CN108676083B

CN108676083B - Sheep gamma interferon mutant and preparation method and application thereof

Info

Publication number: CN108676083B
Application number: CN201810516436.4A
Authority: CN
Inventors: 程奇; 张志芳; 李轶女
Original assignee: Zhejiang Shance Heqishi Biological Technology Co ltd
Current assignee: Hangzhou Heknight Future Biotechnology Co ltd
Priority date: 2018-05-25
Filing date: 2018-05-25
Publication date: 2022-01-28
Anticipated expiration: 2038-05-25
Also published as: CN108676083A

Abstract

The invention provides a sheep gamma interferon, a sheep gamma interferon mutant and a recombinant vector or a recombinant host cell containing the sheep gamma interferon or the sheep gamma interferon mutant, wherein the sheep gamma interferon or the sheep gamma interferon mutant can be used for preparing a medicament or a reagent for preventing or treating sheep viral diseases. The invention expresses the sheep gamma interferon mutant by utilizing a silkworm baculovirus expression system in a silkworm bioreactor, greatly improves the antiviral activity, has simple process, can quickly obtain a large amount of safe and reliable sheep gamma interferon, and has great significance for the development of animal husbandry.

Description

Sheep gamma interferon mutant and preparation method and application thereof

Technical Field

The invention belongs to the field of veterinary medicine, and particularly relates to a sheep gamma interferon mutant and a preparation method and application thereof.

Background

Interferons are a class of proteins with antiviral activity on cells of the same species, whose activity is in turn regulated and controlled by the genome of the cell, involving the synthesis of RNA and proteins. The IFN protein family is classified into type I, type II and type III interferons according to the sequence of its coding gene, chromosomal localization and receptor specificity. The type I interferons include IFN-alpha, IFN-beta, IFN-omega, IFN-delta, IFN-epsilon, IFN-zeta, IFN-tau, and the like, and in mammals primarily IFN-alpha and IFN-beta. The I-type interferon has strong antiviral activity, mainly inhibits the multiplication of viruses by interfering the replication of the viruses, and also has the functions of resisting tumors and regulating immunity. Type II interferons, which are also called immuno-interferons, have only one member of IFN-gamma and mainly act to activate macrophages to kill microorganisms. Type III interferons are newly discovered cytokines that include λ 1(IL-29), λ 2(IL-28a), and λ 3(IL-28 b). Type III interferons are closely related to type I interferons, but have specific physiological functions, such as stimulating the activation and expression of Major Histocompatibility Complex (MHC) molecules, modulating innate and acquired immunity, and the like. Because of its broad-spectrum antiviral and antitumor activities and strong immunoregulation action, interferon has become one of the research hotspots in the relevant fields of virology, cytology, molecular biology, clinical medicine, immunology, oncology, etc.

The member IFN-gamma of type II interferon is mainly expressed by activated NK, NKT cell and T cell, and the receptor of IFN-gamma is IFNGR, belonging to heterodimer and widely expressed in various cells. Is an important immune response molecule, participates in the whole process of immune response, regulates and controls the trend of immune response, and particularly has important effect on cellular immunity.

The IFN-gamma of sheep mainly acts through three ways, the first way is to increase the sensitivity of cytotoxic T lymphocytes to pathogens through the presentation way of up-regulating MHC-I antigens, so that CTL can more effectively remove the pathogens; secondly, the immune response is transformed to Th1 phenotype, so that the static CD4+ T cells are differentiated into Th1 cells, and the proliferation of Th2 cells is inhibited; the immune cells are regulated to realize the immunoregulation function. The third IFN-gamma can also induce virus infected cells to generate a plurality of antiviral proteins by combining with cell surface receptors, so that antiviral states are generated in the cells to play an antiviral role or interfere the cell cycle, inhibit cell proliferation and inhibit the treatment of viral diseases.

The sheep are common raised animals and have the advantages of strong stress resistance, good meat quality, early sexual maturity, strong reproductive capacity and the like. Is one of the important livestock suitable for family cultivation. Fur, which is a raw material of various woollen goods and leather products, and meat are provided to humans. Mutton is a food therapy health-care product excellent in wintering. Mutton contains rich protein, fat, vitamin B, nicotinic acid, inorganic calcium, phosphorus, iron, potassium, iodine and other components, and has comprehensive and rich nutrition. In addition, the pharmaceutical value is higher, but the sheep breeding industry is still invaded by some viral diseases, but the safe, reliable and reasonable-price sheep gamma interferon drug for treating or preventing the sheep viral diseases is lacked.

Disclosure of Invention

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, and the like). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues (Batzer et al, Nucleic acid Res.19:5081 (1991); Ohtsuka et al, J.biol.chem.260: 2605-S2608 (1985); and Cassol et al (1992); Rossolini et al, Mol cell. probes 8:91-98 (1994)).

The term "homology" refers to sequence similarity to a native nucleic acid sequence. "homology" includes a nucleotide sequence having preferably 85% or more, more preferably 90% or more, and most preferably 95% or more identity to the nucleotide sequence of the regulatory fragment of the present invention. Homology can be assessed visually or by computer software. Using computer software, homology between two or more sequences can be expressed as a percentage (%), which can be used to assess homology between related sequences.

The term "complementary" as used herein refers to two nucleotide sequences comprising antiparallel nucleotide sequences capable of pairing with each other upon hydrogen bonding between complementary base residues of the antiparallel nucleotide sequences. It is known in the art that the nucleotide sequences of two complementary strands are reverse complementary to each other when the sequences are viewed in both 5 'to 3' directions. It is also known in the art that two sequences that hybridize to each other under a given set of conditions do not necessarily have to be 100% perfectly complementary.

The term "stringent hybridization conditions" means conditions of low ionic strength and high temperature as known in the art. Typically, a probe hybridizes to its target sequence to a greater extent (e.g., at least 2-fold over background) than to other sequences under stringent conditions. Stringent hybridization conditions are sequence dependent and will be different under different environmental conditions, with longer sequences specifically hybridizing at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the stringency of hybridization or wash conditions. For an exhaustive guidance of Nucleic acid Hybridization, reference is made to the literature (Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic acids Probes, "Overview of principles of Hybridization and the" protocol of Nucleic acid assays. 1993). More specifically, the stringent conditions are typically selected to be about 5-10 ℃ below the thermal melting point (Tm) of the specific sequence at a defined ionic strength pH. The Tm is the temperature (at a given ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, 50% of the probes are occupied at Tm at equilibrium). Stringent conditions may be as follows: wherein the salt concentration is less than about 1.0M sodium ion concentration, typically about 0.01 to 1.0M sodium ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature is at least about 30 ℃ for short probes (including but not limited to 10 to 50 nucleotides) and at least about 60 ℃ for long probes (including but not limited to greater than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. For selective or specific hybridization, the positive signal can be at least two times background hybridization, optionally 10 times background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5 XSSC and 1% SDS, incubated at 42 ℃; or 5 XSSC, 1% SDS, incubated at 65 ℃, washed in 0.2 XSSC and washed in 0.1% SDS at 65 ℃. The washing may be for 5, 15, 30, 60, 120 minutes or more.

The terms "mutation" and "mutant" have their usual meanings herein, and refer to a genetic, naturally occurring or introduced change in a nucleic acid or polypeptide sequence, which has the same meaning as is commonly known to those of skill in the art.

The term "host cell" or "recombinant host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome.

The term "transfection" refers to the process by which eukaryotic cells acquire a new genetic marker due to the incorporation of foreign DNA.

The invention aims to solve the first technical problem of providing sheep gamma interferon and a sheep gamma interferon mutant, wherein the sheep gamma interferon mutant has high antiviral activity;

the second technical problem to be solved by the invention is to provide a method for preparing the sheep gamma interferon or the sheep gamma interferon mutant by using a bombyx mori baculovirus expression system;

the third technical problem to be solved by the invention is to provide the application of the sheep gamma interferon or the sheep gamma interferon mutant in preparing a medicament or a reagent for preventing or treating sheep viral diseases.

In order to solve the technical problems, the invention firstly provides sheep gamma interferon, and the amino acid sequence of the sheep gamma interferon is shown in SEQ ID NO.1 or is an amino acid sequence which has the same interferon function or activity with the amino acid sequence shown in SEQ ID NO. 1.

Preferably, in the gamma interferon of sheep of the present invention, the polynucleotide sequence of the gene encoding the gamma interferon of sheep is represented by (a) or (b) or (c):

(a) the polynucleotide sequence shown in SEQ ID No. 2; or

(b) A polynucleotide sequence capable of hybridizing under stringent hybridization conditions to the complementary sequence of SEQ ID No.2, wherein the protein encoded by the polynucleotide sequence still has the same function or activity as the interferon; or

(c) A polynucleotide sequence which has at least more than 80 percent of homology with the polynucleotide sequence shown in SEQ ID No.2, and the protein coded by the polynucleotide sequence still has the same function or activity of interferon; preferably, the polynucleotide sequence has at least more than 85% homology with the polynucleotide sequence shown in SEQ ID No.2, and the protein coded by the polynucleotide sequence still has the same function or activity of interferon; more preferably, the polynucleotide sequence has at least 90% homology with the polynucleotide sequence described in SEQ ID No.2, and the protein encoded by the polynucleotide sequence still has the same interferon function or activity.

Another aspect of the present invention is to provide a mutant of ovine interferon gamma, wherein the mutant of ovine interferon gamma is obtained by mutating the amino acid sequence shown in SEQ ID No.1 at any one of the following amino acid unit sites of E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T and R160Q; preferably, in the sheep gamma interferon mutant, the sheep gamma interferon mutant is obtained by mutating the amino acid sequence shown in SEQ ID No.1 at any one of the amino acid single sites of E32T, L79F, K103R, Q120K and N157T; more preferably, the sheep gamma interferon mutant is obtained by carrying out Q120K amino acid single-site mutation on the amino acid sequence shown in SEQ ID NO.1, the amino acid sequence of the mutant is shown in SEQ ID NO.5, and the nucleotide sequence of the mutant coding gene is shown in SEQ ID NO. 6.

In another aspect, the invention provides a mutant of gamma interferon in sheep, which is obtained by performing double-site mutation on any one of amino acid sequences shown in SEQ ID No.1, such as E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T and Q120K-N157T; preferably, the sheep gamma interferon mutant is obtained by carrying out double-site mutation on any one of amino acids L79F-Q120K, K103R-Q120K and E32T-N157T on the amino acid sequence shown in SEQ ID NO. 1; more preferably, the sheep gamma interferon mutant is obtained by carrying out L79F-Q120K amino acid double-site mutation on the amino acid sequence shown in SEQ ID NO.1, the amino acid sequence of the mutant is shown in SEQ ID NO.7, and the nucleotide sequence of the coding gene of the mutant is shown in SEQ ID NO. 8.

The other aspect of the invention is to provide a sheep gamma interferon mutant, wherein the sheep gamma interferon mutant is obtained by carrying out multi-site mutation on any one of amino acid of an amino acid sequence shown in SEQ ID No.1, such as E32T-L79F-K103R, E32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T, and K103R-Q120K-N157T; preferably, the sheep gamma interferon mutant is obtained by performing amino acid multi-site mutation on the amino acid sequence shown in SEQ ID NO.1 to obtain a mutant with L79F-K103R-Q120K; more preferably, the sheep gamma interferon is a mutant obtained by performing L79F-K103R-Q120K amino acid multi-site mutation on the amino acid sequence shown in SEQ ID NO.1, the amino acid sequence of the mutant is shown in SEQ ID NO.9, and the nucleotide sequence of the coding gene of the mutant is shown in SEQ ID NO. 10.

The invention further provides a recombinant vector or a recombinant host cell containing the sheep gamma interferon or the sheep gamma interferon mutant.

The invention also provides application of the sheep gamma interferon or the sheep gamma interferon mutant in preparing a medicament or a reagent for preventing or treating sheep viral diseases.

Preferably, the sheep gamma interferon or sheep gamma interferon mutant is used in the preparation of a medicament or a reagent for preventing or treating sheep viral diseases, wherein the sheep viral diseases comprise: any one or more of capripoxvirus infection, caprine infective pustular virus infection or vesicular stomatitis virus infection, or bovine respiratory syncytial virus disease.

The invention also provides a method for preparing the sheep gamma interferon or the sheep gamma interferon mutant, which comprises the following steps:

(1) cloning a coding gene of the sheep gamma interferon of claim 1 or a coding gene of the sheep gamma interferon mutant of any one of claims 2 to 4 into a baculovirus transfer vector to construct a recombinant transfer vector;

(2) co-transfecting the recombinant transfer vector and baculovirus DNA into an insect cell to obtain a recombinant baculovirus;

(3) infecting the recombinant baculovirus into insect cells or insect hosts, culturing the infected insect cells or insect hosts to express corresponding protein, and purifying to obtain the recombinant baculovirus.

Preferably, in the method for preparing the sheep interferon or sheep interferon mutant, the baculovirus transfer vector is selected from AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bacto Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB 4, pAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIEl, pAcJPl, cVP 2, pAcMLF 7, pAcMLF 8, cPL, pAcMP2, pAcRP23, pAcRP 25, pAcMAG 4, pAcUcsl, pAcUuUW 21, pAcUstW A, pAcVyVCW 2, pAcNV 13972, pAcYNyNpYNpNV, pApYNpNV 368672, pApYNcVMV 13972, pApYNcVvEPV 7, pAcNV 369872, pAcYNcVEcNV 369872, pAcVMV, pAcVEcFV, pAcFVpAcFVpApNV 369872, pAcFV 369, pAcNV 36988, pAcFV 3645, pAcNV 3695, pAcNV 369, pAcNV 3695, pAcVEcVMpVIV 36pVIV, pAcFVpVIV 369, pAcFVpVIV, pAcFVNO, pAcFVpVIV 368, pAcFVNO 3, pAcFVpAcFVpVIV 36369, pAcVLI, pAcFVpAcFVpAcFVpAcFL 36988, pAcFVpVIV, pAcFVNO 3, pAcFVpVIV, pAcFVpAcFVpAcFL 3695, pAcFVpAcFVpAcFV 368, pAcFVNO 3, pAcFVNO, pAcFVpAcFVpAcFV 36988, pAcFV 36988, pAcFL 369, pAcFVpVIV, pAcFV 369, pAcFVNO 3, pAcFL 369, pAcFL 3695, pAcFLIII or pAcFVpAcFLV 369, pAcFLV 369; preferably, the baculovirus is selected from the group consisting of bombyx mori baculovirus parent strain BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV; preferably, the insect host is selected from the group consisting of Bombyx mori (Bombyx mori), Bombyx mori (Bombyx mandarina), Ricinus communis (Philosamia cynthia ricim), Bombyx mori (Dictyyoproca japonica), Ailanthus altissima (Philosamia cysticta), Antheraea pernya (Antheraea pernyi), Antheraea japonicus (Antheraea yamamai), Bombyx mori (Antheraea polyphylla), Autographa californica (Atogara californica), Ectropina obliqua (Ectropis obliqua), Trichoplusia glans (Mameria brassica), Trichoplusia ni (Spodoptera litura), Trichoplusia fortunei (Spodopteropis virens), Trichoplusia ni (Spodoptera litura), Heliothis virescens (Heliothis virens), Heliothis virescens (Helicoverpa), Heliothis virescens (Helicosa), or tobacco (tobacco), Helicoverpa armigera (Helicosa); preferably, the baculovirus transfer vector is pVL 1393; the baculovirus is a parent strain BmBacmid of silkworm baculovirus; the insect host is silkworm (Bombyx mori); wherein, the infection in the step 3) means that the recombinant baculovirus infects 1-5-year-old insect larvae or pupae bodies by swallowing or permeating epidermis. Compared with the prior art, the invention has the following advantages:

the invention analyzes the Gamma interferon amino acid sequences of all sheep on NCBI, carries out sequence comparison and signal peptide analysis, finally determines that the amino acid sequence with the accession number of NP-001009803.1 is taken as a main reference sequence, designs a plurality of pairs of primers by taking the sequence after codon optimization as a template and carries out amino acid single-site mutation, amino acid double-site mutation and amino acid multi-site mutation by a fusion PCR method, and obtains a plurality of Gamma interferon mutants of sheep. The gamma interferon mutant of the sheep is expressed in the silkworm bioreactor by using a silkworm baculovirus expression system, so that the antiviral activity of the expressed gamma interferon mutant of the sheep is greatly improved, and the gamma interferon mutant of the sheep has obvious antiviral activity. The method has simple process, and can quickly obtain a large amount of safe and reliable sheep gamma interferon. The gamma interferon mutant of sheep can be used for preparing medicines or reagents for preventing or treating sheep viral diseases, and has great significance for the development of animal husbandry.

Drawings

FIG. 1 is a fluorescence plot corresponding to a proportion of cytopathic effects in an embodiment of the present invention;

FIG. 2 is a diagram showing the double restriction enzyme digestion of the recombinant plasmid pVL-OvIFN-. gamma.in one embodiment of the present invention;

FIG. 3 is a schematic representation of cells exhibiting fluorescence at various ratios in one embodiment of the invention;

Detailed Description

In one embodiment of the invention, the sheep gamma interferon (OvIFN-gamma) is provided, the amino acid sequence of the sheep gamma interferon is shown as SEQ ID NO.1, and the polynucleotide sequence of the coding gene is shown as (a) or (b) or (c):

(a) the polynucleotide sequence shown in SEQ ID No. 2; or

(b) A polynucleotide sequence capable of hybridizing under stringent hybridization conditions to the complement of SEQ id No.2, which polynucleotide encodes a protein that still has the function or activity of an interferon; or

(c) Polynucleotide sequence with at least 80% homology with the polynucleotide sequence of SEQ ID No.2, and the protein coded by the polynucleotide still has the function or activity of interferon; preferably, the polynucleotide sequence has at least more than 85% homology with the polynucleotide sequence of SEQ ID No.2, and the protein coded by the polynucleotide still has the function or activity of interferon; more preferably, the polynucleotide sequence has at least 90% homology with the polynucleotide sequence of SEQ ID No.2, and the protein encoded by the polynucleotide still has the function or activity of interferon.

Carrying out codon optimization on a gamma interferon gene sequence of sheep according to the codon preference of silkworm, carrying out optimization design on various related parameters such as GC content, CpG dinucleotide content, codon preference, secondary structure of mRNA, mRNA free energy stability, RNA instability motif, repetitive sequence and the like which influence the gene transcription efficiency and translation efficiency and protein folding, being beneficial to improving the transcription efficiency and translation efficiency of the optimized gene in silkworm, and keeping the finally translated protein sequence unchanged; in order to improve the translation initiation efficiency in a silkworm baculovirus eukaryotic expression system, a Kozak sequence AAC is added in front of a gene, and in order to improve the translation termination efficiency, a stop codon is changed into TAA. Besides, restriction sites such as BamHI, EcoRI, SmaI and the like in the gene sequence are removed, BamHI is added at the upstream of the gene, and an EcoRI restriction site is added at the downstream of the gene; the new optimized sequence OvIFN-gamma-O of the sheep gamma interferon is obtained, the amino acid sequence of the new optimized sequence OvIFN-gamma-O is shown as SEQ ID NO.3, and the optimized gene nucleotide sequence is shown as SEQ ID NO. 4.

In one embodiment of the invention, the sheep gamma interferon mutant is obtained by carrying out E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T and R160Q single-amino-acid single-site mutation on sheep gamma interferon with an amino acid sequence shown as SEQ ID NO. 3; preferably, the mutant is obtained by carrying out single-site mutation on sheep gamma interferon with an amino acid sequence shown as SEQ ID NO.3, wherein the single-site mutation is any one of E32T, L79F, K103R, Q120K and N157T. The amino acid sequence of the mutant obtained by carrying out Q120K amino acid single-site mutation on the sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is shown as SEQ ID NO.5, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6.

The amino acid single-site mutation Q120K indicates that the 120 th amino acid of the sheep gamma interferon mutant with the amino acid sequence of SEQ ID NO.3 is mutated into lysine (K) from glutamine (Q); N157T indicates a mutation of the amino acid at position 157 from asparagine (N) to threonine (T); and so on.

In one embodiment of the invention, the sheep gamma interferon mutant is obtained by carrying out double-site mutation on any one of amino acid mutants of sheep with an amino acid sequence of SEQ ID NO.5, such as E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T and Q120K-N157T; preferably, the sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is subjected to double-site mutation of any one of L79F-Q120K, K103R-Q120K and E32T-N157T to obtain the mutant. The amino acid sequence of a mutant obtained by carrying out L79F-Q120K amino acid double-site mutation on sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is shown as SEQ ID NO.7, and the nucleotide sequence of a coding gene of the mutant is shown as SEQ ID NO. 8.

The amino acid double-site mutation L79F-Q120K refers to that the 79 th amino acid of the sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is mutated into phenylalanine (F) from leucine (L), and the 120 th amino acid is mutated into lysine (K) from glutamine (Q); the amino acid double-site mutation E32T-Q120K shows that the 32 th amino acid is mutated from glutamic acid (E) to threonine (T), and the 120 th amino acid is mutated from glutamine (Q) to lysine (K); and so on.

In one embodiment of the invention, the sheep gamma interferon mutant is obtained by carrying out multi-site mutation on any one of amino acid E32T-L79F-K103R, E32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T on sheep gamma interferon with an amino acid sequence shown as SEQ ID NO. 3; preferably, the sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is subjected to L79F-K103R-Q120K amino acid multi-site mutation to obtain the mutant. The amino acid sequence of a mutant obtained by carrying out L79F-K103R-Q120K amino acid multi-site mutation on the sheep gamma interferon with the amino acid sequence shown as SEQ ID NO.3 is shown as SEQ ID NO.9, and the nucleotide sequence of a coding gene of the mutant is shown as SEQ ID NO. 10.

Wherein, the amino acid multi-site mutation L79F-K103R-Q120K of the invention indicates that the 79 th amino acid of the sheep gamma interferon with the amino acid sequence shown in SEQ ID NO.3 is mutated from leucine (L) to phenylalanine (F), the 103 th amino acid is mutated from lysine (K) to arginine (R), and the 120 th amino acid is mutated from glutamine (Q) to lysine (K); and so on.

The applicant analyzes the gamma interferon amino acid sequences of all sheep on NCBI, finally determines that the amino acid sequence with the accession number of NP-001009803.1 is the original amino acid sequence of the gamma interferon of the sheep (the amino acid sequence is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2), and only one peptide chain cutting site is obtained through signal peptide prediction, so that signal peptide mutation is not needed.

The invention designs a plurality of pairs of primers by taking an optimized gene sequence of OvIFN-gamma as a template, and performs amino acid single-site mutation, amino acid double-site mutation and amino acid multi-site mutation by utilizing a fusion PCR method to obtain a plurality of sheep gamma interferon mutants.

Wherein, on the basis of OvIFN-gamma-O, after 5 site single-site mutations of E32T, L79F, K103R, Q120K and N157T are respectively carried out, the titer of the gamma interferon of the expressed sheep is higher than the titer measured by OvIFN-gamma-O expression, and the antiviral titer reaches 2.69 multiplied by 10⁶-3.72×10⁶U/mL; the titer is unchanged or even reduced after mutation of the rest sites, which indicates that the mutation of the 5 sites is effective mutation and can achieve the purpose of improving the antiviral activity. Among them, OvIFN-gamma-O-Q120K mutant obtained by Q120K single-site mutation has the strongest antiviral effect.

The invention further combines the single mutation sites E32T, L79F, K103R, Q120K and N157T with improved antiviral activity in pairs, and carries out double-site mutation on the OvIFN-gamma-O. The detection result of the antiviral activity shows that after three groups of double mutations of L79F-Q120K, K103R-Q120K and E32T-N157T, the titer of the gamma interferon of the expressed sheep is higher than the titer measured by the expression of the original sequence and the single mutation sequence, and the antiviral titer reaches 3.98 multiplied by 10⁶-4.68×10⁶U/mL, and the potency is unchanged or even reduced after mutation of other groups of sites, which indicates that the mutation of the 3 combined sites is effective mutation and can achieve the purpose of improving antiviral activity. Among them, the OvIFN-gamma-O-L79F-Q120K mutant obtained by L79F-Q120K double-site mutation has the strongest antiviral effect.

The invention further combines the obtained double mutation sites with high titer, and performs amino acid multi-site mutation on the OvIFN-gamma-O. The detection result of the antiviral activity of the mutant shows that after the L79F-K103R-Q120K three-site mutation, the titer of the gamma interferon of the expressed sheep is far higher than the titer measured by the expression of the original sequence, the single mutation sequence and the double mutation sequence, and is 6.31 multiplied by 10⁶U/mL(ii) a And the titer is unchanged or even reduced after mutation of the rest groups of sites. The mutation of the combined site is effective mutation, and the aim of improving the antiviral activity can be fulfilled.

In one embodiment of the invention, a recombinant vector or a recombinant host cell containing the gene encoding the ovine gamma interferon or the ovine gamma interferon mutant is provided. Wherein, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

In one embodiment of the present invention, there is provided a constructed transfer vector comprising:

(1) a vector pVL-OvIFN-O-M1 containing a mutant (OvIFN-gamma-O-M1 mutant) gene sequence of OvIFN-gamma-O subjected to amino acid single-site mutation;

(2) a vector pVL-OvIFN-gamma-O-M1-M2 containing a mutant (OvIFN-gamma-O-M1-M2 mutant) gene sequence of an OvIFN-gamma-O subjected to amino acid double-site mutation;

(3) the vector pVL-OvIFN-gamma-O-M1-M2-M3 contains a mutant (OvIFN-gamma-O-M1-M2-M3 mutant) gene sequence of OvIFN-gamma-O subjected to amino acid multi-site mutation.

The recombinant baculovirus obtained by the invention comprises: recombinant bombyx mori nuclear polyhedrosis virus rBmBacmid (OvIFN-gamma), rBmBacmid (OvIFN-gamma-O, OvIFN-gamma-O-M1, OvIFN-gamma-O-M1-M2, OvIFN-gamma-O-M1-M2-M3).

In one embodiment of the invention, the invention discloses the application of the sheep gamma interferon or sheep gamma interferon mutant in preparing a medicament or a reagent for preventing or treating sheep viral diseases.

Wherein the sheep viral diseases include: any one or more of capripoxvirus infection, caprine infective pustular virus infection or vesicular stomatitis virus infection, or bovine respiratory syncytial virus disease.

In one embodiment of the present invention, there is provided a method for preparing the ovine gamma interferon or the ovine gamma interferon mutant, comprising the steps of: (1) respectively cloning the coding genes of the sheep gamma interferon or the sheep gamma interferon mutant into a baculovirus transfer vector to construct a recombinant transfer vector; (2) co-transfecting the recombinant transfer vector and baculovirus DNA into an insect cell to obtain recombinant baculovirus; (3) infecting the recombinant baculovirus into insect cells or insect hosts, culturing the infected insect cells or insect hosts to express corresponding protein, and purifying to obtain the recombinant baculovirus.

Wherein the baculovirus transfer vector is selected from AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB 4, pAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIEl, pAcJPl, pALF 2, pAcMLF 7, pAcMLLF 8, pAPLcM, cpAP 2, pAcRP23, pAcRP 25, pAcRW4, pAcMAG, pAcUWl, pAcUW21, pAcUW2A, pAcUW2B, pAcUW 6862, pAcUW 69556, pAcRW4, pAcMAG, pAcUpYNC, pAcVMV 1397, pApYNpYNpYVC 8672, pApYNpYnV 369872, pApYnPVV, pApYVC 9872, pApSeVpYVC 9872, pApPSpYvP, pApYvJ 3611, pAcVpYP pVpVpVpVIV, pApYP + pApYP 3, pApYnVEpYP 3, pApYnVEpVEpVIV, pApVEpVIV, pApKApKAVC, pApKAV, pApIBV, pApKAV, pAcJpAcJpAcJpAcJpAcJpAcJpApIBV, pApIBV, pAcJpAcJpAcJpAcJpAcJpAmW 2, pAcJpAcJpAcJpAcJpAcJpAcJpAcJV 7, pAcJpAcJV, pAcJpAcJpAcJpAcJpAcJV 7, pAcJV, pAcJpAcJV 7, pAcJpAcJpAcJV, pAcJpAcJpAcJpAcJpAcJV 7, pAcJpAcJpAcJV, pAcJpAcJV, pAcJpAcJpAcJV, pAcJV, pAcJpAcJV, pAcJV, pAcJpAcJV, pAcUpIBV # 7, pAcJV, pAcJpAcJV, pAcJV, pAcUpIB8, pAcJpAcJV, pAcJV # 4, pAcUpIVrV # 7, pAcJpAcJV # 4, pAcUpIB8, pAcJV, pAcJpAcUpIBV # 4, pAcJpAcJV # 4, pAcJpAcJpAcUpIB8, pAcJpAcJV # 4, pAcJpAcUpIB8, pAcUpIB8, pAcJpAcJV # 4, pAcUpIB8, pAcJpAcJpAcJV # 4, pAcJpAcUpIB8, pAcJpAcJV # 4, pAcJV # 4, pAcUpIB8, pAcJpAcJpAcUpIB8, pAcJV # 4, pAcJpAcJV # 4, pAcJV # 4, pAcUpIB8, pAcJV # 8, pAcJV #;

the baculovirus is selected from bombyx mori baculovirus parent strain BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV;

the insect host is selected from the group consisting of Bombyx mori (Bombyx mori), Bombyx mori (Bombyx mandarina), Ricinus communis (Philosamia cynthia ricim), Bombyx mori (Dictyoloca japonica), Ailanthus altissima (Philosamia cynthia pryeri), Antheraea pernyi (Antheraea pernyi), Antheraea japonica (Antheraea yamamai), Bombyx mori (Antheraea polyphylla), Autographa californica (Atogaria californica), Ectropicalis gigas (Ectropis obliqua), Trichoplusia (Mamestra brassicae), Spodoptera littoralis (Spodoptera littoralis), Spodoptera frugiperda (Spodoptera frugiperda), Trichoplusia ni (Spodoptera armyworm, Heliothis armyworm (Heliothis virens), Heliothis virtus, Helicosa (tobacco), Heliothis virens (tobacco), and Helicoverpa armigera (tobacco);

preferably, the baculovirus transfer vector is pVL 1393; the baculovirus is a parent strain BmBacmid of silkworm baculovirus; the insect host is silkworm (Bombyx mori).

The infection refers to that the recombinant baculovirus infects 1-5-year-old insect larvae or pupae bodies through swallowing or permeating epidermis; preferably, the recombinant silkworm baculovirus is used for infecting silkworm cells or inoculating silkworm larvae or pupae of 1-5 years old by puncture, and body fluid or tissue homogenate of the silkworm larvae or pupae containing various sheep gamma interferon genes is collected after infection for 3-6 days; wherein, the pupa is the early young pupa of 1-2 days optimally.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

1. Test materials and reagents

Coli strain TOP10, BmN cells, Vero cells, VSV-GFP virus, purchased from the institute of biotechnology, national academy of agricultural sciences; test silkworm variety JY1 was purchased from the institute of silkworm industry, Jiangsu science and technology university, and parental virus BmBacmid DNA was constructed by the method disclosed in the literature (patent No.: ZL 201110142492.4, granted date: 2013.01.23). Restriction enzyme, T₄DNA ligase was purchased from Promega, LA Taq DNA polymerase and other related reagents used in PCR were purchased from Takara, liposomes were purchased from Invitrogen, DMEM cell culture medium, and fetal bovine serum was produced by GIBCO. Reference is made to the relevant tool book for the preparation of solutions and media (Josepheit, third edition of molecular cloning guidelines, 2002; Oseber, et al, eds. molecular biology guidelines, 1998; David L.Spector, cell experiments guidelines, 2001); unless otherwise indicated, percentages and parts are by weight.

2. Preparation method

The fusion PCR method for site-directed mutagenesis in the preparation method is performed by referring to the method described in Kuang Jatin et al (a new method for vector construction: recombinant fusion PCR method, genomics and applied biology, 2012, Vol. 31, No.6, p. 634-639).

The titer of interferon was calculated by using Vero/VSV GFP system, using the Reed-Muench method, and the specific procedures were performed with reference to Liuxing, et al (detection of expression and bioactivity of cat omega-like interferon in silkworms, biotechnological advances, 2015, 5 (6): 441) and Summers MD, et al (A manual of methods for bacterial and antibiotic cell culture products [ R ]. Texas Agricultural Experiment Station, 1987), wherein the criteria for determining cytopathic effect are shown in FIG. 1, wherein A, ": (ii) cell-free lesions; b, "+/-": several cytopathies; c, "+": 20% -30% of cytopathic effect; d, "+ +": 50% -60% of cytopathic effect.

The best improvement in each case served as a comparison criterion for the improvement in the next case.

Example 1 expression and detection in silkworm bioreactor after optimization of sheep gamma-type interferon optimization Gene (OvIFN-. gamma.)

1. Experimental methods

1.1 construction of optimized Gene for sheep gamma-type Interferon

The invention analyzes the amino acid sequences of all sheep gamma interferon on NCBI, carries out sequence comparison and signal peptide analysis, finally determines the amino acid sequence with the accession number of NP-001009803.1 as a main reference sequence, carries out signal peptide prediction on the sheep IFN-gamma amino acid sequence or related sequences by using SignalP4.1 on line, and finds that only one peptide chain cutting site is needed, so that the signal peptide does not need to be mutated.

The invention utilizes OptimumGene^TMThe technology optimizes the sheep gamma interferon gene, modifies the gene sequence according to the codon preference of a bioreactor silkworm, and modifies a plurality of related parameters which influence the gene transcription efficiency, the translation efficiency, the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the mRNA free energy stability, the RNA instability motif, the repetitive sequence and the likeThe optimized design of the number is beneficial to improving the transcription efficiency and the translation efficiency of the optimized gene in the silkworm, and the finally translated protein sequence is kept unchanged.

In order to improve the translation initiation efficiency in a silkworm baculovirus eukaryotic expression system, a Kozak sequence AAC is added in front of a gene, and in order to improve the translation termination efficiency, a stop codon is changed into TAA. In addition, restriction sites for BamHI, EcoRI, SmaI and the like in the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene, for subsequent cloning into the eukaryotic transfer vector pVL 1393.

The designed sequence of the gamma-type interferon gene after optimization is artificially synthesized by a biotechnology company and named as OvIFN-gamma-O, the nucleotide sequence of the gamma-type interferon gene is shown as SEQ ID NO.4, and the synthesized gene fragment is inserted into a pUC57 vector to form a plasmid pUC57-OvIFN which is named as pUC 57-OvIFN-gamma-O.

1.2 construction of recombinant baculovirus transfer vectors

The synthesized plasmid pUC 57-OvIFN-gamma-O is subjected to double enzyme digestion treatment by BamHI and EcoRI, and the target fragment, T, is recovered by a glass milk method₄The DNA ligase is connected with the target fragment and the baculovirus transfer vector pVL1393 which is processed by double enzyme digestion and inactivated is connected at 16 ℃ overnight. The ligation product is transformed into escherichia coli competent cell TOP10, colonies are selected and cultured, plasmids are upgraded, BamHI and EcoRI are used for double enzyme digestion to identify positive clones, recombinant plasmids which are identified correctly are sent to Beijing Optimalaceae biotechnology Limited for sequencing, and the plasmids which are sequenced correctly are named as pVL-OvIFN-gamma-O (as shown in figure 2, wherein M is DNA molecular mass standard; 1 is recombinant plasmid pVL-OvIFN-gamma double enzyme digestion product; negative control).

1.3 obtaining, purifying and amplifying recombinant silkworm baculovirus

The recovery and passage of the BmN cells and the screening of the recombinant viruses are carried out according to the methods reported in the literature. When the BmN cells were cultured until the cell monolayer reached about 80%, the old medium was poured off, washed three times with serum-free TC-100 medium, and 1.5mL of FBS-free medium was added. Sequentially adding 1 mu g of bombyx mori baculovirus parent strain BmBacmid DNA, 2 mu g of recombinant transfer plasmid pVL-OvIFN-gamma-O and 5 mu L of liposome into a sterilizing tube, complementing the volume to 60 mu L by using sterile double distilled water, gently mixing uniformly, standing for 15min, and then dropwise adding into a culture bottle for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu. LFBS were added. Culturing at the constant temperature of 27 ℃ for 4-5 days until the cells shed and float, and collecting cell culture solution to obtain the recombinant virus rBmBacmid (OvIFN-gamma-O) containing the target gene.

The purification and amplification method of the recombinant silkworm baculovirus is as follows: inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the collected cell culture solution at different concentrations, adding 1mL of the diluted cell culture solution into the adherent cells, and uniformly distributing the cells. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. And (3) selecting the plaques which do not contain the polyhedron, repeating the steps, and performing 2-3 rounds of purification to obtain the pure recombinant baculovirus rBmBacmid (OvIFN-gamma-O).

Infecting the recombinant baculovirus rBmBacmid (OvIFN-gamma) and rBmBacmid (OvIFN-gamma-O) of the silkworm with the normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-gamma) and rBmBacmid (OvIFN-gamma-O).

1.4 goat gamma interferon expression in silkworm

Recombinant virus culture solution is added according to the formula 10⁵PFU/head dose is injected into 5-year-old silkworm, the silkworm is cultured under the condition of 27 ℃ and 70% -80% humidity, the silkworm larva grows late, and the OvIFN-gamma is efficiently expressed under the action of the polyhedrosis gene promoter. When the silkworm larva is infected for 3.5-4 days after inoculation, symptoms such as swelling of body nodes, abnormal behavior, decreased appetite and the like can be observed, when the larva is observed to be obviously reduced in volume and stops eating, hemolymph is collected and stored at-20 ℃ for later use.

1.5 detection of antiviral Activity of sheep Gamma-type Interferon protein

Detection of silkworm blood on Vero/VSV GFP system by using micro cytopathic inhibition methodAntiviral activity of ovine gamma interferon expressed in lymph. Vero cells in good state were cultured at 3.0X 10⁵The cells/mL were plated in 96-well plates. Preparing the silkworm hemolymph with ultrasonic disruption and filter sterilization into solution with different dilutions by DMEM culture solution containing 70mL/L fetal bovine serum, inoculating diluted sample into culture wells filled with VERO cells at 100 μ L/well, setting at least 12 duplicate wells for each dilution and control silkworm blood, setting cell control group without silkworm hemolymph and VSV GFP and virus control group with VSV GFP, and culturing at 37 deg.C and 5% CO₂Culturing for 18-24 h under the condition. Diluting to 100TCID₅₀The VSV GFP virus of (1) was added to the culture well from which the supernatant had been aspirated at 100. mu.L/well, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing under the condition. When a large number of cells in each hole of the virus control group generate fluorescence and the cells in the cell control group still completely grow well and no fluorescence appears, the contrast system is completely qualified, and comprehensive observation can be carried out.

2. Results of the experiment

2.1 identification of recombinant transfer vectors

The recombinant transfer vector pVL-OvIFN-gamma-O is subjected to double digestion by BamHI and EcoRI, 2 fragments are separated by 1% agarose gel electrophoresis, the small fragment is positioned between 500 and 750bp and is consistent with the size of the target gene fragment 510bp, and the large fragment is positioned above 8000bp and is consistent with the size of the pVL1393 fragment 9607 bp. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited for nucleotide sequencing, and MegaAlign comparison results show that the sequence is consistent with the originally designed sequence, which shows that the sheep gamma-type interferon mutant gene is successfully inserted between BamHI and EcoRI in the pVL1393 transfer vector.

2.2 obtaining of recombinant goat interferon virus and detection of recombinant product

The antiviral activity of sheep gamma-type interferon expressed by silkworm larvae is detected on a Vero/VSV-GFP system by applying a trace cytopathic inhibition method. As shown in fig. 3, the growth state of the cells in the cell control group was good and no fluorescence appeared, as observed under the inverted fluorescence microscope; cells in control group infected with virus were diseased, most of the cellsFluorescence appeared, and the cells added with the recombinant goat gamma interferon protein had the ability to resist virus infection (in FIG. 3, A: fluorescence exhibited by the VSV virus inhibited by interferon; B: fluorescence exhibited by the VSV virus infection control group; and C: fluorescence exhibited by VSV virus infection of a part of the cells). Observing the pathological change degree of the cells according to the protective effect of the sheep gamma-type interferon on Vero cells, marking the cells in the hole as "+" when green fluorescent cells appear, and calculating the titer of the interferon according to a Reed-Muench method. The detection results are shown in Table 1, and the results of the antiviral activity determination show that the OvIFN-gamma-O expressed in silkworm larva bodies has more obvious antiviral activity compared with the OvIFN-gamma, and the titer reaches 2.51 multiplied by 10⁶U/mL, while the OvIFN-gamma titer is only 1.38X 10⁵U/mL achieves the expected effect, which shows that the method for optimizing the sheep gamma interferon to improve the OvIFN-gamma antiviral activity is feasible and effective.

TABLE 1 results of the detection of the antiviral activity of the optimized goat gamma interferon mutants

Example 2 expression and detection of goat gamma-type interferon mutant (OvIFN-. gamma. -O) in silkworm bioreactor after amino acid single site mutation

1. Experimental methods

1.1 construction of optimized Gene of gamma interferon for sheep

The invention takes the gene sequence of OvIFN-gamma-O as a template, designs a plurality of pairs of primers to carry out site-directed mutagenesis on the sequence, the site-directed mutagenesis is carried out by utilizing a fusion PCR method, and the fusion PCR method is shown in the step 2 and the preparation method.

The mutation sites are E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T and R160Q; the obtained sheep gamma interferon mutant is named as OvIFN-gamma-O-M1 (E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T and R160Q) mutant.

Primers required for carrying out amino acid single-site, double-site and multi-site mutation on the nucleotide sequence of OvIFN-gamma-O:

(1) and upstream and downstream primers on both sides:

F:

TCATACCGTCCCACCATCGGGCGCGGATCAACATGAAATACACATCATC

R:GATCTGCAGCGGCCGCTCCGGAATTCCATGGAGGCTCTTCTTC

(2) middle upstream and downstream primers

1.

F1:TTCTTCAAGGAAATCACGAACTTGAAGGAATACTTC

R1:GAAGTATTCCTTCAAGTTCGTGATTTCCTTGAAGAA

2.

F2:ATCGAAAACTTGAAGGACTACTTCAACGCTAGC

R2:GCTAGCGTTGAAGTAGTCCAACAAGTTTTCGAT

3.

F3:TACTTCAACGCTAGCACCCCTGACGTGGCCAAGGG

R3:CCCTTGGCCACGTCAGGGGAGCTAGCGTTGAAGTA

4.

F4：TTCAACGCTAGCAATTCAGACGTGGCCAAGGGTGG

R4：CCACCCTTGGCCACGTCTGAATTGCTAGCGTTGAA

5.

F5：AATCCTGACGTGGCCAATGGTGGACCATTGTTC

R5：GAACAATGGTCCACCATTGGCCACGTCAGGATT

6.

F6：GGTGGACCATTGTTCTTAGAAATACTCAAAAAC

R6：GTTTTTGAGTATTTCTAAGAACAATGGTCCACC

7.

F7：TCCTTCTACTTCAAATTCTTCGAAAACCTG

R7：CAGGTTTTCGAAGAATTTGAAGTAGAAGGA

8.

F8:TTCAAACTCTTCGAAATCCTGAAGGACAATCAAG

R8：CTTGATTGTCCTTCAGGATTTCGAAGAGTTTGAA

9.

F9：AAACTCTTCGAAAACTTCAAGGACAATCAAGTTATTC

R9：GAATAACTTGATTGTCCTTGAAGTTTTCGAAGAGTTT

10.

F10:CTGAAGGACAATCAAGCCATTCAGAGATCAATGG

R10:CCATTGATCTCTGAATGGCTTGATTGTCCTTCAG

11.

F11：CAGAGATCAATGGACGTGATCAAGCAAGATATG

R11:CATATCTTGCTTGATCACGTCCATTGATCTCTG

12.

F12：CAAGATATGTTCCAGAGGTTCCTCAATGGTAGCTC

R12：GAGCTACCATTGAGGAACCTCTGGAACATATCTTG

13.

F13：CTCAATGGTAGCTCCGGGAAACTGGAAGACTTC

R13：GAAGTCTTCCAGTTTCCCGGAGCTACCATTGAG

14.

F14：AAACTGGAAGACTTCGAAAGATTGATTCAAATACCG

R14：CGGTATTTGAATCAATCTTTCGAAGTCTTCCAGTTT

15.

F15：TTCAAGAGATTGATTAAAATACCGGTCGACG

R15：CGTCGACCGGTATTTTAATCAATCTCTTGAA

16.

F16：CAGAGAAAAGCTATCAGTGAACTCATTAAGGTGATG

R16：CATCACCTTAATGAGAGTTCACTGATAGCTTTTCTCTG

17.

F17：AATGATCTCTCACCCAGATCTAACCTGAGAAAAAG

R17：CTTTTTCTCAGGTTAGATCTGGGTGAGAGATCATT

18.

F18：AGAAAGAGATCACAGACTCTGTTCAGAGGAAG

R18：CTTCCTCTGAACAGAGTCTGTGATCTCTTTCT

19.

F19：TCACAGAACCTGTTCCAAGGAAGAAGAGCCTCC

R19：GGAGGCTCTTCTTCCTTGGAACAGGTTCTGTGA

1.2 construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with BamHI and EcoRI double digested inactivated baculovirus transfer vector pVL1393 using recombinase (pEASY-Uni nucleic Cloning and DNA construct). Transforming the recombinant product into escherichia coli competent cell TOP10, selecting colonies for culture, upgrading the plasmid, carrying out double enzyme digestion by BamHI and EcoRI to identify positive clones, sending the correctly identified recombinant plasmid to Beijing engine biotechnology Limited for sequencing, and naming the correctly sequenced plasmid as pVL-OvIFN-gamma-O-M1 (E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T and R160Q).

1.3 obtaining, purifying and amplifying recombinant silkworm baculovirus

The recovery and passage of the BmN cells and the screening of the recombinant viruses are carried out according to the methods reported in the literature. When the BmN cells were cultured until the cell monolayer reached about 80%, the old medium was poured off, washed three times with serum-free TC-100 medium, and 1.5mL of FBS-free medium was added. Sequentially adding 1 mu g of bombyx mori baculovirus parent strain BmBacmid DNA, 2 mu g of recombinant transfer plasmid pVL-OvIFN-gamma-O-M1 and 5 mu L liposome into a sterilizing tube, complementing the volume to 60 mu L with sterile double distilled water, gently mixing uniformly, standing for 15min, and then dropwise adding into a culture bottle for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu.L FBS were supplemented. Culturing at the constant temperature of 27 ℃ for 4-5 days until the cells shed and float, and collecting cell culture solution to obtain the recombinant virus rBmBacmid (OvIFN-gamma-O-M1) containing the target gene.

The purification and amplification method of the recombinant silkworm baculovirus is as follows: inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the collected cell culture solution at different concentrations, adding 1mL of the diluted cell culture solution into the adherent cells, and uniformly distributing the cells. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. And (3) selecting the plaques which do not contain the polyhedron, repeating the steps, and performing 2-3 rounds of purification to obtain the pure recombinant baculovirus rBmBacmid (pVL-OvIFN-gamma-O-M1).

Infecting the recombinant bombyx mori baculovirus rBmBacmid (OvIFN-gamma-O-M1) with the normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-gamma-O-M1).

1.4 sheep gamma-type interferon mutant is expressed in silkworm body

1.5 detection of antiviral Activity of sheep Gamma-type Interferon mutant protein

The antiviral activity of the goat gamma-type interferon mutant expressed in the silkworm haemolymph is detected on a Vero/VSV-GFP system by adopting a micro cytopathic effect inhibition method. Vero cells in good state were cultured at 3.0X 10⁵The cells/mL were plated in 96-well plates. Preparing the silkworm hemolymph with ultrasonic disruption and filter sterilization into solution with different dilutions by DMEM culture solution containing 70mL/L fetal bovine serum, inoculating diluted sample into culture wells filled with VERO cells at 100 μ L/well, setting at least 12 duplicate wells for each dilution and control silkworm blood, setting cell control group without silkworm hemolymph and VSV GFP and virus control group with VSV GFP, and culturing at 37 deg.C and 5% CO₂Culturing for 18-24 h under the condition. Diluting to 100TCID₅₀The VSV GFP virus of (1) was added to the culture well from which the supernatant had been aspirated at 100. mu.L/well, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing under the condition. In falling downObserving under a fluorescence microscope, when a large number of cells in each hole of the virus control group generate fluorescence, and the cells in the cell control group still completely grow well and do not generate fluorescence, indicating that the control system is completely qualified, and performing comprehensive observation.

2. Results of the experiment

2.1 identification of recombinant transfer vectors

The recombinant transfer vector pVL-OvIFN-gamma-O-M1 is subjected to double enzyme digestion by BamHI and EcoRI, 2 fragments are separated by 1% agarose gel electrophoresis, the small fragment is positioned between 500 and 750bp and is consistent with the size of the target gene fragment 510bp, and the large fragment is positioned above 8000bp and is consistent with the size of the pVL1393 fragment 9607 bp. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited for nucleotide sequencing, and MegaAlign comparison results show that the sequence is consistent with the originally designed sequence, which shows that the sheep gamma-type interferon mutant gene is successfully inserted between BamHI and EcoRI in the pVL1393 transfer vector.

The antiviral activity of sheep gamma-type interferon expressed by silkworm larvae is detected on a Vero/VSV-GFP system by applying a trace cytopathic inhibition method. The growth state of the cells in the cell control group is good and no fluorescence appears when the cells are observed under an inverted fluorescence microscope; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant goat gamma interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of the sheep gamma-type interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to a Reed-Muench method, and obtaining the detection results shown in Table 2, wherein the titer of all sheep gamma-type interferon mutants is 1.26 multiplied by 10⁵U/mL～3.72×10⁶U/mL, wherein after 5 sites of E32T, L79F, K103R, Q120K and N157T are mutated, the titer of the expressed sheep gamma interferon is slightly higher than the titer measured by the expression of the original sequence, and the titer is unchanged or even reduced after the mutation of the rest sites, which indicates that the mutation of the 5 sites is effective mutation, and the purpose of improving the OvIFN-gamma antiviral activity can be achieved. Among them, OvIFN-gamma-O-Q120K mutantHas the strongest antiviral effect, the amino acid sequence of the gene is shown as SEQ ID NO.5, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6.

TABLE 2 detection results of antiviral activity of recombinant ovine gamma interferon single site mutation

Example 3 expression and detection of OvIFN-. gamma. -O-M1 mutant after amino acid double-site mutagenesis in silkworm bioreactor

1. Experimental methods

1.1 construction of sheep gamma-type interferon mutant Gene

In view of the results of example 2, it was confirmed that the mutation at a partial site is a potent mutation, and the objective of improving the antiviral activity of OvIFN-. gamma.can be achieved. Considering that the sequence of amino acids is the primary structure of the protein and determines the higher order structure of the protein, and that the positions of the partial mutation sites in the single-site amino acid mutation performed in example 1 may be correlated with each other, two-site amino acid mutation was attempted. The invention combines single mutation sites E32T, L79F, K103R, Q120K and N157T with improved antiviral activity in pairs to carry out double-site mutation, wherein the double-site mutation is based on the single-site mutation sequence obtained in the example 2, the double-site mutation is carried out by taking the single-site mutation sequence (OvIFN-gamma-O-M1) as a template and utilizing a corresponding primer (see the example 2 for details) to carry out second site-directed mutation by a fusion PCR method, so as to obtain a target fragment of the double-site mutation, and the fusion PCR method is shown in the '2 and experimental methods'.

The double mutation sites are 10 combinations of E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103K-N157K and Q120K-N157K, and the obtained sheep gamma interferon mutants are named as OvIFN-gamma-O-M K-M K (E32K-L79K, E32K-K103K, E32K-Q120K, E32K-N157K, L79K-K103K, L79K-Q120K, L79K-N K, K103-Q120-Q157K, K157K-N157K and N157K).

1.2 construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with the BamHI and EcoRI double digested inactivated baculovirus transfer vector pVL1393 using recombinase (pEASY-Uni subassembly Cloning and Assembly Kit). Transforming a recombinant product into escherichia coli competent cell TOP10, selecting a colony for culture, upgrading the plasmid, carrying out double enzyme digestion by BamHI and EcoRI to identify a positive clone, sending the correctly identified recombinant plasmid to Beijing OvIFN-gamma-O-M1-M2 (E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T and Q120K-N157T) for sequencing the correctly.

1.3 obtaining, purifying and amplifying recombinant silkworm baculovirus

The recovery and passage of the BmN cells and the screening of the recombinant viruses are carried out according to the methods reported in the literature. When the BmN cells were cultured until the cell monolayer reached about 80%, the old medium was poured off, washed three times with serum-free TC-100 medium, and 1.5mL of FBS-free medium was added. Sequentially adding 1 mu g of bombyx mori baculovirus parent strain BmBacmid DNA, 2 mu g of recombinant transfer plasmid pVL-OvIFN-gamma-O-M1-M2 and 5 mu L of liposome into a sterilizing tube, complementing the volume to 60 mu L by using sterile double distilled water, gently mixing uniformly, standing for 15min, and then dropwise adding into a culture bottle for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu.L FBS were supplemented. Culturing at the constant temperature of 27 ℃ for 4-5 days until the cells shed and float, and collecting cell culture solution to obtain the recombinant virus rBmBacmid (OvIFN-gamma-O-M1-M2) containing the target gene.

The purification and amplification method of the recombinant silkworm baculovirus is as follows: inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the collected cell culture solution at different concentrations, adding 1mL of the diluted cell culture solution into the adherent cells, and uniformly distributing the cells. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. And (3) selecting the plaques which do not contain the polyhedron, repeating the steps, and performing 2-3 rounds of purification to obtain the pure recombinant baculovirus rBmBacmid (OvIFN-gamma-O-M1-M2).

Infecting the recombinant bombyx mori baculovirus rBmBacmid (OvIFN-gamma-O-M1-M2) with the normally growing BmN cells, culturing for 3 days, and collecting the supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-gamma-O-M1-M2).

1.4 sheep gamma-type interferon mutant is expressed in silkworm body

The antiviral activity of the goat gamma-type interferon mutant expressed in the silkworm haemolymph is detected on a Vero/VSV-GFP system by adopting a micro cytopathic effect inhibition method. Vero cells in good state were cultured at 3.0X 10⁵The cells/mL were plated in 96-well plates. Preparing the silkworm hemolymph with ultrasonic disruption and filter sterilization into solution with different dilutions by DMEM culture solution containing 70mL/L fetal bovine serum, inoculating diluted sample into culture wells filled with VERO cells at 100 μ L/well, setting at least 12 duplicate wells for each dilution and control silkworm blood, setting cell control group without silkworm hemolymph and VSV GFP and virus control group with VSV GFP, and culturing at 37 deg.C and 5% CO₂Culturing for 18-24 h under the condition. Diluting to 100TCID₅₀The VSV GFP virus of (1) was added to the culture well from which the supernatant had been aspirated at 100. mu.L/well, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing under the condition. When a large number of cells in each well of the virus control group fluoresce under an inverted fluorescence microscope, the virus control groupThe cells in the cell control group still grow well completely, and when no fluorescence appears, the control system is completely qualified, and the comprehensive observation can be carried out.

2. Results of the experiment

2.1 identification of recombinant transfer vectors

The recombinant transfer vector pVL-OvIFN-gamma-O-M1-M2 is subjected to double digestion by BamHI and EcoRI, 2 fragments are separated by 1% agarose gel electrophoresis, the small fragment is positioned between 500 and 750bp and is consistent with the size of the target gene fragment 510bp, and the large fragment is positioned above 8000bp and is consistent with the size of the pVL1393 fragment 9607 bp. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited for nucleotide sequencing, and MegaAlign comparison results show that the sequence is consistent with the originally designed sequence, which shows that the sheep gamma-type interferon mutant gene is successfully inserted between BamHI and EcoRI in the pVL1393 transfer vector.

The antiviral activity of sheep gamma-type interferon expressed by silkworm larvae is detected on a Vero/VSV-GFP system by applying a trace cytopathic inhibition method. The growth state of the cells in the cell control group is good and no fluorescence appears when the cells are observed under an inverted fluorescence microscope; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant goat gamma interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of the sheep gamma-type interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to a Reed-Muench method, and obtaining the detection results shown in Table 3, wherein the titer of all sheep gamma-type interferon mutants is 3.98 multiplied by 10⁵U/mL～4.68×10⁶U/mL, wherein after double mutation of groups L79F-Q120K, K103R-Q120K and E32T-N157T, the titer of the expressed sheep gamma interferon is slightly higher than the titer measured by expression of an original sequence and a single mutation sequence, and the titer is unchanged or even reduced after mutation of other groups of sites, which indicates that the mutation of the 3 combined sites is effective mutation, and the aim of improving the antiviral activity of the OvIFN-gamma-O-M1 mutant can be achieved. Wherein the OvIFN-gamma-O-L79F-Q120K mutant has the strongest antiviral effect, and the amino acid thereofThe sequence is shown as SEQ ID NO.7, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.8

TABLE 3 detection results of the antiviral activity of the recombinant goat gamma interferon double-site mutation

Example 4 expression and detection of OvIFN-. gamma. -O-M1-M2 mutant after amino acid Multi-site mutagenesis in silkworm bioreactor

1. Experimental methods

1.1 construction of sheep gamma-type interferon mutant Gene

In view of the results of example 2, it is assumed that the amino acid sequence is the primary structure of the protein and determines the higher structure of the protein, and that the amino acid multiple site mutation is attempted because the positions of the partial mutation sites of the amino acid single site mutation are closely related to each other. The invention combines the obtained double mutation sites with high titer to determine a third mutation site, the multi-site mutation is based on the double-site mutation sequence obtained in the embodiment 3, the third site-directed mutation is carried out by using the (OvIFN-gamma-O-M1-M2) as a template and a corresponding primer (see the embodiment 2 in detail) through a fusion PCR method, so as to obtain a target fragment of the multi-site mutation, and the fusion PCR method is shown in the 2 and experimental methods.

The following 6 combinations were obtained: E32T-L79F-K103R, E32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T and K103R-Q120K-N157T. The obtained goat gamma interferon mutant is named as OvIFN-gamma-O-M1-M2-M3 (E32T-L79F-K103R, E32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T) mutant.

1.2 construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with the BamHI and EcoRI double digested inactivated baculovirus transfer vector pVL1393 using recombinase (pEASY-Uni subassembly Cloning and Assembly Kit). Transforming a recombinant product into escherichia coli competent cell TOP10, selecting a colony for culturing, upgrading the plasmid, carrying out double enzyme digestion by BamHI and EcoRI to identify a positive clone, sending the correctly identified recombinant plasmid to Beijing OvIFN-gamma-O-M1-M2-M3 (E32T-L79F-K103R, E32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T and K103R-Q120K-N157T) to sequence the correctly sequenced plasmid.

1.3 obtaining, purifying and amplifying recombinant silkworm baculovirus

The recovery and passage of the BmN cells and the screening of the recombinant viruses are carried out according to the methods reported in the literature. When the BmN cells were cultured until the cell monolayer reached about 80%, the old medium was poured off, washed three times with serum-free TC-100 medium, and 1.5mL of FBS-free medium was added. Sequentially adding 1 mu g of bombyx mori baculovirus parent strain BmBacmid DNA, 2 mu g of recombinant transfer plasmid pVL-OvIFN-gamma-O-M1-M2-M3 and 5 mu L of liposome into a sterilization tube, complementing the volume to 60 mu L by using sterile double distilled water, gently mixing the components uniformly, standing the mixture for 15min, and then dropwise adding the mixture into a culture bottle for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu. LFBS were added. Culturing at the constant temperature of 27 ℃ for 4-5 days until the cells are exfoliated and float, and collecting cell culture solution to obtain the recombinant virus rBm-Bacmid (OvIFN-gamma-O-M1-M2-M3) containing the target gene.

The purification and amplification method of the recombinant silkworm baculovirus is as follows: inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the collected cell culture solution at different concentrations, adding 1mL of the diluted cell culture solution into the adherent cells, and uniformly distributing the cells. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. And (3) selecting the plaques which do not contain the polyhedra, repeating the steps, and performing 2-3 rounds of purification to obtain the pure recombinant bombyx mori baculovirus rBm-Bacmid (OvIFN-gamma-O-M1-M2-M3).

Infecting the recombinant bombyx mori baculovirus rBm-Bacmid (OvIFN-gamma-O-M1-M2-M3) with the normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of the recombinant virus rBm-Bacmid (OvIFN-gamma-O-M1-M2-M3).

1.4 sheep gamma-type interferon mutant is expressed in silkworm body

The antiviral activity of the goat gamma-type interferon mutant expressed in the silkworm haemolymph is detected on a Vero/VSV-GFP system by adopting a micro cytopathic effect inhibition method. Vero cells in good state were cultured at 3.0X 10⁵The cells/mL were plated in 96-well plates. Preparing the silkworm hemolymph with ultrasonic disruption and filter sterilization into solution with different dilutions by DMEM culture solution containing 70mL/L fetal bovine serum, inoculating diluted sample into culture wells filled with VERO cells at 100 μ L/well, setting at least 12 duplicate wells for each dilution and control silkworm blood, setting cell control group without silkworm hemolymph and VSV GFP and virus control group with VSV GFP, and culturing at 37 deg.C and 5% CO₂Culturing for 18-24 h under the condition. Diluting to 100TCID₅₀The VSV GFP virus of (1) was added to the culture well from which the supernatant had been aspirated at 100. mu.L/well, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing under the condition. When a large number of cells in each hole of the virus control group generate fluorescence and the cells in the cell control group still completely grow well and no fluorescence appears, the contrast system is completely qualified, and comprehensive observation can be carried out.

2. Results of the experiment

2.1 identification of recombinant transfer vectors

The recombinant transfer vector pVL-OvIFN-gamma-O-M1-M2-M3 is subjected to double digestion by BamHI and EcoRI, 2 fragments are separated by 1% agarose gel electrophoresis, the small fragment is positioned between 500 and 750bp and is consistent with the size of the target gene fragment of 510bp, and the large fragment is positioned above 8000bp and is consistent with the size of the pVL1393 fragment of 9607 bp. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited for nucleotide sequencing, and MegaAlign comparison results show that the sequence is consistent with the originally designed sequence, which shows that the sheep gamma-type interferon mutant gene is successfully inserted between BamHI and EcoRI in the pVL1393 transfer vector.

The antiviral activity of sheep gamma-type interferon expressed by silkworm larvae is detected on a Vero/VSV-GFP system by applying a trace cytopathic inhibition method. The growth state of the cells in the cell control group is good and no fluorescence appears when the cells are observed under an inverted fluorescence microscope; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant goat gamma interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of the sheep gamma-type interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to a Reed-Muench method, and obtaining the detection results shown in Table 4, wherein the titer of all sheep gamma-type interferon mutants is 3.24 multiplied by 10⁵U/mL～6.31×10⁶U/mL, wherein after L79F-K103R-Q120K three-site mutation, the titer of the expressed sheep gamma interferon is far higher than the titer measured by the expression of the original sequence, the single mutation sequence and the double mutation sequence, and is 6.31 multiplied by 10⁶U/mL. The titer is unchanged or even reduced after mutation of other groups of sites, which indicates that the mutation of the combined site is effective mutation and can achieve the purpose of improving the antiviral activity of the OvIFN-gamma-O-M1-M2 mutant. The amino acid sequence of the OvIFN-gamma-O-L79F-K103R-Q120K mutant is shown as SEQ ID NO.9, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.

TABLE 4 detection results of antiviral activity of multiple site mutation of recombinant ovine gamma interferon

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Zhejiang Shanxi Shi biological science and technology Co Ltd

<120> sheep gamma interferon mutant and preparation method and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 166

<212> PRT

<213> Capra hircus

<400> 1

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 2

<211> 498

<212> DNA

<213> Capra hircus

<400> 2

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattcaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 3

<211> 166

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 4

<211> 498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattcaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 5

<211> 166

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 6

<211> 498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 7

<211> 165

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Leu Leu Gly

1 5 10 15

Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn

20 25 30

Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly Gly

35 40 45

Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp Lys

50 55 60

Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe Glu

65 70 75 80

Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile Lys

85 90 95

Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu

100 105 110

Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile Gln

115 120 125

Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro

130 135 140

Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly

145 150 155 160

Arg Arg Ala Ser Met

165

<210> 8

<211> 498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaattcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 9

<211> 155

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Arg Lys Arg Ser

130 135 140

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Met

145 150 155

<210> 10

<211> 498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaattcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaggt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

Claims

1. The sheep gamma interferon mutant is characterized in that the sheep gamma interferon mutant is obtained by carrying out Q120K amino acid single-site mutation on an amino acid sequence of sheep gamma interferon, the amino acid sequence of the mutant is shown as SEQ ID NO.5, and the nucleotide sequence of a mutant coding gene is shown as SEQ ID NO. 6;

the amino acid sequence of the sheep gamma interferon is shown in SEQ ID NO.1 or the amino acid sequence which has the same interferon function or activity with the amino acid sequence shown in SEQ ID NO. 1.

2. The sheep gamma interferon mutant is characterized in that the sheep gamma interferon mutant is obtained by carrying out amino acid double-site mutation on an amino acid sequence shown in SEQ ID NO.1, wherein the amino acid sequence is any one of L79F-Q120K and K103R-Q120K.

3. The sheep gamma interferon mutant is characterized in that the sheep gamma interferon mutant is obtained by carrying out L79F-K103R-Q120K amino acid multi-site mutation on an amino acid sequence shown in SEQ ID NO. 1.

4. A recombinant vector or a recombinant host cell comprising the goat gamma interferon mutant as claimed in any one of claims 1 to 3.

5. Use of the mutant gamma interferon of any one of claims 1 to 3 in the preparation of a medicament or reagent for preventing or treating viral diseases in sheep.

6. Use according to claim 5, characterized in that said viral diseases of sheep comprise: any one or more of capripoxvirus infection, caprine infective pustular virus infection or vesicular stomatitis virus infection, or bovine respiratory syncytial virus disease.

7. A method for preparing the goat gamma interferon mutant as claimed in any one of claims 1 to 3, comprising the steps of:

(1) respectively cloning coding genes of the sheep gamma interferon mutant of any one of claims 1 to 3 into a baculovirus transfer vector to construct a recombinant transfer vector;

8. The method according to claim 7, wherein the baculovirus transfer vector is selected from the group consisting of AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB 4, pAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIEl, pAcJPl, pAcMWLF 24, pAcMW7, cpAcpAcpApApAcpApApApA8, pAcPLL, pAcMP2, pAcRP23, pAcRP 25, pAcMAG 9, pAcsMAG, 686pUWl, pAcUW21, pAcUW2, pAcUcWw 2, pAcUcUw53, pAcYNcVvYNpYNpNV 8672, pApYNcVvWO 72, pApYNcVvYP, pApVEcVvWO 72, pApVEcVvEPV 13972, pApVEcVpVIV 3636363636369872, pApVEcVpVIV 3655, pApVEcVEcVpVIV 36pVIV 3655, pApVEcVpVIV 36pVIV 3655, pApVEcJV 36pVIV 3655, pAcJV 36pVEcJV 3636pVEcJV 3636pVIpVEcJpAcJV 36pVIpVIpVIpVIpI, pAcJV, pAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpAcJpApIII, pAcJpAcJpAcJpAcJpAcJpAcWpIII, pAcJpAcWpIII, pAcWpWpWpWpWpWpIII, pAcJpAcJpAcJpAcWpIII, pAcJpAcWpIII, pAcWpIII, pAcJpAcWpWpWpWpWpWpWpIII, pAcWpIII, pAcJpAcWpIII, pAcJpAcJpAcWpIII, pAcWpIII, pAcJpAcJpAcJpAcJpAcWpIII, pAcJpAcWpWpIII, pAcWpIII, pAcWpWpWpWpIII, pAcWpIII, pAcWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpIII, pAcWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpWpW;

the insect host is selected from the group consisting of Bombyx mori (Bombyx mori), Bombyx mori (Bombyx mandarina), Ricinus communis (Philosamia cynthia ricim), Lauraria camphora (Dictyyoplocajapanica), Ailanthus altissima (Philosamia cyathiapryerii), Antheraea pernyi (Antheraea yamamai), Antheraea japonica (Antheraea yamamai), Philadeltoid (Antheraea heterophylla), Autographa californica (Atogaraea californica), Ectropina obliqua (Ectropis obliqua), Trichoplusia glans (Mamezia brassica), Spodoptera litura (Spodoptera littoralis), Spodoptera armyworm (Spodoptera frugiperda), Trichoplusia ni (Trichoplusia), Mars armyworm (Thaumatopsis wilsonis), Heliothis armigera (Heliothis virens), Heliothis virescens (Helicosa), Helicoverpa armigera (tobacco (Helicosa), or Helicoverpa armigera (Helicosa).

9. The method of claim 7, wherein the baculovirus transfer vector is pVL 1393; the baculovirus is a parent strain BmBacmid of silkworm baculovirus; the insect host is silkworm (Bombyx mori); wherein, the infection in the step 3) means that the recombinant baculovirus infects 1-5-year-old insect larvae or pupae bodies by swallowing or permeating epidermis.