CN108864302A

CN108864302A - A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6

Info

Publication number: CN108864302A
Application number: CN201810752613.9A
Authority: CN
Inventors: 王亚男; 夏兵兵; 徐慕珍; 付超; 刘家炉; 蒋敏之; 高耀辉
Original assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Current assignee: Wuhu Phil Biological Products Industry Research Institute Co Ltd
Priority date: 2017-08-09
Filing date: 2018-07-10
Publication date: 2018-11-23
Also published as: CN107365390A

Abstract

The fusion protein and preparation method thereof that the invention discloses a kind of to be made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6; the fusion protein is connected through flexible linker by pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 and is formed, and is freeze-dried to obtain Recombinant Swine long-acting interferon after fusion protein and freeze drying protectant mixture.The Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, and the half-life period of more common pig interferon improves 23 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune response of pig itself.

Description

A kind of fusion egg being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 Bletilla preparation method

Technical field

The invention belongs to technical field of biological genetic engineering, and in particular to white thin by pig albumin, Porcine interferon-gamma and pig The fusion protein and preparation method thereof that born of the same parents' interleukin 2 forms.

Background technique

Scale Compact Develop is rapidly growing in China in recent years, and China's live pig breeding stock and pork production are sure to occupy First place in the world, traditional swine disease control method is far from the control for adapting to infectious disease in extensive intensive pig production production.I Newly there are nearly 20 kinds of livestock and poultry infectious diseases in the past 20 years in state, in addition original animal epidemic, causes aquaculture industry of China huge Economic loss.According to incompletely statistics, China is every year because various viral diseases cause mortality of livestock to be up to 15%-20%, Economic loss reaches billions of members.

Mainly pass through vaccine inoculation to the prevention and treatment approach of porcine viral diseases at present and uses antibiotic, but by It is not perfect in breeding environment, virus variation and Abwehrkraft des Koepers variation etc. reasons, make traditional prevention and treatment approach by Huge challenge, most of antibiotics and traditional oral antiviral medicament give people due to medicament residue problem Health is brought a negative impact；And traditional vaccine, high specific and side effect due to it, virus variation and new can not be resisted Type virus, which continuously emerges, gives pig aquaculture bring significant damage.

IFN is that a kind of virus infection induction body generates and has broad-spectrum antiviral, antitumor and with immunoregulation effect Protein, nineteen fifty-seven Issacs and Lindeman first discovery, it is a kind of multi-functional cell factor, with cell receptor knot After conjunction, it can induce body and generate a variety of specific proteins and enzyme, it is main by inhibiting viral gene transcription and degradation virus RNA inhibits the growth and breeding of virus and plays antitumor etc. activity.It is existing it is known that γ type IFN be T cell by activating and NK cell generates, and has relatively strong antiviral and immunoloregulation function.A large number of studies show that interferon gamma is in addition to broad-spectrum disease resistance Outside malicious function, crucial adjustment effect is also played to immune system, so IFN-γ is also known as immunological regulation interferon.Although each The interferon of seed type can reaction of the mediated cell to virus infection, but the immunoregulatory activity of interferon gamma coordinate exempt from Epidemic disease, which is reacted and determined, plays even more important effect in the long-term antiviral state of body, therefore interferon gamma is with particularly important Clinical value.

Cell factor IL-2, that is, interleukin 2 also known as t cell growth factor.Mainly generated by the T lymphocyte activated The cell factor with extensive bioactivity, can both promote lymphopoiesis, enhance immune function, but can restricted T it is thin Born of the same parents react and enhance the immune tolerance of body, therefore can be used for treating tumour, infectious diseases and autoimmune disease.In animal doctor In, since IL-2 can improve the immune response of vaccine and reduce the generation of disease, also there is wide application prospect.IL-2 is because of energy The immune level for enhancing body improves the disease resistance of body, thus exempts from for bacillary, viral and parasitic diseases Epidemic disease treatment.In addition, IL-2 can also influence the metabolism of drug, extend the metabolism time of drug, action time increases, to improve Curative effect of medication.IL-2, according to gene constructed, composition fusion protein, is generated and is mentioned to enhance the antibody of vaccine with other cell factors High cellular immune level.

Seralbumin is the important component of blood plasma, is not easy under normal circumstances through glomerulus, internal distributed pole it is wide and There is no zymetology and immunologic competence, is ideal pharmaceutical carrier.Albumin fusion technology has the advantage that：Albumin and target egg It is white to be linked in the cell through protein translation system by peptide bond, it is not required to additional extracorporeal treatment；The expression of albumin is higher, The expression of destination protein can be improved after merging with it；Albumin is one stable " inert protein ", after merging with it The stability of destination protein can be improved；Albumin fusion protein has longer drug half-life, by small molecular protein drug It can be expected to improve half-life period in blood with Albumin fusion.Currently, in experimental animal after multiple protein and Albumin fusion The extension of Half-life in vivo is confirmed.

The limitation of natural interferon and artificial recombination interferon generally existing half-life short at present, half-life period are generally 2-4 A hour.Half-life short brings great inconvenience, the increase for the treatment of number of times, corresponding time cost and economic cost to treatment Increase therewith, and the tenability limit of body is also possible to be broken the generation for leading to adverse reaction.The main reason for half-life short There are two：The too small tachytrophism in vivo of the molecular weight of interferon, interferon especially recombinant interferon affinity is poor to be exempted from Epidemic disease system is removed.

And common long-acting interferon is using polyethylene glycol fused interferon as representative on the market, only in the level of molecular weight Part solves the problems, such as that interferon molecule amount is small and leads to half-life short, while polyethylene glycol fused interferon cost is very Height is unfavorable for clinically applying.

Summary of the invention

It is situated between in order to solve the above technical problems, the present invention provides one kind by pig albumin, Porcine interferon-gamma and pig leucocyte The fusion proteins and preparation method thereof of 2 composition of element, and thus after fusion protein and freeze drying protectant mixture, freeze-dried system Standby to obtain a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is remarkably improved the half-life period of pig interferon, compared with The half-life period of common pig interferon improves 23 times or more, and has broad-spectrum disease resistance toxic action and can improve the immune of pig itself and answer It answers.

The technical scheme adopted by the invention is as follows：

A kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, the fusion protein Amino acid sequence table is as shown in 400 < of SEQUENCE LISTING, 1 >.

The present invention also provides the gene for encoding above-mentioned fusion protein, the nucleotides sequence list such as SEQUENCE of the gene Shown in 400 < of LISTING, 2 >, it is denoted as genome 1；Or as shown in 400 < of SEQUENCE LISTING, 3 >, it is denoted as genome 2.

Fusion protein described in the genome 1 and the equal codified of the genome 2.Genome 2 is the nucleosides to genome 1 Acid sequence optimize after as a result, when usual codon adaptation indexI CAI=1.0 be considered the gene in the expression system In be optimal high efficient expression state, CAI value is lower to show that expression is lower in host.Most ideal point of G/C content in gene Cloth range is 30~70%, is more than that the range will affect translation and transcriptional efficiency in any region.It is sent out using software detection The now codon of pig albumin, porcine IFN γ, pig IL-2 original gene codon adaptation indexI (CAI) difference in Escherichia coli It is 43.7%, 39.2%, 38.7% for 0.24,0.24,0.23, GC percentage；And by pig albumin, porcine IFN γ, pig It is 0.98,1.0,0.97, GC percentage that each gene codon adaptation indexI (CAI) in Escherichia coli is obtained after IL-2 gene optimization Than 50.3%, 45.4%, 47.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence of the son to protein expression, improves the G/C content of gene, improves transcription and translation efficiency.

The present invention also provides the expression vectors containing genome 1 or genome 2.

Further, the expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2.

The present invention also provides the genetic engineering bacteriums containing genome 1 or genome 2.

Further, the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2.

Host cell containing genome 1 or genome 2 also belongs to protection scope of the present invention, further, the place Chief cell is e. coli host cell, and further, the e. coli host cell is BL21 (DE3) competent cell Or BL21 (DE3) competent cell with pGro7 plasmid.

The present invention also provides a kind of Recombinant Swine long-acting interferon, the Recombinant Swine long-acting interferon is by the fusion egg It is freeze-dried to form after the white mixture with freeze drying protectant.

The freeze drying protectant is glycerol, mannitol and sucrose, is buffer, the final concentration of three with 10mmol/L PBS For glycerol 100mL/L, mannitol 0.12g/mL and sucrose 0.025g/mL.

The invention also discloses the preparation methods of the fusion protein, and the preparation method comprises the following steps：It will contain The expression vector of genome 1 or genome 2 is imported into e. coli host cell, obtains genetic engineering bacterium, genetic engineering bacterium The crude product of the fusion protein is obtained after IPTG inducing expression, and fusion protein can be obtained after purified.

The expression vector is the pET-32a coli expression carrier containing genome 1 or genome 2；

The genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, and preparation method is：

(1) design primer obtains by reverse transcription or is manually respectively synthesized the white egg of pig for connecting flexible linker sequence The target gene of white, Porcine interferon-gamma, pig interleukin 2 and 6；By flexible linker by pig albumin, Porcine interferon-gamma, pig The target gene of interleukin 2 connects, the nucleotides sequence list such as SEQUENCE of the target gene after connection Shown in 400 < of LISTING, 2 > or as shown in 400 < of SEQUENCE LISTING, 3 >；

(2) target gene after connection is connected on pET-32a plasmid and obtains expression vector；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb- can be obtained IFNγ-IL2。

The e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) sense with pGro7 plasmid By state cell.

The method of the purifying is：The crude product of fusion protein is successively through affinity chromatography, anion-exchange chromatography and molecular sieve Chromatographic purifying.

BL21 (DE3) competent cell with pGro7 plasmid is purchased from Shanghai Jinan Technology Co., Ltd./glad hundred promise Biology, article No. V205.

The acquisition methods of the genome 1 are：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F1：CATGCCATGGGATACATACA AGAGTGA has NcoI restriction enzyme site；

Downstream Alb-R1：

ACCACCACCAGAACCACCACCACCGGCTAAGATCCCTCG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGAGTTATACAACTT, with flexible linker；

Downstream IFN-γ-R1：

ACCACCACCAGAACCACCACCACCTTTTGATGCTCTCTGGCC, with flexible linker；

The primer sequence of pig interleukin 2 and 6 (IL-2) is：

Upstream IL-2-F1：

GGTGGTTCTGGTGGTGGTGGTTCTATGTATAAGATGCAGC, with flexible linker；

Downstream IL-2-R1：CCCTCGAGAGTCAGTGTTGAGTAG has XhoI restriction enzyme site；

B. RNA is extracted from pig liver, by reverse transcription obtain pig Alb, porcine IFN γ and pig IL-2 target gene, three The gene order of person respectively as shown in 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and Shown in 400 < of SEQUENCE LISTING, 6 >；

Respectively using the target gene of pig Alb, porcine IFN γ and pig IL-2 as template, and it is utilized respectively pig Alb, porcine IFN γ PCR amplification is carried out with the upstream and downstream primer of pig IL-2.

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1.5 μ L of template ribonucleic acid, upstream and downstream primer is each 0.5 μ L, 2.5 μ L, dNTP Mix of reverse transcriptase are 10 μ L, add RNase Free water to 25 μ L；The reaction of the RT-PCR reaction Condition is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 58 DEG C of annealing 45s, 72 DEG C are prolonged 1kb/min is stretched, is recycled 35 times, last 72 DEG C of extensions 10min.

C. rAlb-IFN γ gene is obtained using flexible linker connection pig Alb and porcine IFN γ target gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

D. rAlb-IFN γ-IL2 is obtained using flexible linker connection rAlb-IFN γ gene and pig IL-2 target gene Gene

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rAlb-IFN γ gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95℃ Initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

Genome 2 is artificial synthesized gene after optimizing to genome 1, the acquisition methods of the genome 2 For：

A. design of primers

The primer sequence of pig albumin (Alb) is：

Upstream Alb-F2：CATGCCATGGTGACACCTACAAATCTG has NcoI restriction enzyme site；

Downstream Alb-R2：

ACCACCACCAGAACCACCACCACCAGCCAGGATACCACG, with flexible linker；

The primer sequence of Porcine interferon-gamma (IFN-γ) is：

Upstream IFN-γ-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTCTTACACCACCT, with flexible linker；

Downstream IFN-γ-R2：

ACCACCACCAGAACCACCACCACCTTTAGAAGCACGCTG, with flexible linker；

Pig interleukin 2 and 6 (IL-2)：

Upstream IL-2-F2：

GGTGGTTCTGGTGGTGGTGGTTCTATGTACAAAATGCAGC, with flexible linker；

Downstream IL-2-R2：

CCCTCGAGGGTCAGGGTAGAGTAG has III restriction enzyme site of Hind.

B. the target gene of the pig Alb, porcine IFN γ and pig IL-2, the gene order of three is respectively such as SEQUENCE Shown in 400 < of LISTING, 7 >, 400 < of SEQUENCE LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >；

PCR reaction system and condition are：In the overall reaction system of 25 μ L, 1 μ L of genomic DNA, upstream and downstream primer is each 0.5 μ L, Taq archaeal dna polymerase, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；The RT-PCR reaction Reaction condition is：95 DEG C of initial denaturation 4min, into circulation；95 DEG C of denaturation 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min are followed Ring 35 times, last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, connect flexible linker's 1 μ L of Alb gene template DNA connects 1 μ L, Alb upstream primer of IFN-γ template DNA 0.5 the μ L, IFN- of flexible linker 0.5 μ L, Taq archaeal dna polymerase of γ downstream primer, 2.5 μ L, dNTP Mix is 10 μ L, adds RNase Free water to 25 μ L；Connection PCR reaction condition is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/ Min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The PCR reaction system and reaction condition of connection be：In the overall reaction system of 25 μ L, rAlb-IFN γ gene template 1 μ L of DNA connects 1 μ L, Alb upstream primer of IL-2 template DNA, 0.5 μ L, IL-2 downstream primer, the 0.5 μ L of flexible linker, 2.5 μ L, dNTP Mix of Taq archaeal dna polymerase is 10 μ L, adds RNase Free water to 25 μ L；Connecting PCR reaction condition is：95℃ Initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C extend 10min.

The present invention also provides the application of the Recombinant Swine long-acting interferon, long half time had up to 73 hours or more Broad-spectrum disease resistance toxic action and the immune response that pig itself can be improved.

Compared with prior art, the present invention has the advantages that：

1. pig Alb, porcine IFN γ and pig IL-2 gene are realized amalgamation and expression by flexibility linker, interferon is improved Half-life period improves 23 times or more compared with plain interferon；Compared with common polyethylene glycol fused interferon, significantly reduce Cost.

2. improving pig pig Alb, porcine IFN γ and pig by optimizing to pig Alb, porcine IFN γ and pig IL-2 gene The expression quantity of IL-2 fusion protein.

3. using recombination bacillus coli pET-32a/rAlb-IFN γ-IL2 as expression bacterial strain, by introducing molecular chaperones PGro7 plasmid, in protein expression, generation inclusion body is less, forms great amount of soluble albumen, avoids inclusion body denaturation and answers The process of property, substantially reduces the time of expressing fusion protein；

4. the fusion protein disclosed by the invention being made of pig Alb, porcine IFN γ and pig IL-2 not only has IFN-γ Broad-spectrum disease resistance toxic action, while significantly improving the immune response of pig itself.

Detailed description of the invention

Fig. 1 is that pig albumin gene, 2 gene of porcine interleukin and the Porcine interferon-gamma gene RT-PCR in embodiment 1 are expanded Result；Swimming lane M：DNA Marker DL2000；Swimming lane 1：2 gene RT-PCR amplified production of porcine interleukin；Swimming lane 2：Pig interference Plain γ gene RT-PCR amplified production；Swimming lane 3：Pig albumin gene RT-PCR amplified production；

Fig. 2 is the knot of the PCR amplification after pig Alb, the porcine IFN γ in embodiment 1 are connected with the target gene of pig IL-2 Fruit；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Pig albumin gene, Porcine interferon-gamma gene and pig interleukin 2 and 6 Gene ligation amplification product；

Fig. 3 is the PCR amplification and double digestion qualification result of the positive colony plasmid in embodiment 1；Swimming lane M：DNA Marker DL10000；Swimming lane 1：Recombinant plasmid double digestion result；Swimming lane 2：Plasmid PCR result；

Fig. 4 is the SDS-PAGE electrophoretic examinations result of the recombinant protein in embodiment 1；Swimming lane M：Albumen Marker；Swimming lane 1：It is precipitated after bacterial cell disruption after recombinant bacterium induction；Swimming lane 2：Supernatant after bacterial cell disruption after recombinant bacterium induction；Swimming lane 3：It is unloaded Control；

Fig. 5 is the Western Blot qualification result for the fusion protein that embodiment 1 obtains；Swimming lane M：Albumen Marker；Swimming Road 1：Supernatant after recombinant bacterium induction is broken；Swimming lane 2：It is precipitated after recombinant bacterium induction is broken；

Fig. 6 is that the Recombinant Swine long-acting interferon as made from the fusion protein in embodiment 1 causes cell to VSV in embodiment 5 The inhibiting effect of lesion；1 is VSV virus control wells；2 be HEp-2 cell control well；A3-12 is gradient dilution (from right to left) Human interferon standard items handle hole；B3-12 is that the Recombinant Swine long-acting interferon of gradient dilution (from right to left) handles hole；

Fig. 7 is the Recombinant Swine long-acting interferon intramuscular injection blood medicine as made from the fusion protein in embodiment 1 in embodiment 8 Concentration-time change curve.

Specific embodiment

Embodiment 1

A kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, preparation method is such as Under：

1. the acquisition of pig albumin (Alb), Porcine interferon-gamma (IFN-γ) and pig interleukin 2 and 6 (IL-2) target gene With amplification

Design of primers：

Synthetic primer is designed according to objective gene sequence reported in Genebank and is shown in Table 1, in the upstream of pig albumin NcoI restriction enzyme site and Linker sequence are introduced in primer and downstream primer respectively, upstream primer and downstream in Porcine interferon-gamma Linker sequence is introduced in primer respectively, introduces Linker respectively in the upstream primer and downstream primer of pig interleukin 2 and 6 III restriction enzyme site of sequence and Hind.

1 PCR amplification primer of table

RT-PCR obtains target gene：

RNA is extracted from pig liver tissue, and the target gene of pig Alb, porcine IFN γ and pig IL-2 is obtained by reverse transcription, The gene order of three is respectively such as 400 < of SEQUENCE LISTING, 4 >, 400 < of SEQUENCE LISTING, 5 > and SEQUENCE Shown in 400 < of LISTING, 6 >；

RT-PCR reaction system (25 μ L) is shown in Table 2

2 RT-PCR reaction system of table

Response parameter is：50 DEG C of reverse transcriptions 30min, 95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；58 DEG C are moved back Fiery 45s, 72 DEG C of extension 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 1780bp, 560bp and 490bp or so through agarose gel electrophoresis in RT-PCR amplified production, Its result is as shown in Figure 1, the target gene of pig Alb, porcine IFN γ and pig IL-2 has been prepared in explanation.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 3, table 4：

3 rAlb-IFN γ PCR reaction system of table

4 rAlb-IFN γ-IL2 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；58 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2770bp or so through agarose gel electrophoresis in pcr amplification product, result as shown in Fig. 2, Occur rAlb-IFN γ and IL-2 amplified product band in Fig. 2, this is because connected in rAlb-IFN γ with IL-2 gene In the process, there is non-specific responding.The nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 2 > institute Show.

3. expression vector establishment

For target gene after selection connection after sequencing is errorless, PCR glue recovery product and pET-32a plasmid use NcoI Double digestion and recycling are carried out with XhoI restriction enzyme, does double digestion by 20 μ L systems in table 5：

5 double digestion system of table

General buffer	2μL
		Restriction enzyme (a pair)	1μL+1μL
Carrier or recycling segment	2ul
		RNase Free water	14μL

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 6,4 DEG C overnight connection：

6 enzyme disjunctor system of table

Target fragment DNA	10μL
		Expression vector	3μL
buffer	2μL
		Ligase	1μL
RNase Free water	4μL

Connection product is converted into e. coli bl21 (DE3) competent cell, competent cell is coated on benzyl containing ammonia The LB culture medium flat plate of penicillin is incubated overnight；Single colonie on picking LB plate carries out target gene PCR identification, positive colony Bacteria plasmid identifies that being accredited as positive indicates that engineering bacteria constructs successfully, and PCR amplification and double digestion are produced through NcoI and XhoI double digestion Object detects single band at the place 2770bp or so through agarose gel electrophoresis, and result is as shown in Figure 3.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNγ-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, result is as schemed Shown in 4, it can be seen from the figure that be deposited in the place 119.8KD or so visible for supernatant after bacterial cell disruption after recombinant bacterium induction 5h Predominant expression band illustrates in precipitating and successful expression equal in supernatant fusion protein.

Mass volume ratio 1 is added:Precipitating is resuspended in 1 PBS；- 20 DEG C precipitate 3 times in room temperature multigelation；4 DEG C of ultrasound cracking Bacterial precipitation, work 10s, is spaced 3S, ultrasonic 6min, and whole process repeats 3~4 times；4 DEG C, 12000r/min is centrifuged 15min, Supernatant, inclusion body (inclusion body is through dissolution, refolding strategy) are taken respectively, obtain crude fusion protein.

5. fusion protein purification

5.1 His affinity chromatographys

After membrane filtration of the crude fusion protein with 0.22 μm of aperture, loading is by being connected to AKTA explorer 100 On protein purification system, the His affinity column balanced with Binding Buffer I (PBS) is washed away not with PBS buffer solution In conjunction with albumen, until A280nm stablizes, then with Elution buffer I (50mM trishydroxymethylaminomethane, 20~500mM Imidazoles, PH8.0) elution, collect rAlb-IFN γ-IL2 protein peak.

5.2 DEAE anion-exchange chromatographies

By the albumen collected after His affinitive layer purification displacement to (the 50mM trihydroxy methyl of Binding Buffer II Aminomethane, PH6.5) in after, loading by the DEAE anion exchange chromatography that has been balanced with Binding Buffer II, then After being stablized with the column of Binding Buffer II to A280nm value, with (the 50mM trihydroxy methyl amino first of Elution Buffer II Alkane, 1M NaCl, PH6.5) linear gradient elution, collect rAlb-IFN γ-IL2 protein peak.

5.3 sieve chromatography

Loading is by with III (50mM of Binding Buffer after the sample concentration that ion-exchange chromatography is collected into Na₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, it is washed with Binding Buffer III It is de-, collect rAlb-IFN γ-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualified；It is aseptic subpackaged, -80 DEG C save.The fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, amino acid sequence can be obtained Column are as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 2

A kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, other with embodiment 1, Only e. coli bl21 therein (DE3) competent cell is replaced in order to have BL21 (DE3) competence of pGro7 plasmid Cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 1,119.8KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 3

Pig Alb, porcine IFN γ and pig IL-2 in embodiment 1 is optimized, artificially synthesized pig Alb, porcine IFN γ and Pig IL-2 target gene, after optimization, the nucleotide sequence of three is respectively such as 400 < of SEQUENCE LISTING 7 >, SEQUENCE Shown in 400 < of LISTING 400 <, 8 > and SEQUENCE LISTING, 9 >.

1.1 codon optimization

Genetic codon has 64 kinds, but most biological tendencies are in utilizing a part in these codons.Those By the most frequent referred to as best codon (optimal codons) utilized, what those were not frequently utilized that is known as rare or utilizes The low codon of rate (rare or low-usage codons).In fact, common every kind of biology for doing protein expression or production (including Escherichia coli, yeast, mammalian cell, plant cell and insect cell) all shows the benefit of codon to a certain degree Difference or preference.The expression efficiency of the gene containing best codon is apparently higher than in Escherichia coli, yeast and drosophila and is contained The expression efficiency of the gene of the codon of poor efficiency.Therefore, in heterologous expression system, the preferences of codon are largely On affect the expression of recombinant protein.Using preference codon (preferred codons) and avoid utilizing rare codon Gene chemical synthesis is carried out, the redesign of this gene is codon optimization.Therefore, in the present embodiment to pig Alb, porcine IFN γ and Pig IL-2 gene codon optimizes.

Interpretation of result after 1.2 codon optimizations

It is optimal efficient in the expression system to be considered the gene when usual codon adaptation indexI (CAI)=1.0 Expression status, CAI value is lower to show that expression is lower in host.In gene G/C content most ideal distribution range be 30~ 70%, it is more than that the range will affect translation and transcriptional efficiency in any region.Pig Alb, pig are found using software detection The codon of IFN-γ and pig IL-2 original gene codon adaptation indexI (CAI) in Escherichia coli is respectively 0.24,0.24, 0.23, GC percentage is 43.7%, 39.2%, 38.7%；And by after to pig Alb, porcine IFN γ and pig IL-2 gene optimization Obtaining recombination codon adaptation indexI (CAI) in Escherichia coli is respectively 0.98,1.0,0.97, GC percentage 50.3%, 45.4%, 47.6%.The utilization rate of low codon is significantly reduced by gene optimization, avoids rare codon Influence to protein expression improves the G/C content of gene, improves transcription and translation efficiency, and then improves the table of recombinant protein Up to amount.

1.3 design of primers：

7 PCR amplification primer of table

The genomic DNA of pig Alb, porcine IFN γ and pig IL-2 after optimization are diluted to 0.05mg/mL respectively.It utilizes PCR amplification obtains target gene, and 25 μ L reaction systems are as shown in table 8：

8 PCR reaction system of table

RNase Free water	10.5μL
		dNTP Mix	10.0μL
Taq archaeal dna polymerase	2.5μL
		Upstream and downstream primer	Each 0.5 μ L
Genomic DNA	1.0μL

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：95 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

The pcr amplification product of pig Alb, porcine IFN γ and pig IL-2 are through agarose gel electrophoresis respectively in 1780bp, 560bp There is specific band with 490bp or so, the purpose base of pig Alb, porcine IFN γ and pig IL-2 after illustrating to be prepared optimization Cause.

2. the connection of target gene

Target gene is diluted to 10ug/mL, connects each section of target gene using over-lap PCR, 25 μ L reaction systems are such as Shown in table 9, table 10：

9 rAlb-IFN γ PCR reaction system of table

10 rAlb-IFN γ-IL2 PCR reaction system of table

Response parameter is：95 DEG C of initial denaturation 4min, into circulation：94 DEG C of denaturation 45s；60 DEG C of annealing 45s, 72 DEG C of extensions 1kb/min, totally 35 recycle；Last 72 DEG C of extensions 10min.

There is specific band in 2770bp or so through agarose gel electrophoresis in pcr amplification product, illustrate successfully to be connected RAlb-IFN γ-IL2 gene after connecing, the nucleotide sequence of obtained target gene such as 400 < of SEQUENCE LISTING, 3 > It is shown.

3. expression vector establishment

The glue recovery product for the PCR for selecting the target gene after connecting errorless after being sequenced is used with pET-32a plasmid NcoI, XhoI restriction enzyme carry out double digestion and recycling, do double digestion by 20 μ L systems in table 11：

11 double digestion system of table

The digestion recovery product of target gene and pET-32a plasmid after connection is attached by the system in table 12,4 DEG C overnight connection：

Table 12

Connection product is converted into e. coli bl21 (DE3) competent cell, competence is coated on the mould of benzyl containing ammonia It is incubated overnight in the LB plate of element；The bacterium colony grown on LB plate is taken to identify target gene, positive colony bacteria plasmid warp through PCR The identification of NcoI, XhoI double digestion, being accredited as positive indicates expression vector establishment success, and PCR amplification and double enzyme digestion product are through fine jade There is single band at the place 2770bp or so in sepharose electrophoresis, illustrates that the expression containing rAlb-IFN γ-IL2 fusion carries Body constructs successfully.

4. the expression of recombinant protein

Picking engineering bacteria 37 DEG C of shaking table recovery 1h, engineering bacteria in the LB culture medium containing 100 μ g/ml ampicillins are denoted as pET-32a/rAlb-IFNγ-IL2；Amplification culture 4h (OD ≈ 1.0) in LB culture medium (the 100 μ g/ml containing ampicillin), Final concentration 100 μ g/ml IPTG, 32 DEG C of inducing expression 5h is added；Thallus is collected, through SDS-PAGE electrophoresis detection, recombinant bacterium induction Supernatant is deposited in the visible predominant expression band in the place 119.8KD or so after bacterial cell disruption after 5h, illustrates in supernatant precipitating Recombinant protein is obtained.

5. fusion protein purification

5.1 His affinity chromatographys

5.2 DEAE anion-exchange chromatographies

5.3 sieve chromatography

Loading is by with Binding Buffer III after the sample concentration that ion-exchange chromatography is collected into (50mMNa₂HPO4,0.15M NaCl, PH7.4) 200 molecular sieve chromatography of Superdex has been balanced, with Binding Buffer III elution, collects rAlb-IFN γ-IL2 protein peak.

5.4 sample identification

Measure rAlb-IFN γ-IL2 potency and specific activity, specific activity >=10⁷U/mg, albumen are qualification；It is aseptic subpackaged ,- 80 DEG C of preservations.The fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, amino acid can be obtained Sequence is as shown in 400 < of SEQUENCE LISTING, 1 >.

Embodiment 4

A kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, other with embodiment 3, Only e. coli bl21 therein (DE3) competent cell is replaced in order to have BL21 (DE3) competence of pGro7 plasmid Cell.The SDS-PAGE electrophoresis result of its fusion protein is compareed with embodiment 3,119.8KD or so place's predominant expression in supernatant Band is thicker, illustrates after introducing molecular chaperones pGro7, expression of the destination protein in supernatant is more preferable, obtained fusion protein It measures higher.The albumen of Bacillus coli expression is mostly present in inclusion body；By introducing molecular chaperones in expression bacterial strain, assist It is correctly folded with expression albumen, reaches solubility expression of protein.

Embodiment 5

A kind of Recombinant Swine long-acting interferon, it is mixed with freeze drying protectant respectively by the fusion protein in embodiment 1,2,3,4 Later, freeze-dried to form.The freeze drying protectant is glycerol, mannitol and sucrose, is buffer with 10mmol/L PBS, Final concentration of glycerol 100mL/L, mannitol 0.12g/mL and the sucrose 0.025g/mL of three.

Embodiment 6

Examples 1 to 4 obtains the mirror for the fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 It is fixed

The quantitative detection of 6.1 protein contents

With Lowry method, standard test is made with the standard protein of Chinese food pharmaceutical biological product calibrating institute, measures embodiment 1~4 obtained fusion protein concentration is all larger than 1.1mg/ml.

6.2 SDS-PAGE electrophoresis detections

Compared with empty bacterium, fusion protein has the newly-increased protein band of a dense dye in 119.8KD or so, as shown in Figure 4.

6.3 Western Blot results

Fusion protein in Examples 1 to 4 is detected, respectively with the anti-pig gamma interferon (1 of abcam company mouse:5000 dilutions) be Primary antibody, using goat anti-mouse IgG-HRP as secondary antibody (1:10000 dilutions).Recombinant Swine long-acting interferon sample can be interfered with anti-pig Specific reaction occurs for plain γ monoclonal antibody, and specific band occurs in the place 119.8KD or so, as shown in Figure 5.

Embodiment 7

The freeze-dried bioactivity of four parts of Recombinant Swine long-acting interferons in embodiment 5

Inhibit method according to few cells lesion, Hep-2 cell is made into 5 × 10 with culture medium⁵Cell/ml cell suspends Liquid, every hole inoculation 0.1ml move into 96 porocyte culture plates.37 DEG C, 5%CO₂For 24 hours, the Recombinant Swine that various dose is added is long for culture Interferon is imitated, inhales abandon afterwards for 24 hours, then inoculation 100TCID50VSV virus respectively.

Test result

The result shows that the Recombinant Swine long-acting interferon obtained causes the lesion of HEp-2 cell to have apparent inhibit VSV Effect.The lesions such as there is cell rounding, falls off, is disintegrated after untreated cell inoculation virus.And the Recombinant Swine obtained is long After imitating interferon treated cell inoculation virus, it is observed continuously under inverted microscope, cellular morphology is normal, does not occur any Lesion measures potency >=10⁷U/ml, as shown in Figure 6.

Embodiment 8

The four parts of Recombinant Swine long-acting interferons obtained respectively by the fusion protein of Examples 1 to 4 in embodiment 5 are freeze-dried The measurement of (being denoted as A, B, C, D respectively) in pig intracorporal half-life period

The blood concentration and time relationship of cytopathic-effect inhibition assay measurement rAlb-IFN γ-IL2

The pig (half male and half female) that six weight are roughly the same is taken, neck is subcutaneously injected 2mg/ml Recombinant Swine long-acting interferon and freezes Dry agent 2ml, respectively 1h, 3h, 6h, 12h, for 24 hours, 48h, 72h, 96h, 120h venous blood collection, 4 DEG C of blood sample solidifications, 3500rpm is low Temperature centrifugation 10min separates serum, and every pig blood sample of each time point is to be measured in -20 DEG C of preservations.Blood is measured using cytopathic-effect inhibition assay The concentration of rAlb-IFN γ-IL2 in final proof product is carried out curve fitting and calculating parameter with DAS pharmacokinetics software.Parameter calculates knot Fruit is shown in Table 13.

Dominant dynamic parameters in serum after 13 Recombinant Swine long-acting interferon intramuscular injection of table

The result shows that Recombinant Swine long-acting interferon has longer half-life period.Half-life period can reach 94h or so after measured, more general Logical interferon improves about 23 times.

Embodiment 9

The freeze-dried measurement that pig cell immune response is influenced of four parts of Recombinant Swine long-acting interferons in embodiment 5

It takes six roughly the same pork pigs of weight to be divided into two groups, is denoted as experimental group and control group；Experimental group neck is subcutaneously infused The 2mg/ml freeze-dried 2ml of Recombinant Swine long-acting interferon is penetrated, the PBS of 2mL is subcutaneously injected in control group neck, after taking injection 4 weeks outside pig All blood takes weekly a blood later, separates lymphocyte using lymphocyte separation medium, lymphocyte passes through serum-free RPMI It after 1640 culture mediums wash 2 times, is resuspended with complete medium, adjustment cell concentration is 2 × 10⁶A/ml, 24 porocyte culture plates are every Hole addition 1ml lymphocyte, 37 DEG C, 5%CO₂72h is cultivated, supernatant when collecting lymphocyte culture.ELISA detects culture supernatant Middle IL-4 content, is carried out by kit specification, and testing result is as shown in table 14：

It is horizontal that 14 ELISA of table detects each group pig cell immune response

The result shows that containing for cell factor IL-4 in pig peripheral blood can be significantly improved after injection Recombinant Swine long-acting interferon Amount enhances cellullar immunologic response level, significantly improves immunity level.

It is above-mentioned referring to embodiment to a kind of fusion egg being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 The detailed description that bletilla preparation method carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention it It is interior.

SEQUENCE LISTING

<110>Wuhu Co., Ltd of Ying Tefeier biological products industrial research institute

<120>A kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 and its preparation side

Method

<130> 1

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 923

<212> PRT

<213>Fusion protein

<400> 1

Asp Thr Tyr Lys Ser Glu Ile Ala His Arg Phe Lys Asp Leu Gly Glu

1 5 10 15

Gln Tyr Phe Lys Gly Leu Val Leu Ile Ala Phe Ser Gln His Leu Gln

20 25 30

Gln Cys Pro Tyr Glu Glu His Val Lys Leu Val Arg Glu Val Thr Glu

35 40 45

Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys

50 55 60

Ser Ile His Thr Leu Phe Gly Asp Lys Leu Cys Ala Ile Pro Ser Leu

65 70 75 80

Arg Glu His Tyr Gly Asp Leu Ala Asp Cys Cys Glu Lys Glu Glu Pro

85 90 95

Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asn Asp Asn Pro Asp Ile

100 105 110

Pro Lys Leu Lys Pro Asp Pro Val Ala Leu Cys Ala Asp Phe Gln Glu

115 120 125

Asp Glu Gln Lys Phe Trp Gly Lys Tyr Leu Tyr Glu Ile Ala Arg Arg

130 135 140

His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Tyr Tyr Ala Ile Ile Tyr

145 150 155 160

Lys Asp Val Phe Ser Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys

165 170 175

Leu Leu Pro Lys Ile Glu His Leu Arg Glu Lys Val Leu Thr Ser Ala

180 185 190

Ala Lys Gln Arg Leu Lys Cys Ala Ser Ile Gln Lys Phe Gly Glu Arg

195 200 205

Ala Phe Lys Ala Trp Ser Leu Ala Arg Leu Ser Gln Arg Phe Pro Lys

210 215 220

Ala Asp Phe Thr Glu Ile Ser Lys Ile Val Thr Asp Leu Ala Lys Val

225 230 235 240

His Lys Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg

245 250 255

Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Thr Ile Ser Thr

260 265 270

Lys Leu Lys Glu Cys Cys Asp Lys Pro Leu Leu Glu Lys Ser His Cys

275 280 285

Ile Ala Glu Ala Lys Arg Asp Glu Leu Pro Ala Asp Leu Asn Pro Leu

290 295 300

Glu His Asp Phe Val Glu Asp Lys Glu Val Cys Lys Asn Tyr Lys Glu

305 310 315 320

Ala Lys His Val Phe Leu Gly Thr Phe Leu Tyr Glu Tyr Ser Arg Arg

325 330 335

His Pro Asp Tyr Ser Val Ser Leu Leu Leu Arg Ile Ala Lys Ile Tyr

340 345 350

Glu Ala Thr Leu Glu Asp Cys Cys Ala Lys Glu Asp Pro Pro Ala Cys

355 360 365

Tyr Ala Thr Val Phe Asp Lys Phe Gln Pro Leu Val Asp Glu Pro Lys

370 375 380

Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Lys Leu Gly Glu Tyr

385 390 395 400

Gly Phe Gln Asn Ala Leu Ile Val Arg Tyr Thr Lys Lys Val Pro Gln

405 410 415

Val Ser Thr Pro Thr Leu Val Glu Val Ala Arg Lys Leu Gly Leu Val

420 425 430

Gly Ser Arg Cys Cys Lys Arg Pro Glu Glu Glu Arg Leu Ser Cys Ala

435 440 445

Glu Asp Tyr Leu Ser Leu Val Leu Asn Arg Leu Cys Val Leu His Glu

450 455 460

Lys Thr Pro Val Ser Glu Lys Val Thr Lys Cys Cys Thr Glu Ser Leu

465 470 475 480

Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Thr Pro Asp Glu Thr Tyr

485 490 495

Lys Pro Lys Glu Phe Val Glu Gly Thr Phe Thr Phe His Ala Asp Leu

500 505 510

Cys Thr Leu Pro Glu Asp Glu Lys Gln Ile Lys Lys Gln Thr Ala Leu

515 520 525

Val Glu Leu Leu Lys His Lys Pro His Ala Thr Glu Glu Gln Leu Arg

530 535 540

Thr Val Leu Gly Asn Phe Ala Ala Phe Val Gln Lys Cys Cys Ala Ala

545 550 555 560

Pro Asp His Glu Ala Cys Phe Ala Val Glu Gly Pro Lys Phe Val Ile

565 570 575

Glu Ile Arg Gly Ile Leu Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly

580 585 590

Ser Met Ser Tyr Thr Thr Tyr Phe Leu Ala Phe Gln Leu Cys Val Thr

595 600 605

Leu Cys Phe Ser Gly Ser Tyr Cys Gln Ala Pro Phe Phe Lys Glu Ile

610 615 620

Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser Thr Ser Gly Val Pro Asn

625 630 635 640

Gly Gly Pro Leu Phe Leu Glu Ile Leu Glu Asn Trp Lys Glu Glu Ser

645 650 655

Asp Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe

660 665 670

Phe Glu Ile Phe Lys Asp Asn Gln Ala Ile Gln Arg Ser Met Asp Val

675 680 685

Ile Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Gly Lys

690 695 700

Leu Asn Asp Phe Glu Lys Leu Val Lys Ile Pro Val Asp Asn Leu Gln

705 710 715 720

Ile Gln Arg Lys Ala Ile Ser Glu Leu Ile Lys Val Met Asn Asp Leu

725 730 735

Ser Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Thr Met Phe

740 745 750

Gln Gly Gln Arg Ala Ser Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly

755 760 765

Ser Met Tyr Lys Met Gln Leu Leu Cys Cys Ile Ala Leu Thr Leu Ala

770 775 780

Leu Met Ala Asn Gly Ala Pro Thr Ser Ser Ser Thr Lys Asn Thr Lys

785 790 795 800

Lys Gln Leu Glu Pro Leu Leu Leu Asp Leu Gln Leu Leu Leu Lys Glu

805 810 815

Val Lys Asn Tyr Glu Asn Ala Asp Leu Ser Arg Met Leu Thr Phe Lys

820 825 830

Phe Tyr Met Pro Lys Gln Ala Thr Glu Leu Lys His Leu Gln Cys Leu

835 840 845

Val Glu Glu Leu Lys Ala Leu Glu Gly Val Leu Asn Leu Gly Gln Ser

850 855 860

Lys Asn Ser Asp Ser Ala Asn Ile Lys Glu Ser Met Asn Asn Ile Asn

865 870 875 880

Val Thr Val Leu Glu Leu Lys Gly Ser Glu Thr Ser Phe Lys Cys Glu

885 890 895

Tyr Asp Asp Glu Thr Val Thr Ala Val Glu Phe Leu Asn Lys Trp Ile

900 905 910

Thr Phe Cys Gln Ser Ile Tyr Ser Thr Leu Thr

915 920

<210> 2

<211> 2769

<212> DNA

<213>Genome 1

<400> 2

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagccg gtggtggtgg ttctggtggt ggtggttcta tgagttatac aacttatttc 1800

ttagcttttc agctttgcgt gactttgtgt ttttctggct cttactgcca ggcgcccttt 1860

tttaaagaaa taacgatcct aaaggactat tttaatgcaa gtacctcagg tgtacctaat 1920

ggtggacctc ttttcttaga aattttggag aattggaaag aggagagtga caaaaaaata 1980

attcagagcc aaattgtctc cttctacttc aaattctttg aaatcttcaa agataaccag 2040

gccattcaaa ggagcatgga tgtgatcaag caagacatgt ttcagaggtt cctaaatggt 2100

agctctggga aactgaatga cttcgaaaag ctggttaaaa ttccggtaga taatctgcag 2160

atccagcgca aagccatcag tgaactcatc aaagtgatga atgatctgtc accaagatct 2220

aacctaagaa agcggaagag aagtcagact atgttccaag gccagagagc atcaaaaggt 2280

ggtggtggtt ctggtggtgg tggttctatg tataagatgc agctcttgtg ttgcattgca 2340

ctaacccttg cactcatggc aaacggtgca cctacttcaa gctctacaaa gaacacaaag 2400

aaacaactgg agccattgct gctggattta cagttgcttt tgaaggaagt taagaattac 2460

gagaatgctg atctctccag gatgctcaca tttaaatttt acatgcccaa gcaggctaca 2520

gaattgaaac accttcagtg tttagtagaa gaactcaaag ctctggaggg agtgctaaat 2580

ttaggtcaaa gcaaaaactc tgactcagca aatatcaagg aatcaatgaa caatatcaac 2640

gtaacagttt tggaactaaa gggatctgaa acaagtttca aatgtgaata tgatgatgag 2700

acagtaactg ctgttgaatt tctgaacaaa tggattacct tttgtcaaag catctactca 2760

acactgact 2769

<210> 3

<211> 2769

<212> DNA

<213>Genome 2

<400> 3

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggctg gtggtggtgg ttctggtggt ggtggttcta tgtcttacac cacctacttc 1800

ctggctttcc agctgtgcgt taccctgtgc ttctctggtt cttactgcca ggctccgttc 1860

ttcaaagaaa tcaccatcct gaaagactac ttcaacgctt ctacctctgg tgttccgaac 1920

ggtggtccgc tgttcctgga aatcctggaa aactggaaag aagaatctga caaaaaaatc 1980

atccagtctc agatcgtttc tttctacttc aaattcttcg aaatcttcaa agacaaccag 2040

gctatccagc gttctatgga cgttatcaaa caggacatgt tccagcgttt cctgaacggt 2100

tcttctggta aactgaacga cttcgaaaaa ctggttaaaa tcccggttga caacctgcag 2160

atccagcgta aagctatctc tgaactgatc aaagttatga acgacctgtc tccgcgttct 2220

aacctgcgta aacgtaaacg ttctcagacc atgttccagg gtcagcgtgc ttctaaaggt 2280

ggtggtggtt ctggtggtgg tggttctatg tacaaaatgc agctgctgtg ctgcatcgct 2340

ctgaccctgg ctctgatggc taacggtgct ccgacctctt cttctaccaa aaacaccaaa 2400

aaacagctgg aaccgctgct gctggacctg cagctgctgc tgaaagaagt taaaaactac 2460

gaaaacgctg acctgtctcg tatgctgacc ttcaaattct acatgccgaa acaggctacc 2520

gaactgaaac acctgcagtg cctggttgaa gaactgaaag ctctggaagg tgttctgaac 2580

ctgggtcagt ctaaaaactc tgactctgct aacatcaaag aatctatgaa caacatcaac 2640

gttaccgttc tggaactgaa aggctcggaa accagcttca aatgcgaata cgacgacgaa 2700

accgttaccg ctgttgaatt cctgaacaaa tggatcacct tctgccagtc tatctactct 2760

accctgacc 2769

<210> 4

<211> 1749

<212> DNA

<213>Pig albumin

<400> 4

gatacataca agagtgaaat tgctcatcgg tttaaagatt tgggagaaca atatttcaaa 60

ggcctagtgc tgattgcctt ttctcagcat ctccagcaat gcccatatga agagcatgtg 120

aaattagtga gggaagtaac tgagtttgca aaaacatgtg ttgctgatga gtcagctgaa 180

aattgtgaca agtcaattca cactctcttt ggagataaat tatgtgcaat tccatccctt 240

cgtgaacact atggtgactt ggctgactgc tgtgaaaaag aagagcctga gagaaacgaa 300

tgcttcctcc aacacaaaaa tgataacccc gacatcccta aattgaaacc agaccctgtt 360

gctttatgcg ctgacttcca ggaagatgaa cagaagtttt ggggaaaata cctatatgaa 420

attgccagaa gacatcccta tttctacgcc ccagaactcc tttattatgc cattatatat 480

aaagatgttt tttcagaatg ctgccaagct gctgataaag ctgcctgcct gttaccaaag 540

attgagcatc tgagagaaaa agtactgact tccgccgcca aacagagact taagtgtgcc 600

agtatccaaa aattcggaga gagagctttc aaagcatggt cattagctcg cctgagccag 660

agatttccca aggctgactt tacagagatt tccaagatag tgacagatct tgcaaaagtc 720

cacaaggaat gctgccatgg tgacctgctt gaatgtgcag atgacagggc ggatcttgcc 780

aaatatatat gtgaaaatca agacacaatc tccactaaac tgaaggaatg ctgtgataag 840

cctctgttgg aaaaatccca ctgcattgct gaggcaaaaa gagatgaatt gcctgcagac 900

ctgaacccat tagaacatga ttttgttgaa gataaggaag tttgtaaaaa ctataaagaa 960

gcaaagcatg tcttcctggg cacgtttttg tatgagtatt caagaaggca cccagactac 1020

tctgtctcat tgctgctgag aattgccaag atatatgaag ccacactgga ggactgctgt 1080

gccaaagagg atcctccggc atgctatgcc acagtgtttg ataaatttca gcctcttgtg 1140

gatgagccta agaatttaat caaacaaaac tgtgaacttt ttgaaaaact tggagagtat 1200

ggattccaaa atgcgctcat agttcgttac accaagaaag taccccaagt gtcaactcca 1260

actcttgtgg aggtcgcaag aaaactagga ctagtgggct ctaggtgttg taagcgtcct 1320

gaagaagaaa gactgtcctg tgctgaagac tatctgtccc tggtcctgaa ccggttgtgc 1380

gtgttgcacg agaagacacc agtgagcgaa aaagttacca aatgctgcac agagtccttg 1440

gtgaacagac ggccttgctt ttctgctctg acaccagacg aaacatacaa acccaaagaa 1500

tttgttgagg gaaccttcac cttccatgca gacctatgca cacttcctga ggatgagaaa 1560

caaatcaaga agcaaactgc actcgttgag ttgttgaaac acaagcctca tgcaacagag 1620

gaacaactga gaactgtcct gggcaacttt gcagcctttg tacaaaagtg ctgcgccgct 1680

cctgaccatg aggcctgctt tgctgtggag ggtccgaaat ttgttattga aattcgaggg 1740

atcttagcc 1749

<210> 5

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 5

atgagttata caacttattt cttagctttt cagctttgcg tgactttgtg tttttctggc 60

tcttactgcc aggcgccctt ttttaaagaa ataacgatcc taaaggacta ttttaatgca 120

agtacctcag gtgtacctaa tggtggacct cttttcttag aaattttgga gaattggaaa 180

gaggagagtg acaaaaaaat aattcagagc caaattgtct ccttctactt caaattcttt 240

gaaatcttca aagataacca ggccattcaa aggagcatgg atgtgatcaa gcaagacatg 300

tttcagaggt tcctaaatgg tagctctggg aaactgaatg acttcgaaaa gctggttaaa 360

attccggtag ataatctgca gatccagcgc aaagccatca gtgaactcat caaagtgatg 420

aatgatctgt caccaagatc taacctaaga aagcggaaga gaagtcagac tatgttccaa 480

ggccagagag catcaaaa 498

<210> 6

<211> 462

<212> DNA

<213>Pig IL-2

<400> 6

atgtataaga tgcagctctt gtgttgcatt gcactaaccc ttgcactcat ggcaaacggt 60

gcacctactt caagctctac aaagaacaca aagaaacaac tggagccatt gctgctggat 120

ttacagttgc ttttgaagga agttaagaat tacgagaatg ctgatctctc caggatgctc 180

acatttaaat tttacatgcc caagcaggct acagaattga aacaccttca gtgtttagta 240

gaagaactca aagctctgga gggagtgcta aatttaggtc aaagcaaaaa ctctgactca 300

gcaaatatca aggaatcaat gaacaatatc aacgtaacag ttttggaact aaagggatct 360

gaaacaagtt tcaaatgtga atatgatgat gagacagtaa ctgctgttga atttctgaac 420

aaatggatta ccttttgtca aagcatctac tcaacactga ct 462

<210> 7

<211> 1749

<212> DNA

<213>Pig albumin

<400> 7

gacacctaca aatctgaaat cgctcaccgt ttcaaagacc tgggtgaaca gtacttcaaa 60

ggtctggttc tgatcgcttt ctctcagcac ctgcagcagt gcccgtacga agaacacgtt 120

aaactggttc gtgaagttac cgaattcgct aaaacctgcg ttgctgacga atctgctgaa 180

aactgcgaca aatctatcca caccctgttc ggtgacaaac tgtgcgctat cccgtctctg 240

cgtgaacact acggtgacct ggctgactgc tgcgaaaaag aagaaccgga acgtaacgaa 300

tgcttcctgc agcacaaaaa cgacaacccg gacatcccga aactgaaacc ggacccggtt 360

gctctgtgcg ctgacttcca ggaagacgaa cagaaattct ggggtaaata cctgtacgaa 420

atcgctcgtc gtcacccgta cttctacgct ccggaactgc tgtactacgc tatcatctac 480

aaagacgttt tctctgaatg ctgccaggct gctgacaaag ctgcttgcct gctgccgaaa 540

atcgaacacc tgcgtgaaaa agttctgacc tctgctgcta aacagcgtct gaaatgcgct 600

tctatccaga aattcggtga acgtgctttc aaagcttggt ctctggctcg tctgtcgcag 660

aggttcccga aagctgactt caccgaaatc tctaaaatcg ttaccgacct ggctaaagtt 720

cacaaagaat gctgccacgg tgacctgctg gaatgcgctg acgaccgtgc tgacctggct 780

aaatacatct gcgaaaacca ggacaccatc tctaccaaac tgaaagaatg ctgcgacaaa 840

ccgctgctgg aaaaatctca ctgcatcgct gaagctaaac gtgacgaact gccggctgac 900

ctgaacccgc tggaacacga cttcgttgaa gataaggaag tgtgcaaaaa ctacaaagaa 960

gctaaacacg ttttcctggg taccttcctg tacgaatact ctcgtcgtca cccggactac 1020

tctgtttctc tgctgctgcg tatcgctaaa atctacgaag ctaccctgga agactgctgc 1080

gctaaagaag acccgccggc ttgctacgct accgttttcg acaaattcca gccgctggtt 1140

gacgaaccga aaaacctgat caaacagaac tgcgaactgt tcgaaaaact gggtgaatac 1200

ggtttccaga acgctctgat cgttcgttac accaaaaaag ttccgcaggt ttctaccccg 1260

accctggttg aagttgctcg taaactgggt ctggttggtt ctcgttgctg caaacgtccg 1320

gaagaagaac gtctgtcttg cgctgaagac tacctgtctc tggttctgaa ccgtctgtgc 1380

gttctgcacg aaaaaacccc ggtttctgaa aaagttacca aatgctgcac cgaatctctg 1440

gttaaccgtc gtccgtgctt ctctgctctg accccggacg aaacctacaa accgaaagaa 1500

ttcgttgaag gtaccttcac cttccacgct gacctgtgca ccctgccgga agacgaaaaa 1560

cagatcaaaa aacagaccgc tctggttgaa ctgctgaaac acaaaccgca cgctaccgaa 1620

gaacagctgc gtaccgttct gggtaacttc gctgctttcg ttcagaaatg ctgcgctgct 1680

ccggaccacg aagcttgctt cgctgttgaa ggtccgaaat tcgttatcga aatccgtggt 1740

atcctggct 1749

<210> 8

<211> 498

<212> DNA

<213>Porcine IFN γ

<400> 8

atgtcttaca ccacctactt cctggctttc cagctgtgcg ttaccctgtg cttctctggt 60

tcttactgcc aggctccgtt cttcaaagaa atcaccatcc tgaaagacta cttcaacgct 120

tctacctctg gtgttccgaa cggtggtccg ctgttcctgg aaatcctgga aaactggaaa 180

gaagaatctg acaaaaaaat catccagtct cagatcgttt ctttctactt caaattcttc 240

gaaatcttca aagacaacca ggctatccag cgttctatgg acgttatcaa acaggacatg 300

ttccagcgtt tcctgaacgg ttcttctggt aaactgaacg acttcgaaaa actggttaaa 360

atcccggttg acaacctgca gatccagcgt aaagctatct ctgaactgat caaagttatg 420

aacgacctgt ctccgcgttc taacctgcgt aaacgtaaac gttctcagac catgttccag 480

ggtcagcgtg cttctaaa 498

<210> 9

<211> 462

<212> DNA

<213>Pig IL-2

<400> 9

atgtacaaaa tgcagctgct gtgctgcatc gctctgaccc tggctctgat ggctaacggt 60

gctccgacct cttcttctac caaaaacacc aaaaaacagc tggaaccgct gctgctggac 120

ctgcagctgc tgctgaaaga agttaaaaac tacgaaaacg ctgacctgtc tcgtatgctg 180

accttcaaat tctacatgcc gaaacaggct accgaactga aacacctgca gtgcctggtt 240

gaagaactga aagctctgga aggtgttctg aacctgggtc agtctaaaaa ctctgactct 300

gctaacatca aagaatctat gaacaacatc aacgttaccg ttctggaact gaaaggctcg 360

gaaaccagct tcaaatgcga atacgacgac gaaaccgtta ccgctgttga attcctgaac 420

aaatggatca ccttctgcca gtctatctac tctaccctga cc 462

Claims

1. a kind of fusion protein being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6, it is characterised in that：It is described The amino acid sequence table of fusion protein is denoted as fusion protein 1 as shown in 400 < of SEQUENCE LISTING, 1 >；Or such as Shown in 400 < of SEQUENCE LISTING, 2 >, it is denoted as fusion protein 2.

2. a kind of gene for encoding fusion protein as described in claim 1, which is characterized in that the nucleotide sequence of the gene Table is denoted as genome 1 as shown in 400 < of SEQUENCE LISTING, 3 >；Or as shown in 400 < of SEQUENCE LISTING, 4 >, It is denoted as genome 2.

3. containing the expression vector of gene as claimed in claim 2.

4. containing the genetic engineering bacterium of gene as claimed in claim 2.

5. a kind of Recombinant Swine long-acting interferon, which is characterized in that the Recombinant Swine long-acting interferon is melted by described in claim 1 It is freeze-dried to form after hop protein and freeze drying protectant mixture.

6. the preparation method of fusion protein according to claim 1, which is characterized in that the preparation method includes following step Suddenly：Expression vector as claimed in claim 3 is imported into e. coli host cell, genetic engineering bacterium, genetic engineering are obtained Bacterium obtains the crude product of the fusion protein after IPTG inducing expression, and fusion protein can be obtained after purified.

7. preparation method according to claim 6, which is characterized in that the genetic engineering bacterium is pET-32a/rAlb-IFN γ-IL2, preparation method are：

(1) design primer obtains by reverse transcription or is manually respectively synthesized the pig albumin for connecting flexible linker sequence, pig The target gene of interferon gamma, pig interleukin 2 and 6；By flexible linker by pig albumin, Porcine interferon-gamma, pig leucocyte The target gene of interleukin 2 connects, the nucleotides sequence list of the target gene after connection such as SEQUENCE LISTING 400 Shown in 3 > of < or as shown in 400 < of SEQUENCE LISTING, 4 >；

(3) expression vector is imported into e. coli host cell, genetic engineering bacterium pET-32a/rAlb-IFN can be obtained γ-IL2。

8. preparation method according to claim 6 or 7, which is characterized in that the e. coli host cell is BL21 (DE3) competent cell or BL21 (DE3) competent cell with pGro7 plasmid.

9. preparation method according to claim 6 or 7, which is characterized in that the method for the purifying is：Fusion protein it is thick Product are successively through affinity chromatography, anion-exchange chromatography and molecular sieve chromatography purification.

10. the application of Recombinant Swine long-acting interferon according to claim 5, which is characterized in that the Recombinant Swine is long-acting dry The long half time of element is disturbed up to 94 hours or more, there is broad-spectrum disease resistance toxic action and the immune response of pig itself can be improved.