CN108840953A

CN108840953A - A kind of fusion protein and preparation method thereof being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau

Info

Publication number: CN108840953A
Application number: CN201810768831.1A
Authority: CN
Inventors: 徐慕珍; 高耀辉; 周炜; 杨建伟; 王红朵; 鲍可兵; 付超; 刘家炉
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-13
Publication date: 2018-11-20
Also published as: CN107383204A

Abstract

The fusion protein and preparation method thereof that the invention discloses a kind of to be made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau; the fusion protein is connected through flexible linker with sheep interferon-tau by sheep interleukin 2, sheep interferon gamma and is formed, and is freeze-dried to obtain recombination sheep long-acting interferon after fusion protein and freeze drying protectant mixture.The recombination sheep long-acting interferon is remarkably improved the half-life period of sheep interferon, and the half-life period of more common sheep interferon improves 15 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of sheep itself.

Description

A kind of fusion being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau Albumen and preparation method thereof

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to by sheep interleukin 2, sheep interferon gamma and sheep The fusion protein and preparation method thereof of interferon-tau composition.

Background technique

Animal infectious disease caused by virus seriously constrains the sound development of every country and regional aquaculture, in State is the country that sheep breeding stock, the amount of delivering for sale, Mutton yield are most in the world, and Mutton Sheep Industry is also the mainstay of China's animal husbandry One of industry., inevitably will be in face of disease problems caused by virus with the sustainable development of sheep aquaculture, domestic animals disease is not Huge economic loss only is caused to sheep culturist, more seriously, it is strong that some Zoonosis communicable diseases return the mankind Health brings potential threat.

The prevention and treatment of sheep class communicable disease mainly uses vaccine immunity and drug therapy at present, due to the serum of vaccine immunity Type is single, and the serotype of virus is complicated, and strain variation is fast, often results in vaccine immunity failure.Some virosis there is no epidemic disease at present Seedling is available, some viruses may also directly jeopardize the health of the mankind.

Common drug therapy mainly uses antibiotic to be treated, but extensive and a large amount of due to antibiotic in recent years It uses, causes endurance strain largely to generate, and be transmitted to people by food chain, bigger threat is brought to human health.It is existing In some countries, oneself prohibites the application of some antibiotic and antibacterial agent in aquaculture.Therefore, positive using interferon Treat and prevent domestic animal, the viral disease of poultry will be the problem of mankind pay close attention to the most.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.

Interferon Ct (interferon tau, IFN- τ) is initially referred to as trophoblast protein, the one kind secreted by trophoderm Novel I type IFN is the conceptus signal of ruminant maternal gestational identification, maintains to play in pregnant establishment process in corpus luteum Important biological function.Interferon Ct has the denominator of interferon type Ⅰ:With antiviral, anti-cell proliferation, immune tune The functions such as section.IFN- τ has own characteristic in terms of biological function, it is only expressed in embryonic feeder confluent monolayer cells, without virus Induction, and cytotoxicity more less than IFN- τ/β.Based on its distinctive biological activity and low cytotoxicity, IFN- τ is to be permitted The treatment zone of more diseases carrys out new hope.

γ type IFN is that the T cell and NK cell by activating generate, and has relatively strong antiviral and immunoloregulation function.Largely Studies have shown that interferon gamma also plays crucial adjustment effect other than having the function of broad-spectrum antiviral, to immune system, so IFN-γ is also known as immunological regulation interferon.Although various types of interferon can mediated cell to the anti-of virus infection It answers, but the immunoregulatory activity of interferon gamma is coordinating immune response and determining in the long-term antiviral state of body to play more Important role, therefore interferon gamma has particularly important clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve Curative effect of medication.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

It is interfered in order to solve the above technical problems, the present invention provides one kind by sheep interleukin 2, sheep interferon gamma and sheep The fusion protein and preparation method thereof of plain τ composition, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of recombination sheep long-acting interferon, the recombination sheep long-acting interferon is remarkably improved the half-life period of sheep interferon, compared with The half-life period of common sheep interferon improves 15 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of sheep itself and answer It answers.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, the fusion protein Amino acid sequence table as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection The now codon of sheep interleukin 2, sheep IFN-γ, sheep IFN- τ original gene codon adaptation indexI in Escherichia coli (CAI) be respectively 0.27,0.25,0.27, GC percentage be 54.0%, 40.9%, 54.4%；And by sheep interleukins 2, obtained after sheep IFN-γ, sheep IFN- τ gene optimization each gene in Escherichia coli codon adaptation indexI (CAI) be 1.0, 1.0,1.0, GC percentage 53.0%, 44.1%, 53.1%.The utilization rate of low codon is significantly reduced by gene optimization, Influence of the rare codon to protein expression is avoided, the G/C content of gene is improved, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN τ.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of recombination sheep long-acting interferon, the recombination sheep long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN τ, and preparation method is：

(1) design primer, is obtained or the sheep interleukins of the flexible linker sequence of artificial synthesized band by reverse transcription 2, the target gene of sheep interferon gamma, sheep interferon-tau；By flexible linker by sheep interleukin 2, sheep interferon gamma, sheep The target gene of interferon-tau connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING Shown in 400 <, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2- can be obtained IFNγ-IFNτ。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of sheep interleukin 2 (IL-2) is：

Upstream IL-2-F1：CCGGAATTCATGTACAAGATACAACCC has EcoRI restriction enzyme site；

Downstream IL-2-R1：ACCACCACCAGAACCACCACCACCAGTCATTGTTGAGTAGAT, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACAAGCTC, with flexible linker；

Downstream IFN-γ-R1：ACCACCACCAGAACCACCACCACCCATTGATGCTCTCCG, with flexible linker；

The primer sequence of sheep interferon-tau (IFN- τ) is：

Upstream IFN- τ-F1：GGTGGTTCTGGTGGTGGTGGTTCTATGGCCTTCGTGC, with flexible linker；

Downstream IFN- τ-R1：CCCTCGAGTCAACCTGAGATC has XhoI restriction enzyme site；

B. RNA is extracted from sheep liver, and the target gene of sheep IL-2, sheep IFN-γ and sheep IFN- τ are obtained by reverse transcription, The gene order of three respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of sheep IL-2, sheep IFN-γ and sheep IFN- τ as template, and it is utilized respectively sheep IL-2, sheep IFN-γ and the upstream and downstream primer of sheep IFN- τ carry out PCR amplification, respectively obtain the sheep IL-2 for connecting flexible linker, sheep IFN-γ and sheep IFN- τ gene.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rIL2-IFN γ gene is obtained using flexible linker connection sheep IL-2 and sheep IFN-γ target gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rIL2-IFN γ-IFN is obtained using flexible linker connection rIL2-IFN γ gene and sheep IFN- τ target gene τ gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN- τ template DNA, 0.5 μ L, the IFN- τ downstream primer 0.5 of flexible linker 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of sheep interleukin 2 (IL-2) is：

Upstream IL-2-F2：CGGGATCCATGTACAAAATCCAGCC has BamHI restriction enzyme site；

Downstream IL-2-R2：ACCACCACCAGAACCACCACCACCGGTCATGGTAGAGTAGA, with flexible linker；

The primer sequence of sheep interferon gamma (IFN-γ) is：

Upstream IFN-γ-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGAAATACACCTCTTCT, with flexible linker；

Downstream IFN-γ-R2：ACCACCACCAGAACCACCACCACCCATAGAAGCACGACG, with flexible linker；

Sheep interferon-tau (IFN- τ)：

Upstream IFN- τ-F2：GGTGGTTCTGGTGGTGGTGGTTCTATGGCTTTCGTTCTG, with flexible linker；

Downstream IFN- τ-R2：CCCTCGAGTTACGGAGAGTTC has XhoI restriction enzyme site.

B. the sheep IL-2, sheep IFN-γ and sheep IFN- τ target gene, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.0 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of IL-2 gene template DNA connects 1 μ L, IL-2 upstream primer of IFN-γ template DNA, the 0.5 μ L of flexible linker, 0.5 μ L, Taq archaeal dna polymerase of IFN-γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Even Connecing PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rIL2-IFN γ gene template 1 μ L of DNA connects 1 μ L, IL-2 upstream primer of IFN- τ template DNA, 0.5 μ L, the IFN- τ downstream primer 0.5 of flexible linker 2.5 μ L, dNTP Mix of μ L, Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is： 95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Most 72 DEG C of extension 10min afterwards.

The present invention also provides the application of the recombination sheep long-acting interferon, long half time had up to 60 hours or more Broad-spectrum disease resistance toxic action and the immune response that sheep itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. sheep IL-2, sheep IFN-γ and sheep IFN- τ gene are realized amalgamation and expression by flexibility linker, interference is improved Plain half-life period improves 15 times or more compared with plain interferon；It is significant to drop compared with common polyethylene glycol fused interferon Low cost.

2. by being optimized to sheep IL-2, sheep IFN-γ and sheep IFN- τ gene, improve sheep IL-2, sheep IFN-γ and The expression quantity of sheep IFN- τ fusion protein.

3. using recombination bacillus coli pET-32a/rIL2-IFN γ-IFN τ as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of sheep IL-2, sheep IFN-γ and sheep IFN- τ not only has IFN- τ's Broad-spectrum disease resistance toxic action, while significantly improving the immune response of sheep itself.

Detailed description of the invention

Fig. 1 is sheep Interleukin-2 Gene, sheep Interferon-gamma gene and the sheep interferon-tau gene RT-PCR in embodiment 1 The result of amplification；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep interleukin-22 gene RT-PCR amplified production；Swimming lane 2：Sheep Interferon-gamma gene RT-PCR amplified production；Swimming lane 3：Sheep interferon-tau gene RT-PCR amplified production；

Fig. 2 be embodiment 1 in sheep IL-2, IFN-γ connected with the target gene of IFN- τ after PCR amplification knot Fruit；Swimming lane M：DNA Marker DL2000；Swimming lane 1：Sheep interleukin-22 gene, sheep Interferon-gamma gene and sheep interferon-tau gene Ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Plasmid PCR result；Swimming lane 2：Recombinant plasmid double digestion result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：Zero load control；Swimming lane 2：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：After bacterial cell disruption after recombinant bacterium induction Supernatant；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：It is precipitated after being crushed for recombinant bacterium induction；

Fig. 6 is that the recombination sheep long-acting interferon t as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the recombination sheep long-acting interferon τ of gradient dilution (from right to left) handles hole；

Fig. 7 is to recombinate sheep long-acting interferon t intramuscular injection blood in embodiment 8 as made from the fusion protein in embodiment 1 Concentration-time changing curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, preparation method is such as Under：

1. sheep interleukin 2 (IL-2), sheep interferon gamma (IFN-γ) and sheep interferon-tau (IFN- τ) target gene It obtains and expands

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in sheep interleukin 2 EcoRI restriction enzyme site and Linker sequence are introduced in upstream primer and downstream primer respectively, in the upstream primer of sheep interferon gamma With Linker sequence is introduced in downstream primer respectively, introduced respectively in the upstream primer and downstream primer of sheep interferon-tau Linker sequence and XhoI restriction enzyme site.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from sheep liver tissue, the purpose base of sheep IL-2, sheep IFN-γ and sheep IFN- τ are obtained by reverse transcription Cause, the gene order of three respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 490bp, 560bp and 620bp or so through agarose gel electrophoresis in RT-PCR amplified production, As a result as shown in Figure 1, illustrating that the sheep IL-2 for being separately connected flexible linker sequence, sheep IFN-γ and sheep have been prepared respectively The target gene of IFN- τ.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rIL2-IFN γ PCR reaction system of table

4 rIL2-IFN γ of table-IFN τ PCR reaction system

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1610bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occurs rIL2-IFN γ and IFN- τ amplified product band in Fig. 2, this is because connecting in rIL2-IFN γ with IFN- τ gene During, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > It is shown.

3. expression vector establishment

After sequencing is errorless, PCR glue recovery product uses target gene after selection connection with pET-32a plasmid EcoRI and XhoI restriction enzyme carries out double digestion and recycling, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, PCR amplification and double digestion through EcoRI and XhoI double digestion Product detects single band at the place 1610bp or so through agarose gel electrophoresis, and result is as shown in figure 3, illustrate successfully to obtain PET-32a/rIL2-IFN γ-IFN τ engineering bacteria.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as shown in figure 4, it can be seen from the figure that recombinant bacterium lures Supernatant is deposited in the visible predominant expression band in the place 77.3KD or so after bacterial cell disruption after leading 5h, illustrates in precipitating and supernatant Equal successful expression fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rIL2-IFN γ-IFN τ protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rIL2-IFN γ-IFN τ protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rIL2-IFN γ-IFN τ protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN τ potency and specific activity, specific activity >=10⁶U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, amino acid sequence can be obtained Column are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, other same embodiments 1, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,77.3KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 3

Sheep IL-2, sheep IFN-γ and sheep IFN- τ in embodiment 1 is optimized, artificial synthesized sheep IL-2, sheep IFN-γ With sheep IFN- τ target gene, after optimization, the nucleotide sequence of three respectively as 400 < of SEQUENCE LISTING, 7 >, Shown in 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, to the IL-2 of sheep, sheep IFN- in the present embodiment γ and sheep IFN- τ gene codon optimize.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Sheep IL-2, sheep are found using software detection The codon of IFN-γ and sheep IFN- τ original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.27, 0.25,0.27, GC percentage is 54.0%, 40.9%, 54.4%；And by sheep IL-2, sheep IFN-γ and sheep IFN- τ gene It is respectively 1.0,1.0,1.0, GC percentage that recombination codon adaptation indexI (CAI) in Escherichia coli is obtained after optimization 53.0%, 44.1%, 53.1%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of sheep IL-2, sheep IFN-γ and sheep IFN- τ after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

Sheep IL-2, sheep IFN-γ and sheep IFN- τ pcr amplification product through agarose gel electrophoresis respectively 490bp, There is specific band in 560bp and 530bp or so, illustrate that the sheep for being separately connected flexible linker after optimization has been prepared The target gene of IL-2, sheep IFN-γ and sheep IFN- τ.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rIL2-IFN γ PCR reaction system of table

10 rIL2-IFN γ-IFN- τ PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1610bp or so through agarose gel electrophoresis in pcr amplification product, illustrates successfully to be connected RIL2-IFN γ-IFN τ gene after connecing.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid BamHI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of BamHI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 1610bp or so in sepharose electrophoresis, illustrates containing rIL2-IFN γ-IFN τ fusion gene engineering bacterium PET-32a/rIL2-IFN γ-IFN τ constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h in the LB culture medium containing 100 μ g/ml ampicillins, in LB culture medium Amplification culture 4h (OD=1.0) in (the 100 μ g/ml containing ampicillin), is added the IPTG of final concentration of 100 μ g/ml, 32 DEG C lure Lead expression 5h；Thallus is collected, through SDS-PAGE electrophoresis detection, supernatant is deposited in after the bacterial cell disruption after recombinant bacterium induction 5h The visible predominant expression band in the place 77.3KD or so illustrates to have obtained recombinant protein in supernatant precipitating.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rIL2-IFN γ-IFN τ protein peak.

5.4 sample identification

Measure rIL2-IFN γ-IFN τ potency and specific activity, specific activity >=10⁶U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, other same embodiments 3, only e. coli bl21 therein (DE3) competent cell is replaced in order to which the BL21 (DE3) with pGro7 plasmid experiences State cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,77.3KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 5

A kind of recombination sheep long-acting interferon τ, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the mirror for the fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau It is fixed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 77.3KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-sheep τ interferon (1 of abcam company mouse:5000 dilutions) it is one It is anti-, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinating sheep long-acting interferon sample can be with anti-sheep interferon-tau Specific reaction occurs for monoclonal antibody, and specific band occurs in the place 77.3KD or so, as shown in Figure 5.

Embodiment 7

Four parts in embodiment 5 recombinate the freeze-dried bioactivity of sheep long-acting interferon τ

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the recombination sheep that various dose is added is long for culture Interferon-tau is imitated, inhales abandon afterwards for 24 hours, then be inoculated with 100TCID respectively₅₀VSV virus.

Test result

The result shows that the recombination sheep long-acting interferon τ obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the recombination sheep obtained is long After imitating interferon-tau treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, not incumbent out What lesion, measures potency >=10⁶U/ml, as shown in Figure 6.

Embodiment 8

Being lyophilized respectively by four parts of recombination sheep long-acting interferon τ that the fusion protein of Examples 1 to 4 obtains in embodiment 5 Measurement of the agent (being denoted as A, B, C, D respectively) in sheep intracorporal half-life period

Cytopathic-effect inhibition assay measures rIL2-IFN γ-IFN τ blood concentration and time relationship

The sheep (half male and half female) that six weight are roughly the same is taken, neck is subcutaneously injected 2mg/ml and recombinates sheep long-acting interferon τ Freeze-dried 2ml, respectively 1h, 3h, 6h, 12h, for 24 hours, 48h, 60h, 72h venous blood collection, 4 DEG C of blood sample solidification, 3500rpm low temperature It is centrifuged 10min and separates serum, every sheep blood sample of each time point is to be measured in -20 DEG C of preservations.Serum is measured using cytopathic-effect inhibition assay RIL2-IFN γ-IFN τ concentration in sample is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculates knot Fruit is shown in Table 13.

Dominant dynamic parameters in serum after the recombination sheep long-acting interferon τ intramuscular injection of table 13

The result shows that recombination sheep long-acting interferon τ has longer half-life period.Half-life period can reach 60h or so after measured, compared with Plain interferon improves 15 times or more.

Embodiment 9

Four parts of freeze-dried measurements that sheep cellullar immunologic response is influenced of recombination sheep long-acting interferon τ in embodiment 5

It takes six roughly the same sheep of weight to be divided into two groups, is denoted as experimental group and control group；The subcutaneous injection of experimental group neck 2mg/ml recombinates the freeze-dried 2ml of sheep long-acting interferon τ, and the PBS of 2mL is subcutaneously injected in control group neck, takes sheep periphery after injection 4 weeks Blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 content, is carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group sheep cellullar immunologic response

The result shows that can significantly improve sheep Evaluation of Cytokines in Peripheral Blood IL-4's after injection recombination sheep long-acting interferon τ Content enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion egg being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein and preparation method thereof being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 536

<212> PRT

<213>Sheep IL2-IFN γ-IFN τ fusion protein

<400> 1

Met Tyr Lys Ile Gln Pro Leu Ser Cys Ile Ala Leu Thr Leu Ala Leu

1 5 10 15

Val Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Gly Asn Thr Met Lys

20 25 30

Glu Val Lys Ser Leu Leu Leu Asp Leu Gln Leu Leu Leu Glu Lys Val

35 40 45

Lys Asn Pro Glu Asn Leu Lys Leu Ser Arg Met His Thr Phe Asn Phe

50 55 60

Tyr Met Pro Lys Val Asn Ala Thr Glu Leu Lys His Leu Lys Cys Leu

65 70 75 80

Leu Glu Glu Leu Lys Leu Leu Glu Glu Val Leu Asp Leu Ala Pro Ser

85 90 95

Lys Asn Leu Asn Thr Arg Glu Ile Lys Asp Ser Met Asp Asn Ile Lys

100 105 110

Arg Ile Val Leu Glu Leu Gln Gly Ser Glu Thr Arg Phe Thr Cys Glu

115 120 125

Tyr Asp Asp Ala Thr Val Lys Ala Val Glu Phe Leu Asn Lys Trp Ile

130 135 140

Thr Phe Cys Gln Ser Ile Tyr Ser Thr Met Thr Gly Gly Gly Gly Ser

145 150 155 160

Gly Gly Gly Gly Ser Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu

165 170 175

Leu Cys Val Leu Leu Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe

180 185 190

Phe Lys Glu Ile Glu Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro

195 200 205

Asp Val Ala Lys Gly Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp

210 215 220

Lys Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe

225 230 235 240

Tyr Phe Lys Leu Phe Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg

245 250 255

Ser Met Asp Ile Ile Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly

260 265 270

Ser Ser Glu Lys Leu Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val

275 280 285

Asp Asp Leu Gln Ile Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val

290 295 300

Met Asn Asp Leu Ser Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser

305 310 315 320

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Met Gly Gly Gly Gly Ser

325 330 335

Gly Gly Gly Gly Ser Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu

340 345 350

Val Leu Val Ser Tyr Gly Pro Gly Gly Ser Leu Gly Cys Tyr Leu Ser

355 360 365

Gln Arg Leu Met Leu Asp Ala Arg Glu Asn Leu Lys Leu Leu Asp Arg

370 375 380

Met Asn Arg Leu Ser Pro His Ser Cys Leu Gln Asp Arg Lys Asp Phe

385 390 395 400

Gly Leu Pro Gln Glu Met Val Glu Gly Asp Gln Leu Gln Lys Asp Gln

405 410 415

Ala Phe Pro Val Leu Tyr Glu Met Leu Gln Gln Ser Phe Asn Leu Phe

420 425 430

Tyr Thr Glu His Ser Ser Ala Ala Trp Asp Thr Thr Leu Leu Asp Gln

435 440 445

Leu Cys Thr Gly Leu Gln Gln Gln Leu Asp His Leu Asp Thr Cys Arg

450 455 460

Asp Gln Val Met Gly Glu Lys Asp Ser Glu Leu Gly Asn Met Asp Pro

465 470 475 480

Ile Val Thr Val Lys Lys Tyr Phe Gln Gly Ile His Asp Tyr Leu Gln

485 490 495

Glu Lys Gly Tyr Ser Asp Cys Ala Trp Glu Ile Val Arg Val Glu Met

500 505 510

Met Arg Ala Leu Thr Val Ser Thr Thr Leu Gln Lys Arg Leu Thr Lys

515 520 525

Met Gly Gly Asp Leu Asn Ser Pro

530 535

<210> 2

<211> 1611

<212> DNA

<213>Genome 1

<400> 2

atgtacaaga tacaaccctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctagat 120

ttacagttgc ttttggagaa agttaaaaat cccgagaacc tcaagctctc caggatgcat 180

acatttaact tctacatgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctagatttag ctccaagcaa aaacctgaac 300

accagagaga tcaaggattc aatggacaat atcaagagaa tagttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcgacag taaaggctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgactggtgg tggtggttct 480

ggtggtggtg gttctatgaa atacacaagc tccttcttag ctttactgct ctgtgtgctt 540

ttgggttttt ctggttctta tggccagggc ccatttttta aagaaataga aaacttaaag 600

gagtatttta atgcaagtaa cccagatgta gctaagggtg ggcctctttt ctcagaaatt 660

ttgaagaatt ggaaagagga gagtgacaaa aagattattc agagccaaat tgtctccttc 720

tacttcaaac tctttgaaaa cctcaaagat aaccaggtca ttcaaaggag catggatatc 780

atcaagcaag acatgtttca gaagttcttg aacggcagct ctgagaaact ggaggacttc 840

aaaaggctga ttcaaattcc ggtggatgat ctgcagatcc agcgcaaagc catcaatgaa 900

ctcatcaagg tgatgaatga cctgtcgcca aaatctaacc tcagaaagcg gaagagaagt 960

cagaatctct ttcgaggccg gagagcatca atgggtggtg gtggttctgg tggtggtggt 1020

tctatggcct tcgtgctctc tctactgatg gccctggtgc tggtcagcta tggcccagga 1080

ggatctctgg gttgttacct atctcagaga ctcatgctgg atgccaggga gaacctcaag 1140

ctcctggacc gaatgaacag actctcccct cattcctgtc tgcaggacag aaaagacttt 1200

ggtcttcccc aggagatggt ggagggcgac cagctccaga aggaccaggc cttccctgtg 1260

ctctacgaga tgctccagca gagcttcaac ctcttctaca cagagcactc ctctgctgcc 1320

tgggacacca ccctcctgga ccagctctgc actggactcc aacagcagct ggaccacctg 1380

gacacctgca gggatcaagt gatgggagag aaagactctg aactgggtaa catggacccc 1440

attgtgaccg tgaagaagta cttccagggc atccatgact acctgcaaga gaagggatac 1500

agcgactgcg cctgggaaat cgtcagagtc gagatgatga gagccctcac tgtatcaacc 1560

accttgcaaa aaaggttaac aaagatgggt ggagatctga actcaccttg a 1611

<210> 3

<211> 1611

<212> DNA

<213>Genome 2

<400> 3

atgtacaaaa tccagccgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcaact tctacatgcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctggacctgg ctccgtctaa aaacctgaac 300

acccgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaaagctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgaccggtgg tggtggttct 480

ggtggtggtg gttctatgaa atacacctct tctttcctgg ctctgctgct gtgcgttctg 540

ctgggtttct ctggttctta cggtcagggt ccgttcttca aagaaatcga aaacctgaaa 600

gaatacttca acgcttctaa cccggacgtt gctaaaggtg gtccgctgtt ctctgaaatc 660

ctgaaaaact ggaaagaaga atctgacaaa aaaatcatcc agtctcagat cgtttctttc 720

tacttcaaac tgttcgaaaa cctgaaagac aaccaggtta tccagcgttc tatggacatc 780

atcaaacagg acatgttcca gaaattcctg aacggttctt ctgaaaaact ggaagacttc 840

aaacgtctga tccagatccc ggttgacgac ctgcagatcc agcgtaaagc tatcaacgaa 900

ctgatcaaag ttatgaacga cctgtctccg aaatctaacc tgcgtaaacg taaacgttct 960

cagaacctgt tccgtggtcg tcgtgcttct atgggtggtg gtggttctgg tggtggtggt 1020

tctatggctt tcgttctgtc tctgctgatg gctctggttc tggtttctta cggtccgggt 1080

ggttctctgg gttgctacct gtctcagcgt ctgatgctgg acgctcgtga aaacctgaaa 1140

ctgctggacc gtatgaaccg tctgtctccg cactcttgcc tgcaggaccg taaagacttc 1200

ggtctgccgc aggaaatggt tgaaggtgac cagctgcaga aagaccaggc tttcccggtt 1260

ctgtacgaaa tgctgcagca gtctttcaac ctgttctaca ccgaacactc ttctgctgct 1320

tgggacacca ccctgctgga ccagctgtgc accggtctgc agcagcagct ggaccacctg 1380

gacacctgcc gtgaccaggt tatgggtgaa aaagactctg aactgggtaa catggacccg 1440

atcgttaccg ttaaaaaata cttccagggt atccacgact acctgcagga aaaaggttac 1500

tctgactgcg cttgggaaat cgttcgtgtt gaaatgatgc gtgctctgac cgtttctacc 1560

accctgcaga aacgtctgac caaaatgggt ggtgacctga actctccgta a 1611

<210> 4

<211> 465

<212> DNA

<213>Sheep IL-2

<400> 4

atgtacaaga tacaaccctt gtcttgcatt gcactaactc ttgcactcgt tgcaaacggt 60

gcacctactt caagctctac ggggaacaca atgaaagaag tgaagtcatt gctgctagat 120

ttacagttgc ttttggagaa agttaaaaat cccgagaacc tcaagctctc caggatgcat 180

acatttaact tctacatgcc caaggttaac gctacagaat tgaaacatct taagtgttta 240

ctagaagaac tcaaacttct agaggaagtg ctagatttag ctccaagcaa aaacctgaac 300

accagagaga tcaaggattc aatggacaat atcaagagaa tagttttgga actacaggga 360

tctgaaacaa gattcacatg tgaatatgat gatgcgacag taaaggctgt agaatttctg 420

aacaaatgga ttaccttttg tcaaagcatc tactcaacaa tgact 465

<210> 5

<211> 498

<212> DNA

<213>Sheep IFN-γ

<400> 5

atgaaataca caagctcctt cttagcttta ctgctctgtg tgcttttggg tttttctggt 60

tcttatggcc agggcccatt ttttaaagaa atagaaaact taaaggagta ttttaatgca 120

agtaacccag atgtagctaa gggtgggcct cttttctcag aaattttgaa gaattggaaa 180

gaggagagtg acaaaaagat tattcagagc caaattgtct ccttctactt caaactcttt 240

gaaaacctca aagataacca ggtcattcaa aggagcatgg atatcatcaa gcaagacatg 300

tttcagaagt tcttgaacgg cagctctgag aaactggagg acttcaaaag gctgattcaa 360

attccggtgg atgatctgca gatccagcgc aaagccatca atgaactcat caaggtgatg 420

aatgacctgt cgccaaaatc taacctcaga aagcggaaga gaagtcagaa tctctttcga 480

ggccggagag catcaatg 498

<210> 6

<211> 588

<212> DNA

<213>Sheep IFN- τ

<400> 6

atggccttcg tgctctctct actgatggcc ctggtgctgg tcagctatgg cccaggagga 60

tctctgggtt gttacctatc tcagagactc atgctggatg ccagggagaa cctcaagctc 120

ctggaccgaa tgaacagact ctcccctcat tcctgtctgc aggacagaaa agactttggt 180

cttccccagg agatggtgga gggcgaccag ctccagaagg accaggcctt ccctgtgctc 240

tacgagatgc tccagcagag cttcaacctc ttctacacag agcactcctc tgctgcctgg 300

gacaccaccc tcctggacca gctctgcact ggactccaac agcagctgga ccacctggac 360

acctgcaggg atcaagtgat gggagagaaa gactctgaac tgggtaacat ggaccccatt 420

gtgaccgtga agaagtactt ccagggcatc catgactacc tgcaagagaa gggatacagc 480

gactgcgcct gggaaatcgt cagagtcgag atgatgagag ccctcactgt atcaaccacc 540

ttgcaaaaaa ggttaacaaa gatgggtgga gatctgaact caccttga 588

<210> 7

<211> 465

<212> DNA

<213>Sheep IL-2

<400> 7

atgtacaaaa tccagccgct gtcttgcatc gctctgaccc tggctctggt tgctaacggt 60

gctccgacct cttcttctac cggtaacacc atgaaagaag ttaaatctct gctgctggac 120

ctgcagctgc tgctggaaaa agttaaaaac ccggaaaacc tgaaactgtc tcgtatgcac 180

accttcaact tctacatgcc gaaagttaac gctaccgaac tgaaacacct gaaatgcctg 240

ctggaagaac tgaaactgct ggaagaagtt ctggacctgg ctccgtctaa aaacctgaac 300

acccgtgaaa tcaaagactc tatggacaac atcaaacgta tcgttctgga actgcagggt 360

tcggagacca ggttcacctg cgaatacgac gacgctaccg ttaaagctgt tgaattcctg 420

aacaaatgga tcaccttctg ccagtctatc tactctacca tgacc 465

<210> 8

<211> 498

<212> DNA

<213>Sheep IFN-γ

<400> 8

atgaaataca cctcttcttt cctggctctg ctgctgtgcg ttctgctggg tttctctggt 60

tcttacggtc agggtccgtt cttcaaagaa atcgaaaacc tgaaagaata cttcaacgct 120

tctaacccgg acgttgctaa aggtggtccg ctgttctctg aaatcctgaa aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaactgttc 240

gaaaacctga aagacaacca ggttatccag cgttctatgg acatcatcaa acaggacatg 300

ttccagaaat tcctgaacgg ttcttctgaa aaactggaag acttcaaacg tctgatccag 360

atcccggttg acgacctgca gatccagcgt aaagctatca acgaactgat caaagttatg 420

aacgacctgt ctccgaaatc taacctgcgt aaacgtaaac gttctcagaa cctgttccgt 480

ggtcgtcgtg cttctatg 498

<210> 9

<211> 588

<212> DNA

<213>Sheep IFN- τ

<400> 9

atggctttcg ttctgtctct gctgatggct ctggttctgg tttcttacgg tccgggtggt 60

tctctgggtt gctacctgtc tcagcgtctg atgctggacg ctcgtgaaaa cctgaaactg 120

ctggaccgta tgaaccgtct gtctccgcac tcttgcctgc aggaccgtaa agacttcggt 180

ctgccgcagg aaatggttga aggtgaccag ctgcagaaag accaggcttt cccggttctg 240

tacgaaatgc tgcagcagtc tttcaacctg ttctacaccg aacactcttc tgctgcttgg 300

gacaccaccc tgctggacca gctgtgcacc ggtctgcagc agcagctgga ccacctggac 360

acctgccgtg accaggttat gggtgaaaaa gactctgaac tgggtaacat ggacccgatc 420

gttaccgtta aaaaatactt ccagggtatc cacgactacc tgcaggaaaa aggttactct 480

gactgcgctt gggaaatcgt tcgtgttgaa atgatgcgtg ctctgaccgt ttctaccacc 540

ctgcagaaac gtctgaccaa aatgggtggt gacctgaact ctccgtaa 588

Claims

1. a kind of fusion protein being made of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau, it is characterised in that：It is described The amino acid sequence table of fusion protein is as shown in 400 < of SEQUENCE LISTING, 1 >.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 2 >；Or as shown in 400 < of SEQUENCE LISTING, 3 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of recombination sheep long-acting interferon, which is characterized in that the recombination sheep long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rIL2-IFN γ-IFN τ, preparation method are：

(1) design primer, is obtained or the sheep interleukin 2 of the flexible linker sequence of artificial synthesized band, sheep by reverse transcription The target gene of interferon gamma, sheep interferon-tau；Sheep interleukin 2, sheep interferon gamma, sheep are interfered by flexible linker The target gene of plain τ connects, the nucleotides sequence list of the target gene after connection such as 400 < of SEQUENCE LISTING, 2 > It is shown or as shown in 400 < of SEQUENCE LISTING, 3 >；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rIL2-IFN can be obtained γ-IFNτ。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of recombination sheep long-acting interferon according to claim 5, which is characterized in that the recombination sheep is long-acting dry The long half time of element is disturbed up to 60 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of sheep itself can be improved.