CN100410383C - High-performance bioreactor for baculovirus of insects - Google Patents

High-performance bioreactor for baculovirus of insects Download PDF

Info

Publication number
CN100410383C
CN100410383C CNB2004100377502A CN200410037750A CN100410383C CN 100410383 C CN100410383 C CN 100410383C CN B2004100377502 A CNB2004100377502 A CN B2004100377502A CN 200410037750 A CN200410037750 A CN 200410037750A CN 100410383 C CN100410383 C CN 100410383C
Authority
CN
China
Prior art keywords
baculovirus
silkworm
insect
expression
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CNB2004100377502A
Other languages
Chinese (zh)
Other versions
CN1696294A (en
Inventor
张志芳
陈寅
沈桂芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CNB2004100377502A priority Critical patent/CN100410383C/en
Publication of CN1696294A publication Critical patent/CN1696294A/en
Application granted granted Critical
Publication of CN100410383C publication Critical patent/CN100410383C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a new high-efficiency insect baculovirus bioreactor which has the following work steps: (1) a baculovirus transfer vector of an expression box containing an early promotor, exogenous genes and an enhancer is recombined with baculovirus DNA; (2) insect hosts and cells are infected by the recombinant viruses; (3) the infected insect hosts or cells are cultivated to carry out expression of recombinant proteins, and insect bodies or cells containing the recombinant proteins are collected; (4) and the promotor and the enhancer are combined and directly and stably expressed in cells by resistance sieving. The bioreactor can be used for massively producing recombinant proteins at low cost to be used for the industrial production and the agricultural production of medicaments, foods, feed, enzyme preparations, etc.

Description

A kind of preparation method of insect baculovirus bio-reactor
Technical field
The present invention relates to biotechnology, particularly a kind of recombinant baculovirus efficiently expressing exogenous gene in insect body that utilizes, the preparation method who produces recombinant protein and do sth. in advance the insect baculovirus bio-reactor of effective expression time.
Background technology
Existing insect baculovirus comprises BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV, TnNPV etc., insect host comprise silkworm (Bombyx mori), wild silkworm (Bombyx mandarina), Semen Ricini silkworm (Philosamia cynthia ricim), wild silkworm (Dictyoplocajapanica), Philosamia cynthia (Philosamia cynthia pryeri), tussah (Antheraea pernyi), yamama (Antheraeayamamai), wild giant silkworm (Antheraea polyphymus) autographa california (Atographa califorica), tea geometrid (Ectropis obliqua), cabbage army worm (Mamestrabrassicae), prodenia litura (Spodoptera littoralis), autumn mythimna separata (Spodoptera frugiperda), cabbage looper (Trichoplusia ni), armyworm (Thaumetopoea wilkinsoni), bollworm (Heliothis armigera), U.S. bollworm (Heliothis zea), oriental tobacco budworm (Heliothis assulta), cigarette beetle (Heliothis virescens), oriental armyworm (Pseudaletia separata), gypsymoth (Lymantria dispar) etc.
This bio-reactor of baculovirus expression system is that the eighties is set up.(Smith since nineteen eighty-three utilizes baculovirus expression system to efficiently express people's alpha-interferon first, Mol.CellBiol., 3:2156-2165,1983), existing dozens of foreign gene has obtained efficiently expressing, only just there are alpha-interferon (Yang Guanzhen etc. in China, Acta Biochimica et Biophysica Sinica, 22:355-361,1990), arrowhead proteinase inhibitor (season equality, silkworm industry science, 21:223-227,1995), Mareks disease virus Glycoprotein B (Xiao Qingli etc., silkworm industry science, 23:104-108,1997) etc. multiple.The baculovirus expression carrier system is one of current genetically engineered four big expression systems, for prokaryotic expression system, baculovirus expression system is a kind of eukaryotic expression system, have eukaryotic protein translation post-treatment, modification and delivery system, expression product aspect biological activity, antigenicity and immunogenicity near natural product.U.S. food and drug administration are to being evaluated as of baculovirus expression system " product that FDA approval baculovirus expression system is produced; it provides the prospect of emerging biopharmaceutical industry; especially for human disease treatment and developing vaccines; improve human beings'health and improve millions of people's quality of life all the more so " (Patterson R M, Environ.Health Perspect, 1995,103:756~759).The advantage of utilizing this system to produce recombinant protein is: 1. the expression efficiency of this expression system is high, and output can reach the level of milligram level/worm.Thereby can reduce production costs and make the scale operation of many valuable recombinant proteins to become possibility greatly; 2. this expression system is an eukaryotic expression system, and the exogenous protein of its expression can carry out posttranslational modification, makes it similar to natural product with biological activity etc. at biochemical property, and this provides assurance for the recombinant protein that gives expression to has normal biologic activity.At present, baculovirus expression system, silkworm especially wherein (Bm)-silkworm baculovirus (BmNPV) expression system are one of individual expression systems of eukaryote that has most in the world business development value.
Dna replication dna of baculovirus and genetic expression are a cascade matter, and the back genetic expression of phase for the moment relies on phase expression of gene when last, and the product IE-1 of its utmost point early gene can the trans adjusting expression of phase, late period, late late gene sooner or later.Baculovirus utmost point early gene ie-1 has the promoter element similar to eukaryote because of it, behind the virus infection host, do not need the participation (Lv Hongsheng of the correlated virus factor with regard to expressing by the transcription and translation system of host cell, insect viruses molecular biology, agricultural science and technology press, 1998).According to the ie-1 gene promoter sequence of BmNPV and AcMNPV design primer this virus strain ie-1 gene promoter that from BmNPVZJ-8 strain and AcMNPV C6 pnca gene group, increases.The used expression vector of present baculovirus expression system generally starts exogenous gene expression with the polyhedrosis gene promotor, though this late promoter is active strong, but it is perfect that product is difficult to modify under the ruined situation of host cell, and use early promoter can make foreign gene virus infection just obtain extremely in early days express, the less virus that is subjected to of host cell influences, and expression product can well be modified.In addition, also can be built into stably express carrier (Jarvis DL, et al, Biotechnology (N Y), 1990,8 (10): 950-955) of composing type with the ie-1 promotor.Though the ie-1 promotor is active the strongest one in the baculovirus utmost point early promoter, its activity is obviously on the low side with respect to the polyhedrosis gene promotor.Therefore, thus seek and a kind ofly to strengthen transcriptional activity that element strengthens the ie-1 promotor and make foreign gene obtain to express more efficiently to be and not only have the theoretical approach that is worth but also can in actual production, has broad prospect of application.
In Autographa californica multinucleocapsid nucleopolyhedrovirus (AcMNPV) genome, be dispersed in 8 homology iteron sequences (Kool, M., et al, J.Gen.Virology, 74:2661-2668,1993).Find the homology iteron (hr1, hr2L, hr2R, hr3, hr4L, hr4R and hr5) similar in the silkworm BmNPV genome to AcMNPV.The hr of silkworm BmNPV respectively contains 2~8 of the homologous nucleotide sequences of mean length 75bp.All these homology tumor-necrosis factor glycoproteinss all contain long 30bp palindrome motif, in this motif core an EcoRI or the similar inscribe of EcoRI site are arranged.Same feeling sequence and the AcMNPV of BmNPV hrs have 95% conservative property.
BmNPV ZJ-8 strain hr3 has the constructional feature of baculovirus homology iteron: 1.hr3 and contains 3 small fragments of 72bp EcoRI, each fragment has the incomplete palindromic sequence of 30bp, each palindromic sequence has the asymmetric base of 2~3bp, must be asymmetric in 8 bit bases at the bottom of the both sides, EcoRI site, center; 2. also have one section 13bp conserved sequence TTTGAAAAACAAA that can form loop-stem structure in the zygomorphy position of palindromic sequence, and the relative position of this loop-stem structure and palindromic sequence is also very conservative; 3. being rich in A+T reaches about 70%.BmNPV ZJ-8 strain hr3 and AcMNPV homologous sequence can expand to both sides 72bp from the palindromic sequence of 30bp, homology reaches more than 90%, and the zygomorphy position of palindromic sequence comprises that in EcoRI site, center 2~3bp of the 8th is not complementary, hr3 mainly shows quantitatively in the not difference between the homophyletic of the same race in addition, obvious difference is less than between the xenogenesis, the specificity that this structural conservative property must corresponding function.
Silkworm BmNPV hr3 is rich in A+T and loop-stem structure all is the feature (Zhang Zhi's virtue etc., Chinese science (B) .25 (1995) 949-955) of dna replication dna starting point.Find have viral proteins encoded and virus induction albumen to combine with the hr3 specificity by gel blocking mensuration and footprinting analysis in virus infection, this explanation BmNPV ZJ-8 strain hr3 plays an important role in this virus life working cycle.Report BmNPV ZJ-8 strain hr3 such as Lu can be used as the expression that the composing type enhanser strengthens foreign gene silkworm moth tenuigenin actin gene, this enhancement of mRNA analysis revealed shows transcriptional level rather than levels of replication, only when being connected, the promotor cis of hr3 and this gene has the enhanser function, reach (Lu M about 1000 times at the expression amount that has BmIE-1 can strengthen foreign gene silkworm moth tenuigenin actin gene under as the condition of trans-activating factor, et al, J Biol Chem.1997,272 (49): 30724-30728).
Content of the present invention
The purpose of this invention is to provide a kind of recombinant baculovirus efficiently expressing exogenous gene in insect body that utilizes, the preparation method who produces recombinant protein and do sth. in advance the new and effective insect baculovirus bio-reactor of effective expression time.By the work of this bio-reactor, can produce recombinant protein in a large number, at an easy rate, to be used for industrial and agricultural productions such as medicine, food, feed, zymin.
The objective of the invention is to realize by following technical scheme.The preparation method of the new and effective insect baculovirus bio-reactor of the present invention has following algorithm:
(1), the baculovirus transfer vector and the baculovirus DNA that will contain the expression cassette of early promoter, foreign gene and enhanser recombinated; (2), with recombinant virus infection insect host and cell; (3), cultivating infected insect host or cell makes it carry out Recombinant Protein Expression; Collection contains the insect body or the cell of recombinant protein; (4), also can utilize described promotor, enhanser to make up, directly stably express in cell through resistance screening.
Described baculovirus is following a kind of:
BmNPV、AcMNPV、ApNPV、BsSNPV、CfMNPV、EoSNPV、HaNPV、HzNPV、LdMNPV、MbMNPV、OpMNPV、SlMNPV、SeMNPV、TeNPV。
Described insect host is following a kind of:
Silkworm, wild silkworm, Semen Ricini silkworm, wild silkworm, Philosamia cynthia, tussah, yamama, wild giant silkworm, autographa california, tea geometrid, cabbage army worm, autumn mythimna separata, cabbage looper, armyworm, bollworm, the cotton mythimna separata of the U.S., oriental tobacco budworm, cigarette beetle, oriental armyworm or gypsymoth;
Described insect cell is following a kind of:
Sf-9, Sf-21, Hi5, S2, Bm5, BmN, Tn cell.
Described insect host is a silkworm, and described cell is an insect cell, and described baculovirus is silkworm baculovirus or AcMNPV.
The early promoter ie-1 of described baculovirus delivery carrier and the combination of virus enhancer drive expression of exogenous gene, and both sides are the homologous sequence of viral DNA, obtain the expression recombinant virus in order to carry out homologous recombination.
Its stably express is, the expression cassette that the combination of above-mentioned early promoter ie-1 and virus enhancer is driven exogenous gene expression is implemented in the universal support of resistant gene, to carry out stably express or transient expression in insect or insect cell.
Described recombinant virus is through port food or sees through epidermis and infect the 1-5 insect larvae or the pupal cell in age.Described early promoter is the ie-1 promotor of source BmNPV or AcMNPV; Described enhanser is the homology iteron 3 (hr3) that derives from BmNPV; Described reorganization is meant to be transferred to foreign gene on the genome of silkworm baculovirus parent plant, substitute the Polyhedrin gene on the viral genome, by plaque select technology and PCR detection technique, obtain to carry the recombinant silkworm baculovirus rBmNPV of foreign gene then; Described infection is the silkworm larva or the pupa in the recombinant silkworm baculovirus infection bombyx mori cell that will obtain or percutaneous puncture-inoculation 1-5 age; After infecting 3-6 days, collect and contain the silkworm larva of expression product or the body fluid or the tissue homogenate of pupa.
The expression amount of foreign gene in baculovirus expression system can be done sth. in advance and improve to the expression cassette that contains early promoter, foreign gene and enhanser, being applied in the baculovirus genetically engineered sterilant then can be faster, kill pests more effectively, and above-mentioned expression cassette also can be applicable to the exogenous gene expression of transgenic insect.The expression cassette that described carrier contains above-mentioned early promoter ie-1 and virus enhancer can be used for the foreign gene stably express or the transient expression of insect cell.
The present invention is at first by being cloned in the luciferase gene under the ie-1 gene promoter control of BmNPV, AcMNPV the upstream of hr3 respectively, be built into the transient expression reporter plasmid, transient expression and stably express in autumn mythimna separata sf-21 clone, silkworm Bm5, BmN clone and silkworm five-age larva are by detecting enhancement function activity and the host specificity thereof of uciferase activity research hr3 to the ie-1 promotor.The result is presented at hr3 among above-mentioned 4 kinds of hosts can make the foreign gene under the control of homologous Bmie-1 promotor strengthen 1970,2421,683 and 1059 times respectively; Can make the foreign gene under the allogenic Acie-1 promotor control strengthen 6462,4046,6980 and 605 times respectively.Confirmed that hr3 has superpower enhanser activity.Adopting baculovirus expression system, use in insect larvae and the application of pupa as the bio-reactor large-scale production of recombinant proteins, unite and use ie-1 promotor and hr3 enhanser, in silkworm (Bm)-silkworm baculovirus (BmNPV) expression system, pass through homologous recombination, with the foreign gene into silkworm baculovirus BmNPV that recombinates, obtain recombinant silkworm baculovirus rBmNPV, make its silkworm (larva in different developmental phases, pupa etc.) breeding in, in with the bio-reactor of silkworm, produce recombinant protein as the host, the result shows can make the exogenous gene expression amount improve 32.37%, and can obviously do sth. in advance expression of exogenous gene.In the employed baculovirus transfer vector of homologous recombination, the foreign gene that connects ie-1 promotor and hr3 enhanser can be building up to various baculovirus homologous recombination vectors (as AcRP23-lacZ, AcRP6-SC, AcUW1-lacZ, BacPAK8, Bac to Pac, Bacmid, BlueBacII (pETL), p2Bac, p2Blue, p89B310, pAc360,373, pAcAB3,4, pAcAS3, pAcC129, C4, DZ1, pAcGP67, pAcIE1, pAcJP1, pAcMLF2,7,8, pAcMP1,2, pAcRP23,25, pAcRW4, pAcsMAG, pAcUW1,21,2A, 2B, 3,31,41,42,43,51, pAcVC2,3, pAcYM1, pAcJcC5, pBac1,2, pBlueBacIII, pBlueBacHis, pEV55, mXIV, pIEINeo, pJVETL, pJVNhe1, pJVP10, pJVrsMAG, pMBac, pP10, pPAK1, pPBac, pSHONEX 1.1, pSYN XIV VI+, pSYNVI+wp, pSYNXIVVI-, pVL1391,1392,1393, pVL941,945,985, pVTBac, pBM030, pUAC-5) on.Equally, utilize other baculovirus expression system, also can express the production recombinant protein in the same way as AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SlMNPV, SeMNPV, TnNPV etc.
The present invention also provides a kind of the associating to use ie-1 promotor and hr3 enhanser, significantly to do sth. in advance and to improve the exogenous gene expression amount in the baculovirus bio-reactor.
In sum, by the present invention, can produce recombinant protein in a large number, at an easy rate, to be used for industrial and agricultural productions such as medicine, food, feed, zymin.
Accompanying drawing (table) explanation
Fig. 1 is the nucleotide sequence figure of hr3 enhanser,
Fig. 2 is the design of graphics of transient expression reporter plasmid,
Table 1 is the enhanced activity table of hr3 to homologous BmNPV ie-1 promotor,
Table 2 is the enhanced activity table of hr3 to allogenic AcMNPV ie-1 promotor,
Table 3 is two kinds of different expression strategies to expressing degradation of pesticide enzyme OPD efficient comparison sheet,
Table 4 is the luciferase vigor table of stable expression cell line.
Embodiment
Present embodiment is expressed foreign gene more efficiently for utilizing recombinant baculovirus in insect body, produce the new and effective insect baculovirus bio-reactor that recombinant protein is also done sth. in advance the effective expression time.
The present embodiment material therefor is as follows:
1. bacterial strain, virus strain and carrier e. coli strains E.coli TG1 and DH 5 αAvailable from Promega company; Delivery carrier pVL1393, insect (silkworm) cells BmN, Bombyx mori nuclear polyhydrosis virus parent plant BmNPV-ZJ8 are so kind as to give by the biochemical Wu Xiangfu researcher of institute in Chinese Academy of Sciences Shanghai; Cultivated silkworm breed variety JY1 is preserved by the Ministry of Agriculture of Inst. of Silkworm, Chinese Academy of Agricultural Sciences silkworm biotechnology emphasis open laboratory.
2. enzyme and reagent: restriction enzyme, ligase enzyme are Invitrogen company product.
3. biochemical reagents: IPTG, X-Gal, SDS are Sigma company product.Lipofectin, low melting point agarose LMP, PCR test kit, T4DNA ligase enzyme, RNA enzyme, Proteinase K, cell culture medium TC-100, foetal calf serum and other reagent are purchased the company in Invitrogen.
Substratum: the intestinal bacteria substratum be LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0); The bombyx mori cell substratum is TC-100.
4. carrier pUL220 (containing luciferase gene) (thunder waits eastwards, 1993,1994) is so kind as to give for biochemical Mr. Wu Xiangfu of institute in Chinese Academy of Sciences Shanghai.Baculovirus transfer vector pVL1393-appA and pVL1393-opd are this laboratory and preserve.AppA is a kind of colibacillary new and effective phytase that derives from.Opd is the opd of a kind of Pseudomonas of deriving from sp.92.The pCI-Neo carrier comes from Promega company.
The used conventional gene clone operation of present embodiment is as follows:
1 enzyme is cut and ligation
Endonuclease reaction: DNA analyzes with BamHI and EcoRI double digestion behind the purifying, and the reaction cumulative volume is 50 μ l, the PCR product 10 μ l of purifying wherein, and the corresponding damping fluid 5 μ l of 10 * enzyme, two kinds of enzymes respectively are 1 μ l, sterilized water is supplied volume.37 ℃ of reactions are more than 2 hours.Transferring plasmid pGEM-3Z is made same endonuclease reaction.Reaction finishes the back in 65 ℃ of deactivations 10 minutes.
Ligation: connect cumulative volume 15 μ l, PCR product 8 μ l, carrier 1 μ l, 5 * T4DNA connects damping fluid 3 μ l, T4DNA ligase enzyme 1 μ l, sterilized water is supplied volume, and 12~14 ℃ of connections are spent the night.
2. the genetic transformation of enterobacteria
Use 75mM CaCl 2Preparation e. coli tg1 competent cell.Get the connection mixture 5 μ l of preparation in the step 4, be added in the 200 μ l competent cells, mixing gently, ice bath 30 minutes, 42 ℃ of heat shocks 2 minutes placed rapidly 1~2 minute on ice, add and be incubated to 37 ℃ LB substratum 500 μ l, cultivated 1 hour for 37 ℃, get 100~200 μ l and coat on the LB solid medium flat board that contains 100 μ g/ml penbritins (Amp), be inverted overnight incubation for 37 ℃.
3. the preparation of plasmid DNA
(1) the single bacterium colony of picking from the LB flat board that transforms is inoculated in 3ml and contains in the LB substratum of 100 μ g/ml Amp 37 ℃ of overnight incubation.
(2) get 1.5ml bacterium liquid in little centrifuge tube, the centrifugal 4min of 3500rpm removes supernatant.
(3) add Solution I 150 μ l, mixing is placed on 15min on ice.
(4) add Solution II 300 μ l, chloroform 150 μ l leave standstill 5min behind the mixing gently.
(5) add Solution III 450 μ l, mixing is placed on 15min on ice.
(6) the centrifugal 10min of 11000g, supernatant move into new pipe.
(7) add Virahol 450 μ l, mixing is placed on 4 ℃ of 15min.
(8) the centrifugal 6min of 11000g removes supernatant.
(9) add TER 250 μ l, mixing is placed on 37 ℃ of 20min.
(10) add PPt Buffer 300~350 μ l, leave standstill 15min behind the mixing.
(11) the centrifugal 6min of 11000g removes supernatant.
(12) add 75% ethanol, 400 μ l.
The centrifugal 3min of 11000g outwells ethanol, drains the back and adds 0.1 * TE Buffer, 40 μ l dissolving, in-20 ℃ of preservations.
Present embodiment has following algorithm:
Step (1), the baculovirus transfer vector and the baculovirus DNA that will contain the expression cassette of early promoter, foreign gene and enhanser are recombinated; Comprise following experimentation:
The clone of experiment one, ie-1 promotor:
1. the preparation of free virus genomic dna
Get AcMNPV and BmNPV virus infection cell conditioned medium or centrifugal after sick silkworm hemolymph 150 μ L, add mixing behind the NaOH solution of 150 μ L 0.5mol/L, place 5min under the room temperature; Add the NH4Ac solution of 20 μ L 8mol/L again, place 5min behind the mixing, with isopyknic phenol and chloroform respectively extracting once, behind the alcohol precipitation with 20 μ L, 1 * TE damping fluid dissolving DNA.
2. according to the AcMNPV that has reported and two primers of BmNPV ie-1 gene promoter sequence design, upstream primer (F): 5 ' TAGAATTCATCCCAACGGCGCAGTGTAC3 '; Downstream primer (R): 5 ' ATGGATC CAATAGTCGTTTGGTTCACG 3 '.Synthetic by Shanghai bio-engineering corporation.
3. the virus genom DNA with preparation in the method 1 carries out the PCR reaction as template, amplification ie-1 promoter sequence.The PCR reaction system is as follows:
Figure C20041003775000131
PCR reaction process: 94 ℃ of sex change 10 minutes; 94 1 minute, 56 1 minute, 72 1 minute, totally 28 circulations.Last extension 5 minutes.
4. the ie-1 promoter sequence product with pcr amplification carries out 1% agarose gel electrophoresis, finds to amplify the fragment of about 360bp.Under ultraviolet lamp, cut the gel that contains corresponding DNA fragments, carry out purifying with the Geneclean test kit then with the sterilization scalpel.Method is as follows: cut gel fragment and weigh, put it in the little centrifuge tube of 1.5ml of sterilization, add the 6M NaI of 3 times of (v/w) volumes, 37 ℃ with after the gel dissolving, add 10 μ l glass milk (Glass milk), placed 5 minutes under the room temperature behind the mixing, make DNA fully be adsorbed on the glass milk 12,000rpm centrifugal 5 seconds, it is inferior to give a baby a bath on the third day after its birth with New Wash solution again, all precipitation is upspring at every turn, and centrifugal.At last precipitation is dried the back and add 30 μ l, 0.1 * TE Buffer dissolving DNA, get supernatant after centrifugal.
5. with the PCR product behind BamHI and the EcoRI double digestion purifying, simultaneously with BamHI and EcoRI double digestion pGEM-3Z carrier.After the deactivation ie-1 promoter fragment and carrier after enzyme is cut spent the night with the T4DNA ligase enzyme and be connected.Picking list bacterium colony is cultivated in liquid LB substratum behind the transformed competence colibacillus e. coli tg1, the extracting plasmid DNA by enzyme cut with two kinds of methods of PCR to identify recon.Correct recon called after pBmIE-1 and pAcIE-1 will be identified.
The clone of experiment two, enhanser hr3
1. from the BmNPV genome, isolate the fragment of 25kb with SmaI,
2. obtain the PstIK fragment with the PstI enzymolysis, the PstID fragment of 12.5kb, the fragment of 5.3kb and 2.0kb (two ends should be SmaI and PstI end),
3. use the pUC19 carrier of cutting through the PstI enzyme therefrom to clone the PstIK fragment, obtain recombinant plasmid pBhr3,
4. the PstIK fragment is cut with the DraI enzyme, the DraI fragment of gained is the 651bp sequence that contains hr3, inferior fragment cloning is entered the SmaI site of pUC19.
5. order-checking confirms correctly to clone the hr3 enhancer sequence with 3 EcoRI sites.The nucleotide sequence of hr3 as shown in Figure 1.
6. the hr3 among the pUC19 is cloned in the pSK carrier.
The structure of experiment three, reporter plasmid
1. by BamHI the about 1.8Kb of Luciferase gene is cloned into the downstream of the ie-1 promotor of experiment pBmIE-1 of one gained and plasmid, called after pBmIE-1Luc and pAcIE-1Luc from the pUL220 Central Asia.
2. be template with pBmIE-1Luc or pAcIE-1Luc, the primer amplification of available amplification ie-1 promotor goes out the fragment about 360bp.About visible 3Kb and two bar segment about 1.8Kb,, prove that Luciferase is in the control of ie-1 promotor and descends during with XbaI enzymolysis pBmIE-1Luc or pAcIE-1Luc electrophoretic analysis with conclusive evidence gene direction of insertion.
3. be cloned in the about 0.7Kb subclone of hr3 sequence among the pSK-hr3 to pBmIE-1 and pAcIE-1, called after pBmIE-1hr3 and pAcIE-1hr3 with the XbaI/HindIII restriction enzyme site with former.
With the BamHI site with Luciferase gene subclone to pBmIE-1hr3 and pAcIE-1hr3, be built into pBmIE-1Luchr3 and pAcIE-1Luchr3 carrier.This carrier carries out the visible 3.0Kb of enzymolysis electrophoretic analysis, 1.8Kb, 0.7Kb three bands with XbaI/HindIII, proves that the hr3 sequence is in Luciferase gene downstream, and pBmIE-1Luchr3 and pAcIE-1Luchr3 successfully construct.PBmIE-1Luchr3 and pAcIE-1Luchr3 simplified schematic diagram are as shown in Figure 2.
Experiment four, the transient expression of reporter plasmid in insect cell line and silkworm larva
1. inoculate 10 6Cell is in 15cm 2In the culturing bottle, adherent culture is spent the night.
2. remove the substratum that contains FBS, wash cell three times with the substratum that does not contain FBS, adding 1.5mL does not have the FBS substratum.
3. add 2 μ g plasmid DNA and an amount of Lipofectin in 100 μ L reaction systems, mixing leaves standstill 15min gently.In insect cell, this 100 μ L liquid is dropwise added in the culturing bottle during transient expression, shake up while dripping; Carry out the transient expression analysis if be in the living silkworm, then the amount of this 100 μ L liquid with 20 μ L/ heads is injected in the silkworm body, get silkworm hemolymph after continuing to raise 48h.
4.4h former no FBS substratum is removed in hypsokinesis, adds 3mL and contains the FBS substratum.Cultivate 48h for 27 ℃.
5. behind the transfection 48h, collecting cell or silkworm hemolymph are transferred in the 1.5mL centrifuge tube on ice, and 4 ℃ with the centrifugal 5min of 12000r/min
6. remove supernatant, after precipitation is washed with 1 ice-cold * PBS, add the once abundant lysing cell of 500~1000 μ L lysis buffers (Promega company product, model are E4030) freeze thawing
7. get supernatant after centrifugal and measure the luciferase vigor.Get 15 μ L luciferase analytical reagents in measuring pipe, with the cell extract of preparation, after doing suitably to dilute with stoste or with cell pyrolysis liquid as requested, get certain volume and put into the said determination pipe, make it mixing 2~3 times with the quick suction of Tip head, place liquid glimmer instrument to measure the CPM value, measuring temperature is 25 ℃, and the luciferase vigor is represented (Idahl LA with the bright subnumber in the 15s, et al, Anal Biochem, 1986,155:177-181).
8. be the deviation of the Luciferase expression amount avoiding causing because of the host cell quantity variance, this experiment is proofreaied and correct with the total protein content of cell pyrolysis liquid supernatant on the basis that as far as possible keeps the cell state unanimity.Bovine serum albumin is mixed with normal concentration protein (0.5mg/mL), carries out quantification of protein with microplate reader pair cell extract.
Reorganization reporter plasmid pBmIE-1Luc and pBmIE-1Luchr3 and pAcIE-1Luc and pAcIE-1Luchr3 all have transient expression in silkworm BmN clone, silkworm Bm5 clone, autumn mythimna separata sf-21 clone and five-age larva, and the result shows that hr3 can significantly strengthen the activity of ie-1 promotor, and concrete outcome is shown in table 1,2.
Step (2), usefulness recombinant virus infection insect host and cell; Comprise following experimentation:
The structure of experiment five, baculovirus expression transfer vector and recombinant virus
5.1 be used to express the transfer vector structure of eurytropy, height ratio appA phytase alive
5.1.1 the ie-1 promotor among the pBmIE-1 is connected in the pKS carrier of same double digestion with behind BamHI and the EcoRI double digestion purifying, obtains pKSBmIE-1
5.1.2 to obtain plasmid vector pVL1393-ie1-appA among the baculovirus transfer vector pVL1393-appA that has the appA gene that is connected to same double digestion behind BamHI and the EcoRV double digestion pKSBmIE-1 purifying
5.1.3 with the hr3 among the pUC19 by public restriction enzyme site enzyme cut, mend change pKS over to after flat after available PstI cut out the hr3 fragment
5.1.4 cut out hr3 in the PstI site of inserting pVL1393-ie1-appA behind the purifying by PstI, obtain the baculovirus transfer vector pVL1393-ie 1-appA-hr3 that forward inserts hr3, called after pie1-appA-hr3 cut the direction of identifying hr3 by the EcoRI enzyme after
5.2 be used to express the transfer vector structure of opd
5.2.1, substitute former polyhedron promotor with the ie-1 promotor and obtain pBacPAK8-ie1 to be connected among the pBacPAK8 of same double digestion behind BamHI and the EcoRV double digestion pKSBmIE-1 purifying
5.2.2 with BamHI and XhoI double digestion pBacPAK8-ie1, with separate, the opd fragment cloning of purifying goes among the pVL1393-opd of same double digestion, obtains pBacPAK8-ie1-opd
5.2.3 hr3 cut out with XhoI+XbaI and separation, purifying after insert among the pBacPAK8-ie1-opd of same double digestion, obtain baculovirus transfer vector pBacPAK8-ie1-opd-hr3, and called after pie1-opd-hr3
5.3 be used to express the transfer vector structure of appA phytase and opd
5.3.1 the description of product preparation 1 * TC-100 of Invitrogen company substratum is pressed in the breeding of silkworm nuclear polyhedron wild virus and BmBacPAK6 and the preparation of viral DNA, with 2N NaOH pH is transferred to 6.22, substratum after the filtration sterilization is added 10% foetal calf serum, cultivates bombyx mori cell Bm-5 down for 27 ℃.Infect the about 50ml of cell of logarithmic phase with silkworm nuclear-polyhedrosis virus parent plant BmNPV-ZJ8, infection multiplicity is 1, collect virus infection liquid after 3~4 days, centrifugal (5000rpm * 10min), remove precipitation, supernatant is used centrifugal 1 hour of 25000rpm, removes supernatant, (contains Tris 12.1g among the 1000ml with 1ml viral DNA extract, EDTA 33.6g, KCl 14.1g, pH7.5) suspension virus particle precipitation is transferred in the 1.5ml centrifuge tube, adding Proteinase K to final concentration is 50 μ g/ml, 50 ℃ of insulations 2 hours, add again 35% Sarkorsel to final concentration be 1%, continue at 50 ℃ of insulations 2 hours, use isopyknic phenol respectively, phenol: chloroform (1: 1) chloroform extracting successively, in upper water phase transition to a new pipe, add the 3M NaCl of 1/10 volume, add the dehydrated alcohol of 2 times of volumes again,-20 ℃ of placements precipitated viral DNA more than 2 hours, centrifugal 10 minutes of 5000rpm, precipitation is washed once lyophilize with 75% ethanol.Be dissolved among the 100 μ l TE Buffer, it is standby to put 4 ℃ of preservations.
5.3.2 cotransfection
Inoculate about 1 * 10 6Cell is in 15cm 2In the culturing bottle, behind the cell attachment, remove and contain foetal calf serum (FBS) substratum, give a baby a bath on the third day after its birth time with the substratum that does not contain FBS, adding 1.5ml does not have the FBS substratum.The parental virus DNA that in sterile tube, adds wild silkworm baculovirus of 1 μ g or linearization successively, 2 μ g recombinant transfer plasmid pie1-appA-hr3 or pie1-opd-hr3DNA and 5 μ l liposomes, supply volume to 60 μ l with aseptic double-distilled water, mixing gently, after leaving standstill 15 minutes, dropwise join and carry out cotransfection in the culturing bottle.Cultivate after 4 hours for 27 ℃ and add 1.5ml serum free medium and 300 μ l FBS.27 ℃ of constant temperature culture 4~5 days are collected the screening that supernatant liquor is used for recombinant virus.
5.3.2 screening and the purifying of recombinant silkworm baculovirus rBmNPV (ie1-appA-hr3 or ie1-opd-hr3)
Inoculate an amount of cell (about 70~80%) in the little plate of 35mm, behind the cell attachment, inhale and remove substratum, the cotransfection supernatant is carried out the different concns dilution, get 1ml corotation dye liquor and be added in the attached cell, be evenly distributed.27 ℃ were infected after 1 hour, suction removes to infect liquid, 2% low melting point sepharose is melted in 60 ℃ of water-baths, being chilled to 40 ℃ of 2 * TC-100 substratum (containing 20%FBS) with 40 ℃ of preheatings mixes, every plate adds 4ml glue, wait to solidify the back and seal, be inverted for 27 ℃ and cultivated microscopic examination 3~5 days with Parafilm.To not contain polyhedrosis plaque and pick out, repeat above step, obtain pure recombinant silkworm baculovirus rBmNPV through 2~3 purifying of taking turns.
5.3.3 the amplification of recombinant virus rBmNPV in bombyx mori cell
With the BmN cell of recombinant silkworm baculovirus rBmNPV (ie1-appA-hr3 or ie1-opd-hr3) infection normal growth, cultivate and collect supernatant liquor after 3 days, promptly contain a large amount of recombinant virus rBmNPV in the supernatant liquor.
Step (3), the infected insect host of cultivation or cell make it carry out Recombinant Protein Expression; Collection contains the insect body or the cell of recombinant protein; Comprise following experimentation::
Experiment six, appA and the expression of opd gene in silkworm
The used silkworm high expression level kind of this experiment is JY1 (being preserved by this laboratory).JY1 kind silkworm rearing is pressed the ordinary method of " Chinese sericulture " (Shanghai science tech publishing house, 1991) of Lv Hongsheng chief editor and is carried out.To select 15 identical boss silkworms of mean body weight be one group to 24h behind the five age first feedings, and every silkworm inoculates about 1.0 * 10 5RBmNPV promptly contains 2.0 * 10 in the 5 μ l inoculation liquid 7The rBmNPV of pfu/ml (ie1-appA-hr3 or ie1-opd-hr3), the recombinant virus infection silkworm larva that contains appA and opd gene under controlling with the polyhedron promotor respectively is as experiment contrast.Blood sampling and measure appA or the opd enzyme activity, triplicate during respectively by 24h, 36h, 48h, 60h, 72h, 84h, 96h, 108h behind virus infection.Every ml silkworm hemolymph appA enzyme activity reaches 8340.50 units during 108h, and is higher by 36.63% than the expression amount with under the control of utmost point late promoter of routine.The phase result, begins to express from infective virus 36h by shown in the table 3 during the expression of Opd enzyme, and along with the increase of time, expressed enzyme is lived also to be increased thereupon, reaches the highlyest behind virus infection in 108 hours, and every ml silkworm hemolymph opd enzyme activity reaches 90423.55 units.When employing was carried out the exogenous gene expression strategy with the ie1-opd-hr3 expression cassette, the expression of exogenous gene amount was higher by 32.37% than the conventional expression amount with under the control of utmost point late promoter.
Step (4), also can utilize described promotor, enhanser to make up through resistance screening, direct stably express in cell comprises following experimentation:.
The stably express experiment of experiment seven, ie-1-hr3 expression cassette
The Neo selective marker is obtained from pCI-Neo by the BamHI-NotI enzymolysis, with above-mentioned pBmie-1-luc-hr3, pAcie-1-luc-hr3 reporter plasmid with enzymolysis such as NotI, mend flat latter linked clone's strategy by connecting, obtain stably express carrier pBmie-1-luc-hr3-Neo, the pAcie-1-luc-hr3-Neo of available microbiotic G418 screening.
The reporter plasmid of above-mentioned two stably express is distinguished transfection Sf and Bm cell with preceding method, and by obtain the clone of stably express by the three-wheel screening from low to high of G418 concentration, the bursting resistance cell is measured the light quantity subnumber in the cell pyrolysis liquid, the results are shown in table 4.

Claims (10)

1. the preparation method of an insect baculovirus bio-reactor has following algorithm:
(1), the baculovirus transfer vector and the baculovirus DNA of expression cassette that will contain promotor, foreign gene and the enhanser of baculovirus utmost point early gene 1 recombinated; (2), with recombinant virus infection insect host or insect cell; (3), cultivating infected insect host or insect cell makes it carry out Recombinant Protein Expression; Collection contains the insect body or the insect cell of recombinant protein; (4) or utilize described promotor, enhanser to make up, direct stably express in insect cell through resistance screening.
2. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that described baculovirus is following a kind of:
BmNPV、AcMNPV、ApNPV、BsSNPV、CfMNPV、EoSNPV、HaNPV、HzNPV、LdMNPV、MbMNPV、OpMNPV、SlMNPV、SeMNPV、TeNPV。
3. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that described insect host is following a kind of:
Silkworm, wild silkworm, Semen Ricini silkworm, wild silkworm, Philosamia cynthia, tussah, yamama, wild giant silkworm, autographa california, tea geometrid, cabbage army worm, autumn mythimna separata, cabbage looper, armyworm, bollworm, the cotton mythimna separata of the U.S., oriental tobacco budworm, cigarette beetle, oriental armyworm or gypsymoth;
Described insect cell is following a kind of:
Sf-9, Sf-21, Hi5, S2, Bm5, BmN, Tn cell.
4. according to the preparation method of the described bio-reactor of claim 3, it is characterized in that: described insect host is a silkworm, and described baculovirus is silkworm baculovirus or AcMNPV.
5. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that: the promotor of the baculovirus utmost point early gene 1 of described baculovirus delivery carrier and the combination of virus enhancer drive expression of exogenous gene, both sides are the homologous sequence of viral DNA, obtain the expression recombinant virus in order to carry out homologous recombination.
6. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that: the stably express described in the algorithm (4) is: the expression cassette that the combination of the promotor of above-mentioned baculovirus utmost point early gene 1 and virus enhancer is driven exogenous gene expression is implemented in the universal support of resistant gene, to carry out stably express or transient expression in insect or insect cell.
7. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that described recombinant virus is through port food or sees through epidermis and infect the 1-5 insect larvae or the pupal cell in age.
8. according to the preparation method of the described bio-reactor of claim 1, it is characterized in that: the promotor of described baculovirus utmost point early gene 1 is the promotor of the baculovirus utmost point early gene 1 of source BmNPV or AcMNPV; Described enhanser is the homology iteron 3 that derives from BmNPV; Described reorganization is meant to be transferred to foreign gene on the genome of silkworm baculovirus parent plant, substitute the polyhedron gene on the viral genome, by plaque select technology and PCR detection technique, obtain the recombinant silkworm baculovirus of carrying foreign gene then; Described infection is the silkworm larva or the pupa in the recombinant silkworm baculovirus infection bombyx mori cell that will obtain or percutaneous puncture-inoculation 1-5 age; After infecting 3-6 days, collect and contain the silkworm larva of expression product or the body fluid or the tissue homogenate of pupa.
9. the application of the expression cassette that is utilized in the method for claim 1, it is characterized in that: this expression cassette that contains promotor, foreign gene and the enhanser of baculovirus utmost point early gene 1 is applied to prepare baculovirus genetically engineered sterilant, and is applied to the exogenous gene expression of transgenic insect.
10. the application of the carrier that is utilized in the method for claim 6, it is characterized in that: contain the promotor that has above-mentioned baculovirus utmost point early gene 1 and the expression cassette of virus enhancer in the described carrier, be used for the foreign gene stably express or the transient expression of insect cell.
CNB2004100377502A 2004-05-11 2004-05-11 High-performance bioreactor for baculovirus of insects Expired - Fee Related CN100410383C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2004100377502A CN100410383C (en) 2004-05-11 2004-05-11 High-performance bioreactor for baculovirus of insects

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2004100377502A CN100410383C (en) 2004-05-11 2004-05-11 High-performance bioreactor for baculovirus of insects

Publications (2)

Publication Number Publication Date
CN1696294A CN1696294A (en) 2005-11-16
CN100410383C true CN100410383C (en) 2008-08-13

Family

ID=35349186

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2004100377502A Expired - Fee Related CN100410383C (en) 2004-05-11 2004-05-11 High-performance bioreactor for baculovirus of insects

Country Status (1)

Country Link
CN (1) CN100410383C (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100497612C (en) * 2006-01-25 2009-06-10 中国农业科学院生物技术研究所 Thermostable lactase preparation method
CN101358204B (en) * 2008-08-29 2011-05-18 浙江理工大学 Method for preparing cellular membrane and cellular organelle membrane protein after human enveloped virus budding
CN102286534B (en) * 2011-05-30 2013-01-23 中国农业科学院生物技术研究所 Insect bioreactor capable of expressing multiple exogenous genes, and construction method and application thereof
CN102321635B (en) * 2011-09-02 2014-02-26 中国农业科学院生物技术研究所 Preparation method for human papillomaviral empty capsid particles, and products thereof
CN102492691B (en) * 2011-12-16 2013-05-15 西南大学 Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression
WO2013148260A1 (en) 2012-03-30 2013-10-03 Washington University Methods for modulating tau expression for reducing seizure and modifying a neurodegenerative syndrome
CN104735977B (en) * 2012-06-12 2016-09-21 替代基因表达公司 For expressing the baculovirus DNA element of recombiant protein in host cell
CN102885011A (en) * 2012-10-29 2013-01-23 浙江大学 Novel method for infecting silkworms with recombinant baculovirus
MX2015012621A (en) 2013-03-14 2016-05-31 Ionis Pharmaceuticals Inc Compositions and methods for modulating tau expression.
TW202246503A (en) 2013-07-19 2022-12-01 美商百健Ma公司 Compositions for modulating tau expression
CN103555675B (en) * 2013-11-12 2016-06-22 辽宁省农业科学院大连生物技术研究所 Insect cell High Five application in cultivating Antheraea pernyi nuclear polyhedrosis virus
CN105002132B (en) * 2015-08-19 2018-05-29 中国科学院武汉病毒研究所 It is a kind of in II group of A type baculoviral Bacmid of various insects cell expresses exogenous albumen and application
US11278014B2 (en) * 2015-09-17 2022-03-22 Alternative Gene Expression, S.L. Expression of recombinant proteins in Trichoplusia ni pupae
CN105238816B (en) * 2015-10-26 2018-08-24 广州汉腾生物科技有限公司 A kind of expression vector
US11473055B2 (en) * 2015-11-01 2022-10-18 Glycobac, Llc Virus-free cell lines and methods for obtaining same
JOP20190065A1 (en) 2016-09-29 2019-03-28 Ionis Pharmaceuticals Inc Compounds and methods for reducing tau expression
US20190365852A1 (en) * 2018-05-30 2019-12-05 Academia Sinica Recombinant baculoviruses and uses thereof
CN110964749A (en) * 2018-09-29 2020-04-07 普莱柯生物工程股份有限公司 Method for efficiently expressing foreign protein in baculovirus expression system and application thereof
CN110423781A (en) * 2019-08-13 2019-11-08 江西晶美瑞生物医药有限公司 A kind of carrier pAntigen of mammlian system high efficient expression Membrane protein antigen
CN111321124A (en) * 2020-04-15 2020-06-23 江苏艾津农业科技服务有限公司 Preparation method of spodoptera litura nuclear polyhedrosis virus
CN112852883B (en) * 2021-03-03 2023-06-06 浙江理工大学 Method for titrating recombinant baculovirus based on coexpression secretory luciferase

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997023636A1 (en) * 1995-12-22 1997-07-03 E.I. Du Pont De Nemours And Company Production of recombinant baculoviruses
CN1410540A (en) * 2001-09-29 2003-04-16 中国农业科学院蚕业研究所 Method of producing broad adaptability, high specific activity phytase and acidic phosphoesterase using silkworm bioreactor

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997023636A1 (en) * 1995-12-22 1997-07-03 E.I. Du Pont De Nemours And Company Production of recombinant baculoviruses
CN1410540A (en) * 2001-09-29 2003-04-16 中国农业科学院蚕业研究所 Method of producing broad adaptability, high specific activity phytase and acidic phosphoesterase using silkworm bioreactor

Also Published As

Publication number Publication date
CN1696294A (en) 2005-11-16

Similar Documents

Publication Publication Date Title
CN100410383C (en) High-performance bioreactor for baculovirus of insects
CN104788554B (en) Cat omega interferon mutant and its preparation method and application
CN101121938B (en) Method for preparing foot-and-mouth disease antigen
CN101307317B (en) Method for preparing rabies virus antigen
JP2023098990A (en) Expression of Recombinant Proteins in Trichoplusia ni Pupae
CN102628062B (en) Expression method of animal alpha interferon and gamma interferon
CN107873052B (en) Compositions and methods for pest control management
CN104059927B (en) Preparation method of newcastle disease glycoprotein viral antigen and products thereof
CN106987603A (en) A kind of preparation method of recombinant adeno-associated virus
US20200140890A1 (en) Pyralid moth egg, producing method thereof, and method for producing recombinant protein by using pyralid moth egg
CN102304529B (en) Preparation method of rabbit hemorrhagic fever virus empty capsid antigen
CN104017826A (en) Engineered bombyx mori baculovirus vector and method of increasing the NS1 expression amount by utilization of the vector
CN102286534B (en) Insect bioreactor capable of expressing multiple exogenous genes, and construction method and application thereof
CN106566829A (en) Nucleocapsid assembling necessary element and application thereof
CN100497612C (en) Thermostable lactase preparation method
CN101285072A (en) Process for enhancing gene level of expression of baculoviral expression carrier
Arakawa et al. Flufenoxuron, an insect growth regulator, promotes peroral infection by nucleopolyhedrovirus (BmNPV) budded particles in the silkworm, Bombyx mori L.
CN1089368C (en) Method for producing phytase using silkworm biological reactor
CN110343720A (en) A kind of method and its recombinant baculovirus and application enhancing baculovirus infection
Nai et al. A new nucleopolyhedrovirus strain (LdMNPV-like virus) with a defective fp25 gene from Lymantria xylina (Lepidoptera: Lymantriidae) in Taiwan
CN112359064B (en) Application of methyl-beta-cyclodextrin in improving transduction efficiency of baculovirus to mammalian cells
CN102911947A (en) Porcine circovirus (PCV) type 2 Cap protein and preparation method thereof
Amer Baculovirus expression vector system: An efficient tool for the production of heterologous recombinant proteins
Zhu et al. CRISPR/Cas9-mediated disruption of orf76 as an antiviral therapy against BmNPV in the transgenic silkworm
Ghosh Genetic Characterization of Nucleopolyhedrovirus Isolated from Hyposidra talaca Walker (Lepidoptera: Geometridae), a Tea Pest in Terai Region of Darjeeling Foothills, India.

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080813

Termination date: 20110511