CN108840921B - Sheep alpha interferon mutant and preparation method and application thereof - Google Patents

Abstract

The invention discloses a sheep alpha interferon mutant and a preparation method and application thereof. The invention firstly discloses a sheep alpha interferon mutant, the amino acid sequence of which is shown in SEQ ID NO. 3. The 54 th amino acid of the sheep alpha interferon mutant is mutated into glutamine (Q) from lysine (K) to obtain the mutant with the amino acid sequence shown in SEQ ID NO.5, and the antiviral activity of the mutant is obviously improved. The invention further carries out amino acid single-site mutation, double-site mutation and multi-site mutation on the mutant with the amino acid sequence of SEQ ID NO.5 to obtain a plurality of sheep alpha interferon mutants with improved antiviral activity. The invention greatly improves the antiviral activity of the sheep alpha interferon mutant expressed in a silkworm bioreactor by using a silkworm baculovirus expression system. The sheep alpha interferon mutant provided by the invention can be used for preparing a medicine or a reagent for preventing or treating sheep viral diseases.

Description

Sheep alpha interferon mutant and preparation method and application thereof

Technical Field

The invention relates to a sheep alpha interferon mutant, and also relates to a preparation method and application of the sheep alpha interferon mutant, belonging to the field of recombinant protein of genetic engineering.

Background

Interferon (IFN) was first discovered by Isaacs of England scientists in 1957 by using chick embryo chorioallantoic membrane to study the phenomenon of influenza virus interference, and is a cytokine with various effects of inhibiting cell division, regulating immunity, resisting virus and tumor, etc. Interferons play an important role in the early immune response and are the first line of defense against viral infections. Interferons can be classified into three types according to their binding to membrane receptors.

The type I interferon is an important part of congenital immunity, has obvious effects on resisting virus and intracellular parasitic bacteria, and mainly comprises subtypes of IFN-alpha, IFN-beta, IFN-omega, IFN-epsilon, IFN-zeta and the like, wherein the IFN-alpha and the IFN-beta are the most main interferons in mammals. The type I interferon recognition receptor is the IFN-alpha/beta receptor (IFNAR), widely expressed in a variety of cells. The only interferon in type II is IFN-gamma, which is mainly expressed by activated NK cells, KNT cells and T cells, and the receptor is IFNGR. IFN-gamma is an important immune response molecule, participates in the whole process of immune response, and regulates the trend of immune response. Type III interferons A novel type of interferon discovered in recent years, tissue specific, belongs to the interleukin 10(IL-10) family members, and mainly includes λ 1(IL-29), λ 2(IL-28a), and λ 3(IL-28 b). The receptor is a heterodimer consisting of IL-10R2 and IL-28R alpha. At present, the preliminary understanding of type III interferon is considered that the type III interferon is related to anaphylaxis and autoimmune diseases, has the functions of broad-spectrum antivirus, antibiosis, antiparasitic and the like, participates in immune regulation, has obvious resisting effect on tumors, and has become the key content of research and application in related subjects of biology, clinical medicine, immunology, oncology and the like.

Sheep are one of familiar livestock, and have more than 5000 years of feeding history in China. Sheep are cold-resistant in nature, and are mainly produced in colder plateau areas such as Qinghai, Tibet, inner Mongolia and other areas in China, wherein the variety of sheep in inner Mongolia areas is the best. Cashmere can be woven into cashmere sweaters after being processed; the wool can be made into felt to be paved on a bed; sheepskin, which can be made into fur; mutton is one of the main edible meats and is also a good product for tonifying in winter. The mutton has tender meat quality, delicious taste and rich nutrition, and has less fat and cholesterol content than pork and beef. When the mutton is eaten in winter, the double effects of tonifying and resisting cold can be achieved. Sheep eat Baicao, which is called Baiyao storehouse for strengthening sheep. In addition, the theory of 'eating mutton frequently in hope of longevity' is provided. In the aspect of medical care, sheep can better play the unique role, and mutton, sheep blood and the like can be used for treating various diseases and have higher medicinal value. However, some viral diseases affect the survival and development of sheep and also affect the daily life of people. Therefore, a high-quality and low-cost sheep alpha interferon product is needed to eliminate the influence of viral diseases on the survival and development of sheep.

Disclosure of Invention

The invention aims to provide sheep alpha interferon and sheep alpha interferon mutant with high antiviral activity; a method for preparing the sheep alpha interferon or the sheep alpha interferon mutant by using a bombyx mori baculovirus expression system; and the application of the sheep alpha interferon or the sheep alpha interferon mutant in preparing a medicament or a reagent for preventing or treating sheep viral diseases.

In order to achieve the purpose, the invention adopts the following technical scheme:

the sheep alpha interferon has an amino acid sequence shown as SEQ ID NO.1, and a polynucleotide sequence of a coding gene shown as (a) or (b) or (c):

(a) the polynucleotide sequence shown in SEQ ID NO. 2; or

(b) A polynucleotide sequence capable of hybridizing under stringent hybridization conditions to the complement of SEQ ID No.2, which polynucleotide encodes a protein that still has the function or activity of an interferon; or

(c) Polynucleotide sequence with at least 80% homology with the polynucleotide sequence of SEQ ID NO.2, and the protein coded by the polynucleotide still has the function or activity of interferon;

preferably, the polynucleotide sequence has at least more than 85% homology with the polynucleotide sequence of SEQ ID NO.2, and the protein coded by the polynucleotide still has the function or activity of interferon;

more preferably, the polynucleotide sequence has at least 90% homology with the polynucleotide sequence of SEQ ID NO.2, and the protein encoded by the polynucleotide still has the function or activity of interferon.

Further, a sheep alpha interferon mutant is a mutant obtained by replacing a signal peptide of sheep alpha interferon with a signal peptide with the accession number of CAA41790.1 on NCBI; the amino acid sequence of the mutant is shown in SEQ ID NO.3, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 4.

Further, the sheep alpha interferon mutant is a mutant obtained by mutating 54 th amino acid of the sheep alpha interferon mutant with an amino acid sequence shown as SEQ ID NO.3 from lysine (K) to glutamine (Q); the amino acid sequence of the mutant is shown in SEQ ID NO.5, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 6.

Further, a sheep interferon-alpha mutant is obtained by carrying out mutation on any one of amino acid single-site mutations of S30H, P32L, R57K, Q60A, R63Q, F71L, T76A, V77I, L91F, A94E, N101D, H109R, G118D, T121A, M142A, K158G, T178S, A179T and S184R on the sheep interferon-alpha mutant with an amino acid sequence shown as SEQ ID No. 5;

preferably, the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is subjected to single-site mutation of any one of amino acid P32L, F71L, V77I, H109R, M142A or K158G to obtain a mutant; the amino acid sequence of the mutant obtained by carrying out F71L amino acid single-site mutation on the sheep alpha interferon mutant with the amino acid sequence shown in SEQ ID NO.5 is shown in SEQ ID NO.7, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 8.

The amino acid single-site mutation P32L refers to the mutation of the 32 th amino acid of the sheep alpha interferon mutant with the amino acid sequence of SEQ ID NO.5 from proline (P) to leucine (L); and so on.

Further, a sheep alpha interferon mutant is obtained by carrying out any one of amino acid point mutation of P32L-H109R, P32L-F71L, P32L-F77L, P32L-M142A, P32L-K158G, F71L-V77I, F71L-H109R, F71L-M142A, F71L-K158G, V77I-H109R, V77I-M142A, V77I-K158G, H109R-M142A, H109R-K158G or M142A-K158G on the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID No. 5;

preferably, the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is subjected to double-site mutation of any one amino acid of P32L-K158G, F71L-V77I or H109R-K158G to obtain a mutant; the amino acid sequence of the mutant obtained by carrying out F71L-V77I amino acid double-site mutation on the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is shown as SEQ ID NO.9, and the nucleotide sequence of the coding gene of the mutant is shown as SEQ ID NO. 10.

The amino acid double-site mutation P32L-K158G of the invention means that the amino acid at the position 32 of the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is mutated from proline (P) into leucine (L), and the amino acid at the position 158 is mutated from lysine (K) into glycine (G); and so on.

Further, a sheep alpha interferon mutant is a mutant obtained by carrying out multi-site mutation on any one of amino acid P32L-F71L-K158G, P32L-V77I-K158G, P32L-H109R-K158G, P32L-F71L-V77I, F71L-V77I-K158G, F71L-V77I-H109R, F71L-H109R-K158G or V77I-H109R-K158G on the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID No. 5;

preferably, the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is subjected to F71L-V77I-K158G amino acid multi-site mutation to obtain a mutant; the amino acid sequence of the mutant is shown in SEQ ID NO.11, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 12.

The amino acid multi-site mutation P32L-F71L-K158G of the invention indicates that the 32 th amino acid of the sheep alpha interferon mutant with the amino acid sequence shown as SEQ ID NO.5 is mutated from proline (P) into leucine (L), the 71 th amino acid is mutated from phenylalanine (F) into leucine (L), and the 158 th amino acid is mutated from lysine (K) into glycine (G); and so on.

Furthermore, the invention discloses a recombinant vector or a recombinant host cell containing the sheep alpha interferon or the sheep alpha interferon mutant coding gene. Wherein, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

Further, the application of the sheep alpha interferon or the sheep alpha interferon mutant in preparing a medicine or a reagent for preventing or treating sheep viral diseases.

The sheep viral diseases include: any one or more of capripoxvirus infection, caprine infective pustular virus infection or vesicular stomatitis virus infection, or bovine respiratory syncytial virus disease.

Further, a method for preparing the sheep alpha interferon or the sheep alpha interferon mutant comprises the following steps: (1) respectively cloning the coding genes of the sheep alpha interferon or the sheep alpha interferon mutant into a baculovirus transfer vector to construct a recombinant transfer vector; (2) co-transfecting the recombinant transfer vector and the baculovirus to the insect cell to obtain a recombinant baculovirus; (3) infecting the recombinant baculovirus into insect cells or insect hosts, culturing the infected insect cells or insect hosts to express corresponding protein, and purifying to obtain the recombinant baculovirus.

Wherein the baculovirus transfer vector is selected from AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB 4, pAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIEl, pAcJPl, pALF 2, pAcMLF 7, pAcMLLF 8, pAPLcM, cpAP 2, pAcRP23, pAcRP 25, pAcRW4, pAcMAG, pAcUWl, pAcUW21, pAcUW2A, pAcUW2B, pAcUW 6862, pAcUW 69556, pAcRW4, pAcMAG, pAcUpYNC, pAcVMV 1397, pApYNpYNpYVC 8672, pApYNpYnV 369872, pApYnPVV, pApYVC 9872, pApSeVpYVC 9872, pApPSpYvP, pApYvJ 3611, pAcVpYP pVpVpVpVIV, pApYP + pApYP 3, pApYnVEpYP 3, pApYnVEpVEpVIV, pApVEpVIV, pApKApKAVC, pApKAV, pApIBV, pApKAV, pAcJpAcJpAcJpAcJpAcJpAcJpApIBV, pApIBV, pAcJpAcJpAcJpAcJpAcJpAmW 2, pAcJpAcJpAcJpAcJpAcJpAcJpAcJV 7, pAcJpAc;

the baculovirus is selected from bombyx mori baculovirus parent strain BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV;

the insect host is selected from the group consisting of Bombyx mori (Bombyx mori), Bombyx mori (Bombyx mangarina), ricinus (Philosamia cynthia ricim), Antrodia camphorata (Dictyyoplocajapanica), Ailanthus altissima (Philosamia cyathiapryerii), Antheraea pernyi (Antheraphyma), Antheraea japonica (Antherayamamai), Philotus hirsutus (Antherapolis), Autographa californica (Atogaria californica), Ectropina obliqua (Ectropis obliqua), Trichoplusia glans (Mamezia brasica), Spodoptera littoralis (Spodoptera littoralis), Spodoptera armyworm (Spodoptera nigra), Trichoplusia ni (Spodoptera), Spodoptera armyworm (Heliothis virens), Heliothis armyworm (tobacco), Helicoverpa armigera (tobacco), and Helicoverpa armigera (tobacco);

preferably, the baculovirus transfer vector is pVL 1393; the baculovirus is a parent strain BmBacmid of silkworm baculovirus; the insect host is silkworm (Bombyx mori).

The baculovirus transfer vector constructed by the invention comprises:

(1) vectors pVL-OvIFN-alpha, pVL-OvIFN-alpha-S containing sheep alpha interferon (OvIFN-alpha) gene or sheep alpha interferon signal peptide mutant (OvIFN-alpha-S mutant) gene;

(2) a vector pVL-OvIFN-alpha-S-C-O containing a mutant (OvIFN-alpha-S-C-O mutant) gene sequence obtained by conservative sequence mutation and optimization of an OvIFN-alpha-S mutant;

(3) a vector pVL-OvIFN-alpha-S-C-O-M1 containing a mutant (OvIFN-alpha-S-C-O-M1 mutant) gene sequence of the OvIFN-alpha-S-C-O mutant subjected to amino acid single-site mutation;

(4) a vector pVL-OvIFN-alpha-S-C-O-M1-M2 containing a mutant (OvIFN-alpha-S-C-O-M1-M2 mutant) gene sequence of the OvIFN-alpha-S-C-O mutant subjected to amino acid double-site mutation;

(5) the vector pVL-OvIFN-alpha-S-C-O-M1-M2-M3 contains a mutant (OvIFN-alpha-S-C-O-M1-M2-M3 mutant) of an OvIFN-alpha-S-C-O mutant subjected to amino acid multi-site mutation.

The recombinant baculovirus obtained by the invention comprises: recombinant bombyx mori nuclear polyhedrosis virus rBmBacmid (OvIFN-alpha, OvIFN-alpha-S), rBmBacmid (OvIFN-alpha-S-O, OvIFN-alpha-S-C-O-M1, OvIFN-alpha-S-C-O-M1-M2, OvIFN-alpha-S-C-O-M1-M2-M3).

The infection refers to that the recombinant baculovirus infects 1-5-year-old insect larvae or pupae bodies through swallowing or permeating epidermis; preferably, the recombinant silkworm baculovirus is used for infecting silkworm cells or inoculating silkworm larvae or pupae of 1-5 years old by puncture, and body fluid or tissue homogenate of the silkworm larvae or pupae containing various sheep alpha interferon genes is collected after infection for 3-6 days; wherein, the pupa is the early young pupa of 1-2 days optimally.

The invention has the beneficial effects that: the invention carries out sequence comparison and signal peptide analysis by analyzing all sheep alpha interferon amino acid sequences on NCBI, finally determines that the amino acid sequence with the accession number of CAA41791.1 is taken as a main reference sequence, compares the main reference sequence with other mammal I-type interferon amino acid sequences, finally selects the signal peptide with the accession number of CAA41790.1 on NCBI as the signal peptide of the amino acid sequence to carry out signal peptide mutation, selects the preference amino acid with high occurrence frequency on each site to optimize, and designs a conservative sequence; and a plurality of pairs of primers are designed by taking the conserved sequence as a template, and amino acid single-site mutation, amino acid double-site mutation and amino acid multi-site mutation are carried out by a fusion PCR method, so that a plurality of sheep alpha interferon mutants are obtained. The sheep alpha interferon mutant is expressed in a silkworm bioreactor by using a silkworm baculovirus expression system, and the antiviral activity of the expressed sheep alpha interferon mutant is greatly improved, so that the sheep alpha interferon mutant has obvious antiviral activity. The method has simple process, and can quickly obtain a large amount of safe and reliable sheep alpha interferon. The sheep alpha interferon mutant can be used for preparing medicines or reagents for preventing or treating sheep viral diseases, and has great significance for the development of animal husbandry.

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, and the like). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues (Batzer et al, nucleic acid Res.19:5081 (1991); Ohtsuka et al, J.biol.chem.260: 2605-S2608 (1985); and Cassol et al (1992); Rossolini et al, Mol cell. probes 8:91-98 (1994)).

The term "homology" refers to sequence similarity to a native nucleic acid sequence. "homology" includes a nucleotide sequence having preferably 85% or more, more preferably 90% or more, and most preferably 95% or more identity to the nucleotide sequence of the regulatory fragment of the present invention. Homology can be assessed visually or by computer software. Using computer software, homology between two or more sequences can be expressed as a percentage (%), which can be used to assess homology between related sequences.

The term "complementary" as used herein refers to two nucleotide sequences comprising antiparallel nucleotide sequences capable of pairing with each other upon hydrogen bonding between complementary base residues of the antiparallel nucleotide sequences. It is known in the art that the nucleotide sequences of two complementary strands are reverse complementary to each other when the sequences are viewed in both 5 'to 3' directions. It is also known in the art that two sequences that hybridize to each other under a given set of conditions do not necessarily have to be 100% perfectly complementary.

The term "stringent hybridization conditions" means conditions of low ionic strength and high temperature as known in the art. Typically, a probe hybridizes to its target sequence to a greater extent (e.g., at least 2-fold over background) than to other sequences under stringent conditions. Stringent hybridization conditions are sequence dependent and will be different under different environmental conditions, with longer sequences specifically hybridizing at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the stringency of hybridization or wash conditions. For an exhaustive guidance of Nucleic acid Hybridization, reference is made to the literature (Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic acids Probes, "Overview of principles of Hybridization and the" protocol of Nucleic acid assays. 1993). More specifically, the stringent conditions are typically selected to be about 5-10 ℃ below the thermal melting point (Tm) of the specific sequence at a defined ionic strength pH. The Tm is the temperature (at a given ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, 50% of the probes are occupied at Tm at equilibrium). Stringent conditions may be as follows: wherein the salt concentration is less than about 1.0M sodium ion concentration, typically about 0.01 to 1.0M sodium ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature is at least about 30 ℃ for short probes (including but not limited to 10 to 50 nucleotides) and at least about 60 ℃ for long probes (including but not limited to greater than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. For selective or specific hybridization, the positive signal can be at least two times background hybridization, optionally 10 times background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5 XSSC and 1% SDS, incubated at 42 ℃; or 5 XSSC, 1% SDS, incubated at 65 ℃, washed in 0.2 XSSC and washed in 0.1% SDS at 65 ℃. The washing may be for 5, 15, 30, 60, 120 minutes or more.

The terms "mutation" and "mutant" have their usual meanings herein, and refer to a genetic, naturally occurring or introduced change in a nucleic acid or polypeptide sequence, which has the same meaning as is commonly known to those of skill in the art.

The term "host cell" or "recombinant host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome.

The term "transfection" refers to the process by which eukaryotic cells acquire a new genetic marker due to the incorporation of foreign DNA.

Description of the drawings:

1. FIG. 1 is a fluorescence plot corresponding to a cytopathic ratio; wherein, a, "-": (ii) cell-free lesions; b, "+/-": several cytopathies; c, "+": 20% -30% of cytopathic effect; d, "+ +": 50% -60% of cytopathic effect;

2. FIG. 2 is a double restriction enzyme identification of recombinant plasmid pVL-OvIFN-alpha; wherein, M: DNA molecular mass standard; 1: recombinant plasmid pVL-OvIFN-alpha double enzyme digestion product; negative control (transfer vector pVL1393 double-restriction product);

3. FIG. 3 shows the cells showing various ratios of fluorescence; wherein, A: interferon inhibits fluorescence exhibited by VSV virus; b: fluorescence exhibited by VSV virus infected controls; c: part of the cells were infected with fluorescence exhibited by VSV virus.

Detailed Description

The following examples are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The transfer vector pVL1393, the E.coli strain TOP10, the BmN cell, the Vero cell and the VSV-GFP virus are preserved and provided by the institute of biotechnology of Chinese academy of agricultural sciences; the experimental silkworm variety JY1 is provided by the silkworm research institute of Jiangsu science and technology university, and the parental virus BmBacmid DNA is constructed according to the method disclosed in the literature (patent number: ZL 201110142492.4, authorization date: 2013.01.23). Restriction enzymes, T4 DNA ligase were purchased from Promega, LATaq DNA polymerase and other related reagents used in PCR were purchased from Takara, liposomes were purchased from Invitrogen, DMEM cell culture medium and fetal bovine serum are products of GIBCO. Reference is made to the relevant tool book for the preparation of solutions and media (Josepheit, third edition of molecular cloning guidelines, 2002; Oseber, et al, eds. molecular biology guidelines, 1998; David L.Spector, cell experiments guidelines, 2001); unless otherwise indicated, percentages and parts are by weight.

The fusion PCR method of site-directed mutagenesis was performed by referring to the method described in Kuang Jatin et al (a new method for vector construction: recombinant fusion PCR method, genomics and applied biology, 2012, Vol. 31, No.6, p. 634-639).

The titer of interferon was calculated using Vero/VSV × GFP system using the Reed-Muench method, with specific manipulations performed with reference to Liuxing Jian, et al (detection of expression and bioactivity of cat ω -like interferons in silkworms, advances in biotechnology 2015, 5 (6): 441) 445) and Summers MD, et al (Amanual of methods for bacterial cells and animal cell culture products [ R ]. Texas Agricultural Experiment Station, 1987), wherein the criteria for judging cytopathies were referred to FIG. 1.

The best improvement in each case served as a comparison criterion for the improvement in the next case.

Example 1 expression and detection of sheep interferon-alpha and its signal peptide mutant genes in silkworm bioreactor

I, target gene synthesis and recombinant plasmid construction

The invention analyzes all sheep alpha interferon amino acid sequences on NCBI, carries out sequence comparison and signal peptide analysis, and finally determines that the amino acid sequence with the accession number of CAA41791.1 is an original sequence, the amino acid sequence is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2. In the sequence analysis process, a signal peptide of the sequence is found to have a plurality of cutting peaks, and the invention determines to carry out mutation on the amino acid sequence of the sheep alpha interferon in view of the discovery that the cutting sites of the signal peptide influence the secretion efficiency of the interferon. The method comprises the steps of carrying out signal peptide prediction on a sheep IFN-alpha amino acid sequence or a related sequence on line by using SignalP4.1, finding that only the signal peptide with the accession number of CAA41790.1 is single peak, and other sheep IFN-alpha amino acids or related sequences are double peaks, wherein the double peaks mean that the secretion and cutting efficiency of the signal peptide is not optimal, simultaneously carrying out signal peptide mutation design by referring to other mammal interferon amino acid sequences, and comparing the influence of the signal peptide on antiviral activity to obtain a mutant optimized by the sheep alpha interferon signal peptide. And finally, replacing the original amino acid sequence signal peptide with a signal peptide with the accession number of CAA41790.1 on NCBI to obtain the goat alpha interferon signal peptide mutant of IFN, which is named as an OvIFN-alpha-S mutant, wherein the amino acid sequence of the mutant is shown as SEQ ID NO.3, and the gene sequence of the mutant is shown as SEQ ID NO. 4.

Restriction enzyme cutting sites were analyzed by DNAman software, and restriction enzyme cutting sites not present in the sequence of the target gene were added to both ends of the target gene based on the analysis results of the restriction enzyme cutting sites and the multiple cloning sites on the transfer vectors pVL1393 and pUC 57. According to the analysis result, a BamH I restriction site and a Kozak sequence are added to the 5 'end of the plasmid, an EcoRI restriction site is added to the 3' end of the plasmid, TAA is used as a stop codon, the determined gene sequence is synthesized by Nanjing Kingsry Biotechnology Co., Ltd, and a pUC57 vector is inserted to form a plasmid pUC 57-OvIFN-alpha.

As described above, the signal peptide of the original amino acid sequence was replaced with the signal peptide of CAA41790.1 at NCBI, which was an OvIFN-. alpha. -S mutant. Restriction enzyme cutting sites were analyzed by DNAman software, and restriction enzyme cutting sites not present in the sequence of the target gene were added to both ends of the target gene based on the analysis results of the restriction enzyme cutting sites and the multiple cloning sites on the transfer vectors pVL1393 and pUC 57. According to the analysis result, a BamH I restriction site and a Kozak sequence are added to the 5 'end of the plasmid, an EcoRI restriction site is added to the 3' end of the plasmid, TAA is used as a stop codon, the determined gene sequence is synthesized by Nanjing Kingsry Biotechnology Co., Ltd, and a pUC57 vector is inserted to form a plasmid pUC 57-OvIFN-alpha-S.

II, construction of recombinant baculovirus transfer vectors

And carrying out double enzyme digestion treatment on plasmid pUC 57-OvIFN-alpha and plasmid pUC 57-OvIFN-alpha-S by using BamH I and EcoR I respectively, recovering target fragments by using a DNA gel recovery kit respectively, and connecting T4 DNA ligase with the target fragments and the inactivated baculovirus transfer vector pVL1393 subjected to double enzyme digestion treatment at 16 ℃ for overnight connection. Respectively transforming the ligation products into escherichia coli competent cells TOP10, selecting colonies for culturing, upgrading the plasmids, respectively carrying out BamH I and EcoR I double enzyme digestion on recombinant plasmids (recombinant transfer vectors) pVL-OvIFN-alpha and pVL-OvIFN-alpha-S, and carrying out 1% agarose gel electrophoresis, wherein the electrophoresis result of the recombinant plasmid pVL-OvIFN-alpha double enzyme digestion products is shown in figure 2, 2 fragments are separated out altogether, the small fragment is located between 500 and 750bp and is consistent with the 588bp size of the target gene fragment, and the large fragment is located above 8000bp and is consistent with 9607bp size of the pVL1393 fragment. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited company for nucleotide sequencing, and the MegaAlign comparison result shows that the sequence is consistent with the originally designed sequence, which shows that the sheep alpha-interferon and the signal peptide mutant gene thereof are successfully inserted between BamH I and EcoR I in the pVL1393 transfer vector.

Primers required by the nucleotide sequence of the goat alpha interferon signal peptide mutant:

primers for upstream and downstream on both sides:

F：TCATACCGTCCCACCATCGGGCGCGGATCCAACATGGCCCAGC；

R：GATCTGCAGCGGCCGCTCCGGAATTCTCAAGGTGACGCC。

III, obtaining, purifying and amplifying recombinant silkworm baculovirus

Reviving and passaging the BmN cells, and then screening recombinant viruses: when the BmN cells were cultured until the cell monolayer reached about 80%, the old medium was poured off, washed three times with serum-free TC-100 medium, and 1.5mL of FBS-free medium was added. Sequentially adding 1 mu g of bombyx mori baculovirus parent strain BmBacmid DNA, 2 mu g of recombinant transfer plasmids pVL-OvIFN-alpha, pVL-OvIFN-alpha-S and 5 mu L of liposome into a sterilizing tube, complementing the volume to 60 mu L by using sterile double distilled water, gently mixing uniformly, standing for 15min, and then dropwise adding into a culture bottle for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu.L FBS were supplemented. Culturing at the constant temperature of 27 ℃ for 4-5 days until the cells shed and float, and collecting cell culture solution to obtain recombinant viruses rBmBacmid (OvIFN-alpha) and rBmBacmid (OvIFN-alpha-S) containing target genes.

The purification and amplification method of the recombinant silkworm baculovirus is as follows: inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the collected cell culture solution at different concentrations, adding 1mL of the diluted cell culture solution into the adherent cells, and uniformly distributing the cells. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. And (3) selecting out the plaques which do not contain the polyhedron, repeating the steps, and obtaining pure recombinant baculovirus rBmBacmid (OvIFN-alpha) and rBmBacmid (OvIFN-alpha-S) of the silkworm through 2-3 rounds of purification.

Infecting recombinant bombyx mori baculovirus rBmBacmid (OvIFN-alpha) and rBmBacmid (OvIFN-alpha-S) with normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of recombinant viruses rBmBacmid (OvIFN-alpha) and rBmBacmid (OvIFN-alpha-S).

IV, sheep alpha-interferon and its mutant expression in silkworm body

Recombinant virus culture solution is added according to the formula 10⁵PFU/head dose is injected into 5-year-old silkworm, the silkworm is cultured under the condition of 27 ℃ and 70% -80% humidity, the silkworm larva grows late, and the OvIFN-alpha is efficiently expressed under the action of the polyhedrosis gene promoter. When the silkworm larva is infected for 3.5-4 days after inoculation, symptoms such as swelling of body nodes, abnormal behavior, decreased appetite and the like can be observed, when the larva is observed to be obviously reduced in volume and stops eating, hemolymph is collected and stored at-20 ℃ for later use.

Detection of antiviral activity of V, sheep alpha-interferon and mutant protein thereof

The antiviral activity of sheep alpha-interferon expressed in silkworm haemolymph was examined on a Vero/VSV-GFP system using a microcytopathy inhibition method. Vero cells in good state were cultured at 1.0X 10⁵The cells/mL were plated in 96-well plates. Preparing silkworm hemolymph with ultrasonic disruption and filter sterilization into solution with different dilution with DMEM culture solution containing 70mL/L fetal calf serum, inoculating diluted sample into culture well with Vero cells according to 100 μ L/well, setting at least 8 multiple wells for each dilution and control silkworm blood, and simultaneously preparing the culture medium into the culture mediumCell control group without silkworm hemolymph and VSV GFP and virus control group with VSV GFP added were set at 37 ℃ and 5% CO₂Culturing for 18-24 h under the condition. Diluting to 100TCID₅₀The VSV GFP virus of (1) was added to the culture well from which the supernatant had been aspirated at 100. mu.L/well, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing under the condition. When a large number of cells in each hole of the virus control group generate fluorescence and the cells in the cell control group still completely grow well and no fluorescence appears, the contrast system is completely qualified, and comprehensive observation can be carried out.

The result is observed under an inverted fluorescence microscope, the cell growth state in the cell control group is good, and no fluorescence appears; cells infected with the virus control group were diseased, most cells were fluorescent, and cells supplemented with recombinant ovine interferon-alpha protein had the ability to resist viral infection (FIG. 3). Observing the pathological change degree of the cells according to the protective effect of the sheep alpha interferon on Vero cells, marking the cells in the hole as "+" when green fluorescent cells appear, and calculating the titer of the interferon according to a Reed-Muench method. The detection results are shown in Table 1, and the results of the antiviral activity determination show that the OvIFN-alpha expressed in silkworm larva bodies has more obvious antiviral activity, and the potency reaches 3.16 multiplied by 10⁵U/mL, the OvIFN-alpha-S antiviral potency is higher than that of OvIFN-alpha, and is 5.62 x 10⁵U/mL, achieved the expected effect, suggesting that it is feasible and effective to enhance the OvIFN-. alpha.antiviral activity by using the signal peptide with CAA41790.1 on NCBI with only one specific cleavage site.

TABLE 1 test results of antiviral activity of recombinant ovine interferon-alpha

Example 2 expression and detection of OvIFN-. alpha. -S mutants after conservative sequence mutation and optimization in silkworm bioreactor

Construction of sheep alpha-interferon mutant gene

All sheep alpha interferon amino acid sequences and related sequences obtained from NCBI are compared to obtain a conserved sequence. The conserved sequence is different from the original amino acid sequence in that lysine (K) at position 54 of the original amino acid sequence is changed to glutamine (Q). Therefore, based on the results of example 1, the 54 th K of the amino acid sequence of the mutant ovine interferon-alpha signal peptide (OvIFN-alpha-S mutant) was changed to Q, and a new mutant ovine interferon-alpha was obtained and named as OvIFN-alpha-S-C mutant, and the amino acid sequence thereof is shown in SEQ ID NO. 5.

In addition, the present invention utilizes OptimumGene^TMThe technology optimizes the sheep alpha interferon mutant gene, modifies the gene sequence according to the codon preference of a bioreactor silkworm, optimizes and designs various related parameters which influence the transcription efficiency and the translation efficiency of the gene, the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the stability of mRNA free energy, RNA instability motif, repetitive sequence and the like, is favorable for improving the transcription efficiency and the translation efficiency of the optimized gene in the silkworm and keeps the protein sequence translated finally unchanged.

In order to improve the translation initiation efficiency in a silkworm baculovirus eukaryotic expression system, a Kozak sequence AAC is added in front of a gene, and in order to improve the translation termination efficiency, a stop codon is changed into TAA. In addition, restriction sites such as BamH I, EcoR I, Sma I and the like within the gene sequence were removed, BamH I was added upstream of the gene, EcoR I restriction sites were added downstream of the gene for subsequent cloning into the eukaryotic transfer vector pVL 1393.

The sequence of the designed alpha-interferon mutant gene after optimization is artificially synthesized by a biotechnology company and named as an OvIFN-alpha-S-C-O mutant, the nucleotide sequence of the mutant is shown as SEQ ID NO.6, and the synthesized gene fragment is inserted into a pUC57 vector to form a plasmid pUC57-OvIFN which is named as pUC 57-OvIFN-alpha-S-C-O.

II, construction of recombinant baculovirus transfer vectors

Plasmid pUC 57-OvIFN-alpha-S-C-O is subjected to double enzyme digestion treatment by using BamH I and EcoR I, a target fragment is recovered by a glass milk method, T4 DNA ligase is used for connecting the target fragment and a baculovirus transfer vector pVL1393 subjected to double enzyme digestion and inactivation, and the two fragments are connected at 16 ℃ overnight. Transforming the ligation product into escherichia coli competent cell TOP10, selecting a colony for culture, upgrading the plasmid, carrying out BamH I and EcoR I double enzyme digestion on recombinant plasmid (recombinant transfer vector) pVL-OvIFN-alpha-S-C-O, carrying out 1% agarose gel electrophoresis, and separating 2 fragments, wherein the small fragment is located between 500 and 750bp and is consistent with 588bp of a target gene fragment, and the large fragment is located above 8000bp and is consistent with 9607bp of pVL1393 fragment. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New industry biotechnology Limited company for nucleotide sequencing, and the MegaAlign comparison result shows that the sequence is consistent with the originally designed sequence, which shows that the sheep alpha-interferon mutant gene is successfully inserted between BamH I and EcoR I in the pVL1393 transfer vector.

III, obtaining, purifying and amplifying recombinant silkworm baculovirus

The recombinant bombyx mori baculovirus was obtained in the same manner as in example 1, and finally recombinant virus rBmBacmid (OvIFN-. alpha. -S-C-O) containing the target gene was obtained. The purification and amplification method of the recombinant silkworm baculovirus is the same as that of the example 1, and the pure recombinant silkworm baculovirus rBmBacmid (OvIFN-alpha-S-C-O) is obtained through purification. Infecting the recombinant bombyx mori baculovirus rBmBacmid (OvIFN-alpha-S-C-O) with the normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-alpha-S-C-O).

IV, sheep alpha interferon mutant is expressed in silkworm body (same as example 1)

Detection of antiviral activity of V, sheep alpha-type interferon mutant protein

The detection method was the same as in example 1.

The result is observed under an inverted fluorescence microscope, the cell growth state in the cell control group is good, and no fluorescence appears; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant sheep alpha interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of cells according to the protective effect of sheep alpha-interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, and calculating interferon according to a Reed-Muench methodThe potency of (A). The detection results are shown in Table 2, and the results of the antiviral activity determination show that the expressed OvIFN-alpha-S-C-O in silkworm larva bodies has obvious antiviral activity, and the potency reaches 1.95 multiplied by 10⁶U/mL, the expected effect is achieved, and the method for carrying out conservative sequence mutation and optimization on the sheep alpha interferon signal peptide mutant to improve the OvIFN-alpha antiviral activity is feasible and effective.

TABLE 2 detection results of antiviral activity of sheep alpha interferon mutant after optimization

Example 3 OvIFN-. alpha. -S-C mutant optimization and expression and detection in silkworm bioreactor after amino acid single-site mutation

Construction of sheep alpha-interferon mutant gene

Based on the result of the embodiment 2, the sheep alpha interferon mutant-OvIFN-alpha-S-C mutant with high antiviral activity is obtained, the gene sequence of the OvIFN-alpha-S-C-O mutant after codon optimization is used as a template, a plurality of pairs of primers are designed to carry out site-directed mutagenesis on the conserved sequence, and the site-directed mutagenesis is carried out by utilizing a fusion PCR method.

Carrying out double enzyme digestion treatment on a plasmid pVL-OvIFN-alpha-S-C-O with correct sequencing by using BamH I and EcoR I, recovering a target fragment by using a glass milk method after agarose gel electrophoresis, carrying out site-directed mutagenesis on the target fragment by using a fusion PCR (polymerase chain reaction) technology design primer, then connecting the target fragment by using T4 DNA ligase, carrying out double enzyme digestion treatment and inactivating the inactivated baculovirus transfer vector pVL1393(16 ℃, overnight connection). Transforming the ligation product into escherichia coli competent cell TOP10, selecting a colony for culturing, upgrading the plasmid, carrying out double enzyme digestion identification on positive clones by using BamH I and EcoR I, sending the correctly identified recombinant plasmid to Beijing Strobilanthokes biotechnology limited company for sequencing, and naming the correctly sequenced plasmid as pVL-OvIFN-alpha-S-C-O-M1.

The mutation sites are S30H, P32L, R57K, Q60A, R63Q, F71L, T76A, V77I, L91F, A94E, N101D, H109R, G118D, T121A, M142A, K158G, T178S, A179T and S184R respectively; the obtained sheep interferon-alpha mutant is named as OvIFN-alpha-S-C-O-M1 (S30H, P32L, R57K, Q60A, R63Q, F71L, T76A, V77I, L91F, A94E, N101D, H109R, G118D, T121A, M142A, K158G, T178S, A179T and S184R) mutant.

The invention lists the point mutations with higher interferon titer expressed after mutation as the basis for further mutation improvement, and the mutation sites with poor interferon titer expressed after mutation are not listed, because the successful mutant ratio is lower, the principle is carried out in the subsequent examples.

Primers required for carrying out amino acid single-site, double-site and multi-site mutation on nucleotide sequences of the OvIFN-alpha-S-C-O mutant:

1) primers for upstream and downstream on both sides:

F:TCATACCGTCCCACCATCGGGCGCGGATCCAACATGGCTTTCGTCCTCTCC；

R:GATCTGCAGCGGCCGCTCCGGAATTCTTACGGTGAAGCCAAATCGCCG；

2) intermediate upstream and downstream primers

(1)F1：GACTTGCCACACAACCACGCTCCTCTGAGTAGATCAACTT；

R1：AAGTTGATCTACTCAGAGGAGCGTGGTTGTGTGGCAAGTC；

(2)F2：CCACACAACTCTGCTCTCCTGAGTAGATCAACTTTGGTGTTG；

R2:CAACACCAAAGTTGATCTACTCAGGAGAGCAGAGTTGTGTGG；

(3)F3:TGTCTCCAAGACAGAAAAGATTTCCAGTTCCCCCGG；

R3:CCGGGGGAACTGGAAATCTTTTCTGTCTTGGAGACA；

(4)F4:GACAGAAGAGATTTCGCTTTCCCCCGGGAAGTGGTTAAC；

R4:GTTAACCACTTCCCGGGGGAAAGCGAAATCTCTTCTGTC；

(5)F5:GATTTCCAGTTCCCCCAGGAAGTGGTTAACGGTTCTCAA；

R5:TTGAGAACCGTTAACCACTTCCTGGGGGAACTGGAAATC；

(6)F6:GAAGTGGTTAACGGTTCTCAATTGCAGAAGAATCAGACC；

R6:GGTCTGATTCTTCTGCAATTGAGAACCGTTAACCACTTC；

(7)F7:TTCCAGAAGAATCAGGCCGTGAGCGTTCTCCACG；

R7:CGTGGAGAACGCTCACGGCCTGATTCTTCTGGAA；

(8)F8:CAGAAGAATCAGACCATCAGCGTTCTCCACGAAATGC；

R8:GCATTTCGTGGAGAACGCTGATGGTCTGATTCTTCTG；

(9)F9:CAGATTTTCAACCTCTTCCACACCGCGAGATCATCT；

R9:AGATGATCTCGCGGTGTGGAAGAGGTTGAAAATCTG；

(10)F10:AACCTCTTCCACACCGAAAGATCATCTGCTGCCTGGAAC；

R10:GTTCCAGGCAGCAGATGATCTTTCGGTGTGGAAGAGGTT；

(11)F11:TCATCTGCTGCCTGGGACAATACCCTGTTGCACGAATT；

R11:CAATTCGTGCAACAGGGTATTGTCCCAGGCAGCAGATGA；

(12)F12：CTGTTGGAAGAATTGAGAACAGCCCTCCACCAACAGC；

R12：GCTGTTGGTGGAGGGCTGTTCTCAATTCTTCCAACAG；

(13)F13：CACCAACAGCTGCAAGACCTGGAAACCTGCCTCGT；

R13：ACGAGGCAGGTTTCCAGGTCTTGCAGCTGTTGGTG；

(14)F14：CTGCAAGGCCTGGAAGCCTGCCTCGTGCAGGCTATG；

R14：CATAGCCTGCACGAGGCAGGCTTCCAGGCCTTGCAG；

(15)F15：GATTCGCCTACTCTGGCCTTGAAAAGATACTTCCAAAGAATAAGAC；

R15：GTCTTATTCTTTGGAAGTATCTTTTCAAGGCCAGAGTAGGCGAATC；

(16)F16：TACCTGGACGAAAAGGGCCACAGCGGTTGTGCTTGG；

R16：CCAAGCACAACCGCTGTGGCCCTTTTCGTCCAGGTA；

(17)F17：AGAGCCTTCTCATCATCAGCAGACCTGCAAGAAAGCTTG；

R17：CAAGCTTTCTTGCAGGTCTGCTGATGATGAGAAGGCTCT；

(18)F18：GCCTTCTCATCAACAACAGACCTGCAAGAAAGCTTGAGAAG；

R18：CTTCTCAAGCTTTCTTGCAGGTCTGTTGTTGATGAGAAGGC；

(19)F19：GCAGACCTGCAAGAAAGATTGAGAAGTAAAGACGGCGATT；

R19：AATCGCCGTCTTTACTTCTCAATCTTTCTTGCAGGTCTGC；

The underlined sections indicate the mutated amino acid positions.

II, construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with the inactivated baculovirus transfer vector pVL1393 digested by BamH I and EcoR I using recombinase (pEASY-Uni nucleic Cloning and Assembly Kit). Transforming the recombinant product into an escherichia coli competent cell TOP10, selecting a colony for culture, upgrading the plasmid, carrying out BamHI and EcoRI double enzyme digestion on a recombinant plasmid (recombinant transfer vector) pVL-OvIFN-alpha-S-C-O-M1, carrying out 1% agarose gel electrophoresis, and separating 2 fragments, wherein the small fragment is positioned between 500 and 750bp and is consistent with the 588bp size of a target gene fragment, and the large fragment is positioned above 8000bp and is consistent with 9607bp size of a pVL1393 fragment. The plasmid with correct enzyme restriction identification is sent to Beijing OvIFN-alpha-S-C-O-M1 (S30H, P32L, R57K, Q60A, R63Q, F71L, T76A, V77I, L91F, A94E, N101D, H109R, G118D, T121A, M142A, K158G, T63 178S, A179T and S184R) for nucleotide sequencing. And MegaAlign is used for comparison, the result shows that the sequence is consistent with the originally designed sequence, and the result shows that the sheep alpha-interferon mutant gene is successfully inserted between BamH I and EcoR I in the pVL1393 transfer vector.

III, obtaining, purifying and amplifying recombinant silkworm baculovirus

The recombinant silkworm baculovirus was obtained in the same manner as in example 1, and finally recombinant virus rBmBacmid (OvIFN-. alpha. -S-C-O-M1) containing the target gene was obtained. The purification and amplification method of the recombinant silkworm baculovirus is the same as that of the example 1, and the pure recombinant silkworm baculovirus rBmBacmid (pVL-OvIFN-alpha-S-C-O-M1) is obtained through purification. Infecting the recombinant bombyx mori baculovirus rBmBacmid (OvIFN-alpha-C-O-M1) with the normally growing BmN cells, culturing for 3 days, and collecting the supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-alpha-S-C-O-M1).

IV, sheep alpha interferon mutant is expressed in silkworm body (same as example 1)

Detection of antiviral activity of V, sheep alpha-type interferon mutant protein

The detection method was the same as in example 1.

The result is observed under an inverted fluorescence microscope, the cell growth state in the cell control group is good, and no fluorescence appears; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant sheep alpha interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of sheep alpha-interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to the Reed-Muench method, and obtaining the detection results shown in Table 3, wherein the titer of all sheep alpha-interferon mutants is 4.68 multiplied by 10⁵U/mL～3.98×10⁶U/mL, wherein after 6 sites of P32L, F71L, V77I, H109R, M142A and K158G are mutated, the titer of the expressed sheep alpha interferon is slightly higher than the titer measured by the expression of a conserved sequence of signal peptide mutation, and the titer is unchanged or even reduced after the other sites are mutated, which indicates that the mutation of the 6 sites is effective mutation, and the aim of improving the antiviral activity of the OvIFN-alpha-S-C mutant can be achieved. The mutant OvIFN-alpha-S-C-O-F71L has the strongest antiviral effect, the amino acid sequence of the mutant is shown in SEQ ID NO.7, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 8.

TABLE 3 detection results of antiviral activity of single site mutation of recombinant ovine interferon-alpha

Example 4 expression and detection of OvIFN-. alpha. -S-C-O-M1 mutant after amino acid double-site mutagenesis in silkworm bioreactor

Construction of sheep alpha-interferon mutant gene

In view of the results of example 3, it was confirmed that the mutation at a partial site is a potent mutation, and the objective of improving the antiviral activity of the OvIFN-. alpha. -S-C mutant was achieved. Considering that the sequence of amino acids is the primary structure of the protein and determines the higher order structure of the protein, and that the positions of the partial mutation sites in the single-site amino acid mutation performed in example 3 may be correlated with each other, two-site amino acid mutation was attempted. The invention combines single mutation sites P32L, F71L, V77I, H109R, M142A and K158G with improved antiviral activity in pairs to carry out double-site mutation, wherein the double-site mutation is carried out on the basis of the single-site mutation sequence obtained in the example 3, and the double-site mutation is carried out on the second site-directed mutation by using the single-site mutation sequence (OvIFN-alpha-S-C-O-M1) as a template and using a corresponding primer (see the example 3 for details) through a fusion PCR method, so that a target fragment of the double-site mutation is obtained.

The double mutation sites are 15 combinations of P32L-H109R, P32L-F71L, P32L-F77L, P32L-M142A, P32L-K158G, F71L-V77I, F71L-H109R, F71L-M142A, F71L-K158G, V77I-H109R, V77I-M142A, V77I-K158G, H109R-M142A, H109R-K158G and M142A-K158G, and the obtained sheep alpha interferon mutants are named as OvIFN-alpha-S-O-M1-M2 (P32L-H109R, P32L-F71L, P32-F32L-F72, P32-F72-P77L-F L, P L-V L-F L-M L, V L-F L, V L-L and V L-L.

II, construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with the inactivated baculovirus transfer vector pVL1393 digested simultaneously with BamH I and EcoR I by using recombinase (pEASY-Uni nucleic Cloning and amplification Kit). Transforming the recombinant product into an escherichia coli competent cell TOP10, selecting a colony for culture, upgrading the plasmid, carrying out BamHI and EcoRI double enzyme digestion on a recombinant plasmid (a recombinant transfer vector) pVL-OvIFN-alpha-S-C-O-M1-M2, carrying out 1% agarose gel electrophoresis, and separating 2 fragments, wherein the small fragment is located between 500 and 750bp and is consistent with the 588bp size of a target gene fragment, and the large fragment is located above 8000bp and is consistent with 9607bp size of the pVL1393 fragment. The plasmid with correct enzyme restriction identification is sent to Beijing Optimalaceae New Biotechnology Limited for nucleotide sequencing, and the plasmid with correct sequencing is named as pVL-OvIFN-alpha-S-C-O-M1-M2 (P32L-H109R, P32L-F71L, P32L-F77L, P32L-M142A, P32L-K158G, F71L-V77I, F71L-H109R, F71L-M142A, F71L-K158G, V77I-H109R, V77I-M142A, V77I-K158G, H109R-M142A, H109R-K158G, M142A-K158G). And MegaAlign is used for comparison, the result shows that the sequence is consistent with the originally designed sequence, and the result shows that the sheep alpha-interferon mutant gene is successfully inserted between BamH I and EcoR I in the pVL1393 transfer vector.

III, obtaining, purifying and amplifying recombinant silkworm baculovirus

The recombinant bombyx mori baculovirus was obtained in the same manner as in example 1, and finally, recombinant virus rBmBacmid (OvIFN-. alpha. -S-C-O-M1-M2) containing the target gene was obtained. The purification and amplification method of the recombinant silkworm baculovirus is the same as that of the example 1, and the purified recombinant silkworm baculovirus rBmBacmid (OvIFN-alpha-S-C-O-M1-M2) is obtained. Infecting the recombinant bombyx mori baculovirus rBmBacmid (OvIFN-alpha-S-C-O-M1-M2) with the normally growing BmN cells, culturing for 3 days, and collecting supernatant, wherein the supernatant contains a large amount of the recombinant virus rBmBacmid (OvIFN-alpha-S-C-O-M1-M2).

IV, sheep alpha interferon mutant is expressed in silkworm body (same as example 1)

Detection of antiviral activity of V, sheep alpha-type interferon mutant protein

The detection method was the same as in example 1.

The result is observed under an inverted fluorescence microscope, the cell growth state in the cell control group is good, and no fluorescence appears; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant sheep alpha interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of sheep alpha-interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to the Reed-Muench method, and obtaining the detection results shown in Table 4, wherein the titer of all sheep alpha-interferon mutants is 5.62 multiplied by 10⁵U/mL～5.01×10⁶U/mL, wherein P32L-K158G, F71L-V77IAfter three groups of double mutations of H109R-K158G, the titer of the expressed sheep alpha interferon is slightly higher than the titer measured by expression of a conserved sequence and a single mutation sequence, and the titer is unchanged or even reduced after mutation of other sites of the groups, which indicates that the mutation of the 3 combined sites is effective mutation and can achieve the purpose of improving the antiviral activity of the OvIFN-alpha-S-C-O-M1 mutant. The mutant OvIFN-alpha-S-C-O-F71L-V77I has the strongest antiviral effect, the amino acid sequence of the mutant is shown as SEQ ID NO.9, and the nucleotide sequence of the coding gene of the mutant is shown as SEQ ID NO. 10.

TABLE 4 detection results of the antiviral activity of the recombinant ovine interferon-alpha double site mutation

Example 5 expression and detection of OvIFN-. alpha. -S-C-O-M1-M2 mutant after Multi-site mutation of amino acids in silkworm bioreactor

Construction of sheep alpha-interferon mutant gene

In view of the results of example 4, it is assumed that the amino acid sequence is the primary structure of the protein and determines the higher structure of the protein, and that the amino acid multiple site mutation is attempted because the positions of the partial mutation sites of the amino acid single site mutation are closely related to each other. The invention combines the obtained double mutation sites with high titer to determine a third mutation site, and the multi-site mutation is based on the double-site mutation sequence obtained in example 4, takes the (OvIFN-alpha-S-C-O-M1-M2) as a template, and utilizes corresponding primers (see example 3 for details) to perform the third site-directed mutation by a fusion PCR method, thereby obtaining the target fragment of the multi-site mutation.

The following 8 combinations were obtained: P32L-F71L-K158G, P32L-F71L-K158G, P32L-H109R-K158G, P32L-F71L-V77I, F71L-V77I-K158G, F71L-V77I-H109R, F71L-H109R-K158G, and V77I-H109R-K158G. The obtained sheep interferon-alpha mutant is named as OvIFN-alpha-S-C-O-M1-M2-M3 (P32L-F71L-K158G, P32L-F71L-K158G, P32L-H109R-K158G, P32L-F71L-V77I, F71L-V77I-K158G, F71L-V77I-H109R, F71L-H109R-K158G, V77I-H109R-K158G) mutant.

II, construction of recombinant baculovirus transfer vectors

The target fragment recovered by the glass milk method was homologously recombined with the inactivated baculovirus transfer vector pVL1393 digested by BamH I and EcoR I using recombinase (pEASY-Uni nucleic Cloning and Assembly Kit). Transforming the recombinant product into an escherichia coli competent cell TOP10, selecting a colony for culture, upgrading the plasmid, carrying out BamH I and EcoR I double enzyme digestion on a recombinant plasmid (recombinant transfer vector) pVL-OvIFN-alpha-S-C-O-M1-M2-M3, carrying out 1% agarose gel electrophoresis, and separating 2 fragments, wherein the small fragment is located between 500 and 750bp and is consistent with the 588bp size of a target gene fragment, and the large fragment is located above 8000bp and is consistent with 9607bp size of the pVL1393 fragment. The correctly identified recombinant plasmid is sent to Beijing OvIFN-alpha-S-C-O-M1-M2-M3 (P32L-F71L-K158G, P32L-V77I-K158G, P32L-H109R-K158G, P32L-F71L-V77I, F71L-V77I-K158G, F71L-V77I-H109R, F71L-H109R-K158G and V77I-H109R-K158G) for sequencing, and the correctly sequenced plasmid is named. And MegaAlign is used for comparison, the result shows that the sequence is consistent with the originally designed sequence, and the result shows that the sheep alpha-interferon mutant gene is successfully inserted between BamH I and EcoR I in the pVL1393 transfer vector.

III, obtaining, purifying and amplifying recombinant silkworm baculovirus

The recombinant silkworm baculovirus was obtained in the same manner as in example 1, and finally, rBm-Bacmid (OvIFN-. alpha. -S-C-O-M1-M2-M3) which is a recombinant virus containing a target gene was obtained. The purification and amplification method of the recombinant silkworm baculovirus is the same as that of the example 1, and the purified recombinant silkworm baculovirus rBm-Bacmid (OvIFN-alpha-S-C-O-M1-M2-M3) is obtained through purification. The recombinant bombyx mori baculovirus rBm-Bacmid (OvIFN-alpha-S-C-O-M1-M2-M3) is infected with the normal growth BmN cells, and after 3 days of culture, the supernatant is collected, and the supernatant contains a large amount of recombinant virus rBm-Bacmid (OvIFN-alpha-S-C-O-M1-M2-M3).

IV, sheep alpha interferon mutant is expressed in silkworm body (same as example 1)

Detection of antiviral activity of V, sheep alpha-type interferon mutant protein

The detection method was the same as in example 1.

The result is observed under an inverted fluorescence microscope, the cell growth state in the cell control group is good, and no fluorescence appears; cells infected with virus in the control group are diseased, most cells show fluorescence, and cells added with the recombinant sheep alpha interferon protein have the capacity of resisting virus infection. Observing the pathological change degree of the cells according to the protective effect of sheep alpha-interferon on Vero cells, marking the cells as "+" when green fluorescent cells appear, calculating the interferon titer according to the Reed-Muench method, and obtaining the detection results shown in Table 5, wherein the titer of all sheep alpha-interferon mutants is 1.38 multiplied by 10⁶U/mL～6.31×10⁶U/mL, wherein after the F71L-V77I-K158G three-site mutation, the titer of the expressed sheep alpha interferon is far higher than the titer measured by the expression of a conserved sequence, a single mutation sequence and a double mutation sequence, and is 1.26 multiplied by 10⁷U/mL. The titer is unchanged or even reduced after mutation of other groups of sites, which indicates that the mutation of the combined site is effective mutation and can achieve the purpose of improving the antiviral activity of the OvIFN-alpha-S-C-O-M1-M2 mutant. The amino acid sequence of the OvIFN-alpha-S-C-O-F71L-V77I-K158G mutant is shown as SEQ ID NO.11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 12.

TABLE 5 detection results of antiviral activity of recombinant sheep interferon-alpha by multi-site mutation

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Zhejiang Shanxi Shi biological science and technology Co Ltd

<120> sheep alpha interferon mutant and preparation method and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 195

<212> PRT

<213> OvIFN-α

<400> 1

Met Ala Gln Leu Leu Pro Leu Leu Thr Ala Leu Val Leu Cys Ser Tyr

1 5 10 15

Gly Pro Val Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Leu Lys Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu

50 55 60

Val Val Asn Gly Ser Gln Phe Gln Lys Asn Gln Thr Val Ser Val Leu

65 70 75 80

His Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser

85 90 95

Ser Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu

100 105 110

His Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly

115 120 125

Glu Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys

130 135 140

Arg Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser

145 150 155 160

Gly Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser

165 170 175

Ser Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu

180 185 190

Ala Ser Pro

195

<210> 2

<211> 588

<212> DNA

<213> OvIFN-α

<400> 2

atggcccagc tactccctct gctgacggcc ctggtgctgt gcagctatgg ccctgttgga 60

tctctgggct gtgacctgcc ccacaactct gcccctctga gcaggtcgac cttggtgctt 120

ctggaccaga tgaggagggt ctcccctgtc ttgtgtctca aggacagaag agacttccag 180

ttcccgcggg aggtggtgaa cggcagccag ttccagaaga accagaccgt gtctgtcctg 240

cacgagatgc tgcagcagat cttcaacctc ctccacacag cgcgctcctc tgctgcctgg 300

aacaacaccc tcctggagga actgcacact gcacttcatc agcagctgca aggcctggag 360

acctgcttgg tacaggccat gggagaggaa gactctgtcc tgacagctga cagcccaacg 420

ctgatgctga agaggtactt ccagagaatc cgtctctacc tggacgagaa gaaacacagt 480

ggctgtgcct gggaactcgt cagaatggag atcaggagag ccttctcctc aacagcagac 540

ttgcaggaaa gcttaagaag caaggatgga gacctggcgt caccttga 588

<210> 3

<211> 195

<212> PRT

<213> OvIFN-α-S

<400> 3

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

1 5 10 15

Gly Pro Gly Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Leu Lys Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu

50 55 60

Val Val Asn Gly Ser Gln Phe Gln Lys Asn Gln Thr Val Ser Val Leu

65 70 75 80

His Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser

85 90 95

Ser Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu

100 105 110

His Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly

115 120 125

Glu Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys

130 135 140

Arg Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser

145 150 155 160

Gly Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser

165 170 175

Ser Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu

180 185 190

Ala Ser Pro

195

<210> 4

<211> 588

<212> DNA

<213> OvIFN-α-S

<400> 4

atggctttcg tcctctccct gttgatggcc ctcgtcctgg tgtcttacgg acctggtgga 60

agcctgggct gtgacctgcc ccacaactct gcccctctga gcaggtcgac cttggtgctt 120

ctggaccaga tgaggagggt ctcccctgtc ttgtgtctca aggacagaag agacttccag 180

ttcccgcggg aggtggtgaa cggcagccag ttccagaaga accagaccgt gtctgtcctg 240

cacgagatgc tgcagcagat cttcaacctc ctccacacag cgcgctcctc tgctgcctgg 300

aacaacaccc tcctggagga actgcacact gcacttcatc agcagctgca aggcctggag 360

acctgcttgg tacaggccat gggagaggaa gactctgtcc tgacagctga cagcccaacg 420

ctgatgctga agaggtactt ccagagaatc cgtctctacc tggacgagaa gaaacacagt 480

ggctgtgcct gggaactcgt cagaatggag atcaggagag ccttctcctc aacagcagac 540

ttgcaggaaa gcttaagaag caaggatgga gacctggcgt caccttga 588

<210> 5

<211> 195

<212> PRT

<213> OvIFN-α-S-C-O

<400> 5

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

1 5 10 15

Gly Pro Gly Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Leu Gln Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu

50 55 60

Val Val Asn Gly Ser Gln Phe Gln Lys Asn Gln Thr Val Ser Val Leu

65 70 75 80

His Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser

85 90 95

Ser Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu

100 105 110

His Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly

115 120 125

Glu Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys

130 135 140

Arg Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser

145 150 155 160

Gly Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser

165 170 175

Ser Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu

180 185 190

Ala Ser Pro

195

<210> 6

<211> 588

<212> DNA

<213> OvIFN-α-S-C-O

<400> 6

atggctttcg tcctctccct gttgatggcc ctcgtcctgg tgtcttacgg acctggtgga 60

agcctgggct gcgacttgcc acacaactct gctcctctga gtagatcaac tttggtgttg 120

ctcgatcaaa tgagaagagt ttcgccggtc ttgtgtctcc aggacagaag agatttccag 180

ttcccccggg aagtggttaa cggttctcaa ttccagaaga atcagaccgt gagcgttctc 240

cacgaaatgc tgcaacagat tttcaacctc ctccacaccg cgagatcatc tgctgcctgg 300

aacaataccc tgttggaaga attgcacaca gccctccacc aacagctgca aggcctggaa 360

acctgcctcg tgcaggctat gggtgaagaa gactccgttc tgacagctga ttcgcctact 420

ctgatgttga aaagatactt ccaaagaata agactctacc tggacgaaaa gaaacacagc 480

ggttgtgctt gggaacttgt gagaatggaa atcagaagag ccttctcatc aacagcagac 540

ctgcaagaaa gcttgagaag taaagacggc gatttggctt caccgtaa 588

<210> 7

<211> 195

<212> PRT

<213> OvIFN-α-S-C-O-F71L

<400> 7

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

1 5 10 15

Gly Pro Gly Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Leu Gln Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu

50 55 60

Val Val Asn Gly Ser Gln Leu Gln Lys Asn Gln Thr Val Ser Val Leu

65 70 75 80

His Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser

85 90 95

Ser Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu

100 105 110

His Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly

115 120 125

Glu Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys

130 135 140

Arg Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser

145 150 155 160

Gly Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser

165 170 175

Ser Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu

180 185 190

Ala Ser Pro

195

<210> 8

<211> 588

<212> DNA

<213> OvIFN-α-S-C-O-F71L

<400> 8

atggctttcg tcctctccct gttgatggcc ctcgtcctgg tgtcttacgg acctggtgga 60

agcctgggct gcgacttgcc acacaactct gctcctctga gtagatcaac tttggtgttg 120

ctcgatcaaa tgagaagagt ttcgccggtc ttgtgtctcc aggacagaag agatttccag 180

ttcccccggg aagtggttaa cggttctcaa ttgcagaaga atcagaccgt gagcgttctc 240

cacgaaatgc tgcaacagat tttcaacctc ctccacaccg cgagatcatc tgctgcctgg 300

aacaataccc tgttggaaga attgcacaca gccctccacc aacagctgca aggcctggaa 360

acctgcctcg tgcaggctat gggtgaagaa gactccgttc tgacagctga ttcgcctact 420

ctgatgttga aaagatactt ccaaagaata agactctacc tggacgaaaa gaaacacagc 480

ggttgtgctt gggaacttgt gagaatggaa atcagaagag ccttctcatc aacagcagac 540

ctgcaagaaa gcttgagaag taaagacggc gatttggctt caccgtaa 588

<210> 9

<211> 194

<212> PRT

<213> OvIFN-α-S-C-O-F71L-V77I

<400> 9

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

1 5 10 15

Gly Pro Gly Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Gln Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu Val

50 55 60

Val Asn Gly Ser Gln Leu Gln Lys Asn Gln Thr Val Ser Val Leu His

65 70 75 80

Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser Ser

85 90 95

Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu His

100 105 110

Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly Glu

115 120 125

Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys Arg

130 135 140

Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser Gly

145 150 155 160

Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser Ser

165 170 175

Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu Ala

180 185 190

Ser Pro

<210> 10

<211> 588

<212> DNA

<213> OvIFN-α-S-C-O-F71L-V77I

<400> 10

atggctttcg tcctctccct gttgatggcc ctcgtcctgg tgtcttacgg acctggtgga 60

agcctgggct gcgacttgcc acacaactct gctcctctga gtagatcaac tttggtgttg 120

ctcgatcaaa tgagaagagt ttcgccggtc ttgtgtctcc aggacagaag agatttccag 180

ttcccccggg aagtggttaa cggttctcaa ttgcagaaga atcagaccat cagcgttctc 240

cacgaaatgc tgcaacagat tttcaacctc ctccacaccg cgagatcatc tgctgcctgg 300

aacaataccc tgttggaaga attgcacaca gccctccacc aacagctgca aggcctggaa 360

acctgcctcg tgcaggctat gggtgaagaa gactccgttc tgacagctga ttcgcctact 420

ctgatgttga aaagatactt ccaaagaata agactctacc tggacgaaaa gaaacacagc 480

ggttgtgctt gggaacttgt gagaatggaa atcagaagag ccttctcatc aacagcagac 540

ctgcaagaaa gcttgagaag taaagacggc gatttggctt caccgtaa 588

<210> 11

<211> 195

<212> PRT

<213> OvIFN-α-S-C-O-F71L-V77I-K158G

<400> 11

Met Ala Phe Val Leu Ser Leu Leu Met Ala Leu Val Leu Val Ser Tyr

1 5 10 15

Gly Pro Gly Gly Ser Leu Gly Cys Asp Leu Pro His Asn Ser Ala Pro

20 25 30

Leu Ser Arg Ser Thr Leu Val Leu Leu Asp Gln Met Arg Arg Val Ser

35 40 45

Pro Val Leu Cys Leu Gln Asp Arg Arg Asp Phe Gln Phe Pro Arg Glu

50 55 60

Val Val Asn Gly Ser Gln Leu Gln Lys Asn Gln Thr Val Ser Val Leu

65 70 75 80

His Glu Met Leu Gln Gln Ile Phe Asn Leu Leu His Thr Ala Arg Ser

85 90 95

Ser Ala Ala Trp Asn Asn Thr Leu Leu Glu Glu Leu His Thr Ala Leu

100 105 110

His Gln Gln Leu Gln Gly Leu Glu Thr Cys Leu Val Gln Ala Met Gly

115 120 125

Glu Glu Asp Ser Val Leu Thr Ala Asp Ser Pro Thr Leu Met Leu Lys

130 135 140

Arg Tyr Phe Gln Arg Ile Arg Leu Tyr Leu Asp Glu Lys Lys His Ser

145 150 155 160

Gly Cys Ala Trp Glu Leu Val Arg Met Glu Ile Arg Arg Ala Phe Ser

165 170 175

Ser Thr Ala Asp Leu Gln Glu Ser Leu Arg Ser Lys Asp Gly Asp Leu

180 185 190

Ala Ser Pro

195

<210> 12

<211> 588

<212> DNA

<213> OvIFN-α-S-C-O-F71L-V77I-K158G

<400> 12

atggctttcg tcctctccct gttgatggcc ctcgtcctgg tgtcttacgg acctggtgga 60

agcctgggct gcgacttgcc acacaactct gctcctctga gtagatcaac tttggtgttg 120

ctcgatcaaa tgagaagagt ttcgccggtc ttgtgtctcc aggacagaag agatttccag 180

ttcccccggg aagtggttaa cggttctcaa ttgcagaaga atcagaccat cagcgttctc 240

cacgaaatgc tgcaacagat tttcaacctc ctccacaccg cgagatcatc tgctgcctgg 300

aacaataccc tgttggaaga attgcacaca gccctccacc aacagctgca aggcctggaa 360

acctgcctcg tgcaggctat gggtgaagaa gactccgttc tgacagctga ttcgcctact 420

ctgatgttga aaagatactt ccaaagaata agactctacc tggacgaaaa gggccacagc 480

ggttgtgctt gggaacttgt gagaatggaa atcagaagag ccttctcatc aacagcagac 540

ctgcaagaaa gcttgagaag taaagacggc gatttggctt caccgtaa 588

Claims (7)

1. A sheep interferon-alpha mutant, which is characterized in that: mutation of lysine K into glutamine Q at 54 th amino acid of the sheep alpha interferon mutant with the amino acid sequence of SEQ ID NO.3 to obtain a mutant;

the amino acid sequence of the mutant is shown in SEQ ID NO.5, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 6.

2. A sheep interferon-alpha mutant, which is characterized in that: the mutant obtained by subjecting the ovine interferon-alpha mutant of claim 1 to any one of amino acid single-site mutations of S30H, P32L, R57K, Q60A, R63Q, F71L, T76A, V77I, L91F, A94E, N101D, H109R, G118D, T121A, M142A, K158G, T178S, A179T or S184R.

3. A sheep interferon-alpha mutant, which is characterized in that: the mutant of sheep interferon-alpha of claim 1 is subjected to any one of amino acid double-site mutation of P32L-H109R, P32L-F71L, P32L-V77I, P32L-M142A, P32L-K158G, F71L-V77I, F71L-H109R, F71L-M142A, F71L-K158G, V77I-H109R, V77I-M142A, V77I-K158G, H109R-M142A, H109R-K158G or M142A-K158G.

4. A sheep interferon-alpha mutant, which is characterized in that: the mutant of the sheep interferon-alpha of claim 1 is subjected to mutation of any one amino acid of P32L-F71L-K158G, P32L-V77I-K158G, P32L-H109R-K158G, P32L-F71L-V77I, F71L-V77I-K158G, F71L-V77I-H109R, F71L-H109R-K158G or V77I-H109R-K158G at multiple sites.

5. A recombinant vector or a recombinant host cell comprising a gene encoding the sheep alpha interferon mutant of any one of claims 1 to 4.

6. Use of the mutant ovine interferon alpha according to any one of claims 1 to 4 for the manufacture of a medicament for the treatment of a disease caused by infection with a vesicular stomatitis virus.

7. A method for preparing the sheep alpha interferon mutant of any one of claims 1 to 4, comprising the steps of:

(1) cloning the coding genes of the sheep alpha interferon mutant of any one of claims 1 to 4 into a baculovirus transfer vector to construct a recombinant transfer vector;

(2) co-transfecting the recombinant transfer vector and the baculovirus to the insect cell to obtain a recombinant baculovirus;

(3) infecting insect cells or insect hosts with the recombinant baculovirus, culturing the infected insect cells or insect hosts to express corresponding proteins, and purifying to obtain the recombinant baculovirus;

wherein the baculovirus transfer vector is selected from AcRP23-lacZ、AcRP6-SC、AcUWl-lacZ、BacPAK6、Bac to Pac、Bacmid、p2Bac、p2Blue、p89B310、pAc360、pAc373、pAcAB3、pAcAB 4、PAcAS3、pAcC129、pAcC4、DZI、pAcGP67、pAcIEl、pAcJPl、pAcMLF2、pAcMLF 7、pAcMLF 8、pAcMPl、pAcMP2、pAcRP23、pAcRP 25、pAcRW4、pAcsMAG、pAcUWl、pAcUW21、pAcUW2A、pAcUW2B、pAcUW3、pAcUW31、pAcUW41、pAcUW42、pAcUW43、pAcUW51、pAcVC2、pAcVC 3、pAcYMl、pAcJcC5、pBacl、pBac2、pBlueBacIII、pBlueBacHis、pEV55、mXIV、pIEINeo、pJVETL、pJVNhel、pJVP10、pJVrsMAG. pMBac, pP10, pPAKl, pPBac, pSHONEX 1.1, pSYN XIV VI +, pSYNVI + wp, pSYNXIV VI-, pVL1391, pVL 1392, pVL1393, pVL941, pVL 945, pVL 985, pVTBac, pBM030 or pUAC-5;

the baculovirus is selected from bombyx mori baculovirus parent strain BmBacmid, BmNPV, AcMNPV, ApNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV or SpltNPV;

the insect host is selected from Bombyx moriBombyx mori) Wild silkworm (wild silkworm)Bombyx mandarina) Castor silkworm (1)Philosamia cynthia ricim) Antrodia camphorata (A, B, D)Dictyoplocajapanica) Heaven silkworm (A. F.) (Philosamia cynthiapryeri) Tussah, tussah (Antheraeapernyi) Japanese tussah (A.pernyi)Antheraeayamamai) Wild silkworm (wild silkworm)Antheraea polyphymus) Alfalfa loopers (a) ((b))Atogra pha califorica) Tea geometrid inchworm (Ectropis obliqua) And Spodoptera glauca (L.) MoenchMamestra brassicae) (ii) Spodoptera lituraSpodoptera littoralis) Autumn armyworm (Spodopterafrugiperda) Powder looper (A, B)Trichoplusia ni) Marching insects (A)Thaumetopoea wilkinsoni) Cotton bollworm: (A)Heliothis armigera) American bollworm: (Heliothiszea) "YeqingchongHeliothis assulta) Tobacco budworm (2)Heliothis virescens) Oriental armyworm (Pseudaletia separata) Or gypsy mothLymantria dispar)；

The infection refers to the infection of 1-5-year-old insect larvae or pupae bodies by the recombinant baculovirus through ingestion or penetration of the epidermis.

Images