CN108676083A - A kind of interferon mutant of sheep and the preparation method and application thereof - Google Patents

Abstract

Recombinant vector or recombinant host cell the present invention provides a kind of interferon of sheep and sheep interferon mutant and containing above-mentioned sheep interferon or sheep interferon mutant, the sheep interferon or sheep interferon mutant can be used for preparing in the drug or reagent that prevent or treat sheep virosis.The present invention expresses the interferon mutant of the sheep using baculovirus expression vector system in silkworm biological reactor, antiviral activity increases substantially, the method of the present invention is simple for process, can be quickly obtained the interferon of a large amount of safe and reliable sheep, be of great significance to the development of animal husbandry.

Description

A kind of interferon mutant of sheep and the preparation method and application thereof

Technical field

The invention belongs to Veterinary Medicine fields, and in particular to a kind of interferon mutant of sheep and preparation method thereof with answer With.

Background technology

Interferon is a kind of protein with antiviral activity on allogenic cell, active to play again by cell base Because of the adjusting and control of group, it is related to the synthesis of RNA and protein.Sequence of the IFN protein families according to its encoding gene, chromosome Positioning and receptor-specific are divided into I type, II type and III type interferon.Interferon type Ⅰ includes IFN-α, IFN-β, IFN- ω, IFN- δ, IFN- ε, IFN- δ, IFN- τ etc. are mainly IFN-α and IFN-β in mammal.Interferon type Ⅰ has stronger antiviral Activity also has antitumor and immunoregulatory function mainly by its proliferation of the inhibition of DNA replication of viral interference.Interferon type Ⅱ Only one member of IFN-γ, also known as immune interferon, main function are that activating macrophage kills microorganism.III type interferes Element is newfound cell factor, including λ 1 (IL-29), λ 2 (IL-28a) and λ 3 (IL-28b).III type interferon and I type interfere Element is in close relations, but has special physiologic function, such as stimulates major histocompatibility complex (major histocom- Patibility complex, MHC) molecule activation and expression, adjust congenital immunity and acquired immunity etc..Due to interferon With broad-spectrum antiviral, antitumor active and powerful immunoregulation effect, virology, cytology, molecule are become One of research hotspots of related fields such as biology, clinical medicine, immunology, oncology.

Member's IFN-γ of interferon type Ⅱ is mainly expressed by NK, NKT cell and T cell that activate, the receptor of IFN-γ It is IFNGR, belongs to heterodimer, wide expression is in various kinds of cell.It is important immune response molecule, participates in the whole of immune response A process regulates and controls the trend of immune response, especially has important role to cellular immunity.

The IFN-γ of sheep is mainly worked by three approach, and first is increased by raising the approach of offering of MHC- class Ⅰ antigens Refinement Cytotoxic T Lymphocytes make CTL more effectively remove pathogen the sensibility of pathogen；Second makes immune response To Th1 Phenotypic Changes, static CD4+ T cells are made to be divided into Th1 cells, while inhibiting the proliferation of Th2 cells；To immune thin Born of the same parents are adjusted to realize immunoloregulation function.Third IFN-γ can also by and cell surface receptor combination, induction Virus infected cell generates a variety of antiviral proteins, makes to generate antiviral state into the cell and play antivirus action or interference Cell cycle inhibits cell Proliferation, inhibits the treatment of viral disease.

Sheep is common raising animal, high-output stress-resistance, it is with good meat quality, early sexual maturity and fertility are strong the advantages that.It is suitable Close one of the important livestock of family-raise.Fur and meat are provided for the mankind, fur is the original of a variety of woolen knitwears and leather and fur products Material.Mutton is winter excellent food therapeutic health.Mutton contains abundant protein, fat, vitamin B, niacin, inorganic matter The ingredients such as calcium, phosphorus, iron, potassium, iodine, nutrition is very comprehensive, enriches.In addition, also have higher medical value, but sheep aquaculture is still The invasion of some viral diseases is so received, but is the absence of safe and reliable and reasonable price sheep interferon class drug therapy Or prevent sheep virosis.

Invention content

The term definition involved in the present invention arrived

Unless otherwise defined, otherwise all technologies used herein and scientific terminology all have with it is of the art Those of ordinary skill usually understands identical meaning.

Term " polynucleotides " or " nucleotide " mean the deoxyribonucleotide of sub-thread or bifilar form, deoxyribose core Glycosides, ribonucleotide or ribonucleotide and its polymer.Except nonspecific limitation, otherwise the term is covered containing natural nucleotide Known analog nucleic acid, the analog have similar to reference nucleic acid binding characteristic and with similar to naturally-produced The mode of nucleotide is metabolized.Unless in addition specific limitation, otherwise the term also mean oligonucleotide analogs comprising PNA (peptide nucleic acid), the DNA analogs used in antisense technology (thiophosphate, phosphamide acid esters etc.).Unless in addition referring to Fixed, the variant that otherwise specific nucleic acid sequence also impliedly covers its conservative modification (includes but is not limited to that degenerate codon takes Generation) and complementary series and clearly specified sequence.Particularly, can by generate one of them or more than one selected by (or It is all) the 3rd of codon realize that degenerate codon replaces through mixing the sequence of base and/or deoxyinosine residue substitution (Batzer et al., Nucleic Acid Res.19:5081(1991)；Ohtsuka et al., J.Biol.Chem.260:2605- 2608(1985)；With Cassol et al., (1992)；Rossolini et al., Mol Cell.Probes 8:91-98(1994)).

Term " homology ", refers to the sequence similarity with native sequence nucleic acid." homology " includes the regulation and control with the present invention The nucleotide sequence of segment has preferably 85% or a higher, and more preferably 90% or higher, and most preferably 95% or more The nucleotide sequence of high homogeneity.Homology can with the naked eye or computer software is evaluated.Using computer software, two Or the homology between multiple sequences can use percentage (%) to indicate, it can be homologous between correlated series for evaluating Property.

Term " complementary " referred to herein as two kinds of nucleotide sequences for including antiparallel nucleotide sequence, it is antiparallel Nucleotide sequence matches each other after capable of forming hydrogen bond between the complementary base residue of antiparallel nucleotide sequence.Ability When domain is known that the sequence in terms of all from 5 ' to 3 ' direction, the nucleotide sequence of two kinds of complementary strands is reversely with each other complementary. Also known in the art, two kinds of sequences that can hybridize each other under given condition group need not must be 100% complete complementary 's.

Term " stringent hybridisation conditions " means the condition of known low ionic strength and high temperature in the art.In general, Under high stringency conditions, detectable degree that probe hybridizes with its target sequence is than the detectable degree higher that hybridizes with other sequences (such as more than background at least 2 times).Stringent hybridisation conditions are sequence dependents, under different environmental conditions will be different, Longer sequence specific hybrid at relatively high temperatures.By control hybridization preciseness or wash conditions can identify and probe 100% complementary target sequence.Related document (Tijssen, Techniques in can refer to for the detailed guidance of nucleic acid hybridization Biochemistry and Molecular Biology-Hybridization with Nucleic Probes," Overview of principles of hybridization and the strategy of nucleic acid assays.1993).More specifically, the high stringency conditions are typically selected to be less than distinguished sequence at regulation ionic strength pH About 5-10 DEG C of heat fusion joint (Tm).Tm is residing when 50% hybridizes to target sequence with the probe of target complementation in the state of the equilibrium Temperature (under specified ionic strength, pH and nucleic acid concentration) (because target sequence is present in excess, in equilibrium-like at Tm 50% probe is occupied under state).High stringency conditions can be the following conditions：Wherein it is below about in the lower salinity of pH 7.0 to 8.3 1.0M Na ion concentrations, typically about 0.01 arrive 1.0M Na ion concentrations (or other salt), and temperature for short probe (including 10 to 50 nucleotide of (but not limited to)) for be at least about 30 DEG C, and for long probe (including but not limited to be more than 50 Nucleotide) for be at least about 60 DEG C.High stringency conditions can also be realized by the way that the destabilizing agent of such as formamide is added.For choosing For selecting property or specific hybrid, positive signal can be the background hybridization of at least twice, be optionally 10 times of background hybridizations.It is illustrative Stringent hybridisation conditions can be as follows：50% formamide, 5 × SSC and 1%SDS are cultivated at 42 DEG C；Or 5 × SSC, 1%SDS, It cultivates at 65 DEG C, washed in 0.2 × SSC and is washed in 0.1%SDS at 65 DEG C.The washing can carry out 5,15,30, 60,120 minutes or longer time.

Term " mutation " and " mutant " have their common meaning herein, refer in nucleic acid or polypeptide sequence Variation that is heredity, naturally occurring or introducing, their meaning are identical as the meaning that those skilled in the art are generally known.

Term " host cell " or " recombinant host cell " mean to include the cell of polynucleotides of the present invention, but regardless of using Which kind of method is inserted into generate recombinant host cell, such as directly known in intake, transduction, f pairings or fields Other methods.Exogenous polynucleotide can remain the non-integrated vector of such as plasmid or can be integrated into host genome.

Term " transfection " refers to the process that eukaryocyte obtains new genetic marker due to exogenous DNA incorporation.

First technical problem to be solved by this invention is to provide the interferon mutation of a kind of sheep interferon and sheep The interferon mutant of body, the sheep has high antiviral active；

Second technical problem to be solved by this invention is to provide a kind of utilization baculovirus expression vector system preparation The method of the interferon of the sheep or the interferon mutant of sheep；

Third technical problem to be solved by this invention is to provide the interferon of the sheep or the interferon of sheep is dashed forward Variant is preparing the purposes in preventing or treating the drug or reagent of sheep virosis.

In order to solve the above technical problems, present invention firstly provides a kind of interferon of sheep, the interferon of the sheep Amino acid sequence be shown in SEQ ID NO.1 or for there is same disturbance element with amino acid sequence shown in SEQ ID NO.1 Function or active amino acid sequence.

Preferably, in the interferon of sheep of the present invention, the multinuclear of the encoding gene of the interferon of the sheep Nucleotide sequence is shown for (a) or (b) or (c)：

(a) polynucleotide sequence shown in SEQ ID No.2；Or

(b) with complementary series can be hybridized in stringent hybridisation conditions shown in SEQ ID No.2 polynucleotides sequence The albumen of row, the polynucleotide sequence coding still has the function of same disturbance element or activity；Or

(c) with SEQ ID No.2 shown in polynucleotide sequence at least 80% or more homology polynucleotide sequence, And the albumen of the polynucleotide sequence coding still has the function of same disturbance element or activity；Preferably, with SEQ ID No.2 Shown in polynucleotide sequence at least 85% or more homology polynucleotide sequence, and the polynucleotide sequence coding Albumen still has the function of same disturbance element or activity；It is furthermore preferred that at least with the polynucleotide sequence described in SEQ ID No.2 There is the polynucleotide sequence of 90% or more homology, and the albumen of the polynucleotide sequence coding is still with same disturbance element Function or activity.

Another aspect of the invention is a kind of sheep interferon mutant is provided, the interferon mutant of the sheep is will The following E32T, E36D of amino acid sequence progress, N42T, P43S, K47N, S53L, L79F shown in the SEQ ID NO.1, Any one in N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T, R160Q The mutant that kind amino acid unit point mutation obtains；Preferably, in sheep interferon mutant of the present invention, the sheep Interferon mutant be amino acid sequence shown in the SEQ ID NO.1 carry out it is following carry out E32T, L79F, K103R, The mutant that any one of Q120K, N157T amino acid unit point mutation obtain；It is highly preferred that the interferon of the sheep Mutant is that amino acid sequence shown in the SEQ ID NO.1 carries out the mutant that Q120K amino acid unit point mutation obtains, The amino acid sequence of the mutant is shown in SEQ ID NO.5, and the nucleotides sequence of the mutant code gene is classified as SEQ Shown in IDNO.6.

Another aspect of the invention is a kind of sheep interferon mutant is provided, the interferon mutant of the sheep is will Amino acid sequence shown in the SEQ ID NO.1 carries out E32T-L79F, E32T-K103R, E32T-Q120K, E32T- In N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T, Q120K-N157T Any type amino acid double-site mutant obtain mutant；Preferably, the interferon mutant of the sheep be will be described Amino acid sequence shown in SEQ ID NO.1 carries out L79F-Q120K, K103R-Q120K, E32T-N157T any type amino The mutant that sour double-site mutant obtains；It is highly preferred that the interferon mutant of the sheep is by the SEQ ID NO.1 Shown in amino acid sequence carry out L79F-Q120K amino acid double-site mutants obtain mutant, the amino acid of the mutant Sequence is shown in SEQ ID NO.7, and the nucleotides sequence of the encoding gene of the mutant is classified as shown in SEQ ID NO.8.

Another aspect of the invention is a kind of sheep interferon mutant is provided, the interferon mutant of the sheep is will Amino acid sequence shown in the SEQ ID NO.1 carries out E32T-L79F-K103R, F32T-L79F-Q120K, E32T-L79F- N157T, L79F-K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T any type amino acid multidigit point It is mutated the mutant obtained；Preferably, the interferon mutant of the sheep is by amino acid shown in the SEQ ID NO.1 Sequence carries out the mutant that L79F-K103R-Q120K amino acid multisite mutations obtain；It is highly preferred that the γ interference of the sheep Element obtains for amino acid sequence shown in the SEQ ID NO.1 is carried out L79F-K103R-Q120K amino acid multisite mutations Mutant, the amino acid sequence of the mutant is the nucleotide of the encoding gene of the mutant shown in SEQ ID NO.9 Sequence is shown in SEQ ID NO.10.

Another aspect of the invention is to provide the recombinant vector containing above-mentioned sheep interferon or sheep interferon mutant Or recombinant host cell.

Another aspect of the present invention is to provide above-mentioned sheep interferon or sheep interferon mutant to prevent or control preparing The drug for treating sheep virosis or the purposes in reagent.

Preferably, sheep interferon of the present invention or sheep interferon mutant are preparing prevention or treatment sheep disease toxicity On the way, the sheep virosis includes for the drug of disease or the use in reagent：Capripox virus infection, sheep infective pustule virus Infection or vesicular stomatitis virus infect any one or more of associated diseases or Bovine Respiratory Syncytial virosis.

Another aspect of the present invention is the interferon for preparing above-mentioned sheep or the method for sheep interferon mutant, including with Lower step：

(1) respectively by the encoding gene of the interferon of sheep described in claim 1 or claim 2 to 4 any one The encoding gene of the interferon mutant of the sheep is cloned into baculovirus transfer vector, and structure obtains recombination transfer and carries Body；

(2) by the recombinant transfer vector and baculovirus DNA cotransfection insect cell, recombinant baculovirus is obtained；

(3) by the recombinate shape virus infection insect cell or insect host, infected insect cell or elder brother are cultivated The corresponding albumen of worm host expresses, purifying to get.

Preferably, described rod-shaped in the method for preparing sheep interferon of the present invention or sheep interferon mutant Baculovirus transfer vector be selected from AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII(pETL)、p2Bac、p2Blue、p89B310、pAc360、pAc373、pAcAB3、pAcAB 4、PAcAS3、 pAcC129、pAcC4、DZI、pAcGP67、pAcIEl、pAcJPl、pAcMLF2、pAcMLF 7、pAcMLF 8、pAcMPl、 pAcMP2、pAcRP23、pAcRP 25、pAcRW4、pAcsMAG、pAcUWl、pAcUW21、pAcUW2A、pAcUW2B、pAcUW3、 pAcUW31、pAcUW41、pAcUW42、pAcUW43、pAcUW51、pAcVC2、pAcVC 3、pAcYMl、pAcJcC5、pBacl、 pBac2、pBlueBacIII、pBlueBacHis、pEV55、mXIV、pIEINeo、pJVETL、pJVNhel、pJVP10、 pJVrsMAG、pMBac、pP10、pPAKl、pPBac、pSHONEX 1.1、pSYN XIV VI+、pSYNVI+wp、pSYNXIV VI-, pVL1391, pVL 1392, pVL 1393, pVL941, pVL 945, pVL 985, pVTBac, pBM030 or pUAC-5；It is excellent Selection of land, the baculoviral be selected from silkworm baculovirus parent plant BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV；Preferably, the insect host is selected from silkworm (Bombyx mori), wild silkworm (Bombyx mandarina), castor silkworm (Philosamia cynthia ricim), wild silkworm (Dictyoploca japanica), Philosamia cynthia (Philosamia cynthia pryeri), tussah (Antheraea Pernyi), yamama (Antheraea yamamai), wild giant silkworm (Antheraea polyphymus), autographa california (Atographa califorica), tea geometrid (Ectropis obliqua), cabbage army worm (Mamestra brassicae), Prodenia litura (Spodoptera littoralis), autumn armyworm (Spodoptera frugiperda), cabbage looper (Trichoplusia ni), armyworm (Thaumetopoea wilkinsoni), bollworm (Heliothis armigera), U.S. bollworm (Heliothis zea), oriental tobacco budworm (Heliothis assulta), cigarette beetle (Heliothis Virescens), oriental armyworm (Pseudaletia separata) or gypsymoth (Lymantria dispar)；Preferably, institute It is pVL1393 to state baculovirus transfer vector；The baculoviral is silkworm baculovirus parent plant BmBacmid；The insect Host is silkworm (Bombyx mori)；Wherein, infection described in step 3) refers to recombinant baculovirus by eating or penetrating table Skin infects the insect larvae or pupal cell in 1-5 ages.Compared with prior art, the present invention the present invention has the following advantages：

The present invention carries out sequence alignment and signal peptide point by the interferon amino acid sequence of all sheep on analysis NCBI Analysis, it is final to determine that the amino acid sequence with accession number for NP_001009803.1 is main reference sequences, after codon optimization Sequence be the multipair primer of stencil design carry out amino acid unit point mutation, amino acid double-site mutant, amino with fusion DNA vaccine method Sour multisite mutation obtains the interferon mutant of multiple sheep.The present invention is in using baculovirus expression vector system The interferon mutant of the sheep, the antiviral work of the interferon mutant of expressed sheep are expressed in silkworm bioreactor Property increase substantially, have more apparent antiviral activity.The method of the present invention is simple for process, and can be quickly obtained a large amount of safety can The interferon of the sheep leaned on.The interferon mutant of sheep of the present invention, which can be used in preparing, prevents or treats sheep disease toxicity The drug or reagent of disease, are of great significance to the development of animal husbandry.

Description of the drawings

Fig. 1 is the corresponding fluorogram of cytopathy ratio in one embodiment of the present of invention；

Fig. 2 is the double digestion qualification figure of the recombinant plasmid pVL-OvIFN- γ in one embodiment of the present of invention；

Fig. 3 is that the cell in one embodiment of the present of invention the case where various ratios of fluorescence schematic diagram occurs；

Specific implementation mode

In one embodiment of the invention, a kind of interferon of sheep (OvIFN- γ), amino acid sequence are provided Shown in SEQ ID NO.1, the polynucleotide sequence of encoding gene is for (a) or (b) or (c) shown：

(a) polynucleotide sequence shown in SEQ ID No.2；Or

(b) polynucleotide sequence that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID No.2, should The albumen of polynucleotide encoding still has the function of interferon or activity；Or

(c) with the polynucleotide sequence of the polynucleotide sequence of SEQ ID No.2 at least 80% or more homology, and should The albumen of polynucleotide encoding still has the function of interferon or activity；Preferably, with the polynucleotide sequence of SEQID No.2 At least polynucleotide sequence of 85% or more homology, and the albumen of the polynucleotide encoding still have the function of interferon or Activity；It is furthermore preferred that the polynucleotide sequence with polynucleotide sequence at least 90% or more the homology of SEQ ID No.2, And the albumen of the polynucleotide encoding still has the function of interferon or activity.

Codon optimization is carried out to the gamma interferon genes sequence of sheep according to silkworm codon preference, is turned to influencing gene Record the G/C content of efficiency, translation efficiency and protein folding, the two level knot of CpG dinucleotides content, codon preference, mRNA A variety of relevant parameters such as the free stabilizability of structure, mRNA, RNA unstability motif, repetitive sequence optimize, and are conducive to Transcriptional efficiency and translation efficiency of institute's optimization gene in silkworm are improved, and keeps the protein sequence finally translated into constant；For The translation initiation efficiency in silkworm baculovirus eukaryotic expression system is improved, has added Kozak sequence AAC before gene, In order to improve translation termination efficiency, terminator codon is changed to TAA.In addition, also remove the BamHI inside gene order, The restriction enzyme sites such as EcoRI, SmaI, BamHI is added in upstream region of gene, and it is restricted to add EcoRI in downstream of gene Restriction enzyme site；Obtaining new sheep interferon optimization OvIFN- γ-O, amino acid sequence is shown in SEQ ID NO.3, Gene nucleotide series after optimization are shown in SEQ ID NO.4.

In one embodiment of the invention, a kind of interferon mutant of sheep is provided, is to be by amino acid sequence The interferon of sheep shown in SEQ ID NO.3 carry out E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T, R160Q any type amino acid The mutant that single-site mutant obtains；Preferably, the interferon that amino acid sequence is sheep shown in SEQ ID NO.3 is carried out The mutant that E32T, L79F, K103R, Q120K, N157T any type amino acid unit point mutation obtain.Wherein, by amino acid Sequence is that the interferon of sheep shown in SEQ ID NO.3 carries out the ammonia for the mutant that Q120K amino acid unit point mutation obtains Base acid sequence is shown in SEQ ID NO.5, and the nucleotides sequence of encoding gene is classified as shown in SEQ ID NO.6.

Wherein, amino acid unit point mutation Q120K of the present invention indicates that by amino acid sequence be shown in SEQ IDNO.3 The 120th amino acids of interferon mutant of sheep lysine (K) is mutated by glutamine (Q)；N157T is indicated the 157 amino acids are mutated into threonine (T) by asparagine (N)；The rest may be inferred.

In one embodiment of the invention, a kind of interferon mutant of sheep is provided, is to be by amino acid sequence The interferon mutant of sheep shown in SEQ ID NO.5 carries out E32T-L79F, E32T-K103R, E32T-Q120K, E32T- N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T, Q120K-N157T appoint A kind of what mutant that amino acid double-site mutant obtains；Preferably, it is sheep shown in SEQ ID NO.3 by amino acid sequence Interferon carries out the prominent of L79F-Q120K, K103R-Q120K, E32T-N157T any type amino acid double-site mutant acquisition Variant.Wherein, the interferon that amino acid sequence is sheep shown in SEQ ID NO.3 is subjected to L79F-Q120K amino acid dibits The amino acid sequence for the mutant that point mutation obtains is shown in SEQ ID NO.7, and the nucleotides sequence of encoding gene is classified as SEQ Shown in ID NO.8.

Wherein, amino acid double-site mutant L79F-Q120K of the present invention indicates that by amino acid sequence be SEQ ID 79th amino acids of the interferon of sheep shown in NO.3 are mutated into phenylalanine (F) by leucine (L), and by the 120th Amino acids are mutated into lysine (K) by glutamine (Q)；Amino acid double-site mutant E32T-Q120K is indicated the 32nd ammonia Base acid is mutated into threonine (T) by glutamic acid (E), and the 120th amino acids are mutated into lysine by glutamine (Q) (K)；The rest may be inferred.

In one embodiment of the invention, a kind of interferon mutant of sheep is provided, is to be by amino acid sequence The interferon of sheep shown in SEQ ID NO.3 carries out E32T-L79F-K103R, F32T-L79F-Q120K, E32T-L79F- N157T, L79F-K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T any type amino acid multidigit point It is mutated the mutant obtained；Preferably, the interferon that amino acid sequence is sheep shown in SEQ ID NO.3 is subjected to L79F- The mutant that K103R-Q120K amino acid multisite mutations obtain.Wherein, it is shown in SEQ ID NO.3 by amino acid sequence The amino acid sequence that the interferon of sheep carries out the mutant that L79F-K103R-Q120K amino acid multisite mutations obtain is SEQ Shown in ID NO.9, the nucleotides sequence of encoding gene is classified as shown in SEQ ID NO.10.

Wherein, amino acid multisite mutation L79F-K103R-Q120K of the present invention indicates that by amino acid sequence be SEQ 79th amino acids of sheep interferon shown in ID NO.3 are mutated into phenylalanine (F) by leucine (L), and by the 103rd Amino acids are mutated into arginine (R) by lysine (K), while the 120th amino acids are mutated into bad ammonia by glutamine (Q) Sour (K)；The rest may be inferred.

Present invention applicant analyzes the interferon amino acid sequence of all sheep on NCBI, and final determine with accession number is The amino acid sequence of NP_001009803.1 is that (its amino acid sequence is SEQ ID for the interferon original amino acid of sheep Shown in NO.1, the nucleotides sequence of encoding gene is classified as shown in SEQ ID NO.2), by signal peptide prediction, only there are one peptides Chain cleavage site, so signal polypeptide mutant need not be carried out again.

The present invention carries out ammonia using the optimization gene sequence of OvIFN- γ as the multipair primer of stencil design, using fusion DNA vaccine method Base acid single-site mutant, amino acid double-site mutant, amino acid multisite mutation obtain the interferon mutation of multiple sheep Body.

Wherein, on the basis of OvIFN- γ-O, this 5 positions E32T, L79F, K103R, Q120K, N157T are carried out respectively After point single-site mutant, the interferon potency of the sheep of expression expresses the potency measured, antiviral activity higher than OvIFN- γ-O Reach 2.69 × 10⁶-3.72×10⁶U/mL；And potency is constant after remaining site mutation or even reduces, and illustrates the prominent of this 5 sites Change is effectively to be mutated, and can achieve the purpose that improve antiviral activity.Wherein, Q120K single-site mutant acquisitions are carried out OvIFN- γ-O-Q120K mutant has most strong antivirus action.

Single mutation site E32T, L79F, K103R, Q120K, N157T two that the present invention further improves antiviral activity OvIFN- γ-O are carried out double-site mutant by two combinations.The testing result of antiviral activity shows L79F-Q120K, K103R- After the double mutation of tri- groups of Q120K, E32T-N157T, the interferon potency of the sheep of expression is higher than former sequence, the expression of single mutation sequence The potency measured, antiviral activity reach 3.98 × 10⁶-4.68×10⁶U/mL, and potency is constant after remaining several groups of site mutation It even reduces, illustrates that the mutation in this 3 combination sites is effectively to be mutated, can achieve the purpose that improve antiviral activity.Wherein, OvIFN- γ-O-L79F-Q120K the mutant for carrying out L79F-Q120K double-site mutant acquisitions has most strong antivirus action.

The present invention further combines double mutational sites with high-titer of acquisition, and OvIFN- γ-O are carried out amino acid Multisite mutation.After the testing result of mutant antiviral activity shows tri- site mutations of L79F-K103R-Q120K, expression The interferon potency of sheep is far above former sequence, single mutation sequence, double mutant nucleotide sequences and expresses the potency measured, be 6.31 × 10⁶U/mL；And potency is constant after remaining several groups of site mutation or even reduces.Illustrate that the mutation in this combination site is effectively to be mutated, It can achieve the purpose that improve antiviral activity.

In one embodiment of the invention, the interferon containing the sheep or sheep interferon mutant are provided Encoding gene recombinant vector or recombinant host cell.Wherein, the recombinant vector is recombinant expression carrier or recombinant clone Carrier.

In one embodiment of the invention, the transfer vector of structure is provided, including：

(1) mutant (OvIFN- γ-O-M1 mutant) after amino acid unit point mutation is carried out containing OvIFN- γ-O The carrier pVL-OvIFN-O-M1 of gene order；

(2) mutant (OvIFN- γ-O-M1-M2 mutation after amino acid double-site mutant are carried out containing OvIFN- γ-O Body) gene order carrier pVL-OvIFN- γ-O-M1-M2；

(3) mutant after amino acid multisite mutation is carried out containing OvIFN- γ-O, and (OvIFN- γ-O-M1-M2-M3 are prominent Variant) gene order carrier pVL-OvIFN- γ-O-M1-M2-M3.

The recombinant baculovirus that is obtained of the present invention includes：Recombinant bombyx mori nuclear polyhedrosis virus rBmBacmid (OvIFN- γ)、rBmBacmid(OvIFN-γ-O、OvIFN-γ-O-M1、OvIFN-γ-O-M1-M2、OvIFN-γ-O-M1-M2-M3)。

In one embodiment of the invention, the interferon of the interferon or sheep that disclose the sheep is provided Mutant is preparing the purposes in preventing or treating the drug or reagent of sheep virosis.

Wherein, the sheep virosis includes：Capripox virus infection, sheep infective pustule virus infection or blister mouth Scorching virus infection any one or more of associated diseases or Bovine Respiratory Syncytial virosis.

In one embodiment of the invention, a kind of interferon for the interferon or sheep preparing the sheep is provided The method of mutant, includes the following steps：(1) respectively by the interferon of the sheep or the interferon mutant of the sheep Encoding gene be cloned into baculovirus transfer vector, structure obtain recombinant transfer vector；(2) by recombinant transfer vector and bar Shape viral DNA cotransfection insect cell obtains recombinant baculovirus；(3) by recombinate shape virus infection insect cell or insect Host cultivates infected insect cell or insect host and expresses corresponding albumen, purifying to get.

Wherein, the baculovirus transfer vector be selected from AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac、Bacmid、BlucBacII(pETL)、p2Bac、p2Blue、p89B310、pAc360、pAc373、pAcAB3、 pAcAB 4、PAcAS3、pAcC129、pAcC4、DZI、pAcGP67、pAcIEl、pAcJPl、pAcMLF2、pAcMLF 7、 pAcMLF 8、pAcMPl、pAcMP2、pAcRP23、pAcRP 25、pAcRW4、pAcsMAG、pAcUWl、pAcUW21、 pAcUW2A、pAcUW2B、pAcUW3、pAcUW31、pAcUW41、pAcUW42、pAcUW43、pAcUW51、pAcVC2、pAcVC 3、pAcYMl、pAcJcC5、pBacl、pBac2、pBlueBacIII、pBlueBacHis、pEV55、mXIV、pIEINeo、 pJVETL、pJVNhel、pJVP10、pJVrsMAG、pMBac、pP10、pPAKl、pPBac、pSHONEX 1.1、pSYNXIV VI +、pSYNVI+wp、pSYNXIV VI-、pVL1391、pVL 1392、pVL 1393、pVL941、pVL 945、pVL 985、 PVTBac, pBM030 or pUAC-5；

The baculoviral be selected from silkworm baculovirus parent plant BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV；

The insect host is selected from silkworm (Bombyx mori), wild silkworm (Bombyx mandarina), castor silkworm (Philosamia cynthia ricim), wild silkworm (Dictyoploca japanica), Philosamia cynthia (Philosamia cynthia Pryeri), tussah (Antheraea pernyi), yamama (Antheraea yamamai), wild giant silkworm (Antheraea Polyphymus), autographa california (Atographa califorica), tea geometrid (Ectropis obliqua), cabbage army worm (Mamestra brassicae), prodenia litura (Spodoptera littoralis), autumn armyworm (Spodoptera Frugiperda), cabbage looper (Trichoplusia ni), armyworm (Thaumetopoea wilkinsoni), bollworm (Heliothis armigera), U.S. bollworm (Heliothis zea), oriental tobacco budworm (Heliothis assulta), tobacco Noctuid (Heliothis virescens), oriental armyworm (Pseudaletia separata) or gypsymoth (Lymantria dispar)；

Preferably, the baculovirus transfer vector is pVL1393；The baculoviral is silkworm baculovirus parent plant BmBacmid；The insect host is silkworm (Bombyx mori).

It is described to infect the insect larvae or pupa for referring to recombinant baculovirus by eating or being infected through epidermis 1-5 ages Body；Preferably, it by recombinant Bombyx mori baculovirus infected silkworm cell or the silkworm larva or pupa in percutaneous puncture-inoculation 1-5 ages, is infecting Body fluid or the tissue homogenate of silkworm larva or pupa containing various sheep gamma interferon genes are collected after 3-6 days；Wherein, the pupa is most Excellent is 1-2 days early stage tender pupas.

Below in conjunction with the embodiment in the present invention, the technical solution in the present invention is clearly and completely described.It is aobvious So, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the reality in the present invention Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to In the scope of protection of the invention.

1, test material and reagent

Transfer vector pVL1393, E.coli bacterial strain TOP10, BmN cell, Vero cells, VSV-GFP viruses, purchased from China Academy of Agricultural Sciences's biotechnology research institute；It tests cultivated silkworm breed variety JY1 and is purchased from sericulture research institute of Jiangsu University of Science and Technology, parental virus BmBacmid DNA are referring to the document (patent No.：ZL 201110142492.4, authorization date：2013.01.23 disclosed in) Method is built.Restriction enzyme, T₄DNA ligase is purchased from Promega companies, PCR reactions LA Taq DNA polymerizations used Enzyme and other related reagents are purchased from TakaRa companies, and liposome is purchased from Invitrogen companies, DMEM cell culture mediums, tire ox Serum is GIBCO Products.In relation to the configuration method of solution and culture medium with reference to related tool book (Josephetal., molecule The cloning experimentation guide third edition, 2002；Ao Sibai, et al., fine works Molecular Biology, 1998；David L.Spector, Cell experiment guide, 2001)；Unless otherwise stated, otherwise percentage and number are calculated by weight.

2, preparation method

The fusion DNA vaccine method of rite-directed mutagenesis is used in preparation method, with reference to a kind of graceful et al. (the new side of vector construction of Kuang bird with red feathers Method：Recombination fusion DNA vaccine method, genomics and applied biology, 2012, volume 31, the 6th phase, the 634-639 pages) it is described Method carry out.

The potency that interferon is calculated in preparation method, using Vero/VSV*GFP systems, using Reed-Muench methods, Concrete operations with reference to Liu Xingjian, wait (expression and bioactivity detection of the cat ω-like interferon in silkworm, biotechnology into Exhibition, 2015,5 (6)：441-445) and (the A manual of methods for baculovirus such as Summers MD vectors and insect cell culture procedures[R].Texas Agricultural Experiment Station, 1987) method described in carries out, wherein judging the standard of cytopathy referring to Fig.1, wherein A, "-"：It is acellular Lesion；B, " ± "：Several cytopathies；C, "+"：20%~30% cytopathy；D, " ++ "：50%~60% cytopathy.

Standard of comparison of the best evolutionary approach as next case study on implementation evolutionary approach in each case study on implementation.

Table in silkworm biological reactor after 1 sheep interferon gamma optimization gene (OvIFN- γ) of embodiment optimizes Up to detection

1, experimental method

The structure of 1.1 sheep interferon gamma optimization genes

The present invention carries out sequence alignment and signal peptide point by the interferon amino acid sequence of all sheep on analysis NCBI Analysis, it is final to determine that the amino acid sequence with accession number for NP_001009803.1 is main reference sequences, existed with SignalP4.1 Line carries out signal peptide prediction to sheep IFN-γ amino acid sequence or correlated series, it is found that only there are one peptide chain cleavage sites, so Without jump signal peptide.

The present invention utilizes OptimumGene^TMTechnology optimizes above-mentioned sheep gamma interferon genes, according to bioreactor The codon preference of silkworm is transformed gene order, to influencing genetic transcription efficiency, translation efficiency and protein folding G/C content, CpG dinucleotides content, codon preference, the secondary structure of mRNA, the free stabilizabilities of mRNA, RNA are unstable Property a variety of relevant parameters such as motif, repetitive sequence optimize, be conducive to improve institute's optimization gene and turn effect in silkworm Rate is recorded and translation efficiency, and keeps the protein sequence finally translated into constant.

In order to improve the translation initiation efficiency in silkworm baculovirus eukaryotic expression system, add before gene Kozak sequence AAC, in order to improve translation termination efficiency, terminator codon is changed to TAA.In addition, also removing inside gene order The restriction enzyme sites such as BamHI, EcoRI, SmaI, add BamHI in upstream region of gene, added in downstream of gene EcoRI restriction enzyme sites, to be subsequently cloned into eukaryon transfer vector pVL1393.

Sequence after designed interferon gamma gene optimizes is artificial synthesized by biotechnology company, is named as OvIFN- γ-O, for nucleotide sequence as shown in SEQ ID NO.4, the genetic fragment of synthesis is inserted into pUC57 carriers, forms plasmid PUC57-OvIFN is named as pUC57-OvIFN- γ-O.

1.2 structure recombinant baculovirus transfer vectors

Double digestion processing, the recycling of glass milk method are carried out to the plasmid pUC57-OvIFN- γ-O of synthesis with BamHI and EcoRI Target fragment, T₄DNA ligase connects target fragment and carries out the baculovirus transfer vector after double digestion processing and inactivation PVL1393,16 DEG C, connection is overnight.Connection product is converted into competent escherichia coli cell TOP10, choosing colony culture, upgrading Grain identifies positive colony with BamHI and EcoRI double digestions, will identify that correct recombinant plasmid send Beijing to hold up section's biotechnology and has Limit company is sequenced, and correct plasmid is sequenced and is named as pVL-OvIFN- γ-O (as shown in Figure 2, wherein M：DNA molecular quality mark It is accurate；1：Recombinant plasmid pVL-OvIFN- γ double digestion products；It is negative control).

Acquisition, purifying and the amplification of 1.3 recombinant Bombyx mori baculovirus

Recovery, passage and the screening of recombinant virus of BmN cells are carried out according to the method for existing document report.Work as BmN When cell culture is to cell monolayer up to 80% or so, old culture medium is outwelled, is washed three times, is added with serum-free TC-100 culture mediums 1.5mL is without FBS culture mediums.1 μ g silkworm baculovirus parent plant BmBacmid DNA, 2 μ g weights are sequentially added into a sterile tube Group transferring plasmid pVL-OvIFN- γ-O and 5 μ L liposomes supply volume to 60 μ L with aseptic double-distilled water, and gently mixing, stands After 15min, it is added dropwise in culture bottle and carries out cotransfection.1.5mL serum free mediums and 300 μ L are added after 27 DEG C of culture 4h FBS.27 DEG C of constant temperature incubations 4~5 days collect cell culture fluid until cell detachment floats, and obtain the recombination disease containing target gene Malicious rBmBacmid (OvIFN- γ-O).

The purifying of recombinant Bombyx mori baculovirus and amplification method are as follows：It is small in 35mm to be inoculated with appropriate cell (about 70~80%) In plate, after cell is adherent, culture medium is sucked, the cell culture fluid of collection is subjected to various concentration dilution, takes 1mL to be added to adherent In cell, it is evenly distributed.After 27 DEG C of infection 1h, infection liquid is sucked, 2% low fusion agarose gel is melted in 60 DEG C of water-baths Change, is cooled to 40 DEG C and is uniformly mixed with 40 DEG C of 2 × TC-100 culture mediums preheated (containing 20%FBS), each plate adds 4mL glue, waits for It is sealed with Parafilm after solidification, 27 DEG C are inverted 3~5d of culture, micro- sem observation.Being picked out without containing polyhedrosis plaque Come, repeat above step, pure recombinant Bombyx mori baculovirus rBmBacmid (OvIFN- γ-are obtained by the purifying of 2~3 wheels O)。

Recombinant Bombyx mori baculovirus rBmBacmid (OvIFN- γ), rBmBacmid (OvIFN- γ-O) are infected normal raw Long BmN cells, culture collect supernatant, contain a large amount of recombinant virus rBmBacmid (OvIFN- in supernatant after 3 days γ)、rBmBacmid(OvIFN-γ-O)。

1.4 sheep interferon gammas are expressed in silkworm body

Recombinant virus culture solution is pressed 10⁵PFU/ dosage injects silkworm from 5 ages, in 27 DEG C, 70%~80% humidity Under the conditions of cultivate, silkworm larva grows late period, and OvIFN- γ obtain high efficient expression under the action of polyhedrosis gene promoter.It connects Kind infection 3.5d~4d or so, it is observed that the symptoms such as the swelling of silkworm larva body segment, abnormal behavior, loss of appetite, work as observation It is obviously reduced to larva volume, when stopping feed, collects hemolymph, -20 DEG C save backup.

1.5 sheep interferon gamma albumen antiviral activities detect

Method is inhibited to detect the sheep γ types expressed in silkworm hemolymph in Vero/VSV*GFP systems using few cells lesion The antiviral activity of interferon.By Vero cells in good condition with 3.0 × 10⁵The density of a/mL is inoculated in 96 well culture plates In.The DMEM culture solutions of silkworm hemolymph fetal calf serum containing 70mL/L of ultrasonication and filtration sterilization are configured to different dilute The sample diluted is inoculated in by 100 holes μ L/ in the culture hole for being paved with VERO cells by the solution for degree of releasing, each to dilute Degree and control silkworm blood at least set 12 multiple holes, while setting the cell controls group for being not added with silkworm hemolymph and VSV*GFP and addition VSV* The virus control group of GFP, in 37 DEG C, 5%CO₂Under the conditions of culture 18~for 24 hours.100TCID will be diluted to₅₀VSV*GFP virus, It is added and has been inhaled in the culture hole for abandoning supernatant by 100 holes μ L/, be placed in 37 DEG C, 5%CO₂Under the conditions of cultivate.It is aobvious being inverted fluorescence Micro- microscopic observation, when fluorescence occur in a large amount of cells in each hole of virus control group, and the cell in cell controls group is still grown completely Well, when unstressed configuration occurs, then show that contradistinction system is completely qualified, you can make complete observation.

2, experimental result

The identification of 2.1 recombinant transfer vectors

Recombinant transfer vector pVL-OvIFN- γ-O are through BamHI and EcoRI double digestions, in 1% agarose gel electrophoresis point 2 segments are separated out, small fragment is consistent, large fragment is located between 500-750bp with target gene fragment 510bp sizes Above 8000bp, it is consistent with pVL1393 segment 9607bp sizes.Digestion is identified that correct plasmid send Beijing to hold up the new industry biology of section Technology Co., Ltd. carries out nucleotide sequencing, shows that sequence is consistent with the sequence originally designed with MegaAlign comparison results, table Bright sheep gama-type interferon mutant gene has been successfully plugged into pVL1393 transfer vectors between BamHI and EcoRI.

The acquisition of 2.2 sheep interferon recombinant viruses and the detection of recombinant products

The sheep γ types for inhibiting method to detect silkworm larva expression in Vero/VSV*GFP systems using few cells lesion are dry Disturb plain antiviral activity.As shown in figure 3, being observed under inverted fluorescence microscope, the cell growth state in cell controls group Well, unstressed configuration occurs；Lesion occurs for the cell in virus infection control group, and fluorescence, addition recombination sheep occur in most cells The cell of interferon albumen has the ability (A in Fig. 3 to viral infection resisting：Interferon inhibits the fluorescence that VSV viruses are shown； B：The fluorescence that VSV virus-infected controls groups are shown；C：The fluorescence that part cell infection VSV viruses are shown).It is interfered according to sheep γ types Protective effect of the element to Vero cells, observes the lesion degree of cell, green cells appearance to be had, this hole cell is just remembered For "+", the potency of interferon is calculated according to Reed-Muench methods.Testing result is listed in table 1, Assay of Antiviral Activity result Show that the OvIFN- γ-O expressed in silkworm larva body have more significant antiviral activity, potency to reach compared to OvIFN- γ 2.51×10⁶U/mL, and the potency of OvIFN- γ only has 1.38 × 10⁵U/mL produces a desired effect, and illustrates to interfere sheep γ The method that element optimizes is come to improve OvIFN- γ antiviral activities be feasible and effective.

The testing result of antiviral activity after the optimization of 1 sheep interferon mutant of table

In silkworm biology after 2 sheep gama-type interferon mutant of embodiment (OvIFN- γ-O) progress amino acid unit point mutation Expression in reactor and detection

1, experimental method

The structure of 1.1 sheep interferon optimization genes

The present invention designs multipair primer pair sequence and carries out rite-directed mutagenesis using the gene order of OvIFN- γ-O as template, fixed Point mutation is carried out using the method for fusion DNA vaccine, and the method for fusion DNA vaccine is shown in aforementioned " 2, preparation method ".

Mutational site be respectively E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V, K103R、E110G、K116E、Q120K、N134S、K146R、N157T、R160Q；The sheep interferon mutant of gained is named as OvIFN-γ-O-M1(E32T、E36D、N42T、P43S、K47N、S53L、L79F、N82T、L83F、V88A、I95V、K103R、 E110G, K116E, Q120K, N134S, K146R, N157T, R160Q) mutant.

Primer needed for OvIFN- γ-O nucleotide sequences progress amino acid unit point, double site and multisite mutation：

(1), both sides upstream and downstream primer：

F:

TCATACCGTCCCACCATCGGGCGCGGATCAACATGAAATACACATCATC

R:GATCTGCAGCGGCCGCTCCGGAATTCCATGGAGGCTCTTCTTC

(2), intermediate upstream and downstream primer

1.

F1:TTCTTCAAGGAAATCACGAACTTGAAGGAATACTTC

R1:GAAGTATTCCTTCAAGTTCGTGATTTCCTTGAAGAA

2.

F2:ATCGAAAACTTGAAGGACTACTTCAACGCTAGC

R2:GCTAGCGTTGAAGTAGTCCAACAAGTTTTCGAT

3.

F3:TACTTCAACGCTAGCACCCCTGACGTGGCCAAGGG

R3:CCCTTGGCCACGTCAGGGGAGCTAGCGTTGAAGTA

4.

F4：TTCAACGCTAGCAATTCAGACGTGGCCAAGGGTGG

R4：CCACCCTTGGCCACGTCTGAATTGCTAGCGTTGAA

5.

F5：AATCCTGACGTGGCCAATGGTGGACCATTGTTC

R5：GAACAATGGTCCACCATTGGCCACGTCAGGATT

6.

F6：GGTGGACCATTGTTCTTAGAAATACTCAAAAAC

R6：GTTTTTGAGTATTTCTAAGAACAATGGTCCACC

7.

F7：TCCTTCTACTTCAAATTCTTCGAAAACCTG

R7：CAGGTTTTCGAAGAATTTGAAGTAGAAGGA

8.

F8:TTCAAACTCTTCGAAATCCTGAAGGACAATCAAG

R8：CTTGATTGTCCTTCAGGATTTCGAAGAGTTTGAA

9.

F9：AAACTCTTCGAAAACTTCAAGGACAATCAAGTTATTC

R9：GAATAACTTGATTGTCCTTGAAGTTTTCGAAGAGTTT

10.

F10:CTGAAGGACAATCAAGCCATTCAGAGATCAATGG

R10:CCATTGATCTCTGAATGGCTTGATTGTCCTTCAG

11.

F11：CAGAGATCAATGGACGTGATCAAGCAAGATATG

R11:CATATCTTGCTTGATCACGTCCATTGATCTCTG

12.

F12：CAAGATATGTTCCAGAGGTTCCTCAATGGTAGCTC

R12：GAGCTACCATTGAGGAACCTCTGGAACATATCTTG

13.

F13：CTCAATGGTAGCTCCGGGAAACTGGAAGACTTC

R13：GAAGTCTTCCAGTTTCCCGGAGCTACCATTGAG

14.

F14：AAACTGGAAGACTTCGAAAGATTGATTCAAATACCG

R14：CGGTATTTGAATCAATCTTTCGAAGTCTTCCAGTTT

15.

F15：TTCAAGAGATTGATTAAAATACCGGTCGACG

R15：CGTCGACCGGTATTTTAATCAATCTCTTGAA

16.

F16：CAGAGAAAAGCTATCAGTGAACTCATTAAGGTGATG

R16：CATCACCTTAATGAGAGTTCACTGATAGCTTTTCTCTG

17.

F17：AATGATCTCTCACCCAGATCTAACCTGAGAAAAAG

R17：CTTTTTCTCAGGTTAGATCTGGGTGAGAGATCATT

18.

F18：AGAAAGAGATCACAGACTCTGTTCAGAGGAAG

R18：CTTCCTCTGAACAGAGTCTGTGATCTCTTTCT

19.

F19：TCACAGAACCTGTTCCAAGGAAGAAGAGCCTCC

R19：GGAGGCTCTTCTTCCTTGGAACAGGTTCTGTGA

1.2 structure recombinant baculovirus transfer vectors

Glass milk method is recycled with recombinase (pEASY-Uni seamless Cloning and Assembly Kit) Above-mentioned purpose segment and the inactivation baculovirus transfer vector pVL1393 homologous recombinations for passing through BamHI and EcoRI double digestions.Weight Group product converts competent escherichia coli cell TOP10, choosing colony culture, and upgrading grain is reflected with BamHI and EcoRI double digestions Determine positive colony, will identify that correct recombinant plasmid send Beijing Qing Ke Bioisystech Co., Ltd to be sequenced, correct plasmid is sequenced Be named as pVL-OvIFN- γ-O-M1 (E32T, E36D, N42T, P43S, K47N, S53L, L79F, N82T, L83F, V88A, I95V、K103R、E110G、K116E、Q120K、N134S、K146R、N157T、R160Q)。

Acquisition, purifying and the amplification of 1.3 recombinant Bombyx mori baculovirus

Recovery, passage and the screening of recombinant virus of BmN cells are carried out according to the method for existing document report.Work as BmN When cell culture is to cell monolayer up to 80% or so, old culture medium is outwelled, is washed three times, is added with serum-free TC-100 culture mediums 1.5mL is without FBS culture mediums.1 μ g silkworm baculovirus parent plant BmBacmid DNA, 2 μ g weights are sequentially added into a sterile tube Group transferring plasmid pVL-OvIFN- γ-O-M1 and 5 μ L liposomes, supply volume to 60 μ L, gently mixing, quiet with aseptic double-distilled water After setting 15min, it is added dropwise in culture bottle and carries out cotransfection.1.5mL serum free mediums and 300 are added after 27 DEG C of culture 4h μL FBS.27 DEG C of constant temperature incubations 4~5 days collect cell culture fluid until cell detachment floats, and obtain the weight containing target gene Group virus rBmBacmid (OvIFN- γ-O-M1).

The purifying of recombinant Bombyx mori baculovirus and amplification method are as follows：It is small in 35mm to be inoculated with appropriate cell (about 70~80%) In plate, after cell is adherent, culture medium is sucked, the cell culture fluid of collection is subjected to various concentration dilution, takes 1mL to be added to adherent In cell, it is evenly distributed.After 27 DEG C of infection 1h, infection liquid is sucked, 2% low fusion agarose gel is melted in 60 DEG C of water-baths Change, is cooled to 40 DEG C and is uniformly mixed with 40 DEG C of 2 × TC-100 culture mediums preheated (containing 20%FBS), each plate adds 4mL glue, waits for It is sealed with Parafilm after solidification, 27 DEG C are inverted 3~5d of culture, micro- sem observation.Being picked out without containing polyhedrosis plaque Come, repeat above step, pure recombinant Bombyx mori baculovirus rBmBacmid (pVL-OvIFN- are obtained by the purifying of 2~3 wheels γ-O-M1)。

Recombinant Bombyx mori baculovirus rBmBacmid (OvIFN- γ-O-M1) is infected to the BmN cells of normal growth, culture 3 Supernatant is collected after it, contains a large amount of recombinant virus rBmBacmid (OvIFN- γ-O-M1) in supernatant.

1.4 sheep gama-type interferon mutants are expressed in silkworm body

Recombinant virus culture solution is pressed 10⁵PFU/ dosage injects silkworm from 5 ages, in 27 DEG C, 70%~80% humidity Under the conditions of cultivate, silkworm larva grows late period, and OvIFN- γ obtain high efficient expression under the action of polyhedrosis gene promoter.It connects Kind infection 3.5d~4d or so, it is observed that the symptoms such as the swelling of silkworm larva body segment, abnormal behavior, loss of appetite, work as observation It is obviously reduced to larva volume, when stopping feed, collects hemolymph, -20 DEG C save backup.

1.5 sheep gama-type interferon mutant albumen antiviral activities detect

Method is inhibited to detect the sheep γ types expressed in silkworm hemolymph in Vero/VSV*GFP systems using few cells lesion The antiviral activity of interferon mutant.By Vero cells in good condition with 3.0 × 10⁵The density of a/mL is inoculated in 96 holes In culture plate.The DMEM culture solutions of silkworm hemolymph fetal calf serum containing 70mL/L of ultrasonication and filtration sterilization are configured to The sample diluted is inoculated in by 100 holes μ L/ in the culture hole for being paved with VERO cells, often by the solution of different dilutions A dilution and control silkworm blood at least set 12 multiple holes, while setting the cell controls group for being not added with silkworm hemolymph and VSV*GFP and adding The virus control group for adding VSV*GFP, in 37 DEG C, 5%CO₂Under the conditions of culture 18~for 24 hours.100TCID will be diluted to₅₀VSV* GFP viruses, are added by 100 holes μ L/ and have been inhaled in the culture hole for abandoning supernatant, be placed in 37 DEG C, 5%CO₂Under the conditions of cultivate.It is falling Set fluorescence microscopy under the microscope, when fluorescence occur in a large amount of cells in each hole of virus control group, and the cell in cell controls group is still Complete well-grown when unstressed configuration occurs, then shows that contradistinction system is completely qualified, you can make complete observation.

2, experimental result

The identification of 2.1 recombinant transfer vectors

Recombinant transfer vector pVL-OvIFN- γ-O-M1 are through BamHI and EcoRI double digestions, in 1% agarose gel electrophoresis 2 segments are isolated, small fragment is consistent, large fragment is located between 500-750bp with target gene fragment 510bp sizes Above 8000bp, it is consistent with pVL1393 segment 9607bp sizes.Digestion is identified that correct plasmid send Beijing to hold up the new industry biology of section Technology Co., Ltd. carries out nucleotide sequencing, shows that sequence is consistent with the sequence originally designed with MegaAlign comparison results, table Bright sheep gama-type interferon mutant gene has been successfully plugged into pVL1393 transfer vectors between BamHI and EcoRI.

The acquisition of 2.2 sheep interferon recombinant viruses and the detection of recombinant products

The sheep γ types for inhibiting method to detect silkworm larva expression in Vero/VSV*GFP systems using few cells lesion are dry Disturb plain antiviral activity.It is observed under inverted fluorescence microscope, the cell growth state in cell controls group is good, unstressed configuration Occur；Lesion occurs for the cell in virus infection control group, and fluorescence, addition recombination sheep interferon albumen occur in most cells Cell have to viral infection resisting ability.Protective effect according to sheep interferon gamma to Vero cells, observes cell Lesion degree, green cells appearance to be had, this hole cell are just denoted as "+", calculate and interfere according to Reed-Muench methods Plain potency, testing result are listed in table 2, and it is 1.26 × 10 that all sheep interferon mutant, which measure potency,⁵U/mL~3.72 × 10⁶After this 5 site mutations of U/mL, wherein E32T, L79F, K103R, Q120K, N157T, the sheep interferon potency of expression is omited The potency measured is expressed higher than former sequence, and potency is constant after remaining site mutation or even reduces, and illustrates the mutation in this 5 sites It is effectively to be mutated, can achievees the purpose that improve OvIFN- γ antiviral activities.Wherein, OvIFN- γ-O-Q120K mutant has It is shown in SEQ ID NO.5 to have most strong antivirus action, amino acid sequence, and the nucleotides sequence of encoding gene is classified as SEQ ID Shown in NO.6.

Table 2 recombinates the testing result of sheep interferon single-site mutant antiviral activity

After 3 OvIFN- γ-O-M1 mutant of embodiment progress amino acid double-site mutant in silkworm biological reactor Expression and detection

1, experimental method

The structure of 1.1 sheep gama-type interferon mutant genes

In view of embodiment 2 as a result, determine that the mutation of moiety site is effectively to be mutated, it can reach and improve OvIFN- γ's Antiviral activity purpose.In view of putting in order for amino acid is the primary structure of protein, and decide the advanced of protein Structure, and the amino acid unit point mutation carried out in embodiment 1 have the position in fractional mutations site may be mutually related, therefore It attempts to carry out amino acid double-site mutant.Single mutation site E32T, L79F that the present invention improves antiviral activity, K103R, Q120K, N157T combination of two carry out double-site mutant, and double-site mutant is the single-site mutant sequence obtained in embodiment 2 Basis on, pass through fusion using corresponding primer (detailed in Example 2) using its (OvIFN- γ-O-M1) as template The method of PCR carries out deputy rite-directed mutagenesis, to obtain the target fragment of double-site mutant, before the method for fusion DNA vaccine is shown in It states " 2, experimental method ".

Double mutational sites be E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T, Q120K-N157T totally 10 kinds of combinations, are obtained Sheep interferon mutant is named as OvIFN- γ-O-M1-M2 (E32T-L79F, E32T-K103R, E32T-Q120K, E32T- N157T, L79F-K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T, Q120K-N157T) it is prominent Variant.

1.2 structure recombinant baculovirus transfer vectors

Glass milk method is recycled with recombinase (pEASY-Uni seamless Cloning and Assembly Kit) Above-mentioned purpose segment and the inactivation baculovirus transfer vector pVL1393 homologous recombinations for passing through BamHI and EcoRI double digestions.Weight Group product converts competent escherichia coli cell TOP10, choosing colony culture, and upgrading grain is reflected with BamHI and EcoRI double digestions Determine positive colony, will identify that correct recombinant plasmid send Beijing Qing Ke Bioisystech Co., Ltd to be sequenced, correct plasmid is sequenced It is named as pVL-OvIFN- γ-O-M1-M2 (E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F- K103R、L79F-Q120K、L79F-N157T、K103R-Q120K、K103R-N157T、Q120K-N157T)。

Acquisition, purifying and the amplification of 1.3 recombinant Bombyx mori baculovirus

Recovery, passage and the screening of recombinant virus of BmN cells are carried out according to the method for existing document report.Work as BmN When cell culture is to cell monolayer up to 80% or so, old culture medium is outwelled, is washed three times, is added with serum-free TC-100 culture mediums 1.5mL is without FBS culture mediums.1 μ g silkworm baculovirus parent plant BmBacmid DNA, 2 μ g weights are sequentially added into a sterile tube Group transferring plasmid pVL-OvIFN- γ-O-M1-M2 and 5 μ L liposomes, supply volume to 60 μ L with aseptic double-distilled water, gently mix It is even, after standing 15min, it is added dropwise in culture bottle and carries out cotransfection.1.5mL serum free mediums are added after 27 DEG C of culture 4h With 300 μ L FBS.27 DEG C of constant temperature incubations 4~5 days collect cell culture fluid until cell detachment floats, and acquisition contains target gene Recombinant virus rBmBacmid (OvIFN- γ-O-M1-M2).

The purifying of recombinant Bombyx mori baculovirus and amplification method are as follows：It is small in 35mm to be inoculated with appropriate cell (about 70~80%) In plate, after cell is adherent, culture medium is sucked, the cell culture fluid of collection is subjected to various concentration dilution, takes 1mL to be added to adherent In cell, it is evenly distributed.After 27 DEG C of infection 1h, infection liquid is sucked, 2% low fusion agarose gel is melted in 60 DEG C of water-baths Change, is cooled to 40 DEG C and is uniformly mixed with 40 DEG C of 2 × TC-100 culture mediums preheated (containing 20%FBS), each plate adds 4mL glue, waits for It is sealed with Parafilm after solidification, 27 DEG C are inverted 3~5d of culture, micro- sem observation.Being picked out without containing polyhedrosis plaque Come, repeat above step, pure recombinant Bombyx mori baculovirus rBmBacmid (OvIFN- γ-O- are obtained by the purifying of 2~3 wheels M1-M2)。

Recombinant Bombyx mori baculovirus rBmBacmid (OvIFN- γ-O-M1-M2) is infected to the BmN cells of normal growth, training Supernatant is collected after supporting 3 days, contains a large amount of recombinant virus rBmBacmid (OvIFN- γ-O-M1-M2) in supernatant.

1.4 sheep gama-type interferon mutants are expressed in silkworm body

Recombinant virus culture solution is pressed 10⁵PFU/ dosage injects silkworm from 5 ages, in 27 DEG C, 70%~80% humidity Under the conditions of cultivate, silkworm larva grows late period, and OvIFN- γ obtain high efficient expression under the action of polyhedrosis gene promoter.It connects Kind infection 3.5d~4d or so, it is observed that the symptoms such as the swelling of silkworm larva body segment, abnormal behavior, loss of appetite, work as observation It is obviously reduced to larva volume, when stopping feed, collects hemolymph, -20 DEG C save backup.

1.5 sheep gama-type interferon mutant albumen antiviral activities detect

Method is inhibited to detect the sheep γ types expressed in silkworm hemolymph in Vero/VSV*GFP systems using few cells lesion The antiviral activity of interferon mutant.By Vero cells in good condition with 3.0 × 10⁵The density of a/mL is inoculated in 96 holes In culture plate.The DMEM culture solutions of silkworm hemolymph fetal calf serum containing 70mL/L of ultrasonication and filtration sterilization are configured to The sample diluted is inoculated in by 100 holes μ L/ in the culture hole for being paved with VERO cells, often by the solution of different dilutions A dilution and control silkworm blood at least set 12 multiple holes, while setting the cell controls group for being not added with silkworm hemolymph and VSV*GFP and adding The virus control group for adding VSV*GFP, in 37 DEG C, 5%CO₂Under the conditions of culture 18~for 24 hours.100TCID will be diluted to₅₀VSV* GFP viruses, are added by 100 holes μ L/ and have been inhaled in the culture hole for abandoning supernatant, be placed in 37 DEG C, 5%CO₂Under the conditions of cultivate.It is falling Set fluorescence microscopy under the microscope, when fluorescence occur in a large amount of cells in each hole of virus control group, and the cell in cell controls group is still Complete well-grown when unstressed configuration occurs, then shows that contradistinction system is completely qualified, you can make complete observation.

2, experimental result

The identification of 2.1 recombinant transfer vectors

Recombinant transfer vector pVL-OvIFN- γ-O-M1-M2 are through BamHI and EcoRI double digestions, in 1% Ago-Gel 2 segments are separated by electrophoresis out, small fragment is consistent between 500-750bp with target gene fragment 510bp sizes, large fragment Above 8000bp, it is consistent with pVL1393 segment 9607bp sizes.Digestion is identified that correct plasmid send Beijing to hold up the new industry of section Bioisystech Co., Ltd carries out nucleotide sequencing, the sequence one for showing sequence with MegaAlign comparison results and originally designing It causes, shows that sheep gama-type interferon mutant gene has been successfully plugged into pVL1393 transfer vectors between BamHI and EcoRI.

The acquisition of 2.2 sheep interferon recombinant viruses and the detection of recombinant products

The sheep γ types for inhibiting method to detect silkworm larva expression in Vero/VSV*GFP systems using few cells lesion are dry Disturb plain antiviral activity.It is observed under inverted fluorescence microscope, the cell growth state in cell controls group is good, unstressed configuration Occur；Lesion occurs for the cell in virus infection control group, and fluorescence, addition recombination sheep interferon albumen occur in most cells Cell have to viral infection resisting ability.Protective effect according to sheep interferon gamma to Vero cells, observes cell Lesion degree, green cells appearance to be had, this hole cell are just denoted as "+", calculate and interfere according to Reed-Muench methods Plain potency, testing result are listed in table 3, and all sheep interferon mutant measure potency 3.98 × 10⁵U/mL~4.68 × 10⁶After the double mutation of U/mL, wherein L79F-Q120K, K103R-Q120K, E32T-N157T group, the sheep interferon potency of expression Slightly above former sequence, single mutation sequence express the potency measured, and potency is constant after remaining several groups of site mutation or even reduces, and says The mutation in bright this 3 combinations site is effectively to be mutated, and can reach the mesh for improving OvIFN- γ-O-M1 mutant antiviral activities 's.Wherein, OvIFN- γ-O-L79F-Q120K mutant has most strong antivirus action, amino acid sequence SEQ Shown in IDNO.7, the nucleotides sequence of encoding gene is classified as shown in SEQ ID NO.8

Table 3 recombinates the testing result of sheep interferon double-site mutant antiviral activity

In silkworm biological reactor after 4 OvIFN- γ-O-M1-M2 mutant of embodiment progress amino acid multisite mutation In expression and detection

1, experimental method

The structure of 1.1 sheep gama-type interferon mutant genes

In view of embodiment 2 as a result, in view of putting in order for amino acid be the primary structure of protein, and decide egg The higher structure of white matter, thus it is speculated that may be since the amino acid unit point mutation of progress has the position in fractional mutations site mutually to lean on It is close associated with each other, therefore attempt to carry out amino acid multisite mutation.The present invention is by double mutational sites with high-titer of acquisition Combination, determines third mutational site, multisite mutation be on the basis for the double-site mutant sequence that embodiment 3 obtains, Pass through the method for fusion DNA vaccine using corresponding primer (detailed in Example 2) using its (OvIFN- γ-O-M1-M2) as template The rite-directed mutagenesis for carrying out third position, to obtain the target fragment of multisite mutation, the method for fusion DNA vaccine see it is aforementioned " 2, experiment Method ".

Obtain following 6 kinds of combinations：E32T-L79F-K103R、F32T-L79F-Q120K、E32T-L79F-N157T、 L79F-K103R-Q120K、L79F-K103R-N157T、K103R-Q120K-N157T.The sheep interferon mutant obtained Be named as OvIFN- γ-O-M1-M2-M3 (E32T-L79F-K103R, F32T-L79F-Q120K, E32T-L79F-N157T, L79F-K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T) mutant.

1.2 structure recombinant baculovirus transfer vectors

Glass milk method is recycled with recombinase (pEASY-Uni seamless Cloning and Assembly Kit) Above-mentioned purpose segment and the inactivation baculovirus transfer vector pVL1393 homologous recombinations for passing through BamHI and EcoRI double digestions.Weight Group product converts competent escherichia coli cell TOP10, choosing colony culture, and upgrading grain is reflected with BamHI and EcoRI double digestions Determine positive colony, will identify that correct recombinant plasmid send Beijing Qing Ke Bioisystech Co., Ltd to be sequenced, correct plasmid is sequenced It is named as pVL-OvIFN- γ-O-M1-M2-M3 (E32T-L79F-K103R, F32T-L79F-Q120K, E32T-L79F- N157T、L79F-K103R-Q120K、L79F-K103R-N157T、K103R-Q120K-N157T)。

Acquisition, purifying and the amplification of 1.3 recombinant Bombyx mori baculovirus

Recovery, passage and the screening of recombinant virus of BmN cells are carried out according to the method for existing document report.Work as BmN When cell culture is to cell monolayer up to 80% or so, old culture medium is outwelled, is washed three times, is added with serum-free TC-100 culture mediums 1.5mL is without FBS culture mediums.1 μ g silkworm baculovirus parent plant BmBacmid DNA, 2 μ g weights are sequentially added into a sterile tube Group transferring plasmid pVL-OvIFN- γ-O-M1-M2-M3 and 5 μ L liposomes, volume is supplied to 60 μ L, gently with aseptic double-distilled water Mixing is added dropwise in culture bottle after standing 15min and carries out cotransfection.1.5mL free serum cultures are added after 27 DEG C of culture 4h Base and 300 μ L FBS.27 DEG C of constant temperature incubations 4~5 days collect cell culture fluid until cell detachment floats, and obtain and contain purposeful base The recombinant virus rBm-Bacmid (OvIFN- γ-O-M1-M2-M3) of cause.

The purifying of recombinant Bombyx mori baculovirus and amplification method are as follows：It is small in 35mm to be inoculated with appropriate cell (about 70~80%) In plate, after cell is adherent, culture medium is sucked, the cell culture fluid of collection is subjected to various concentration dilution, takes 1mL to be added to adherent In cell, it is evenly distributed.After 27 DEG C of infection 1h, infection liquid is sucked, 2% low fusion agarose gel is melted in 60 DEG C of water-baths Change, is cooled to 40 DEG C and is uniformly mixed with 40 DEG C of 2 × TC-100 culture mediums preheated (containing 20%FBS), each plate adds 4mL glue, waits for It is sealed with Parafilm after solidification, 27 DEG C are inverted 3~5d of culture, micro- sem observation.Being picked out without containing polyhedrosis plaque Come, repeat above step, pure recombinant Bombyx mori baculovirus rBm-Bacmid (OvIFN- γ-are obtained by the purifying of 2~3 wheels O-M1-M2-M3)。

The BmN that recombinant Bombyx mori baculovirus rBm-Bacmid (OvIFN- γ-O-M1-M2-M3) is infected to normal growth is thin Born of the same parents, culture collect supernatant, contain a large amount of recombinant virus rBm-Bacmid (OvIFN- γ-O-M1-M2- in supernatant after 3 days M3)。

1.4 sheep gama-type interferon mutants are expressed in silkworm body

Recombinant virus culture solution is pressed 10⁵PFU/ dosage injects silkworm from 5 ages, in 27 DEG C, 70%~80% humidity Under the conditions of cultivate, silkworm larva grows late period, and OvIFN- γ obtain high efficient expression under the action of polyhedrosis gene promoter.It connects Kind infection 3.5d~4d or so, it is observed that the symptoms such as the swelling of silkworm larva body segment, abnormal behavior, loss of appetite, work as observation It is obviously reduced to larva volume, when stopping feed, collects hemolymph, -20 DEG C save backup.

1.5 sheep gama-type interferon mutant albumen antiviral activities detect

Method is inhibited to detect the sheep γ types expressed in silkworm hemolymph in Vero/VSV*GFP systems using few cells lesion The antiviral activity of interferon mutant.By Vero cells in good condition with 3.0 × 10⁵The density of a/mL is inoculated in 96 holes In culture plate.The DMEM culture solutions of silkworm hemolymph fetal calf serum containing 70mL/L of ultrasonication and filtration sterilization are configured to The sample diluted is inoculated in by 100 holes μ L/ in the culture hole for being paved with VERO cells, often by the solution of different dilutions A dilution and control silkworm blood at least set 12 multiple holes, while setting the cell controls group for being not added with silkworm hemolymph and VSV*GFP and adding The virus control group for adding VSV*GFP, in 37 DEG C, 5%CO₂Under the conditions of culture 18~for 24 hours.100TCID will be diluted to₅₀VSV* GFP viruses, are added by 100 holes μ L/ and have been inhaled in the culture hole for abandoning supernatant, be placed in 37 DEG C, 5%CO₂Under the conditions of cultivate.It is falling Set fluorescence microscopy under the microscope, when fluorescence occur in a large amount of cells in each hole of virus control group, and the cell in cell controls group is still Complete well-grown when unstressed configuration occurs, then shows that contradistinction system is completely qualified, you can make complete observation.

2, experimental result

The identification of 2.1 recombinant transfer vectors

Recombinant transfer vector pVL-OvIFN- γ-O-M1-M2-M3 are solidifying in 1% agarose through BamHI and EcoRI double digestions Gel electrophoresis isolates 2 segments, and small fragment is consistent between 500-750bp with target gene fragment 510bp sizes, large stretch of Section is located above 8000bp, is consistent with pVL1393 segment 9607bp sizes.It is new that digestion is identified that correct plasmid send Beijing to hold up section Industry Bioisystech Co., Ltd carries out nucleotide sequencing, the sequence for showing sequence with MegaAlign comparison results and originally designing Unanimously, show that sheep gama-type interferon mutant gene has been successfully plugged into pVL1393 transfer vectors between BamHI and EcoRI.

The acquisition of 2.2 sheep interferon recombinant viruses and the detection of recombinant products

The sheep γ types for inhibiting method to detect silkworm larva expression in Vero/VSV*GFP systems using few cells lesion are dry Disturb plain antiviral activity.It is observed under inverted fluorescence microscope, the cell growth state in cell controls group is good, unstressed configuration Occur；Lesion occurs for the cell in virus infection control group, and fluorescence, addition recombination sheep interferon albumen occur in most cells Cell have to viral infection resisting ability.Protective effect according to sheep interferon gamma to Vero cells, observes cell Lesion degree, green cells appearance to be had, this hole cell are just denoted as "+", calculate and interfere according to Reed-Muench methods Plain potency, testing result are listed in table 4, and all sheep interferon mutant measure potency 3.24 × 10⁵U/mL~6.31 × 10⁶U/mL, wherein after tri- site mutations of L79F-K103R-Q120K, the sheep interferon potency of expression is far above former sequence, list Mutant nucleotide sequence, double mutant nucleotide sequences express the potency measured, are 6.31 × 10⁶U/mL.And potency is not after remaining several groups of site mutation Becoming even reduces, and illustrates that the mutation in this combination site is effectively to be mutated, can reach and improve OvIFN- γ-O-M1-M2 mutant The purpose of antiviral activity.The amino acid sequence of OvIFN- γ-O-L79F-K103R-Q120K mutant is SEQ ID NO.9 institutes Show, the nucleotides sequence of encoding gene is classified as shown in SEQ ID NO.10.

Table 4 recombinates the testing result of sheep interferon multisite mutation antiviral activity

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Zhejiang Shan Cehe knight bio tech ltd

<120>A kind of interferon mutant of sheep and the preparation method and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 166

<212> PRT

<213> Capra hircus

<400> 1

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 2

<211> 498

<212> DNA

<213> Capra hircus

<400> 2

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattcaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 3

<211> 166

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 3

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Gln Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 4

<211> 498

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattcaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 5

<211> 166

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 5

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser

130 135 140

Pro Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg

145 150 155 160

Gly Arg Arg Ala Ser Met

165

<210> 6

<211> 498

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaactcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 7

<211> 165

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 7

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Leu Leu Gly

1 5 10 15

Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn

20 25 30

Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly Gly

35 40 45

Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp Lys

50 55 60

Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe Glu

65 70 75 80

Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile Lys

85 90 95

Gln Asp Met Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu

100 105 110

Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile Gln

115 120 125

Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro

130 135 140

Lys Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly

145 150 155 160

Arg Arg Ala Ser Met

165

<210> 8

<211> 498

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaattcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaagt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

<210> 9

<211> 155

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 9

Met Lys Tyr Thr Ser Ser Phe Leu Ala Leu Leu Leu Cys Val Leu Leu

1 5 10 15

Gly Phe Ser Gly Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu

20 25 30

Asn Leu Lys Glu Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Lys Gly

35 40 45

Gly Pro Leu Phe Ser Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp

50 55 60

Lys Lys Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Phe Phe

65 70 75 80

Glu Asn Leu Lys Asp Asn Gln Val Ile Gln Arg Ser Met Asp Ile Ile

85 90 95

Lys Gln Asp Met Phe Gln Arg Phe Leu Asn Gly Ser Ser Glu Lys Leu

100 105 110

Glu Asp Phe Lys Arg Leu Ile Lys Ile Pro Val Asp Asp Leu Gln Ile

115 120 125

Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Arg Lys Arg Ser

130 135 140

Gln Asn Leu Phe Arg Gly Arg Arg Ala Ser Met

145 150 155

<210> 10

<211> 498

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

atgaaataca catcatcttt cctggctctg ttgctctgcg ttctgttggg attctcgggc 60

agttacggcc aaggtccttt cttcaaggaa atcgaaaact tgaaggaata cttcaacgct 120

agcaatcctg acgtggccaa gggtggacca ttgttctcgg aaatactcaa aaactggaag 180

gaagaaagtg ataaaaagat catacaaagc cagatcgtgt ccttctactt caaattcttc 240

gaaaacctga aggacaatca agttattcag agatcaatgg acataatcaa gcaagatatg 300

ttccagaggt tcctcaatgg tagctccgaa aaactggaag acttcaagag attgattaaa 360

ataccggtcg acgatttgca aatccagaga aaagctatca acgaactcat taaggtgatg 420

aatgatctct cacccaaatc taacctgaga aaaagaaaga gatcacagaa cctgttcaga 480

ggaagaagag cctccatg 498

Claims (10)

1. a kind of interferon of sheep, it is characterised in that：The amino acid sequence of the interferon of the sheep is SEQ ID NO.1 institutes Show or to have the function of same disturbance element or active amino acid sequence with amino acid sequence shown in SEQ ID NO.1.

2. the interferon of sheep according to claim 1, which is characterized in that the encoding gene of the interferon of the sheep Polynucleotide sequence is shown for (a) or (b) or (c)：

(a) polynucleotide sequence shown in SEQ ID No.2；Or

(b) with the polynucleotide sequence that complementary series can be hybridized in stringent hybridisation conditions shown in SEQ ID No.2, institute The albumen for stating polynucleotide sequence coding still has the function of same disturbance element or activity；Or

(c) with the polynucleotide sequence of polynucleotide sequence at least 80% or more homology shown in SEQ ID No.2, and institute The albumen for stating polynucleotide sequence coding still has the function of same disturbance element or activity；Preferably, with shown in SEQ ID No.2 Polynucleotide sequence at least 85% or more homology polynucleotide sequence, and the albumen of the polynucleotide sequence coding Still have the function of same disturbance element or activity；It is furthermore preferred that at least with the polynucleotide sequence described in SEQ ID No.2 The polynucleotide sequence of 90% or more homology, and the albumen of the polynucleotide sequence coding still work(with same disturbance element Energy or activity.

3. a kind of sheep interferon mutant, which is characterized in that the interferon mutant of the sheep is by the SEQ ID The following E32T, E36D of amino acid sequence progress, N42T, P43S, K47N, S53L, L79F, N82T, L83F shown in NO.1, Any one of V88A, I95V, K103R, E110G, K116E, Q120K, N134S, K146R, N157T, R160Q amino acid list The mutant that site mutation obtains；

Preferably, the interferon mutant of the sheep be the SEQ ID NO.1 shown in amino acid sequence carry out as follows into The mutant that any one of row E32T, L79F, K103R, Q120K, N157T amino acid unit point mutation obtain；

It is highly preferred that the interferon mutant of the sheep, which is amino acid sequence shown in the SEQ ID NO.1, carries out Q120K The amino acid sequence of the mutant that amino acid unit point mutation obtains, the mutant is the mutation shown in SEQ ID NO.5 The nucleotides sequence of body encoding gene is classified as shown in SEQ ID NO.6.

4. a kind of sheep interferon mutant, which is characterized in that the interferon mutant of the sheep is by the SEQ ID Amino acid sequence shown in NO.1 carries out E32T-L79F, E32T-K103R, E32T-Q120K, E32T-N157T, L79F- Any one of K103R, L79F-Q120K, L79F-N157T, K103R-Q120K, K103R-N157T, Q120K-N157T ammonia The mutant that base acid double-site mutant obtains；

Preferably, the interferon mutant of the sheep is that amino acid sequence shown in the SEQ ID NO.1 is carried out L79F- The mutant that Q120K, K103R-Q120K, E32T-N157T any type amino acid double-site mutant obtain；

It is highly preferred that the interferon mutant of the sheep is to carry out amino acid sequence shown in the SEQ ID NO.1 The mutant that L79F-Q120K amino acid double-site mutants obtain, the amino acid sequence of the mutant is SEQ ID NO.7 institutes Show, the nucleotides sequence of the encoding gene of the mutant is classified as shown in SEQ ID NO.8.

5. a kind of sheep interferon mutant, which is characterized in that the interferon mutant of the sheep is by the SEQ ID Amino acid sequence shown in NO.1 carries out E32T-L79F-K103R, F32T-L79F-Q120K, E32T-L79F-N157T, L79F- What K103R-Q120K, L79F-K103R-N157T, K103R-Q120K-N157T any type amino acid multisite mutation obtained Mutant；

Preferably, the interferon mutant of the sheep is that amino acid sequence shown in the SEQ ID NO.1 is carried out L79F- The mutant that K103R-Q120K amino acid multisite mutations obtain；

It is highly preferred that the interferon of the sheep is that amino acid sequence shown in the SEQ ID NO.1 is carried out L79F- The mutant that K103R-Q120K amino acid multisite mutations obtain, the amino acid sequence of the mutant is SEQ ID NO.9 institutes Show, the nucleotides sequence of the encoding gene of the mutant is classified as shown in SEQ ID NO.10.

6. a kind of recombinant vector containing any one of Claims 1 to 5 sheep interferon or sheep interferon mutant or Recombinant host cell.

7. sheep interferon or sheep interferon mutant described in a kind of Claims 1 to 5 any one prevent preparing or The drug for treating sheep virosis or the purposes in reagent.

8. purposes according to claim 7, which is characterized in that the sheep virosis includes：Capripox virus infection, sheep Infective pustule virus infects or vesicular stomatitis virus infects times in associated diseases or Bovine Respiratory Syncytial virosis What is one or more.

9. a kind of method preparing the interferon of sheep described in Claims 1 to 5 any one or sheep interferon mutant, It is characterized in that, includes the following steps：

It (1) respectively will be described in the encoding gene of the interferon of sheep described in claim 1 or claim 2 to 4 any one The encoding gene of the interferon mutant of sheep is cloned into baculovirus transfer vector, and structure obtains recombinant transfer vector；

(2) by the recombinant transfer vector and baculovirus DNA cotransfection insect cell, recombinant baculovirus is obtained；

(3) by the recombinate shape virus infection insect cell or insect host, infected insect cell or insect place are cultivated The corresponding albumen of main expression, purifying to get.

10. according to the method described in claim 9, it is characterized in that, the baculovirus transfer vector is selected from AcRP23- lacZ、AcRP6-SC、AcUWl-lacZ、BacPAK6、Bac to Pac、Bacmid、BlucBacII(pETL)、p2Bac、 p2Blue、p89B310、pAc360、pAc373、pAcAB3、pAcAB 4、PAcAS3、pAcC129、pAcC4、DZI、pAcGP67、 pAcIEl、pAcJPl、pAcMLF2、pAcMLF 7、pAcMLF 8、pAcMPl、pAcMP2、pAcRP23、pAcRP 25、 pAcRW4、pAcsMAG、pAcUWl、pAcUW21、pAcUW2A、pAcUW2B、pAcUW3、pAcUW31、pAcUW41、pAcUW42、 pAcUW43、pAcUW51、pAcVC2、pAcVC3、pAcYMl、pAcJcC5、pBacl、pBac2、pBlueBacIII、 pBlueBacHis、pEV55、mXIV、pIEINeo、pJVETL、pJVNhel、pJVP10、pJVrsMAG、pMBac、pP10、 pPAKl、pPBac、pSHONEX 1.1、pSYN XIV VI+、pSYNVI+wp、pSYNXIV VI-、pVL1391、pVL 1392、 PVL 1393, pVL941, pVL 945, pVL 985, pVTBac, pBM030 or pUAC-5；

The baculoviral be selected from silkworm baculovirus parent plant BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV；

The insect host is selected from silkworm (Bombyx mori), wild silkworm (Bombyx mandarina), castor silkworm (Philosamia cynthia ricim), wild silkworm (Dictyoploca japanica), Philosamia cynthia (Philosamia cynthia Pryeri), tussah (Antheraea pernyi), yamama (Antheraea yamamai), wild giant silkworm (Antheraea Polyphymus), autographa california (Atographa califorica), tea geometrid (Ectropis obliqua), cabbage army worm (Mamestra brassicae), prodenia litura (Spodoptera littoralis), autumn armyworm (Spodoptera Frugiperda), cabbage looper (Trichoplusia ni), armyworm (Thaumetopoea wilkinsoni), bollworm (Heliothis armigera), U.S. bollworm (Heliothis zea), oriental tobacco budworm (Heliothis assulta), tobacco Noctuid (Heliothis virescens), oriental armyworm (Pseudaletia separata) or gypsymoth (Lymantria dispar)；

Preferably, the baculovirus transfer vector is pVL1393；The baculoviral is silkworm baculovirus parent plant BmBacmid；The insect host is silkworm (Bombyx mori)；Wherein, infection described in step 3) refers to the rod-shaped disease of recombination Poison is by eating or being infected through epidermis the insect larvae or pupal cell in 1-5 ages.