CN100497612C - Thermostable lactase preparation method - Google Patents
Thermostable lactase preparation method Download PDFInfo
- Publication number
- CN100497612C CN100497612C CNB200610001785XA CN200610001785A CN100497612C CN 100497612 C CN100497612 C CN 100497612C CN B200610001785X A CNB200610001785X A CN B200610001785XA CN 200610001785 A CN200610001785 A CN 200610001785A CN 100497612 C CN100497612 C CN 100497612C
- Authority
- CN
- China
- Prior art keywords
- silkworm
- celb
- baculovirus
- enzyme
- thermostable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
This invention discloses a new preparation for the heatproof lactobionic enzyme, which belongs to the biology technique filed. This invention includes the following steps: constructing the heatproof lactobionic enzyme gene onto the baculoviral vector to obtain the recombining baculoviral vector; through internal or external combining, conforming the heatproof lactobionic enzyme gene on the baculoviral gene group to obtain the recombining baculoviral; using the obtained recombining baculoviral to infect the insect host; culturing the infected insect hose to do the heatproof lactobionic enzyme expression; collecting and purifying the expression product. This invention can produce cheap heatproof l lactobionic enzyme with high efficient and large scale, and the product can be used in foodstuff and feedstuff production field extensively.
Description
Technical field
The present invention relates to a kind of preparation method of enzyme, relate in particular to a kind of method of utilizing baculovirus expression system to produce thermostable lactase, belong to biological technical field.
Background technology
This bio-reactor of baculovirus expression system is that the eighties is set up.(Smith since nineteen eighty-three utilizes baculovirus expression system to efficiently express people's alpha-interferon first, Mol.CellBiol., 3:2156-2165,1983), existing dozens of foreign gene has obtained efficiently expressing, only just there are alpha-interferon (Yang Guanzhen etc. in China, Acta Biochimica et Biophysica Sinica, 22:355-361,1990), arrowhead proteinase inhibitor (season equality, silkworm industry science, 21:223-227,1995), Mareks disease virus Glycoprotein B (Xiao Qingli etc., silkworm industry science, 23:104-108,1997) etc. multiple.The advantage of utilizing this system to produce thermostable lactase is: 1. the expression efficiency of this expression system is high, and output can reach the level of 10 milligrams of level/worms, that is more than every silkworm 3000U.Thereby can reduce the production cost of thermostable lactase greatly and make thermostable lactase scale operation become possibility; 2. this expression system is an eukaryotic expression system, the exogenous protein of its expression can carry out posttranslational modification, make it similar to natural product with biological activity etc. at biochemical property, this provides assurance for the thermostable lactase that gives expression to has normal biologic activity.3. but the thermostable lactase of producing with this system only needs just purifying of high temperature, has reduced production cost.At present, baculovirus expression system, silkworm especially wherein (Bm)-silkworm baculovirus (BmNPV) expression system are one of individual expression systems of eukaryote that has most in the world business development value.
The CelB gene of cloning from high temperature resistant ancient microorganism is once in escherichia expression system (VoorhorstW., et al, J.Bacteriol., 177,7105-7111,1995; Lebbink J., et al, Methods Enzymol, 330,364-379,2001) and Bichi yeast system (Smith J., et al., Biotechnol.Bioeng., 79 (7): 713-723,2002) express in, but expression amount is all very low, is not enough to scale operation.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiencies in the prior art, and a kind of preparation method of efficient, cheap, large-scale thermostable lactase is provided.
Technical problem to be solved by this invention realizes by following technological approaches:
A kind of preparation method of thermostable lactase may further comprise the steps:
Thermostable lactase is gene constructed to baculovirus delivery carrier, obtain recombinant baculovirus delivery carrier; By in the body or vitro recombination, the thermostable lactase gene integration to the genome of baculovirus, is obtained recombinant baculovirus; With resulting recombinate shape virus infection insect host; Cultivating infected insect host makes it carry out the expression of thermostable lactase; Collection, the expressed recombination high temperature-resistant Sumylact L of purifying, promptly.
Among the above-mentioned preparation method, described thermostable lactase gene can be for deriving from the thermostable lactase gene of various high temperature microbes, plant etc., be preferably the CelB gene that derives from strong red-hot archeobacteria (Pyrococcusfuriosus) bacterial strain, this gene has the nucleotide sequence shown in the SEQ ID NO:1, and the aminoacid sequence of this coded by said gene is shown in SEQ ID NO:2.
Described baculovirus delivery carrier can be selected from AcRP23-lacZ, AcRP6-SC, AcUW1-lacZ, BacPAK6, Bac to Pac, Bacmid, BlueBacII (pETL), p2Bac, p2Blue, p89B310, pAc360, pAc373, pAcAB3, pAcAB4, pAcAS3, pAcC129, C4, DZ1, pAcGP67, pAcIE1, pAcJP1, pAcMLF2, pAcMLF7, pAcMLF8, pAcMP1, pAcMP 2, pAcRP23, pAcRP 25, pAcRW4, pAcsMAG, pAcUW1, pAcUW 21, pAcUW 2A, pAcUW 2B, pAcUW 3, and pAcUW 31, and pAcUW 41, and pAcUW 42, pAcUW 43, and pAcUW 51, pAcVC2, pAcVC3, pAcYM1, pAcJcC5, pBac 1, and pBac 2, pBlueBacIII, pBlueBacHis, pEV55, mXIV, pIEINeo, pJVETL, pJVNhe1, pJVP10, pJVrsMAG, pMBac, pP10, pPAK1, pPBac, pSHONEX1.1, pSYN XIV VI+, pSYNVI+wp, pSYNXIV VI-, pVL1391, pVL1392, pVL1393, pVL941, pVL945, pVL985, pVL94, pVTBac, pBM030 or pUAC-5 are preferably pVL94.Because different transport vehicle is very big to the influence of expression efficiency, the structure of the dedicated carrier pVL1393 series of AcMNPV had proved the comparison success already.According to one's analysis, the key of expression efficiency is that the quality of promotor and near the sequential structure the translation starting point are to the mRNA stability of foreign gene and the influence of translation efficiency in the baculovirus bio-reactor.In view of the above, we have made up the novel dedicated expression vector therefor pVL94 that is suitable for silkworm baculovirus BmNPV (concrete building process is seen embodiment two), and this dedicated expression vector therefor can efficiently express in silkworm baculovirus.
Described recombinant baculovirus delivery carrier is preferably pVL94-CelB.
Described baculovirus is selected from BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, S1MNPV, SeMNPV or TeNPV, is preferably BmNPV.
Described recombinant baculovirus is preferably rBmNPVCelB, this recombinant baculovirus can prepare by the following method: thermostable lactase gene C elB is recombinated on the genome of silkworm baculovirus parent plant BmNPV, substitute the Polyhedrin gene on the viral genome, by plaque select technology and PCR detection technique, obtain to carry the recombinant silkworm baculovirus rBmNPVCelB of CelB then.
Described insect host comprises the insect to the baculovirus sensitivity, as silkworm (Bombyx mori), wild silkworm (Bombyx mandarina), Semen Ricini silkworm (Philosamia cynthia ricim), wild silkworm (Dictyoploca japanica), Philosamia cynthia (Philosamia cynthiapryeri), tussah (Antheraeapernyi), yamama (Antheraea yamamai), wild giant silkworm (Antheraea polyphymus), autographa california (Atographa califorica), tea geometrid (Ectropis obliqua), cabbage army worm (Mamestra brassicae), prodenia litura (Spodoptera littoralis), autumn mythimna separata (Spodopterafrugiperda), cabbage looper (Trichoplusia ni), armyworm (Thaumetopoea wilkinsoni), bollworm (Heliothis armigera), U.S. bollworm (Heliothis zea), oriental tobacco budworm (Heliothisassulta), cigarette beetle (Heliothis virescens), oriental armyworm (Pseudaletia separata) or gypsymoth (Lymantria dispar) etc. are preferably silkworm (Bombyx mori).
Described infection is meant infects the 1-5 insect larvae or the pupal cell in age with recombinant virus through port food or the approach by epidermis, and wherein, described insect larvae is preferably the insect larvae in 4 or 5 ages, and described pupal cell is preferably 1-3 days early stage tender pupa.
The method of described purification of Recombinant thermostable lactase is preferably the body fluid or the whole homogenate of collecting the silkworm larva or the pupa that contain the recombination high temperature-resistant Sumylact L, behind the body fluid or whole homogenate pyroprocessing collected, it is centrifugal to carry out normal temperature again, get supernatant, carry out spraying drying with 105-130 ℃ of vapo(u)rizing temperatures, promptly get the thermostable lactase behind the purifying; Wherein said high temperature is often referred to 80-95 ℃, is preferably 90 ℃; Described normal temperature is often referred to 4-42 ℃, is preferably 30 ℃.
The purification process of the gene engineering expression product of general silkworm baculovirus bio-reactor all carries out at low temperatures, and will be through a series of protein (ammonium sulfate) precipitation, concentrate, methods such as dialysis, column chromatography are with the expressed table thing of separation and purification.The present invention has designed an egg collection white matter purifying according to the enzymatic property of the thermostable of expression product and has concentrated, dryly is the purification process of one, has advantages such as step is simple and direct, cheap, quick, cost is low, security height.
The integral body of a most preferred technique scheme of the present invention is described:
To derive from the thermostable lactase gene C elB of high temperature extinct plants and animal, be inserted on the virus delivery carrier pVL94 that makes up voluntarily, obtain recombinant virus delivery carrier; Again by recombinating in the body the CelB transgenosis to the genome of silkworm baculovirus parent plant BmNPV, substitute the Polyhedrin gene on the genome, by plaque select technology and PCR detection technique, obtain to carry the recombinant silkworm baculovirus rBmNPV (CelB) of CelB; With the silkworm larva or the pupa in recombinant silkworm baculovirus rBmNPV (CelB) the infected silkworm clone that obtains or percutaneous puncture-inoculation 1-5 age, breed rBmNPV (CelB) in a large number.When rBmNPV (CelB) duplicated in the silkworm body, CelB expressed under the control of polyhedron gene (polh) promotor, produces thermostable lactase.Collect and contain the silkworm larva of thermostable lactase or the body fluid of pupa (or whole homogenate) infecting 3-6 days (best be 4.5-5 days) backs, after the pyroprocessing, it is centrifugal to carry out normal temperature, remove the silkworm body protein, get supernatant, carry out spraying drying, promptly get thermostable lactase with 105-130 ℃ of vapo(u)rizing temperatures.
The present invention uses insect larvae and pupa as bio-reactor scale operation thermostable lactase by baculovirus expression system, can efficiently express thermostable lactase.For example, every milliliter of silkworm hemolymph can produce the CelB albumen more than 3 milligrams, vigor is up to more than the 10000U, article one, the enzyme activity of silkworm (or pupa) generation is about more than 20,000 units (or 12000 units), at pH4.0-6.5, in the temperature 80-130 ℃ of scope, expressed enzyme all has very high vigor, helps zymin processing.The thermostable lactase that the present invention produces can add in food, milk preparation or the feed through behind the purifying, improves the nutritive ingredient in food, milk preparation or the feed, improves the nutritive value of food and feed.
The production cost that the inventive method is produced thermostable lactase also is starkly lower than the cost that utilizes escherichia expression system or Yeast system production thermostable lactase.
In a word, the invention provides a kind of efficient, cheap, produce the method for thermostable lactase on a large scale, can be widely used in food and fodder production field.
Description of drawings
Fig. 1 CelB gene is the phase curve when the intravital expression of host insect.
Fig. 2 thermostable lactase carries out the SDS-PAGE protein electrophoresis collection of illustrative plates after purifying and the processing.
1, the contrast of 4:10kDa standard protein molecular weight; 2: untreated β-glucosidase; 3: the β-glucosidase of preliminary purification; 5: the wild-type contrast.
The activity of Fig. 3 thermostable lactase under different pH condition.
The stability of Fig. 4 thermostable lactase under condition of different temperatures.
Further describe beneficial effect of the present invention by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.
Embodiment
Experiment material:
1. bacterial strain, virus strain and carrier: e. coli strains E.coli TG1 and DH
5 αAvailable from Promega company; PVL1393 (available from Clontech company), bombyx mori cell BmN, Bombyx mori nuclear polyhydrosis virus parent plant BmNPV (BmNPV, bombyx mori cell BmN also can buy from Clontech company and obtain) are so kind as to give by the biochemical Wu Xiangfu researcher of institute in Chinese Academy of Sciences Shanghai; Cultivated silkworm breed variety JY1 is preserved by the Ministry of Agriculture of Inst. of Silkworm, Chinese Academy of Agricultural Sciences silkworm biotechnology emphasis open laboratory; The ancient bacteria strain of high temperature is available from Japan Collection of Microorganisms, RIKEN.
2. enzyme and reagent: restriction enzyme, ligase enzyme, RNA enzyme, Proteinase K are Promega company product.
3. biochemical reagents: IPTG, X-Ga1, SDS and pNPG are Sigma company product.Ammonium persulphate, TEMED, acrylamide and methylene diacrylamide are Promega company product.Lipofectin, low melting point agarose LMP, PCR test kit, cell culture medium TC-100, foetal calf serum and other reagent are purchased the company in GIBCO-BRL.
4. substratum: the intestinal bacteria substratum be LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0); The bombyx mori cell substratum is TC-100 (available from Gibco company or a Sigma company).
Illustrate: make the experimental methods of molecular biology specify in following examples, all with reference to " (Sambrook etc. write molecular cloning test handbook, Science Press, version in 1992) listed concrete grammar carries out in the book, perhaps carries out according to test kit and product description.
The clone of embodiment one, CelB gene and sequential analysis
1, contains the preparation of high temperature resistant strong red-hot archeobacteria (Pyrococcus furiosus) genomic dna of CelB gene
(1) picking list bacterium colony, incubated overnight.
The centrifugal 2min of (2) 12,000rpm removes supernatant.
(3) add 0.05M Tris-Cl (pH8.0) damping fluid that 500 μ l contain 25% sucrose in the precipitation, mixing is resuspended, adds 100 μ l5mg/ml N,O-Diacetylmuramidases, mixing, 20 ℃ of incubation 1hr.
(4) add SET solution (150mM NaCl, 1Mm EDTA, the Tris-C1 of 20mM pH8.0), 500 μ l 5%SDS and 100 μ l 20mg/ml Proteinase Ks, mixing is in 37 ℃ of incubation 1hr.
(5) add equal-volume chloroform/primary isoamyl alcohol (24:1), mixing, 11, the centrifugal 5min of 000g, supernatant move into new pipe.
(6) add equal-volume phenol/chloroform/primary isoamyl alcohol (25:24:1), mixing, 11, the centrifugal 5min of 000g, supernatant move into new pipe.
(7) add the equal-volume chloroform, mixing, 11, the centrifugal 5min of 000g, supernatant move into new pipe.
(8) add 2 times of volume dehydrated alcohols, mixing precipitates to DNA gently, and 11, the centrifugal 5min of 000g removes supernatant.
(9) add 1ml70% alcohol in the precipitation.
The centrifugal 5min of (10) 11,000g removes supernatant, drains the back and adds 50 μ l, 0.1 * TE dissolving, in-20 ℃ of preservations.
2, pcr amplification CelB gene product
Chemosynthesis CelB gene 5 ' end and 3 ' end primer: 5 '-GAG GGA TCC AAT ATG AAGTTC CCA AAA AAC TTC ATG T-3 ' (Forward) and 5 '-AAA GAA TTC TGGCTA CTT TCT TGT AAC AAA TTT GAG-3 ' (Revise).Genomic dna with preparation in the step 1 carries out the PCR reaction as template, amplification CelB gene.
The PCR reaction system sees Table 1, the PCR reaction process: 94 ℃ of sex change 10 minutes; 94 ℃ 1 minute, 53 ℃ 1 minute 30 seconds, 72 ℃ 3 minutes, totally 35 circulations.Last 72 ℃ of extensions 10 minutes.
Table 1 PCR reaction system
3, the purifying of PCR product
The CelB gene product of pcr amplification is carried out 1% agarose gel electrophoresis, find to amplify the fragment of about 1.4kb.Under ultraviolet lamp, cut the gel that contains corresponding DNA fragments, carry out purifying with the Geneclean test kit then with the sterilization scalpel.Method is as follows: cut gel fragment and weigh, put it in the little centrifuge tube of 1.5ml of sterilization, the 6M NaI that adds 3 times of (v/w) volumes, 37 ℃ with after the gel dissolving, adds 10 μ l glass milk (Glass milk), placed 5 minutes under the room temperature behind the mixing, DNA fully is adsorbed on the glass milk, 12,000rpm centrifugal 5 seconds, use the resuspended precipitation of New Wash solution and centrifugal again, repeat 3 times.Precipitation is dried the back add 30 μ l, 0.1 * TE Buffer dissolving DNA, get supernatant after centrifugal to do further to analyze.
4, enzyme is cut and ligation
Endonuclease reaction: DNA analyzes with BamHI and EcoRI double digestion behind the purifying, and the reaction cumulative volume is 50 μ l, the PCR product 10 μ l of purifying wherein, and the corresponding damping fluid 5 μ l of 10 * enzyme, two kinds of enzymes respectively are 1 μ l, sterilized water is supplied volume.37 ℃ of reactions are more than 2 hours.Transferring plasmid pGEM-3Z is made same endonuclease reaction.Reaction finishes the back in 65 ℃ of deactivations 10 minutes.
Ligation: connect cumulative volume 15 μ l, PCR product 8 μ l, carrier 1 μ l, 5 * T
4DNA connects damping fluid 3 μ l, T
4Dna ligase 1 μ l, sterilized water is supplied volume, and 12～14 ℃ of connections are spent the night.
5, colibacillary genetic transformation
Use 75mM CaCl
2Preparation e. coli tg1 competent cell.Get the connection mixture 5 μ l of preparation in the step 4, be added in the 200 μ l competent cells, mixing gently, ice bath 30 minutes, 42 ℃ of heat shocks 2 minutes placed rapidly 1～2 minute on ice, add and be incubated to 37 ℃ LB substratum 500 μ l, cultivated 1 hour for 37 ℃, get 100～200 μ l and coat on the LB solid medium flat board that contains 100 μ g/ml penbritins (Amp), be inverted overnight incubation for 37 ℃.
6, the preparation of plasmid DNA
(1) the single bacterium colony of picking from the LB flat board that transforms is inoculated in 3ml and contains in the LB substratum of 100 μ g/ml Amp 37 ℃ of overnight incubation.
(2) get 1.5ml bacterium liquid in little centrifuge tube, 3, the centrifugal 4min of 500rpm removes supernatant.
(3) add Solution I 150 μ l, mixing is placed on 15min on ice.
(4) add Solution II 300 μ l, chloroform 150 μ l leave standstill 5min behind the mixing gently.
(5) add Solution III 450 μ l, mixing is placed on 15min on ice.
The centrifugal 10min of (6) 11,000g, supernatant move into new pipe.
(7) add Virahol 450 μ l, mixing is placed on 4 ℃ of 15min.
The centrifugal 6min of (8) 11,000g removes supernatant.
(9) add TER 250 μ l, mixing is placed on 37 ℃ of 20min.
(10) add PPt Buffer 300～350 μ l, leave standstill 15min behind the mixing.
The centrifugal 6min of (11) 11,000g removes supernatant.
(12) add 75% ethanol, 400 μ l.
The centrifugal 3min of (13) 11,000g outwells ethanol, drains the back and adds 0.1 * TE Buffer, 100 μ l dissolving, in-20 ℃ of preservations.
7, the evaluation of recon
With the plasmid DNA of preparation in BamHI and the EcoRI double digestion step 6, the plasmid that occurs the DNA band of about 1.4kb behind the electrophoresis is reorganization delivery plasmid.Recombinant plasmid pGEM-3Z (CelB) is carried out two-way order-checking, and sequencing result is seen SEQ ID NO:1, and institute's deduced amino acid is seen shown in the SEQ ID NO:2.
The structure of embodiment two, recombinant transfer vector pVL94 (CelB)
At first designed a pair of mutant primer, this primer sequence is as follows:
Primer1：5’gggatcccgatggtgggggtgtatgaataattcggaatattt
Primer2：5’aaagcttaactttatcc?aataatatat?tatgtata
Primer1 sports ATT with polyhedrosis initiator codon ATG, has introduced BamH I site at 5 ' end simultaneously, has kept transcription product and the raising translation efficiency of polyhedrosis gene sequence to stablize foreign gene of 35bp; In reverse primer Primer2, introduce the HindIII site and be beneficial to gene clone.
DNA with wild BmNPV is that template is carried out pcr amplification, the segment that will increase BamH I, behind the HindIII double digestion, be cloned into HindIII and the BamH I site of pUC18 (available from Gibco company), get carrier pUC-BH, further cut pVL1393 carrier (available from Clontech company) and get its 3 ' end homologous sequence with BamH I and Sal I enzyme, it is cloned among the carrier pUC-BH of the BamH I that contains promotor and 5 ' end homologous sequence and EcoR I double digestion by being connected, Klenow mends flat, to connect product transformed into escherichia coli TG1, screening obtains being suitable for the transfer vector pVL94 of silkworm baculovirus high expression level.
With plasmid pGEM-3Z (CelB) prepared among the embodiment one BamHI and EcoRI double digestion, press the method purifying CelB gene fragment of step 3 among the embodiment one, with transformed into escherichia coli TG1 after the baculovirus transfer vector pVL94 that cuts through same enzyme is connected, screen and obtain recombinant transfer vector pVL94-CelB.
The breeding of embodiment three, silkworm nuclear-polyhedrosis virus parent plant BmNPV and the preparation of viral DNA
Press the description of product preparation 1 * TC-100 of GIBCO company substratum, with 2N NaOH pH is transferred to 6.22, the substratum after the filtration sterilization is added 10% foetal calf serum, cultivates bombyx mori cell Bm-5 down for 27 ℃.Infect the about 50ml of cell of logarithmic phase with silkworm nuclear-polyhedrosis virus parent plant BmNPV, infection multiplicity is to collect virus infection liquid, centrifugal (5 after 1,3～4 days, 000rpm * 10min), remove precipitation, supernatant is with 25, centrifugal 1 hour of 000rpm, remove supernatant, with 1ml viral DNA extract (1, contain Tris 12.1g among the 000ml, EDTA 33.6g, KCl 14.1g, pH7.5) suspension virus particle precipitation is transferred in the 1.5ml centrifuge tube, and adding Proteinase K to final concentration is 50 μ g/ml, 50 ℃ are incubated 2 hours, add again 35% Sarkorsel to final concentration be 1%, continue at 50 ℃ of insulations 2 hours, use isopyknic phenol respectively, phenol: chloroform (1:1) chloroform extracting successively, in upper water phase transition to a new pipe, the 3M NaCl that adds 1/10 volume adds the dehydrated alcohol of 2 times of volumes again, and-20 ℃ of placements precipitated viral DNA more than 2 hours, 5, centrifugal 10 minutes of 000rpm, precipitation is washed once lyophilize with 75% ethanol.Be dissolved among the 100 μ l TE Buffer, it is standby to put 4 ℃ of preservations.Structure and the acquisition of embodiment four, recombinant silkworm baculovirus rBmNPV (CelB)
1. the structure of recombinant baculovirus rBmNPV (CelB)
Inoculate about 1 * 10
6Bombyx mori cell is in 15cm
2In the culturing bottle, behind the cell attachment, remove and contain foetal calf serum (FBS) substratum, give a baby a bath on the third day after its birth time with the substratum that does not contain FBS, adding 1.5ml does not have the FBS substratum, standby.
In a sterile tube, add 1 μ g silkworm baculovirus parent plant BmNPV DNA successively, 2 μ g recombinant transfer plasmid pVL94-CelB DNA and 5 μ l liposomes are supplied volume to 60 μ l, mixings gently with aseptic double-distilled water, after leaving standstill 15 minutes, dropwise join and carry out cotransfection in the above-mentioned culturing bottle.Cultivate after 4 hours for 27 ℃ and add 1.5ml serum free medium and 300 μ l FBS (available from Invitrogen company).27 ℃ of constant temperature culture 4～5 days are collected the screening that supernatant liquor is used for recombinant virus.
2. screening and the purifying of recombinant silkworm baculovirus rBmNPV (CelB)
Inoculate an amount of bombyx mori cell (about 70～80%) in the little plate of 35mm, behind the cell attachment, inhale and remove substratum, the cotransfection supernatant is carried out the different concns dilution, get 1ml corotation dye liquor and be added in the attached cell, be evenly distributed.27 ℃ were infected after 1 hour, suction removes to infect liquid, 2% low melting point sepharose is melted in 60 ℃ of water-baths, being chilled to 40 ℃ of 2 * TC-100 substratum (containing 20%FBS) with 40 ℃ of preheatings mixes, every plate adds 4ml glue, wait to solidify the back and seal, be inverted for 27 ℃ and cultivated microscopic examination 3～5 days with Parafilm.To not contain polyhedrosis plaque and pick out, repeat above step, obtain pure recombinant silkworm baculovirus rBmNPV (CelB) through 2～3 purifying of taking turns.
3. the amplification of recombinant virus rBmNPV (CelB) in bombyx mori cell
With the BmN cell of recombinant silkworm baculovirus rBmNPV (CelB) infection normal growth, cultivate and collect supernatant liquor after 3 days, promptly contain a large amount of recombinant virus rBmNPV (CelB) in the supernatant liquor.
4. the evaluation of recombinant virus
Utilize PCR method to analyze exogenous origin gene integrator.The extracting method of free virus genomic dna is as follows: get viral supernatant 150 μ l, add mixing behind the NaOH of 150 μ l (0.5mol/L), the ammonium acetate that adds 20 μ l (8mol/L) again, behind the mixing with isopyknic phenol and chloroform respectively extracting once, behind the alcohol precipitation with the TE dissolving DNA of 20 μ l.Oligonucleolide primers is:
5’-GAG?GAT?CCA?CGA?TGA?AAG?CGA?TCT?TAA?TCC?CAT-3’
5’-TTG?AAT?TCA?TTA?CAA?ACT?GCA?CGC?CGG?TAT-3’
Get above-mentioned virus genom DNA 1 μ l and carry out pcr amplification, reaction conditions is: 94 ℃ of sex change 5min, 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min, and 30 circulations, last 72 ℃ are extended 5min.Electrophoresis is identified amplified production.
Embodiment five, the expression of CelB gene in silkworm
The used silkworm high expression level kind of this experiment is JY1 (being preserved by inventor laboratory).JY1 kind silkworm rearing is pressed the ordinary method of " Chinese sericulture " (Shanghai science tech publishing house, 1991) of Lv Hongsheng chief editor and is carried out.15 identical boss silkworms of 48h selection mean body weight are one group behind the first feeding, and every silkworm inoculates about 1.0 * 10
5RBmNPV (CelB) promptly contains 2.0 * 10 in the 5 μ l inoculation liquid
7The rBmNPV of pfu/ml (CelB), totally 12 groups, behind virus infection respectively by the time blood sampling of 60h, 72h, 84h, 96h, 108h, 120h and measure CelB enzyme activity, triplicate.From infective virus 60h, CelB begins to express, and along with the increase of time, expressed enzyme is lived also to be increased thereupon, reaches the highlyest behind virus infection in 120 hours, and every ml silkworm hemolymph CelB enzyme activity reaches 10,199.5 units.The phase graphic representation is seen Fig. 1 during expression.
Embodiment six, CelB gene are expressed in the silkworm pupa body
The used silkworm pupa of this experiment is JY1 (being preserved by this laboratory) for the high expression level kind.JY1 kind silkworm rearing is pressed the ordinary method of " Chinese sericulture " (Shanghai science tech publishing house, 1991) of Lv Hongsheng chief editor and is carried out.Selecting 15 identical silkworm chrysalises of mean body weight after cocooing seven days is one group, and every pupa inoculates about 1.0 * 10
5RBmNPV (CelB) promptly contains 2.0 * 10 in the 5 μ l inoculation liquid
7The rBmNPV of pfu/ml (CelB), totally 12 groups, behind virus infection by the time blood sampling of 60h, 72h, 84h, 96h, 108h, 120h and measure CelB enzyme activity, triplicate.From infective virus 60h, CelB begins to express, increase along with the time, expressed enzyme is lived also to be increased thereupon, reached the highlyest behind virus infection in 108 to 120 hours, every ml silkworm hemolymph CelB enzyme activity is greater than 10000 units, through the expression amount of every silkworm of enzyme activity determination and pupa up to 20,000 and 12,000 international unit.
The purifying of embodiment seven, thermostable lactase
The insect polypide that contains thermostable lactase is with a certain amount of 0.1mol/L citric acid-sodium citrate damping fluid (pH5.0,90 ℃) or acetic acid-sodium-acetate buffer dilution, high-speed homogenization, 90 ℃ are incubated 15 minutes, make the albumen and the abundant sex change of DNA of host insect, 4 ℃, 2000-10,000rpm * 20min high speed centrifugation or filtration method remove residue and sex change thing, keep supernatant, carry out spraying drying with 105-130 ℃ of vapo(u)rizing temperatures, obtain the thermostable lactase of purifying, the SDS of purified product-PAGE electrophorogram is seen Fig. 2.The specificity analysis of the thermostable lactase that embodiment eight, the present invention are prepared
For the purified thermostable lactase of examination enzyme: embodiment seven.
1. the reaction optimum pH of thermostable lactase
With different damping fluid preparation substrates, regulate substrate pH value, 0.1mol/L Na respectively
2HPO
4-NaAC (Ph2.5-3.0), 0.1mol/L NaAc-Hac (pH2.5-6.5), 0.1mol/L Na
2HPO
4-NaH
2PO
4(pH6.0-8.0), condition of different pH reacts 10 minutes enzyme activity down when being determined at 90 ℃, and the optimal pH of CelB catalyzed reaction is 5.0, and when the pH value surpassed 6.0, enzyme activity sharply descended, and surpassed at 8.0 o'clock in the pH value, and enzyme activity almost can not surveyed (Fig. 3).
2. the temperature stability of thermostable lactase
The blood sample 0.1mol/L citric acid-sodium citrate damping fluid (pH5.0 that contains thermostable lactase, 90 ℃) dilution after, respectively 90-140 ℃ of following oil bath 15 minutes, lower the temperature with ice bath rapidly, 10,000rpm * 20min is centrifugal, gets supernatant dilution back and measures enzyme activity, compare to dilute the undressed sample in back, relatively enzyme activity.The thermostable lactase vigor is lived with the rising enzyme of temperature between temperature 90-110 ℃ and is not changed, and it is about 20% then to descend during to 120 ℃, 130 ℃, the rapid inactivation of enzyme (Fig. 4) after temperature surpasses 140 ℃.
Sequence table .txt
SEQUENCE?LISTING
＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences; Institute of Feeds,China Academy of Agriculture Sciences
＜120〉a kind of preparation method of thermostable lactase
<130>P0089
<160>2
<170>Patentln?version?3.3
<210>1
<211>1419
<212>DNA
＜213〉strong red-hot archeobacteria (Pyrococcus furiosus)
<400>1
<210>2
<211>472
<212>PRT
＜213〉strong red-hot archeobacteria (Pyrococcus furiosus)
<400>2
Claims (2)
1, a kind of preparation method of thermostable lactase may further comprise the steps:
Thermostable lactase shown in the SEQ ID NO:1 is gene constructed to baculovirus delivery carrier pVL94, obtain recombinant baculovirus delivery carrier pVL94-CelB; By in the body or vitro recombination, recombinant baculovirus is delivered on the genome that carrier pVL94-CelB is incorporated into baculovirus BmNPV, obtain recombinant baculovirus rBmNPVCelB; With resulting recombinant baculovirus rBmNPVCelB infected insect host silkworm (Bombyx mori); Cultivating infected insect host silkworm makes it carry out the expression of thermostable lactase; The recombination high temperature-resistant Sumylact L that purifying is expressed, promptly.
2, according to the preparation method of claim 1, it is characterized in that: described purifying is for collecting the body fluid or the whole homogenate of the silkworm larva or the pupa that contain thermostable lactase, behind the body fluid or whole homogenate 80-95 ℃ pyroprocessing collected, under 4-42 ℃ temperature, carry out centrifugal again, get supernatant, carry out spraying drying with 105-130 ℃ of vapo(u)rizing temperatures, promptly get the product behind the purifying.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200610001785XA CN100497612C (en) | 2006-01-25 | 2006-01-25 | Thermostable lactase preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200610001785XA CN100497612C (en) | 2006-01-25 | 2006-01-25 | Thermostable lactase preparation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1807609A CN1807609A (en) | 2006-07-26 |
| CN100497612C true CN100497612C (en) | 2009-06-10 |
Family
ID=36839704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200610001785XA Expired - Fee Related CN100497612C (en) | 2006-01-25 | 2006-01-25 | Thermostable lactase preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100497612C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104322666A (en) | 2007-12-03 | 2015-02-04 | 诺维信公司 | Method for Producing a Dairy Product |
| CN101948854B (en) * | 2010-08-16 | 2012-01-11 | 中国农业科学院生物技术研究所 | Lactase mutator, secretory expression method and application thereof |
| CN102268421B (en) * | 2011-08-03 | 2012-12-12 | 山西恩泽生物技术有限公司 | Cloning, expression and application of beta-glucosaccharase gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999031257A2 (en) * | 1997-12-18 | 1999-06-24 | Stichting Instituut Voor Dierhouderij En Diergezondheid | Protein expression in baculovirus vector expression systems |
| CN1229135A (en) * | 1999-04-02 | 1999-09-22 | 中国农业科学院蚕业研究所 | Method for producing phytase using silkworm biological reactor |
| CN1446909A (en) * | 2002-03-27 | 2003-10-08 | 中国农业科学院生物技术研究所 | Reformed lactase of Pichia pastoris and its application |
| CN1696294A (en) * | 2004-05-11 | 2005-11-16 | 中国农业科学院生物技术研究所 | High-performance bioreactor for baculovirus of insects |
-
2006
- 2006-01-25 CN CNB200610001785XA patent/CN100497612C/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999031257A2 (en) * | 1997-12-18 | 1999-06-24 | Stichting Instituut Voor Dierhouderij En Diergezondheid | Protein expression in baculovirus vector expression systems |
| CN1229135A (en) * | 1999-04-02 | 1999-09-22 | 中国农业科学院蚕业研究所 | Method for producing phytase using silkworm biological reactor |
| CN1446909A (en) * | 2002-03-27 | 2003-10-08 | 中国农业科学院生物技术研究所 | Reformed lactase of Pichia pastoris and its application |
| CN1696294A (en) * | 2004-05-11 | 2005-11-16 | 中国农业科学院生物技术研究所 | High-performance bioreactor for baculovirus of insects |
Non-Patent Citations (1)
| Title |
|---|
| Characterization of the celB gene coding for beta-glucosidasefrom the hyperthermophilic archaeon Pyrococcus furiosus andits expression and site-directed mutation in Escherichia coli. Voorhorst,W.G., Eggen,R.I., Luesink,E.J. and de Vos,W.M.J. Bacteriol.,Vol.177 No.24. 1995 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1807609A (en) | 2006-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101307317B (en) | Method for preparing rabies virus antigen | |
| CN101121938B (en) | Method for preparing foot-and-mouth disease antigen | |
| CN100410383C (en) | High-performance bioreactor for baculovirus of insects | |
| CN100569938C (en) | Can produce the Cladosporium endogenetic fungus of trans-resveratrol | |
| CN104788554B (en) | Cat omega interferon mutant and its preparation method and application | |
| CN102382845B (en) | Method for producing porcine parvovirus antigen and its product | |
| CN102628062B (en) | Expression method of animal alpha interferon and gamma interferon | |
| CN108474004A (en) | Expression of the recombinant protein in cabbage looper pupa | |
| CN104059927B (en) | Preparation method of newcastle disease glycoprotein viral antigen and products thereof | |
| CN107227311A (en) | Recombination porcine parvovirus like-particles and its preparation method and application | |
| CN100497612C (en) | Thermostable lactase preparation method | |
| CN101629186B (en) | Method for producing recombinant scorpion toxin protein by adopting silkworm as parasitifer | |
| CN102286534B (en) | Insect bioreactor capable of expressing multiple exogenous genes, and construction method and application thereof | |
| CN100371449C (en) | Structural method for improving gene engineering vector of recombinant silkworm nuclear polyhedron virus | |
| CN102492714A (en) | Method for preparing recombinant Chinese rural dog interferon-alpha | |
| CN103436557A (en) | Visual tracking method for rapid expression of NS1 protein by bombyx mori bioreactor | |
| CN1089368C (en) | Method for producing phytase using silkworm biological reactor | |
| CN101381726A (en) | Method for expressing growth factor of human blood vessel in bombyx mori by Bac-to-Bac system | |
| CN101434958A (en) | Method for preparing porcine alpha-interferon | |
| CN1180088C (en) | Method of producing broad adaptability, high specific activity phytase and acidic phosphoesterase using silkworm bioreactor | |
| CN104388437B (en) | Express recombinant defective type adenovirus and its construction method and the application of O-shaped foot and mouth disease virus hollow capsid | |
| Amer | Baculovirus expression vector system: An efficient tool for the production of heterologous recombinant proteins | |
| JP6044974B2 (en) | Recombinant silkworm nuclear polyhedrosis virus vector | |
| CN101307315B (en) | Method for expressing growth factor of human blood vessel in bombyx mori by Bac-to-Bac system | |
| CN101613679B (en) | Rhabdovirus with recombination superoxide dismutase gene and preparation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090610 Termination date: 20120125 |