WO2008116368A1

WO2008116368A1 - A method for preparing antigens of foot-and-mouth disease virus

Info

Publication number: WO2008116368A1
Application number: PCT/CN2008/000126
Authority: WO
Inventors: Jixing Liu; Zhifang Zhang; Zhiyong Li; Yongzhu Yi; Xiangping Yin; Yinmei Bai; Yinv Li; Baoyu Li; Xuerui Li; Bin Yang; Xi Lan; Guifang Shen
Original assignee: Lanzhou Veterinary Research Institute Chinese Academy Of Agricultural Sciences; Biotechnology Research Institute Chinese Academy Of Agricultural Sciences
Priority date: 2007-03-23
Filing date: 2008-01-17
Publication date: 2008-10-02
Also published as: CN101121938B; GB2463783B; GB2463783A; CN101121938A; GB0916723D0

Abstract

A method for expressing antigens of foot-and-mouth disease virus in insect in vivo by using recombinant baculovirus is disclosed, which comprises: cloning different genes combination of foot-and-mouth disease virus into baculovirus carrying vector to construct transfer vector, transfecting baculovirus with the transfer vector to proceed DNA recombination, and thus to get recombinant baculovirus, infecting insect host with the recombinant baculovirus, culturing the infected insect host to express the antigens of foot-and-mouth disease virus, and then collecting and purifying the expressed antigens. The preferred genes, baculovirus carrying vector, baculovirus and insect host are selected from P1-2A3C, ORF and VP1 genes of foot-and-mouth disease virus as shown in SEQ ID NO 1, 3 or 5, pVL1393, Bombyx mori Bm-NPV-ZJ8 and larvae or pupa of Bombyx mori, respectively.

Description

Method for preparing foot-and-mouth disease antigen

The invention relates to a method for preparing an antigen, in particular to a method for expressing a foot-and-mouth disease antigen in an insect by using a recombinant baculovirus, and belongs to the field of genetic engineering. Background technique

Foot-and-mouth disease is an acute, highly-contact, febrile infectious disease caused by Foot-and-mouth disease virus (FMDV), which is known for its rapid spread and high infection rate. Once the disease erupts, it will cause huge economic losses to the country of incidence. Countries around the world attach great importance to the study of the disease, and the International Veterinary Bureau ranks it as the first class A infectious disease. Foot-and-mouth disease is a member of the foot-and-mouth disease virus family of the small RNA virus family. There are 7 serotypes of A, 0, C, Asia I, SA T1, SA T2 and SA T3. At present, the prevention and control of foot-and-mouth disease in China is still based on prevention. Although traditional vaccines still dominate the prevention and control of foot-and-mouth disease, the production costs are high, the immunization period is short, and risk factors such as virus escape during vaccine preparation are difficult to avoid. Therefore, traditional vaccines need to be improved, and it is still necessary to develop a safe and effective molecular vaccine for foot-and-mouth disease.

With the development of high-tech such as biotechnology and genetic engineering, people realize that the use of bioreactors to efficiently express foot-and-mouth disease genes through genetic engineering is expected to greatly increase the production of foot-and-mouth disease antigens and reduce production costs (Conneely OM). , Biotechnology in the Feed Industry, TP Lyons ( Ed ) , Alltech Technical Publications. Nicholasville, K Y. 57-66, 1992 ).

The Roxvirus Expression System, a bioreactor, was established in the 1980s. Since the first significant use of the baculovirus expression system in 1983 to express human alpha-interferon (Smith, Mol. Cell Biol" 3: 2156-2165, 1983), dozens of foreign genes have been efficiently expressed, In China alone, there are α-interferons (Yang Guanzhen et al., Journal of Biochemistry and Biophysics, 22: 355-361, 1990), and mushroom protease inhibitors (Ji et al., Sericulture Science, 21: 223-227, 1995). Marek's virus glycoprotein Β (Xiao Qingli et al., Sericulture Science, 23: 104-108, 1997), etc. The advantages of using this system to produce foot-and-mouth disease antigens are: 1. The expression system is highly efficient, yielding Up to the level of 10 mg/worm. It can greatly reduce the production cost of foot-and-mouth disease antigen and make it possible to mass-produce the foot-and-mouth disease antigen by genetic engineering. 2. This expression system is a eukaryotic expression system, and its expression is exogenous. The protein can be post-translationally modified to provide a biochemical shield and biological activity similar to natural products, which provides a normal protein structure and biological immunological activity for the expressed foot-and-mouth disease antigen. At present, the baculovirus expression system, especially the silkworm (Bm)-Bomworm baculovirus (BmNPV) expression system, is the world's most commercially valuable eukaryotic organism. One of the expression systems. Summary of the invention

The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and to provide a method for safely and efficiently expressing foot-and-mouth disease antigen in insects using a baculovirus expression system.

The technical problem to be solved by the present invention is achieved by the following technical solutions:

A method for preparing a foot-and-mouth disease antigen comprises: cloning a different gene combination of foot-and-mouth disease into a baculovirus carrier to obtain a transfer vector; transfecting the baculovirus with the obtained transfer vector for DNA recombination to obtain a recombinant baculovirus Infecting an insect host with a recombinant baculovirus; culturing the infected insect host for expression of foot-and-mouth disease antigen; harvesting and purifying the expressed antigen.

Wherein the different gene combinations of the foot-and-mouth disease are preferably the base sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5;

The baculovirus carrier is preferably selected from the group consisting of AcRP23-/acZ, AcRP6-SC, AcUWl-/acZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB 4, PAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIEl, pAcJPl, pAcMLF2, pAcMLF 7, pAcMLF 8, pAcMPK pAcMP2, pAcRP23, pAcRP 25, pAcRW4, pAcsMAG, pAcUWK pAcUW21, pAcUW2A, pAcUW2B, pAcUW3, pAcUW31, pAcUW41, pAcUW42 , pAcUW43, pAcUW51, pAcVC2, pAcVC 3, pAcYMl, pAcJcC5, pBacL pBac2, pBlueBacIII, pBlueBacHis, pEV55, mXIV, pIEINeo, pJVETL, pJVNhel, pJVPIO, pJVrsMAG, pMBac, pPIO, pPAKl, pPBac, pSHONEX 1.1, pSYN XIV VI+, pSY VI+wp, pSY XIV VI-, pVL1391, pVL 1392, pVL 1393, pVL941, pVL 945, pVL 985, pVTBac, pBM030, pUAC-5 or other similar baculovirus homologous recombination or transposition vector, more preferably For pVL1393.

The transfer vector constructed is preferably pVL1393 (P1-2A3C)>pVL1393 (ORF) or pVL1393 (VP1).

The baculovirus is selected from the group consisting of BmNPV, AcMNPV, ApNPV, BsSNPV, CfM PV, EoSNPV, HaNPV HzNPV, LdMNPV, MbMNPV, OpMNPV S1MNPV, SeMNPV, or TeNPV, preferably Bombyx mori Bm-NPV-ZJ8;

The recombinant baculovirus is preferably any one of the following: (1) Recombinant Bombyx mori nuclear polyhedrosis virus rBm PV (ORF), the microbial deposit number is: CGMCC NO. 1980; The preservation time is: March 20, 2007 The deposit unit is: General Microbiology Center of China Microbial Culture Collection Management Committee; The address is: No.13, Zhongguancun, Haidian District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences; (2) Recombinant Bombyx mori nuclear polyhedrosis virus rBmNPV (P1-2A3C), the microbial deposit number is: CGMCC NO.1979; : General Microbiology Center of China Microbial Culture Collection Management Committee; The preservation address is: No.13, Zhongguancun, Haidian District, Beijing, China; Institute of Microbiology, Chinese Academy of Sciences; (3) Recombinant Bombyx mori nuclear polyhedrosis virus rBmNPV (VP1), its microbial preservation No.: CGMCC NO.1975; The depositary is: General Microbiology Center of China Microbial Culture Collection Management Committee; The deposit address is: No. 13, North Section of Zhongguancun, Haidian District, Beijing, China Institute of Microbiology, Chinese Academy of Sciences.

The insect host is selected from the group consisting of Bombyx mori, Bombyx mandarina, Philosamia cynthia ricim, Dictyoploca japanica, Philosamia cynthia pryeri, Antheraea pernyi, Japanese tussah (Antheraea yamamai), Antheraea polyphymus, Atographa califorica, Ectropis obliqua, Mamestra brassicae, Spodoptera littoralis, Autumn armyworm ( Spodoptera fmgiperda ), Trichoplusia ni, Thaumetopoea wilkinsoni, Heliothis armigera, Heliothis zea, Heliothis assulta, Heliothis virescens ), Pseudaletia separata, Lymantria dispar, etc.; more preferably Bombyx mori.

The infection refers to a recombinant baculovirus infecting 1-5-year-old insect larvae or corpus callosum by mouth or through the epidermis (more preferably: infecting silkworm cells with recombinant silkworm baculovirus or inoculation 1-5 years old) The silkworm larva or pupa collects body fluid or tissue pulp of the silkworm larva or cockroach containing the foot-and-mouth disease antigen after 3-6 days of infection; wherein the corpus callosum is 1-2 days of early tenderness.

The invention adopts genetic recombination technology to construct different gene combinations derived from foot-and-mouth disease virus, including P1-2A3C, ORF and VP1, into various baculovirus carrier vectors (such as AcRP23-lacZ, AcRP6-SC, AcUWl-lacZ, BacPAK6, Bac to Pac, Bacmid, BlueBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, 373, pAcAB3, 4, pAcAS3, pAcC129, C4, DZ1, pAcGP67, pAcIEl, pAcJPl, pAcMLF2 7, 8, pAcMPl, 2, pAcRP23, 25, pAcRW4, pAcsMAG, pAcUWl, 21, 2A, 2B, 3, 31, 41, 42, 43, 51, pAcVC2, 3, pAcYMl, pAcJcC5, pBacl, 2, pBlueBacIII, pBlueBacHis, pEV55, mXIV, pIEINeo, pJVETL, pJVNhel , p J VP 10, pJVrsMAG, pMBac, pPIO, pPAKl , pPBac, pSHONEX 1.1 , pSYN XIV VI+, pSYNVI+wp, pSYNXIV VI-, pVL1391, 1392, 1393, pVL941, 945, 985, pVTBac, pBM030, pUAC- 5), the different gene combinations of foot-and-mouth disease virus, including ORF, P1-2A3C, VP1 gene under the control of the polyhedrin promoter, plO promoter or other strong promoters of viruses and eukaryotes Recombination in vivo or in vitro (in vivo/in vitro), the different gene combinations of foot-and-mouth disease virus, including P1-2A3C, ORF, VPl, are integrated into the genome of baculovirus to obtain recombinant virus. Recombinant viruses can infect insect larvae or carcasses of 1-5 years (optimally four or five years old) through the epidermis by oral or by various means (optimal time is 1-2 days of early tenderness) ), expressing the production of foot-and-mouth disease virus antigen.

A most preferred technical solution in the present invention is: inserting the base sequence represented by SEQ ID NO: 1 (P1-2A3C), SEQ ID NO: 3 (ORF) or SEQ ID NO: 5 (VPl) into a carrier On pVL1393, the full-length P1-2A3C, ORF, and VP1 genes were transferred to the genome of the silkworm baculovirus parental strain Bm-PV-ZJ8 by in vivo recombination, replacing the Polyhedrin gene on the genome, and screening by plaque screening technique and PCR. Technology, obtaining recombinant silkworm baculovirus rBmNPV (ORF), rBm PV (P1-2A3C), rBmNPV (VPl) with different gene combinations of foot-and-mouth disease. Infecting silkworm cell lines or puncture inoculation of 1-5-year-old silkworm larvae or pupa , multiplication of rBmNPV (ORF), rBmNPV (P1-2A3C) rBmNPV (VPl λ when rBmNPV (ORF), rBmNPV (P1-2A3C), rBmNPV (VPl) replicate in the silkworm, ORF, P1-2A3C, VPl in multiple angles Expression of the body protein gene (polh) under the control of a promoter, producing a foot-and-mouth disease antigen. After 3-6 days of infection (optimally 5 days), the body fluid (or whole homogenate) of the silkworm larva or pupa containing the foot-and-mouth disease antigen is collected, per ml. Silkworm hemolymph can produce 10 milli FMD antigens above, after killing infection pathogens, through protein purification after safe and efficient FMD antigens, such antigens can be used to prepare vaccines.

The method of the invention adopts the baculovirus expression system to safely and efficiently produce the foot-and-mouth disease antigen in the silkworm bioreactor, and the production cost thereof is significantly lower than the traditional method for preparing the foot-and-mouth disease antigen (for example, preparing the foot-and-mouth disease antigen by the cell propagation virus), without investing in the establishment of the plant. There are no three wastes, and energy consumption such as electricity and water resources is extremely low. Since the silkworm has been approved by the Ministry of Health of China as a food-and-disease insect, the antigen prepared by the method of the present invention has high safety and can directly produce a vaccine-immunized animal.

In general, the method of the invention can greatly reduce the production cost of foot-and-mouth disease antigen, and has the advantages of safety, high efficiency, low energy consumption, low cost and the like. DRAWINGS

Figure 1. Expression of foot-and-mouth disease virus P1-2A3C in silkworm larvae;

Figure 2. Expression of foot-and-mouth disease virus P1-2A3C in silkworm pupa;

Figure 3. Expression of the full-length ORF of foot-and-mouth disease virus in silkworm larvae;

Figure 4. Expression of the full-length ORF of foot-and-mouth disease virus in silkworms;

Figure 5. Expression of foot-and-mouth disease virus VP1 in silkworm larvae;

Figure 6. Expression of foot-and-mouth disease virus VP1 in silkworm pupa. detailed description

In order to further illustrate the invention, a series of examples are given below. The examples are intended to be illustrative, and are not to be construed as limiting the invention. experiment material

E. coli TGI and DH _5a were purchased from Promega; carrier vector pVL1393 (purchased from Invitrogen), silkworm cell BmN, Bombyx mori nuclear polyhedrosis virus Bm-PV-ZJ8 by Institute of Biotechnology, Chinese Academy of Agricultural Sciences The foot-and-mouth disease virus was preserved by the National Reference Laboratory for Foot-and-Mouth Disease of Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences; the antigen detection kit was prepared by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, and the silkworm variety JY1 was preserved by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences.

Enzymes and reagents: Restriction enzymes and ligases are products of Promega.

Biochemical reagents: IPTG and X-Gal are products of Promega. As Lipofectin, low melting point agarose LMP, PCR kits, T ₄ DNA ligase, RNA enzyme, Proteinase K, fetal calf serum, and other reagents were purchased from Invitrogen Corporation, cell culture medium TC-100 were purchased from Sigma.

Medium: E. coli medium was LB (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0); the silkworm cell culture medium was TC-100.

5. Animal experiments of different combinations of foot-and-mouth disease virus genes were performed at the Animal Isolation Laboratory of the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. Example 1 Preparation, Purification, Animal Immunization Experiment and Virus Attack Protection Experiment of Foot-and-Mouth Disease Antigen

1. Cloning and sequence analysis of P1-2A and 3C genes

1.1 Acquisition of target genes

The primers were designed to amplify the foot-and-mouth disease virus antigen protein P1-2A gene and the non-structural protein 3C gene by RT-PCR.

The designed primers for the antigenic protein P1-2A gene and the non-structural protein 3C gene are

P1-2A upstream: 5,-ATAGGATCCACCATGGGAGCCGGGCAATCCAGCC-3,,

ΒαπϊΆ I cleavage site

Downstream of PI-2A: 5,- CGCGAATTCTGACATGTCCTCCTGC ATCTGGTTG-3.

EcoR I restriction site

3C upstream: 5 '-GCGGAATTCAAGAAACCTGTCGCTTTGAAAGT-3 '.

EcoR I restriction site 3 C downstream: 5, -ATAAGATCTCTACTCGTGGTGTGGTTCGGGAT-3 '

Bgl ll cleavage site

Total RNA was extracted from the foot-and-mouth disease virus cell culture medium. The extracted total RNA was subjected to 0 0 ((11 ₁₈ primers under the action of AMV reverse transcriptase, reverse transcription at 42 ° C to prepare cDNA. The obtained cDNA was used as a template, and PCR amplification was carried out with a specific antibody.

The PCR reaction system is as follows:

Table 1 PCR reaction conditions

PCR reaction: Denaturation at 94 °C for 10 minutes; 94 °C for 1 minute, 58 °C for 1 minute, and 72 °C for 8 minutes for 30 cycles. Finally, the reaction was extended for 10 minutes.

1.2. Purification of PCR products

The PCR-amplified P1-2A and 3C gene products were subjected to 1% agarose gel electrophoresis, and it was found that a fragment of about 2.4 kb 0.7 kb was amplified. The gel containing the corresponding DNA fragment was cut with a sterilized scalpel under a UV lamp and then purified using a Geneclean kit. The method is as follows: Cut the gel fragment and weigh it, place it in a sterile 1.5 ml small centrifuge tube, add 3 times (v/w) volume of 6 M Nal, dissolve the gel at 37 °C, add 10 Glass milk, mix and leave at room temperature for 5 minutes, allow the DNA to fully adsorb on the glass milk, centrifuge at 12000 rpm for 5 seconds, then wash it three times with New Wash solution, each time the pellet is bounced and centrifuged. . Finally, the precipitate was air-dried, and 30 l of O.l xTE Buffer was added to dissolve the DNA. After centrifugation, the precipitate was removed, and the supernatant was taken for further analysis.

1.3. Digestion and ligation reactions

Digestion reaction: Purified P1-2A was analyzed by double digestion with «7 HI and coRI. The total volume of the reaction was 50 μΐ, of which 10 μΐ of the purified PCR product and 5 μΐ of the corresponding buffer of 10χ enzyme. 1 μ1, sterile water to make up Volume. The reaction was carried out at 37 ° C for 2 hours or more. The transfer plasmid pGEM-3Z was subjected to the same digestion reaction. After the reaction was completed, the mixture was inactivated at 65 ° C for 10 minutes.

Ligation reaction: Total volume of ligation 15 μΐ, PCR product 8 μl, vector 1 μΐ, 5xT4 DNA ligation buffer 3 μl, Τ4 DNA ligase 1 μΐ, make up the volume with sterile water, and connect overnight at 12 ~ 14 °C.

The 3C, pGEM-3Z were digested by the same method, and the ligation reaction was carried out.

1.4. Genetic transformation of E. coli

E. coli TG1 competent cells were prepared with 75 mM CaCl ₂ . Take 5 μΐ of the ligation mixture prepared in step 3, add to 200 μΐ of competent cells, mix gently, bath for 30 minutes, heat at 42 °C for 2 minutes, quickly place on ice for 1-2 minutes, add warm Incubate to LB medium at 37 °C for 500 μΐ, incubate at 37 °C for 1 hour, take 100-200 μΐ, apply to LB solid medium plate containing 100 g/ml ampicillin (Amp), and incubate at 37 °C. overnight.

1.5. Preparation of plasmid DNA

(1) Single colonies were picked from the transformed LB plates, inoculated into 3 ml of LB medium containing 100 g/ml Am, and cultured overnight at 37 °C.

(2) Take ^1.5 ml of the bacterial solution in a small centrifuge tube, centrifuge at 3500 rpm for 4 min, and remove the supernatant.

(3) Add Solution I 150 μΐ, mix and place on ice for 15 min.

(4) Add Solution II 300 μΐ, chloroform 150 μΐ, mix gently and let stand for 5 min.

(5) Add Solution III 450 μΐ, mix and place on ice for 15 min.

(6) Centrifuge at 11000g for 10 minutes, and move the supernatant into a new tube.

(7) Add isopropanol 450 μΐ, mix and place at 4 °C for 15 min.

(8) Centrifuge at HOOOg for 6 min, and remove the supernatant.

(9) Add ΤΕΙ 250 μl, mix and place at 37 °C for 20 min.

(10) Add PP ~ Buffer 300 ~ 350 μΐ, mix and let stand for 15 min.

(11) Centrifuge at 11000 g for 6 min, and remove the supernatant.

(12) Add 75% ethanol 400 μl.

(13) Centrifuge at 11000 g for 3 min, pour off the ethanol, drain and add 0.1 x TE Buffer 40 μl to dissolve at -20. C save.

1.6. Identification of recombinants

The plasmid DNA prepared in 1.5 was double-digested with Bamm/EcoRI, and a plasmid having a DNA band of about 2.4 kb and 0.7 kb after electrophoresis was used as a recombinant carrying plasmid pGEM-3Z (P1-2A). The plasmid DNA prepared in 1.5 was digested with EcoRI/BgiU, and the plasmid with 0.7 kb DNA band after electrophoresis was used as the recombinant carrying plasmid pGEM-3Z. OC The recombinant plasmid pGEM-3Z (P1-2A pGEM-3Z (3C) was subjected to bidirectional sequencing. The P1-2A3C gene sequence and amino acid sequence are shown in SEQ ID ΝΟ: 1 and SEQ ID NO: 2, respectively.

2. Construction of transfer vector pVL1393 ( P1-2A3C )

The plasmid pGEM-3Z (P1-2A) prepared in 1.6 was digested with BamlU and EcoRI, and the P1-2A gene fragment was purified by the method of 1.2, and the baculovirus transfer vector PVL1393 double-digested with Bamm and coRI. After ligation, E. coli TG1 was transformed and the recombinant transfer vector pVL1393 (P1-2A) was selected. The plasmid pGEM-3Z (3C) prepared in 1.6 was digested with EcoRI and Bglli, and the 3C gene fragment was purified by the method of 1.2, and ligated with the baculovirus transfer plasmid pVL1393 (P1-2A) double-digested with coRI and BglU. After transformation of E. coli TG1, the recombinant transfer vector pVL 1393 (P1-2A3C) was screened.

3, Bombyx mori nuclear polyhedrosis virus parent strain Bm-NPV-ZJ8 reproduction and virus DNA preparation

Prepare l xTC-100 medium according to GIBCO product instructions, adjust the pH to 6.22 with 2 N NaOH, and add 10% fetal bovine serum to the culture medium after filtration. The silkworm cell BmN was cultured under C. The silkworm nuclear polyhedrosis virus parent strain Bm-NPV-ZJ8 was used to infect about 50 ml of cells in the logarithmic growth phase, and the infection was collected for 1, 3 to 4 days. The virus infection solution was collected and centrifuged (5000 rpm x lO min) to remove the precipitate. After centrifugation at 25,000 rpm for 1 hour, the supernatant was removed, and 1 ml of virus DNA extract (Tris 12.1 g, EDTA 33.6 g, KC1 14.1 g, pH 7.5 in 1000 ml) was used to suspend the virion pellet and transferred to 1.5 ml. In the centrifuge tube, add proteinase K to a final concentration of 50 g/ml, incubate at 50 °C for 2 hours, then add 35% Sarkonsel to a final concentration of 1%, continue to incubate at 50 °C for 2 hours, respectively, with an equal volume Phenol, phenol: Chloroform (1:1) chloroform was sequentially extracted, and the upper aqueous phase was transferred to a new tube, and 1/10 volume of 3 M NaCl was added, followed by 2 volumes of absolute ethanol, -20. C was placed for more than 2 hours to precipitate virus DNA, centrifuged at 5000 rpm for 10 minutes, and the precipitate was washed once with 75 % ethanol and lyophilized. Dissolve in 100 μΐ TE Buffer and store at 4 °C for later use.

4. Construction and acquisition of recombinant silkworm baculovirus rBmNPV (P1-2A3C)

4.1 Construction of recombinant baculovirus rBmNPV ( P1-2A3C )

Approximately 1×10 ⁶ cells were inoculated into a 15 cm ² flask. After the cells were attached, the medium containing fetal bovine serum (FBS) was removed and washed three times with medium without FBS, and the force was 1.5 ml without FBS medium. Add 1 μ _β silkworm baculovirus parental strain Bm-NPV-ZJ8 DNA, 2 μ _β recombinant transfer plasmid pVL1393 ( P1-2A3C ) DNA and 5 μL liposome to a sterile tube, using sterile double distilled water. Make up the volume to 60 μΐ, mix gently, let stand for 15 minutes, then add to the flask for co-transfection. 27. C culture for 4 hours, add 1.5 ml without Serum medium and 300 μΐ FBS. Incubate at 27 °C for 4 to 5 days, and collect the supernatant for screening of recombinant virus.

4.2 Screening and purification of recombinant silkworm baculovirus rBmNPV ( P1-2A3C )

Inoculate appropriate cells (about 70 ~ 80%) in 35 mm flat, after the cells were attached, the medium was aspirated, the co-transfected supernatant was diluted to different concentrations, and 1 ml of the co-transfection solution was added to the adherent cells. , the distribution is hooked. After infection at 27 °C for 1 hour, the infection solution was aspirated, and the 2% low melting point agarose gel was melted in a 60 °C water bath, and cooled to 40 °C and 40 °C preheated 2xTC-100 medium (including 20 % FBS ) Mix evenly, add 4 ml of glue per level, seal with Parafilm after solidification, 27. C was inverted for 3 to 5 days and observed under a microscope. The plaques containing no polyhedron were selected and the above procedure was repeated. After 2 to 3 rounds of purification, pure recombinant silkworm baculovirus rBmNPV (P1-2A3C) was obtained (the microbial deposit number is: CGMCC NO.1979).

4.3 Recombinant virus rBmNPV (P1-2A3C) amplification in silkworm cells

The recombinant silkworm baculovirus rBmNPV (P1-2A3C) was infected with normal growing BmN cells, and the supernatant was collected after 3 days of culture. The supernatant contained a large amount of recombinant virus rBmNPV (P1-2A3C X

4.4 Identification of recombinant virus

The integration of foreign genes was analyzed by PCR. The extraction method of free viral genomic DNA is as follows: Take the virus supernatant 150μ1, add 150μ1 (0.5 mol/L) NaOH, mix well, add 20μ1 (8 mol/L) ammonium acetate, mix the hook and use an equal volume of phenol. It was extracted once with chloroform, and after ethanol precipitation, the DNA was dissolved with 20 μl of TE. Oligonucleotide primers are:

5,-GAGGATCC ACGATGAAAGCGATCTTAATCCC AT-3 '

5 ' - TTA A C ATCTG TTT C A GGTGCA AT-3, the above viral genomic DNA Ιμΐ was used for PCR amplification, and the reaction conditions were: denaturation at 94 °C for 5 min, 94. C lmin, 58 °C lmm, 72 °C lmin, 30 cycles, and finally 72 °C extension for 5 min. The 15 μl reaction product was subjected to electrophoresis analysis, and it was confirmed that the recombinant virus was obtained.

5. Expression of P1-2A3C gene in silkworm

The high-expression variety of silkworm used in this experiment is JY1 (preserved by our laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). The silkworms with the same average body weight were selected 48 h after foraging. Each silkworm was inoculated with about 1.0×10 ⁵ rBmNP (P1-2A3C). After 4-5 days, the hemolymph of the silkworm was collected and frozen at -20 V for double antibody sandwich ELISA. . The 96-well microtiter plate was coated with rabbit anti-foot-and-mouth disease positive serum at 4 °C overnight. After the skim milk powder is closed, the foot-and-mouth disease positive antigen, infection rBmNPV (P1-2A3C) Silkworm blood harvested from silkworm, silkworm blood infected with Bm-NPV-ZJ8, was diluted 2 times in silkworm. After 1 h at 37 °C, it was washed, and guinea pig anti-FMDV positive serum was added and treated at 37 °C for 1 h. After washing, HRP-rabbit anti-guinea pig IgG was added and treated at 37 °C for 1 h. The substrate OPD-H ₂ O ₂ was added and allowed to act at 37 ° C for 15 min, and the reaction was terminated with a stop solution, and the OD value was measured at λ 492 ηπι. Results As shown in Fig. 1, the hemolymph OD value obtained from the silkworm infected with rBmNPV (P1-2A3C) gradually decreased with the increase of the dilution ratio, and the change rule was the same as that of the positive control traditional cell vaccine virus antigen. From the results of the OD value measurement experiment, the expression level reached 100 times higher than that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the silkworm hemolymph of the control Bm-NPV-ZJ8 infection.

6. P1-2A3C gene is expressed in silkworm pupa

The silkworm cocoon used in this experiment is a highly expressed variety of JY1 (preserved by the laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). After seven days of crusting, 15 silkworm cocoons with the same average body weight were selected. The silkworms with the same average body weight were selected 48 h after the foraging. Each silkworm was inoculated with about l.Ox lO ⁵ rBmNPV (P1-2A3C), and the cocoon was collected 4-5 days later. Hemolymph, frozen at -20 °C for double antibody sandwich ELISA. As shown in Figure 2, the hemolymph OD value obtained from the silkworm pupa infected with rBmNPV (P1-2A3C) gradually decreased with the increase of the dilution ratio > the change rule and the change of the OD value of the traditional cell vaccine virus antigen of the positive control The same rules. From the results of the OD value measurement experiment, the expression level reached 100 times higher than that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the hemolymph of the silkworm infected with the control Bm-NPV-ZJ8.

7. Purification of foot-and-mouth disease antigen

The Sephadex xerogel was weighed, swollen and placed in a glass column, and washed with an eluent (5 mmol/LTris solution, 0.1 mol/L NaCl, pH 8.0) until the baseline was stable. The silkworm blood collected in the above 5 and 6 was ultrasonically disrupted and centrifuged to remove cell debris. The above sample was loaded, and an appropriate amount of eluate was taken at a flow rate of 0.3 ml/min. The protein eluate was collected at 5 min/tube, collected to the first peak, and the collected protein eluates were combined to obtain a purified foot-and-mouth disease antigen. .

8, animal immunity experiments and virus attack protection experiments

The collected purified antigen is mixed with an equal volume of oil adjuvant. Take 3ml / head and neck muscles to immunize cattle. The real group was immunized with 5 cows and a control group of 2 cows was established. Before the vaccination, the antibody level of the candidate cattle was tested by the OIE standard method liquid phase blocking ELISA method, and the cattle whose titer was less than 1/8 were selected in Lanzhou. Experiment in the isolation animal room of the Veterinary Research Institute

Bovine serum was collected 21 days after immunization, and the anti-FMDV antibody levels in bovine serum were detected by liquid phase blocking ELISA. All the experimental animals achieved high antibody levels. Bovine tongue was inoculated with 10,000 BID ₅₍₎ homologous virus for 10 days, and the incidence of the lips and four hooves was detected. Five animals in the experimental group were fully protected, while the control animals were all ill. Example 2 Preparation, Purification, Animal Immunization Experiment and Virus Attack Protection Experiment of Foot-and-Mouth Disease Antigen

1. Cloning and sequence analysis of the full-length ORF of foot-and-mouth disease virus

Primers were designed to amplify the full-length ORF of the foot-and-mouth disease virus by RT-PCR (the amplified primers of the amplified full-length ORF designed by SEQ ID ΝΟ: 3 λ are

ORF: 5, - GCGACTAGTACCATGGAATTCACACTTCACAACGGTGAG -3,,

Spe I cleavage site

ORF: 5'-ATAGCGGCCGCAGGGATTATGCGTCACCGCACAC-3 '.

Not I cleavage site

Total RNA was extracted from the foot-and-mouth disease virus cell culture medium. The extracted total RNA was subjected to reverse transcription at 42 °C using a 0 0 ( ) ₁₈ primer under the action of AMV reverse transcriptase to prepare cDNA. The obtained cDNA was used as a template, and PCR amplification was carried out using specific primers.

The PCR reaction system is as follows:

Table 2 PCR reaction conditions

PCR reaction process: 94. C denatured for 10 minutes; 94. C 1 minute, 58 ° C 1 minute, 72. C 8 minutes, a total of 30 cycles. The reaction was finally extended for 10 minutes.

2. Construction of the transfer vector pVL1393 (ORF)

The ORF amplified in the above method was purified by the method of 1.2 in Example 1, and digested with Spel and NWI, and then ligated with the scorpion virus transfer vector pVL1393 digested with Xbal and Νοή, and then transformed into Escherichia coli TG1. Recombinant transfer vector pVL1393 (ORF). The recombinant plasmid pVL1393 (ORF) was subjected to bidirectional sequencing. The ORF gene sequence and amino acid sequence are shown in SEQ ID ΝΟ: 3 and SEQ ID NO: 4, respectively.

3. Construction and acquisition of recombinant silkworm baculovirus rBmNPV (ORF)

3.1. Construction of recombinant baculovirus rBmNPV (ORF)

Inoculate approximately Ι χ ⁶ cells in a 15 cm ² flask. After the cells were attached, the medium containing fetal bovine serum (FBS) was removed and washed three times with medium without FBS. 1.5 ml without FBS medium. Add a silkworm baculovirus parental strain Bm-NPV-ZJ8 DNA, 2 recombinant transfer plasmid pVL1393 (ORF) DNA and 5 μL liposome to a sterile tube, and make up the volume to 60 μΐ with sterile double distilled water. Mix gently, let stand for 15 minutes, and add to the flask for co-transfection. 27. After 5 hours of C culture, 1.5 ml of serum-free medium and 300 l of FBS were added. Incubate at 27 °C for 4 to 5 days, and collect the supernatant for screening of recombinant virus.

3.2 Screening and purification of recombinant silkworm baculovirus rBmNPV (ORF)

Inoculate appropriate cells (about 70 ~ 80%) in 35 mm flat, after the cells were attached, the medium was aspirated, the co-transfected supernatant was diluted at different concentrations, and 1 ml of the co-transfection solution was added to the adherent cells. , evenly distributed. After infection at 27 °C for 1 hour, the infection solution was aspirated, and the 2% low melting point agarose gel was melted in a 60 °C water bath, and cooled to 40 °C and 40 °C preheated 2xTC-100 medium (including 20 % FBS ) Mix evenly, add ml glue per level, seal with Parafilm after solidification, 27. C was inverted for 3 to 5 days and observed under a microscope. The plaques containing no polyhedron were selected and the above procedure was repeated. After 2 to 3 rounds of purification, pure recombinant silkworm baculovirus rBmNPV (ORJF) was obtained (the microbial deposit number is: CGMCC NO. 1980).

3.3 Recombinant virus rBmNPV (ORF) amplification in silkworm cells

The recombinant silkworm baculovirus rBmNPV (ORF) was infected with normal growing BmN cells, and the supernatant was collected for 3 days, and the supernatant contained a large amount of recombinant virus rBmNPV (ORF).

3.4 Identification of recombinant virus

The integration of foreign genes was analyzed by PCR. The extraction method of free viral genomic DNA is as follows: Take the virus supernatant 150μ1, add 150μ1 (0.5 mol/L) NaOH, mix well, then add 20μ1 (8 mol/L) Ammonium acetate, after mixing, was extracted once with an equal volume of phenol and chloroform, and after ethanol precipitation, the DNA was dissolved with 20 μl of hydrazine. Oligonucleotide primers are:

5'-GAGGATCCACGATGAAAGCGATCTTAATCCCAT-3 '

5,- TTACACCATCTGCTTTCCAGGTGCAAT-3 ' Take the above viral genome ϋΝΑ ΙμΙ for PCR amplification, the reaction conditions are: 94 °C denaturation 5 min, 94 °C lmin, 55 °C lmin, 72 °C lmin, 30 cycles, the last 72 ° C extends for 5 min. The 15 μl reaction product was subjected to electrophoresis analysis, and it was confirmed that the recombinant virus was obtained.

4. Expression of ORF in silkworm

The high-expression variety of silkworm used in this experiment is JY1 (preserved by our laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). The silkworms with the same average body weight were selected 48 h after foraging. Each silkworm was inoculated with l.Ox lO ⁵ rBmNPV (ORF). After 4-5 days, the hemolymph of the silkworm was collected and frozen at -20 以 for double antibody sandwich ELISA. The 96-well microtiter plate was coated with rabbit anti-FMDV positive serum for 4 overnight. After the skim milk powder was blocked, the FMDV antigen, the silkworm blood infected with the rBmNPV (ORF) infected silkworm, and the silkworm blood harvested from the silkworm infected with Bm-NPV-ZJ8 were diluted 2-fold. After being treated for 1 h at 37 °C, it was washed, and guinea pig anti-FMDV positive serum was added and treated at 37 °C for 1 h. After washing, HRP-rabbit anti-guinea pig IgG was added and treated at 37 °C for 1 h. The substrate OPD-H ₂ O ₂ was added and allowed to act at 37 ° C for 15 min, and the reaction was terminated with a stop solution, and the OD value was measured at λ 492 ηηι. Results As shown in Fig. 3, the hemolymph OD value obtained from the silkworm infected with rBmNPV (ORF) gradually decreased with the increase of the dilution ratio, and the change rule was the same as that of the positive control traditional cell vaccine virus antigen. From the results of the OD value measurement experiment, the expression level reached 10 times higher than that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the hemolymph of the silkworm infected with the control Bm-NPV-ZJ8.

5. ORF is expressed in silkworm pupa

The silkworm cocoon used in this experiment is a highly expressed variety of JY1 (preserved by the laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). After the crusting for seven days, 15 silkworm pupa with the same average body weight were selected. The cocoon with the same average body weight was selected 48 h after the foraging. Each silkworm cocoon was inoculated with about 1.0× ^{10 5} pfu rBmNPV (ORP), and the silkworm sputum hemolymph was collected after 4-5 days. °C was frozen for double antibody sandwich ELISA. Results As shown in Fig. 4, the hemolymph OD value obtained from the silkworm pupa infected with rBmNPV (ORF) gradually decreased with the increase of the dilution ratio, and the change rule was positively transmitted with the positive control. The cell seed virus antigen changes in the same pattern. From the OD value test results, the expression level reached 10 times higher than that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the silkworm hemolymph of the control Bm-NPV-ZJ8 infection.

6, antigen purification

The Sephadex xerogel was weighed, swelled and placed on a glass column, and washed with an eluent (5 mmol/LTris solution, 0.1 mol/L NaCl, pH 8.0) until the baseline was stable. The silkworm blood lymphocytes harvested in 4 and 5 were broken by ultrasonic waves and centrifuged to remove cell debris. The above sample was loaded, and an appropriate amount of eluate was taken at a flow rate of 0.3 ml/min. The protein eluate was collected at 5 min/tube, collected to the first peak, and the protein eluate was combined to obtain a purified antigen.

7. Animal immunization experiment and virus attack protection experiment

Six collected purified antigens were mixed with an equal volume of oil adjuvant. Take 3ml/head and neck muscles to immunize cattle. The experimental group was immunized with 5 cows and a control group of 2 cows was established. Before the vaccination, the antibody level of the candidate cattle was tested by the OIE standard method liquid phase blocking ELISA, and the cattle whose titer was less than 1/8 were selected for experiment in the isolation animal room of the Lanzhou Veterinary Research Institute.

Bovine serum was collected 21 days after immunization, and the anti-FMDV antibody levels in bovine serum were detected by liquid phase blocking ELISA. All the experimental animals achieved high antibody levels.牛 Inoculation of beef tongue with 10,000 BID _{5 ()} homologous virus, continuous observation for 10 days, detection of the incidence of the lips and four hooves, the experimental group of 5 animals obtained 4 protection, while the control group of all the disease. Example 3 Preparation, Purification, Animal Immunization Experiment and Virus Attack Protection Experiment of Foot-and-Mouth Disease Antigen

1. Cloning and sequence analysis of FMDV VP 1 gene

Primers were designed to amplify the foot-and-mouth disease virus VP 1 gene by RT-PCR.

The designed amplification primer for the amplified VP 1 gene is

VP1 upstream: 5 '-ATAGGATCCACCATGGCCACCACTACCGGCGAGTCAG-3 ',

BamR I restriction site

Downstream of VP 1 : 5, - CGCGAATTCTTACACCATCTGCTTTCCAGGTGCAAT-3,.

EcoR I restriction site

Total RNA was extracted from the foot-and-mouth disease virus cell culture medium. The extracted total RNA was subjected to PCR amplification using 03⁄40 ((110 ₁₈ primer under the action of AMV reverse transcriptase, reverse transcription at 42 °C to prepare cDNA. The obtained cDNA was used as a template, and specificity] was used for PCR amplification. The PCR reaction system is as follows: Table 3 PCR reaction conditions

PCR reaction process: 94. C denaturation for 10 minutes; 94 °C for 1 minute, 58 °C for 1 minute, and 72 °C for 1 minute for a total of 30 cycles. Finally, the reaction was extended for 10 minutes.

2. Construction of transfer vector pVL1393 ( VP1 )

The obtained VP1 gene fragment was purified by the method of 1.2 in Example 1, and digested with ΒωηΉΙ and EcoRI, and then ligated with the same double-cut baculovirus transfer vector pVL1393, and then transformed into Escherichia coli TG1. Transfer the pVL1393 (VP1). The recombinant plasmid pVL1393 (VP1) was subjected to bidirectional sequencing. The VP1 gene sequence and amino acid sequence are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

3. Construction and acquisition of recombinant silkworm baculovirus rBmNPV (VP1)

3.1 Construction of recombinant baculovirus rBmNPV ( VP1 )

Inoculate approximately Ιχ ⁶ cells in a 15 cm ² flask, and after adhering the cells, remove the medium containing fetal bovine serum (FBS) and wash three times with medium containing no FBS. 1.5 ml without FBS medium. Add a silkworm baculovirus parental forest Bm-NPV-ZJ8 DNA, 2 recombinant transfer plasmid pVL1393 (VP1) DNA and 5 μΐ liposome to a sterile tube, and make up the volume to 60 μl with sterile double distilled water. Mix gently, let stand for 15 minutes, and add to the flask for co-transfection. 27. After C-culture for 4 hours, 1.5 ml of serum-free medium and 300 μΐ FBSo were incubated at 27 °C for 4 to 5 days, and the supernatant was collected for screening of recombinant virus.

3.2 Screening and purification of recombinant silkworm baculovirus rBmNPV (VP1) Inoculate appropriate cells (about 70 ~ 80%) in 35 mm Xiaoping, after the cells were attached, the medium was aspirated, the co-transfected supernatant was diluted at different concentrations, and 1 ml of the co-transfection solution was added to the adherent cells. In the distribution, the distribution is hooked. After infection at 27 °C for 1 hour, the infection solution was aspirated, and the 2% low melting point agarose gel was melted in a 60 °C water bath, and cooled to 40 °C and 40 °C preheated 2xTC-100 medium (including 20 % FBS ) Mix well, add 4 ml of glue per level. After solidification, seal with Parafilm, incubate at 27 °C for 3 to 5 days, and observe under microscope. The plaques containing no polyhedron were selected and the above procedure was repeated. After 2 to 3 rounds of purification, pure recombinant silkworm baculovirus rBm PV (VP1) was obtained (the microbial deposit number is: CGMCC NO.1975).

3.3 Recombinant virus rBmNPV ( VP1 ) amplification in silkworm cells

The recombinant silkworm baculovirus rBmNPV (VP1) was infected with normal growth BmN cells, and the supernatant was collected after 3 days of culture. The supernatant contained a large amount of recombinant virus rBmNPV (VP1).

3.4 Identification of recombinant virus

5 '-GAGGATCCACGATGAAAGCGATCTTAATCCCAT-3 '

5'- TTACACCATCTGCTTTCCAGGTGCAAT-3 ' Take the above viral genome ϋΝΑ Ι μΙ for PCR amplification, the reaction conditions are: 94 °C denaturation 5 min, 94 °C lmin, 55 °C lmin, 72 °C lmin, 30 cycles, last 72 °C extended for 5 min. The 15 μl reaction product was subjected to electrophoresis analysis, and it was confirmed that the recombinant virus was obtained.

4, VP1 expression in silkworm

The high-expression variety of silkworm used in this experiment is JY1 (preserved by our laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). The silkworms with the same average body weight were selected 48 h after foraging. Each silkworm was inoculated with about 1.0χ 10 ⁵ rBmNPV (VP1). After 4-5 days, the hemolymph of the silkworm was collected and frozen at -20 °C for double antibody sandwich ELISA. Results As shown in Fig. 5, the hemolymph OD value obtained from the silkworm infected with rBmNPV (VP1) gradually decreased with the increase of the dilution ratio, and the change rule was the same as that of the control traditional cell vaccine virus antigen. From the results of the OD value measurement experiment, the expression level reached more than 100 times that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the silkworm hemolymph of the control Bm-NPV-ZJ8 infection. 5. VP1 gene is expressed in silkworm pupa

The silkworm cocoon used in this experiment is a highly expressed variety of JY1 (preserved by the laboratory). The silkworm rearing of JY1 variety was carried out according to the conventional method of "Chinese Sericulture" edited by Lu Hongsheng (Shanghai Science and Technology Press, 1991). After seven days of crusting, 15 silkworm pupa with the same average body weight were selected. The cocoon with the same average body weight was selected 48 h after the foraging. Each silkworm cocoon was inoculated with about 1.0×10 ⁵ rBm PV (VP1), and the silkworm hemolymph was collected after 4-5 days. 20 Ό frozen for detection by double antibody sandwich ELISA. Results As shown in Fig. 6, the hemolymph OD value obtained from the silkworm infected with rBm PV (ORF) gradually decreased with the increase of the dilution ratio, and the change rule was the same as that of the positive control traditional cell vaccine virus antigen. From the results of the OD value measurement experiment, the expression level reached 100 times higher than that of the positive control traditional cell vaccine virus antigen, while no antigen expression was detected in the silkworm hemolymph of the control Bm-PV-ZJ8 infection.

6, antigen purification

The Sephadex xerogel was weighed, swelled and placed in a glass column, and washed with an eluent (5 mmol LTris solution, 0.1 mol/L NaCl, pH 8.0) until the baseline was stable. The silkworm blood lymphocytes harvested in 4 and 5 were broken by ultrasonic waves and centrifuged to remove cell debris. The above sample was loaded, and an appropriate amount of eluate was taken at a flow rate of 0.3 ml/min. The protein eluate was collected at 5 min/tube, collected to the first peak, and the protein eluate was combined to obtain a purified antigen.

7. Animal immune test and virus attack protection experiment

The silkworm blood lymphocytes collected in 4 or 5 were ultrasonically disrupted, and the cell debris was discarded and mixed with an equal volume of oil adjuvant. Take 3ml/head and neck muscles to immunize cattle. The experimental group was immunized with 5 cows and a control group of 2 cows was established. Before the vaccination, the antibody was tested by the OIE standard method liquid phase blocking ELISA method, and the cattle whose titer was less than 1/8 were selected for experiment in the isolation animal room of Lanzhou Veterinary Research Institute.

Bovine serum was collected 21 days after immunization, and the level of anti-foot-and-mouth disease antibody in bovine serum was detected by liquid phase blocking ELISA. All the experimental animals achieved high antibody levels. The tongue was inoculated with a 10,000 BID ₅₀ homologous virus for 10 days, and the incidence of the lips and the four hooves was detected. Four of the five animals in the experimental group were protected, while the control animals were all ill.

Claims

Rights request

A method for preparing a foot-and-mouth disease antigen, comprising: cloning different gene combinations of foot-and-mouth disease into a baculovirus carrier, constructing a transfer vector; transfecting the baculovirus with the constructed transfer vector for DNA recombination, obtaining recombination Baculovirus; Infecting an insect host with a recombinant baculovirus; cultivating an infected insect host for expression of foot-and-mouth disease antigen; collecting and purifying the expressed foot-and-mouth disease antigen.

2. The method according to claim 1, wherein: the different gene combinations of foot-and-mouth disease are selected from the group consisting of the base sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO:

3. A method according to claim 1, characterized in that said baculovirus carrier is selected from the group consisting of AcRP23-/cZ, AcRP6-SC, AcUWl-/acZ, BacPAK6, Bac to Pac, Bacmid, BlucBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB4, PAcAS3, pAcC129, pAcC4, DZI, pAcGP67, pAcIE1, pAcJPl, pAcMLF2, pAcMLF 7, pAcMLF8, pAcMPl, pAcMP2, pAcRP23, pAcRP25, pAcRW4, pAcsMAG, pAcUWl, pAcUW21, pAcUW2A, pAcUW2B, pAcUW3, pAcUW31, pAcUW41, pAcUW42, pAcUW43, pAcUW51, pAcVC2, pAcVC3, pAcYMl, pAcJcC5, pBacl, pBac2, pBlueBacIII, pBlueBacHis, pEV55, mXIV, pIEINeo, pJVETL, pJVNhel, pJVPIO, pJVrsMAG, pMBac, pPIO, pPAKl, pPBac, pSHONEX 1.1, pSYN XIV VI+, pSYNVI+wp, pSYNXIV VI-, pVL1391, pVL 1392, pVL 1393, pVL941, pVL 945, pVL 985, pVTBac, pBM030, pUAC-5 or other similar rod Viral homologous recombination or transposition vector.

4. A method according to claim 3 wherein the baculovirus carrier is pVL1393.

5. A method according to claim 1, characterized in that the transfer vector constructed is pVL1393

(P1-2A3C), pVL1393 (ORF) or pVL1393 (VP1).

6. A method according to claim 1, characterized in that said baculovirus is selected from the group consisting of BmNPV, AcMNPV, ApNPV BsSNPV C PV EoSNPV, HaNPV, HzNPV, LdMNPV > MbMNPV, OpMNPV, S1MNPV. SeMNPV or TeNPV.

7. The method according to claim 1, wherein: said baculovirus is a silkworm baculovirus

8. A method according to claim 1, wherein: said recombinant baculovirus is selected from any one of the following recombinant viruses: (1) recombinant Bombyx mori nuclear polyhedrosis virus rBmNPV (ORF), the microbial deposit number of which is: CGMCC NO. 1980; (2) Recombinant Bombyx mori nuclear polyhedrosis virus rBmNPV (P1-2A3C), the microbial deposit number is: CGMCC NO.1979; (3) Recombinant Bombyx mori nuclear polyhedrosis virus rBmNPV (VP1), its microorganism The deposit number is: CGMCC NO.1975.

9. The method according to claim 1, wherein: said insect host comprises Bombyx mori, Bombyx mandarina, Philosamia cynthia ricim, tussah.

(Dictyoploca japanica), tussah (Philosamia cynthia pryeri), tussah (Antheraea pernyi), Japanese tussah (Antheraea yamamai), Antheraea polyphymus, 苜 ϋ

(Atographa califorica), Ectropis obliqua, Mamestra brassicae, Spodoptera littoralis, Spodoptera frugiperda, powdery night

(Trichoplusia ni ), Thaumetopoea wilkinsoni, Heliothis armigera, Heliothis zea, Heliothis assulta, Heliothis virescens, Pseudaletia separata Or the toxic field (Lymantria dispar).

10. A method according to claim 9, characterized in that the insect host is a silkworm larva or a bombyx mori.