced by gene optimization, it is to avoid rare codon is to albumen table The influence reached, improves the G/C content of gene, improves transcription and translation efficiency.

1.3 design of primers：

The pcr amplification primer thing of table 7

Sheep Alb after optimization, sheep IFN-γ and sheep IL-2 genomic DNA are diluted to 0.05mg/mL respectively.Utilize PCR amplifications obtain target gene, and 25 μ L reaction systems are as shown in table 8：

The PCR reaction systems of table 8

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerases	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

Sheep Alb, sheep IFN-γ and sheep IL-2 pcr amplification product are through agarose gel electrophoresis respectively in 1850bp, 560bp There is specific band with 490bp or so, illustrate to have prepared sheep Alb after optimization, sheep IFN-γ and sheep IL-2 purpose base Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, each section of target gene is connected using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

The rAlb-IFN γ PCR reaction systems of table 9

RAlb-IFN γ-IL2PCR the reaction systems of table 10

Response parameter is：95 DEG C of pre-degeneration 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 circulations；Last 72 DEG C of extensions 10min.

There is specific band through agarose gel electrophoresis in 2840bp or so in pcr amplification product, its result as shown in figure 5, RAlb-IFN γ and IL-2 amplified production bands are occurred in that in Fig. 5, because connected in rAlb-IFN γ and IL-2 gene During, occur in that non-specific responding.The nucleotide sequence of the obtained target gene such as ＞ institutes of 400 ＜ of SEQUENCE LISTING 3 Show.

3. expression vector establishment

The PCR errorless after sequencing of the target gene after connection glue reclaim product is selected to be used with pET-32a plasmids EcoRI, XhoI restriction enzyme carry out double digestion and recovery, and double digestion is done by 20 μ L systems in table 11：

The double digestion system of table 11

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier reclaims fragment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene after connection and pET-32a plasmids is attached by the system in table 12,4 DEG C overnight connect：

Table 12

Purpose fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia Incubated overnight in the LB flat boards of element；The bacterium colony grown on LB flat boards is taken to identify target gene, positive colony bacteria plasmid warp through PCR EcoRI, XhoI double digestion are identified, are accredited as positive and are represented expression vector establishment success, PCR amplifications and double digestion product are through fine jade There is single band at 2840bp or so places in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN γ-IL2 fusions is carried Body is successfully constructed.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture mediums containing 100 μ g/ml ampicillins, engineering bacteria is designated as pET-32a/rAlb-IFNγ-IL2；The amplification culture 4h (OD ≈ 1.0) in LB culture mediums (the μ g/ml containing ampicillin 100), Add final concentration 100 μ g/ml IPTG, 32 DEG C of induced expression 5h；Thalline is collected, through SDS-PAGE electrophoresis detections, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in 122.6KD or so places after bacterial cell disruption after 5h, illustrates in supernatant is precipitated Recombinant protein is obtained.

Add mass volume ratio 1:Precipitation is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasonic degradations Bacterial precipitation, worked 10s, is spaced 3S, and ultrasonic 6min, whole process is repeated 3~4 times；4 DEG C, 12000r/min centrifugation 15min, Supernatant, precipitation are taken respectively, obtain rough fusion protein.

5. fusion protein purification

5.1His affinity chromatography

After membrane filtration of the rough fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity columns balanced with Binding Buffer I (PBS) are washed away not with PBS With reference to albumen, until A280nm is stable, then with Elution buffer I (50mM trishydroxymethylaminomethanes, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peaks.

5.2DEAE anion-exchange chromatography

(the 50mM trihydroxy methyls of Binding Buffer II are arrived into the albumen collected after His affinitive layer purifications displacement Aminomethane, PH6.5) in after, the DEAE anion exchange chromatography that loading has been balanced by using Binding Buffer II, Crossed again with Binding Buffer II after post to A280nm value stabilizations, with (the 50mM trihydroxy methyl ammonia of Elution Buffer II Methylmethane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peaks.

5.3 sieve chromatography

Loading is by using Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) molecular sieve chromatographies of Superdex 200 have been balanced, use Binding Buffer III elution, collects rAlb-IFN γ-IL2 protein peaks.

5.4 sample identification

Determine rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁶IU/mg, albumen is qualified；It is aseptic subpackaged ,- 80 DEG C of preservations.It can obtain the fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, its amino acid Sequence is as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1.

Embodiment 4

A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, other be the same as Examples 3, Simply e. coli bl21 therein (DE3) competent cell is replaced for BL21 (DE3) competence with pGro7 plasmids Cell.The SDS-PAGE electrophoresis results be the same as Example 3 of its fusion protein is compareed, 122.6KD or so places predominant expression in supernatant Band is thicker, illustrates to introduce after molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein Amount is higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist Correctly folded with expressing protein, reach solubility expression of protein.

Described BL21 (DE3) competent cell with pGro7 plasmids is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

Embodiment 5

One kind restructuring sheep long-acting interferon, by the fusion protein in embodiment 1,2,3,4 respectively with freeze drying protectant mixture Afterwards, it is freeze-dried to form.The freeze drying protectant is glycerine, mannitol and sucrose, is buffer solution with 10mmol/L PBS, Final concentration of glycerine 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Embodiment 1~4 obtains the mirror for the fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 It is fixed

6.1 the quantitative detection of protein content

Lowry methods are used, the standard protein for examining and determine institute with Chinese food pharmaceutical biological product makees standard test, determine embodiment 1~4 obtained fusion protein concentration is all higher than 1.1mg/ml.

6.2SDS-PAGE electrophoresis detection

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 122.6KD or so, as shown in Figure 4.

6.3Western Blot results

Fusion protein in embodiment 1~4 is detected respectively, with the anti-sheep interferon (1 of abcam companies mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Restructuring sheep long-acting interferon sample can be disturbed with anti-sheep Specific reaction occurs for plain γ monoclonal antibodies, and specific band occur in 122.6KD or so places, as shown in Figure 5.

Embodiment 7

Four parts in embodiment 5 recombinate the freeze-dried bioactivity of sheep long-acting interferon

Suppress method according to few cells lesion, Hep-2 cells are made into 5 × 10 with culture medium⁵Cell/ml cells suspend Liquid, per hole, inoculation 0.1ml moves into 96 porocyte culture plates.37 DEG C, 5%CO₂24h is cultivated, the restructuring sheep length of various dose is added Imitate to inhale after interferon, 24h and abandon, then inoculation 100TCID50VSV viruses respectively.

Result of the test

As a result show that the restructuring sheep long-acting interferon obtained causes the lesion of HEp-2 cells to have obvious suppression to VSV Effect.The lesion such as occurs cell rounding after undressed cell virus inoculation, comes off, is disintegrated.And the restructuring sheep length obtained Imitate after the cell virus inoculation after interferon processing, the Continuous Observation under inverted microscope, cellular morphology is normal, does not occur any Lesion, measures potency >=10⁶IU/ml, as shown in Figure 6.

Embodiment 8

Four parts obtained respectively by the fusion protein of embodiment 1~4 restructuring sheep long-acting interferons in embodiment 5 are freeze-dried The measure of the half-life period of (being designated as A, B, C, D respectively) in sheep body

Cytopathic-effect inhibition assay determines rAlb-IFN γ-IL2 blood concentration and time relationship

The sheep (male and female half and half) that six body weight are roughly the same is taken, 2mg/ml restructuring sheep long-acting interferons α is subcutaneously injected in neck Freeze-dried 2ml, respectively in 1h, 3h, 6h, 12h, 24h, 36h, 48h, 72h venous blood collection, 4 DEG C of solidifications of blood sample, 3500rpm low temperature 10min separation serum is centrifuged, each every sheep blood sample of time point is to be measured in -20 DEG C of preservations.Serum is determined using cytopathic-effect inhibition assay RAlb-IFN γ-IL2 concentration in sample, is carried out curve fitting and calculating parameter with DAS pharmacokinetics softwares.Parameter result of calculation It is shown in Table 13.

Dominant dynamic parameters in serum after the restructuring sheep long-acting interferon intramuscular injection of table 13

As a result show that restructuring sheep long-acting interferon has longer half-life period.Half-life period can reach 70h or so after measured, more general Logical interferon improves about 17 times.

Embodiment 9

Four parts of freeze-dried measure influenceed on sheep cellullar immunologic response of restructuring sheep long-acting interferon in embodiment 5

Take six roughly the same mutton sheeps of body weight to be divided into two groups, be designated as experimental group and control group；Experimental group neck is subcutaneously noted The 2mg/ml restructuring freeze-dried 2ml of sheep long-acting interferon are penetrated, 2mL PBS is subcutaneously injected in control group neck, takes after injecting 4 weeks outside sheep All blood, takes weekly a blood afterwards, and lymphocyte is separated using lymphocyte separation medium, and lymphocyte passes through serum-free RPMI 1640 culture mediums are washed after 2 times, and it is 2 × 10 to be resuspended with complete medium, adjust cell concentration⁶Individual/ml, 24 porocyte culture plates are every Hole adds 1ml lymphocytes, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 contents, are carried out, testing result is as shown in table 14 by kit specification：

The ELISA of table 14 detects each group sheep cellullar immunologic response level

As a result show after injection restructuring sheep long-acting interferon, containing for sheep Evaluation of Cytokines in Peripheral Blood IL-4 can be significantly improved Amount, enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned with reference to embodiment to a kind of fusion egg being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 The detailed description that bletilla its preparation method is carried out, is illustrative rather than limited, can be included according to limited scope Several embodiments, therefore changing and modifications in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2 and its preparation side

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 948

<212> PRT

<213>Fusion protein

<400> 1

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Leu Leu Phe Ser Ser Ala

1 5 10 15

Tyr Ser Arg Gly Val Phe Arg Arg Asp Thr His Lys Ser Glu Ile Ala

20 25 30

His Arg Phe Lys Asp Leu Gly Glu Glu His Phe Lys Gly Leu Val Leu

35 40 45

Ile Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Asp Glu His Val

50 55 60

Lys Leu Val Asn Glu Leu Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

65 70 75 80

Glu Ser His Ala Gly Cys Glu Lys Ser Leu His Thr Leu Phe Gly Asp

85 90 95

Glu Leu Cys Lys Val Ala Ser Leu Arg Glu Thr Tyr Gly Asp Met Ala

100 105 110

Asp Cys Cys Glu Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Ser

115 120 125

His Lys Asp Asp Ser Pro Asp Leu Pro Lys Leu Lys Pro Asp Pro Asn

130 135 140

Thr Leu Cys Asp Glu Phe Lys Ala Asp Glu Lys Lys Phe Trp Gly Lys

145 150 155 160

Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu

165 170 175

Leu Leu Tyr Tyr Ala Asn Lys Tyr Asn Gly Val Phe Gln Glu Cys Cys

180 185 190

Gln Ala Glu Asp Lys Gly Ala Cys Leu Leu Pro Lys Ile Glu Thr Met

195 200 205

Arg Glu Lys Val Leu Ala Ser Ser Ala Arg Gln Arg Leu Arg Cys Ala

210 215 220

Ser Ile Gln Lys Phe Gly Glu Arg Ala Leu Lys Ala Trp Ser Val Ala

225 230 235 240

Arg Leu Ser Gln Lys Phe Pro Lys Ala Glu Phe Val Glu Val Thr Lys

245 250 255

Leu Val Thr Asp Leu Thr Lys Val His Lys Glu Cys Cys His Gly Asp

260 265 270

Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys

275 280 285

Asp Asn Gln Asp Thr Ile Ser Ser Lys Leu Lys Glu Cys Cys Asp Lys

290 295 300

Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Lys Asp Ala

305 310 315 320

Ile Pro Glu Asn Leu Pro Pro Leu Thr Ala Asp Phe Ala Glu Asp Lys

325 330 335

Asp Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Ala Phe Leu Gly Ser

340 345 350

Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr Ala Val Ser Val

355 360 365

Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Glu Cys Cys

370 375 380

Ala Lys Asp Asp Pro His Ala Cys Tyr Ser Thr Val Phe Asp Lys Leu

385 390 395 400

Lys His Leu Val Asp Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Asp

405 410 415

Gln Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Ile Val

420 425 430

Arg Tyr Thr Arg Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu

435 440 445

Val Ser Arg Ser Leu Gly Lys Val Gly Thr Arg Cys Cys Thr Lys Pro

450 455 460

Glu Ser Glu Arg Met Pro Cys Thr Glu Asp Tyr Leu Ser Leu Ile Leu

465 470 475 480

Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Lys Val

485 490 495

Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser

500 505 510

Ala Leu Thr Pro Asp Glu Thr Tyr Val Pro Lys Ala Phe Asp Glu Lys

515 520 525

Leu Phe Thr Phe His Ala Asp Ile Cys Thr Leu Pro Asp Thr Glu Lys

530 535 540

Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Leu Lys His Lys Pro

545 550 555 560

Lys Ala Thr Glu Glu Gln Leu Lys Thr Val Met Glu Asn Phe Val Ala

565 570 575

Phe Val Asp Lys Cys Cys Ala Ala Asp Asp Lys Glu Ala Cys Phe Ala

580 585 590

Val Glu Gly Pro Lys Leu Val Val Ser Thr Gln Thr Ala Leu Ala Gly

595 600 605

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Ser Phe

610 615 620

Leu Ala Leu Leu Leu Cys Val Leu Leu Gly Phe Ser Gly Ser Tyr Gly

625 630 635 640

Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn

645 650 655

Ala Ser Asn Pro Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile

660 665 670

Leu Lys Asn Trp Lys Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln

675 680 685

Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln

690 695 700

Val Ile Gln Arg Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys

705 710 715 720

Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys Arg Leu Ile

725 730 735

Gln Ile Pro Val Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu

740 745 750

Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys

755 760 765

Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Met Gly

770 775 780

Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Tyr Lys Ile Gln Pro Leu

785 790 795 800

Ser Cys Ile Ala Leu Thr Leu Ala Leu Val Ala Asn Gly Ala Pro Thr

805 810 815

Ser Ser Ser Thr Gly Asn Thr Met Lys Glu Val Lys Ser Leu Leu Leu

820 825 830

Asp Leu Gln Leu Leu Leu Glu Lys Val Lys Asn Pro Glu Asn Leu Lys

835 840 845

Leu Ser Arg Met His Thr Phe Asn Phe Tyr Met Pro Lys Val Asn Ala

850 855 860

Thr Glu Leu Lys His Leu Lys Cys Leu Leu Glu Glu Leu Lys Leu Leu

865 870 875 880

Glu Glu Val Leu Asp Leu Ala Pro Ser Lys Asn Leu Asn Thr Arg Glu

885 890 895

Ile Lys Asp Ser Met Asp Asn Ile Lys Arg Ile Val Leu Glu Leu Gln

900 905 910

Gly Ser Glu Thr Arg Phe Thr Cys Glu Tyr Asp Asp Ala Thr Val Lys

915 920 925

Ala Val Glu Phe Leu Asn Lys Trp Ile Thr Phe Cys Gln Ser Ile Tyr

930 935 940

Ser Thr Met Thr

945

<210> 2

<211> 2844

<212> DNA

<213>Genome 1

<400> 2

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc cggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860

acaagctcct tcttagcttt actgctctgt gtgcttttgg gtttttctgg ttcttatggc 1920

cagggcccat tttttaaaga aatagaaaac ttaaaggagt attttaatgc aagtaaccca 1980

gatgtagcta agggtgggcc tcttttctca gaaattttga agaattggaa agaggagagt 2040

gacaaaaaga ttattcagag ccaaattgtc tccttctact tcaaactctt tgaaaacctc 2100

aaagataacc aggtcattca aaggagcatg gatatcatca agcaagacat gtttcagaag 2160

ttcttgaacg gcagctctga gaaactggag gacttcaaaa ggctgattca aattccggtg 2220

gatgatctgc agatccagcg caaagccatc aatgaactca tcaaggtgat gaatgacctg 2280

tcgccaaaat ctaacctcag aaagcggaag agaagtcaga atctctttcg aggccggaga 2340

gcatcaatgg gtggtggtgg ttctggtggt ggtggttcta tgtacaagat acaacccttg 2400

tcttgcattg cactaactct tgcactcgtt gcaaacggtg cacctacttc aagctctacg 2460

gggaacacaa tgaaagaagt gaagtcattg ctgctagatt tacagttgct tttggagaaa 2520

gttaaaaatc ccgagaacct caagctctcc aggatgcata catttaactt ctacatgccc 2580

aaggttaacg ctacagaatt gaaacatctt aagtgtttac tagaagaact caaacttcta 2640

gaggaagtgc tagatttagc tccaagcaaa aacctgaaca ccagagagat caaggattca 2700

atggacaata tcaagagaat agttttggaa ctacagggat ctgaaacaag attcacatgt 2760

gaatatgatg atgcgacagt aaaggctgta gaatttctga acaaatggat taccttttgt 2820

caaagcatct actcaacaat gact 2844

<210> 3

<211> 2844

<212> DNA

<213>Genome 2

<400> 3

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc tggtggtggt ggttctggtg gtggtggttc tatgaaatac 1860

acctcttctt tcctggctct gctgctgtgc gttctgctgg gtttctctgg ttcttacggt 1920

cagggtccgt tcttcaaaga aatcgaaaac ctgaaagaat acttcaacgc ttctaacccg 1980

gacgttgcta aaggtggtcc gctgttctct gaaatcctga aaaactggaa agaagaatct 2040

gacaaaaaaa tcatccagtc tcagatcgtt tctttctact tcaaactgtt cgaaaacctg 2100

aaagacaacc aggttatcca gcgttctatg gacatcatca aacaggacat gttccagaaa 2160

ttcctgaacg gttcttctga aaaactggaa gacttcaaac gtctgatcca gatcccggtt 2220

gacgacctgc agatccagcg taaagctatc aacgaactga tcaaagttat gaacgacctg 2280

tctccgaaat ctaacctgcg taaacgtaaa cgttctcaga acctgttccg tggtcgtcgt 2340

gcttctatgg gtggtggtgg ttctggtggt ggtggttcta tgtacaaaat ccagccgctg 2400

tcttgcatcg ctctgaccct ggctctggtt gctaacggtg ctccgacctc ttcttctacc 2460

ggtaacacca tgaaagaagt taaatctctg ctgctggacc tgcagctgct gctggaaaaa 2520

gttaaaaacc cggaaaacct gaaactgtct cgtatgcaca ccttcaactt ctacatgccg 2580

aaagttaacg ctaccgaact gaaacacctg aaatgcctgc tggaagaact gaaactgctg 2640

gaagaagttc tggacctggc tccgtctaaa aacctgaaca cccgtgaaat caaagactct 2700

atggacaaca tcaaacgtat cgttctggaa ctgcagggtt cggagaccag gttcacctgc 2760

gaatacgacg acgctaccgt taaagctgtt gaattcctga acaaatggat caccttctgc 2820

cagtctatct actctaccat gacc 2844

<210> 4

<211> 1821

<212> DNA

<213>Sheep albumin

<400> 4

atgaagtggg tgacttttat ttcccttctc cttctcttca gctctgctta ttccaggggt 60

gtgtttcgtc gagatacaca caagagtgag attgctcatc ggtttaatga tttgggagaa 120

gaaaattttc aaggcctggt gctgattgcc ttttctcagt atctccagca gtgtccattt 180

gacgaacatg taaaattagt gaaggagcta actgagtttg caaaaacatg tgttgctgat 240

gagtcacatg ccggttgtga taagtcactt cacactctct ttggagatga attgtgtaaa 300

gttgcaaccc ttcgcgaaac ctatggtgac atggccgact gctgtgagaa acaagagcct 360

gaaagaaatg aatgcttcct gaatcacaaa gatgatagcc cagacctccc taaactgaaa 420

ccagagcccg atactttgtg tgccgagttt aaggcagatg aaaagaagtt ttggggaaaa 480

tacctatacg aagttgccag aagacatccc tacttttatg caccagaact cctttactat 540

gctaataaat ataatggagt ttttcaagaa tgctgccaag ctgaagataa aggtgcctgc 600

ctactaccaa agattgacgc tatgagagaa aaagtactgg cttcatctgc cagacagaga 660

ctcaggtgtg ccagtattca aaaattcgga gaaagagctt taaaagcatg gtcagtagct 720

cgcctgagcc agaaatttcc caaggctgac tttacagatg ttaccaagat agtgacagat 780

ctcactaagg tccacaagga gtgttgccat ggtgacctgc ttgaatgcgc agacgacagg 840

gcagatcttg ccaagtacat atgtgatcat caagacgcac tctccagtaa actgaaggaa 900

tgctgtgata agcctgtgtt ggaaaaatcc cactgcattg ctgaggtaga taaagatgcc 960

gtgcctgaaa acctgccccc attaactgct gactttgctg aagataagga ggtttgcaaa 1020

aactatcagg aagcaaaaga cgtcttcctg ggctcgtttt tgtatgaata ttcaagaagg 1080

catcctgagt atgctgtctc agtgctattg agacttgcca aggaatatga agccacactg 1140

gaggactgct gtgccaaaga agatccacat gcctgctatg ccacagtgtt tgacaaactt 1200

aagcatcttg tggatgagcc tcagaattta atcaaaaaaa actgtgagct attcgaaaaa 1260

catggagagt atggattcca aaatgcgctc atagttcgtt acaccaggaa agcaccccaa 1320

gtgtcaactc caactctggt ggagatttca agaagcctag gaaaagtggg cactaagtgt 1380

tgtgcaaagc ctgaatcaga aagaatgccc tgtaccgaag actatctgag cttgatcctg 1440

aaccggttgt gcgtgttgca tgagaagaca ccagtgagtg aaaaagtcac caagtgctgc 1500

acggagtcat tggtgaacag acggccatgt ttctctgatc tgacacttga cgaaacatat 1560

gtacccaaac ccttcgatga gaaatttttc accttccatg cagatatatg cacacttcct 1620

gatactgaga aacaaatcaa gaaacaaact gcacttgttg agctgttgaa acacaagccc 1680

aaggcaacag atgaacaact gaaaaccgtt atggagaatt ttgtggcttt tgtagacaag 1740

tgctgtgcag ctgatgacaa agaaggctgc tttgttctgg agggtccaaa acttgttgct 1800

tcaactcaag cagccttagc c 1821

<210> 5

<211> 498

<212> DNA

<213>Sheep IFN-γ

<400> 5

atgaaataca caagctcctt cttagcttta ctgctctgtg tgcttttggg tttttctggt 60

tcttatggcc agggcccatt ttttaaagaa atagaaaact taaaggagta ttttaatgca 120

agtaacccag atgtagctaa gggtgggcct cttttctcag aaattttgaa gaattggaaa 180

gaggagagtg acaaaaagat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaacgg cagctctgag aaactggagg acttcaaaag gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccatca atgaactcat caaggtgatg 420

aatgacctgt cgccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaatg 498

<210> 6

<211> 465

<212> DNA

<213>Sheep IL-2

<400> 6

atgtacaaga tacaaccctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctagat 120

ttacagttgc ttttggagaa agttaaaaat cccgagaacc tcaagctctc caggatgcat 180

acatttaact tctacatgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctagatttag ctccaagcaa aaacctgaac 300

accagagaga tcaaggattc aatggacaat atcaagagaa tagttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcgacag taaaggctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 7

<211> 1821

<212> DNA

<213>Sheep albumin

<400> 7

atgaaatggg ttaccttcat ctctctgctg ctgctgttct cttctgctta ctctcgtggt 60

gttttccgtc gtgacaccca caaatctgaa atcgctcacc gtttcaaaga cctgggtgaa 120

gaacacttca aaggtctggt tctgatcgct ttctctcagt acctgcagca gtgcccgttc 180

gacgaacacg ttaaactggt taacgaactg accgaattcg ctaaaacctg cgttgctgac 240

gaatctcacg ctggttgcga aaaatctctg cacaccctgt tcggtgacga actgtgcaaa 300

gttgcttctc tgcgtgaaac ctacggtgac atggctgact gctgcgaaaa acaggaaccg 360

gaacgtaacg aatgcttcct gtctcacaaa gacgactctc cggacctgcc gaaactgaaa 420

ccggacccga acaccctgtg cgacgaattc aaagctgacg aaaaaaaatt ctggggtaaa 480

tacctgtacg aaatcgctcg tcgtcacccg tacttctacg ctccggaact gctgtactac 540

gctaacaaat acaacggtgt tttccaggaa tgctgccagg ctgaagacaa aggtgcttgc 600

ctgctgccga aaatcgaaac catgcgtgaa aaagttctgg cttcttctgc tcgtcagcgt 660

ctgcgttgcg cttctatcca gaaattcggt gaacgtgctc tgaaagcttg gtctgttgct 720

cgtctgtctc agaaattccc gaaagctgaa ttcgttgaag ttaccaaact ggttaccgac 780

ctgaccaaag ttcacaaaga atgctgccac ggtgacctgc tggaatgcgc tgacgaccgt 840

gctgacctgg ctaaatacat ctgcgacaac caggacacca tctcttctaa actgaaagaa 900

tgctgcgaca aaccgctgct ggaaaaatct cactgcatcg ctgaagttga aaaagacgct 960

atcccggaaa acctgccgcc gctgaccgct gacttcgctg aagacaaaga cgtttgcaaa 1020

aactaccagg aagctaaaga cgcttttctc ggtagcttcc tgtacgaata ctctcgtcgt 1080

cacccggaat acgctgtttc tgttctgctg cgtctggcta aagaatacga agctaccctg 1140

gaagaatgct gcgctaaaga cgacccgcac gcttgctact ctaccgtttt cgacaaactg 1200

aaacacctgg ttgacgaacc gcagaacctg atcaaacaga actgcgacca gttcgaaaaa 1260

ctgggtgaat acggtttcca gaacgctctg atcgttcgtt acacccgtaa agttccgcag 1320

gtttctaccc cgaccctggt tgaagtttct cgttctctgg gtaaagttgg tacccgttgc 1380

tgcaccaaac cggaatctga acgtatgccg tgcaccgaag actacctgtc tctgatcctg 1440

aaccgtctgt gcgttctgca cgaaaaaacc ccggtttctg aaaaagttac caaatgctgc 1500

accgaatctc tggttaaccg tcgtccgtgc ttctctgctc tgaccccgga cgaaacctac 1560

gttccgaaag ctttcgacga aaaactgttc accttccacg ctgacatctg caccctgccg 1620

gacaccgaaa aacagatcaa aaaacagacc gctctggttg aactgctgaa acacaaaccg 1680

aaagctaccg aagaacagct gaaaaccgtt atggaaaact tcgttgcttt cgttgacaaa 1740

tgctgcgctg ctgacgacaa agaagcttgc ttcgctgttg aaggtccgaa actggttgtt 1800

tctacccaga ccgctctggc t 1821

<210> 8

<211> 498

<212> DNA

<213>Sheep IFN-γ

<400> 8

atgaaataca cctcttcttt cctggctctg ctgctgtgcg ttctgctggg tttctctggt 60

tcttacggtc agggtccgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaacg tctgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctatg 498

<210> 9

<211> 465

<212> DNA

<213>Sheep IL-2

<400> 9

atgtacaaaa tccagccgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcaact tctacatgcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctggacctgg ctccgtctaa aaacctgaac 300

acccgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaaagctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

Claims (10)

1. a kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interleukin 2, it is characterised in that：It is described The amino acid sequence table of fusion protein is designated as fusion protein 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 1；Or such as Shown in the ＞ of 400 ＜ of SEQUENCE LISTING 2, fusion protein 2 is designated as.

2. a kind of gene for encoding fusion protein as claimed in claim 1, it is characterised in that the nucleotide sequence of the gene Table is designated as genome 1 as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 3；Or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 4, It is designated as genome 2.

3. the expression vector containing gene as claimed in claim 2.

4. the genetic engineering bacterium containing gene as claimed in claim 2.

5. one kind restructuring sheep long-acting interferon, it is characterised in that the restructuring sheep long-acting interferon is as melting described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, it is characterised in that the preparation method includes following step Suddenly：Expression vector described in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering is obtained Bacterium obtains the crude product of the fusion protein after IPTG induced expressions, purified to can obtain fusion protein afterwards.

7. preparation method according to claim 6, it is characterised in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ, its preparation method is：

(1) primer is designed, is obtained by reverse transcription or is manually respectively synthesized the sheep albumin for connecting flexible linker sequences, sheep The target gene of interferon gamma, sheep interleukin 2；By flexible linker by sheep albumin, sheep interferon gamma, sheep leucocyte The target gene of interleukin 2 is connected, the nucleotides sequence list such as SEQUENCE LISTING 400 of the target gene after connection Shown in the ＞ of ＜ 3 or as shown in the ＞ of 400 ＜ of SEQUENCE LISTING 4；

(2) target gene after connection is connected on pET-32a plasmids and obtains expression vector；

(3) expression vector is imported into e. coli host cell, you can obtain genetic engineering bacterium pET-32a/rAlb-IFN γ-IL2。

8. the preparation method according to claim 6 or 7, it is characterised in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmids.

9. the preparation method according to claim 6 or 7, it is characterised in that the method for the purifying is：Fusion protein it is thick Purified after product elder generation through affinity chromatography, anion-exchange chromatography and sieve chromatography.

10. the application of restructuring sheep long-acting interferon according to claim 5, it is characterised in that the restructuring sheep is long-acting dry The long half time of element is disturbed up to more than 70 hours, with broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.