KR100737446B1 - Recombinant Baculovirus Comprising Genes Coding Structural Proteins of FMDV and Production Method of Recombinant Protein - Google Patents

Abstract

The present invention provides a recombinant baculovirus comprising at least a gene encoding a structural protein constituting foot-and-mouth virus and a 3C gene which is a non-structural protein. In addition, the present invention provides a method for producing a recombinant protein for a foot and mouth virus vaccine antigen and diagnostic antigen by transforming the recombinant baculovirus to a host cell.

Baculovirus, bacmid, P1, 3C, antigen

Description

Recombinant Baculovirus Comprising Genes Coding Structural Proteins of FMDV and Production Method of Recombinant Protein}             

Figure 1 is a schematic diagram of cloning the gene encoding the P1 and 3C proteins of isolated foot-and-mouth disease virus in the baculovirus expression vector pFastBacDual.

Figure 2 is a photograph of each of the P1-3C antigen of foot-and-mouth virus expressed in recombinant baculovirus-infected Sf9 cells detected by indirect fluorescence antibody detection using foot-and-mouth negative serum, foot-and-mouth positive serum, foot-and-mouth specific monoclonal antibody.

Figure 3 was recovered by fractionation of the expression protein by sedimentation using CsCl, and confirmed the reactivity of the protein expressed using immunochromatography strip, also Western blot using a VP1-specific monoclonal antibody. Lanes 1-4 are expressed foot-and-mouth virus P13C protein, lane 5 is uninfected control Sf9 cells, lane 6 is a lysate of wild-type AcMNPV infected cells, and M is a protein size marker from Intron.

4 is an electron microscope photograph of foot-and-mouth disease P13C protein expressed in recombinant baculovirus by self-assembly. The size of the protein is 7-8 nm in diameter.

5 shows experimental results of immunogenicity experiments in mice of recombinant proteins.

6 is a diagram showing the results of ELISA method using recombinant protein and pig foot-and-mouth disease positive and negative control serum.

7 is a diagram showing the results of ELISA method using recombinant protein and bovine foot and mouth disease positive and negative control serum.

The present invention relates to a recombinant baculovirus that can be used for the production of foot-and-mouth virus vaccines and diagnostic antigens, and more specifically, does not rely on the production of vaccines or diagnostic antigens using existing inactivated viruses, and gene manipulation. It relates to a recombinant baculovirus and a method for producing a recombinant protein using the same to enable the production of subunits consisting of structural proteins that are not infectious.

Foot-and-mouth disease is a disease that is very important to livestock and is classified as Class A by the Office International des disease. All animals that have two hooves, such as cows, pigs, sheep, goats and deer, can be infected.The disease is highly contagious and causes blisters on the lips, tongue, gums, nose and hooves at the beginning of infection. Body temperature rises sharply and appetite is lowered, leading to acute death. In addition to the direct damages caused by disease outbreaks, countries that suffer from foot and mouth disease are economically severe, including international sanctions such as the failure to export animals and livestock products to non-occurring countries.

In addition, the foot-and-mouth disease vaccines and diagnostic antigens currently being used inactivate infectious viruses and thus require special facilities and technologies. Therefore, it is difficult to actually do the above-mentioned work in countries that do not have such facilities and technologies. to be.

The present invention has been made to solve the problems of the prior art, the object of the present invention is that the production of foot and mouth virus vaccine antigens and diagnostic antigens can be prepared even in a general laboratory scale, and there is no concern about infectivity, it is possible to supply a safe antigen To provide a recombinant baculovirus.

Another object of the present invention is to provide a method for producing a recombinant protein for foot-and-mouth virus vaccine and diagnostic antigen by transforming the recombinant baculovirus to a host cell.

In order to achieve the above object, the present invention provides a recombinant baculovirus comprising at least a gene encoding a structural protein constituting foot-and-mouth virus and a 3C gene which is a non-structural protein.

The recombinant baculovirus has the ability to express a pentamer-type recombinant protein in the host cell. As used herein, the term "recombinant protein" refers to a subunit unit consisting of most or all of a viral structural protein having most of its structural properties and subunits of an infectious wild type. The particles lack the ability to produce progeny viruses because they do not have the appropriate nucleic acid sequence when interacting with the host cell. The particles may contain no nucleic acid therein or may contain RNA that is not related to the production of progeny virus, but the overall structure is similar to that of a wild type subunit.

In the above, the recombinant protein includes P1 constituting the capsid, and includes VP1, VP2, VP3 and VP4 proteins. The P1 and 3C genes of foot-and-mouth virus include the nucleotide sequences shown in SEQ ID NOs: 1 and 2, or modified sequences thereof, wherein the modified sequences differ from the nucleotide sequences shown in SEQ ID NOs: 1 and 2, but These and three-dimensional structures include sequences that can be inferred from the amino acid sequence of the same protein.

Recombinant baculovirus according to the present invention can be prepared by inserting the P1 and 3C genes into known commercially available transition vectors and transforming them into DH10Bac competent cells and the like. The RT-PCR method can be used for the amplification of P1 and 3C genes. The transition vector preferably has a polyhedrin promoter and a p10 promoter derived from baculovirus. For example, a commercially available product such as pFastBac Dual of Invitrogen may be used.

It is sufficient to perform the specific manufacturing process of the transfer vector according to the protocol provided by the manufacturer, the resulting recombinant transfer vector can be obtained by transforming DH10Bac competent cells and the like to obtain a recombinant virus.

The present invention provides a method for preparing a recombinant structural protein by infecting the recombinant baculovirus to a host cell. The host cell is usually an insect cell, and need not be limited to a special kind as long as it provides a good environment for the baculovirus to be expressed and is developed as a host system for gene expression or is a commercial insect cell. (Sf) family cells, in particular Sf9. Infection of recombinant baculovirus may be applied with the transfection procedure provided by the manufacturer.

The host cell is cultured under known culture conditions, and collected and crushed according to a conventional fermentation product recovery method to recover and purify the recombinant protein therefrom. The recombinant protein thus prepared includes structural proteins constituting the foot-and-mouth virus and is provided as an antigen. The recombinant antigen may be provided as a vaccine use or as an antigen for diagnosis of foot and mouth virus. The antigens produced according to the present invention can be prepared simply because they do not require special facilities and techniques required for the production of vaccines and diagnostic antigens which have been used by inactivating existing living viruses, and are not infectious and long-term storage. It has the advantage of maintaining its potency.

Hereinafter, the content of the present invention will be described in more detail with reference to Examples. However, these examples are only presented to understand the content of the present invention, and the scope of the present invention should not be construed as being limited to these embodiments.

Example 1 Foot-and-mouth virus RNA extraction and cDNA synthesis

The foot-and-mouth virus O / SKR / 2002 used for the experiment was used to extract tissues and blisters from domestically infected pigs. The tissues and blisters of domestically infected pigs were homogenized and then mixed with 0.9 ml of lysis buffer containing guanidium thiocynate (GTC) at a rate of 0.1 ml. The mixture was adsorbed with silica at room temperature for 10 minutes and then centrifuged to discard the supernatant. The pellet was washed in the order of the wash solution containing GTC, ethanol and acetone, and then dried at 56 ° C. Purified water added with the RNase inhibitor was added thereto, followed by heating at 65 ° C. for 5 minutes to elute RNA.

CDNA was synthesized from the RNA. The extracted RNA was mixed with a reverse primer, and then cut off for 5 minutes, immediately placed in ice, cooled for 5 minutes, and centrifuged at 10,000 rpm for 1 minute. First-strand cDNA contains 1 μg total RNA, 40 units RNAsin (Promega), 50 mM Tris-HCl pH8.3, 3 mM MgCl ₂ , 75 mM KCl, 10 mM DTT, 0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dTTP, 0.4mM dGTP and reverse primer were added to the reaction solution in 20µl for 2 minutes at 42 ° C, and 2000 units of reverse transcriptase (SUPERSCIPT II RNase H-Reverse Transcriptase, Gibco-BRL) were added at The reaction was conducted for a minute to synthesize.

Example 2 Preparation of Baculovirus Expression Vector of Cloned PCR Product

In order to clone the gene for the P1 protein known as the foot-and-mouth virus protective protein and the 3C protein known to be processed and converted into an active form into a baculovirus expression vector, a polymerase chain reaction (PCR) was performed using the cDNA synthesized in Example 1 ) Was performed. PCR primers were prepared by referring to gene sequences of foot-and-mouth disease retrieved from the gene bank. To facilitate cloning, the restriction enzyme and recognition sites were inserted at both ends of P1 and 3C gene amplification. Specifically, when the P1 gene was amplified, the front primer put the BamHI recognition region immediately before the start code ATG, and the rear primer inserted the stop codes TAA and XbaI . In addition, when amplifying the 3C gene, XhoI was immediately placed in front of ATG, which is the start code, and the stop primer and SphI were inserted in the rear primer. More specifically, for the P1 gene synthesis, the front primer was BamHI- ATGGGACAGGAACACGCTGC of SEQ No. 1 and the rear primer was XbaI -TTACTGTTTCACAGGCGCCA of SEQ No. 2, and the front primer was XhoI -of SEQ No. 3 for 3C gene synthesis. ATGAGTGGTGCTCCCCCGACTG, and the back primer was SphI- TTACTCGTGTGGTTCGGGGTCG of SEQ No.4. cDNA was denatured at 95 ° C. for 5 minutes using Gene Amp PCR System 9600 (Perkin Elmer) using the synthesized primers and Taq polymerase (Takara). After 30-35 cycles of reaction at 1 to 5 minutes at -94 ° C, the reaction was amplified at 50 to 58 ° C for 1 to 5 minutes and 72 ° C for 2 to 5 minutes. DNA fragments amplified by PCR were immediately cloned into pGEM-T Easy vector (Promega) without restriction enzyme treatment, and sequencing was performed using dedeoxy chain dye terminator cycle sequencing-kit (PE-Bio-system). The gene was then analyzed using an auto sequencing (ABI). The base sequence of the analyzed gene is shown in SEQ NO.5, 6. After purification, each of the cloned P1 and 3C genes was digested with BamHI and XbaI for the P1 gene, XhoI and SphI for the 3C gene, and then cloned into the transfer vector pFastBac Dual (Invitrogen) treated with the restriction enzyme used above. Vector pFastBac Dual P13C was prepared (FIG. 1).

Example 3 Preparation of Recombinant Bamid

DH10Bac (Invitrogen) competent cells were used to generate recombinant backmids. More specifically, the DH10Bac was placed on ice for about 10 minutes, and then mixed with an appropriate amount according to the manufacturer's instructions with pFastBac Dual P13C and left on ice for 30 minutes. Heat shock was applied for 45 seconds in a 42 ° C. water bath and left on ice for 2 minutes. After adding 900ul of medium, shaking culture was performed at 37 ° C for 4 hours, and then inoculated in a medium containing various antibiotics, and then cultured at 37 ° C for 24 hours to 48 hours. Only whites of the grown colonies were selected for miniprep and PCR was performed using PUC / M13 primers for selection of the desired recombinant bacmids. The selection was used to prepare a recombinant virus.

Example 4 Preparation of Recombinant Virus

The transfection kit (Invitrogen) was used to generate recombinant baculovirus. Sf9 cells were placed in an amount of 4 x 10 ^{6 in} a 35 mm culture plate and allowed to stand at room temperature for 1 hour, and then the medium was removed and washed three times with fresh medium. Mix 5 ul of miniprep bacmid into the medium without antibiotics, and mix 5 ul of lipofectin (0.1 mg / ml) into the medium without antibiotics and mix the two solutions for about 30 minutes at room temperature. It was left dropwise to drop onto the washed cells drop by drop.

After 5 hours of incubation at 27 ° C., the solution was removed and incubated for 4 days in Grace medium containing 10% fetal calf serum. When the cytopathic effect appeared, the culture supernatant was taken and used again as a seed poison.

Example 5 Confirmation of foot-and-mouth structure protein by fluorescence antibody method

The cover slide glass in which the recombinant virus-infected cells were cultured for 4 days was washed with phosphate buffer, dried and fixed in 80% cold acetone for 5 minutes. The cover slide was inoculated with the foot and mouth virus, and the foot-and-mouth structure protein specific monoclonal antibody, foot-and-mouth infection positive bovine serum, and control negative serum, which were produced in this laboratory, were reacted for 1 hour and reacted for 2 hours. After the primary antibody was reacted for another 1 hour, specific fluorescence was observed under a light microscope (FIG. 2).

Example 6 Expression Protein Identification by Immunoblotting

After incubating Sf9 cells, which are insect cells infected with recombinant virus, for 4 days, harvesting the cells, centrifuging the cells at 3000 rpm for 30 minutes, discarding the supernatant, and removing the cell pellet from 1/10 of triton-100 in culture medium. The cells were mixed with the phosphate buffer solution, digested, and subjected to electrophoresis (SDS-PAGE), which was then transferred to nitrocellulose paper and subjected to immunoblotting using monoclonal antibodies that specifically reacted with the recombinant protein. Specific band of the expressed protein was confirmed (FIG. 3).

Example 7 Identification of Foot-and-mouth Recombinant Structural Protein by ELISA Method

Cells were harvested by centrifugation at 3,000 rpm for 30 minutes when the cytopathic effect appeared 80-90% while incubating the recombinant baculovirus in Sf9 cells at 0.1 m.o.i for 4-6 days. Precipitated cells were suspended in phosphate buffer at 1/10 of the initial culture medium, frozen and thawed three times at -70 ° C to completely destroy the cells, and then centrifuged at 15,000 rpm for 40 minutes to harvest supernatant, using positive and negative serum and negative serum. ELISA titers were measured. The produced recombinant structural protein showed high reactivity with the foot-and-mouth positive serum, but hardly with the negative serum (FIGS. 6 and 7).

Example 8 Concentration and Purification of Foot-and-mouth Recombinant Structural Protein

The recombinant protein produced in Example 6 was concentrated and purified using a cesium chloride gradient method. More specifically, 40% and 5% cesium chloride solutions were prepared, respectively, and the two solutions were mixed in ultracentrifuge tubes to form a linear gradient, followed by centrifugation at 120,000 g for 6 hours using Beckman ultracentrifuge. Each fraction of the gradient was analyzed to harvest only the concentrated recombinant protein fraction, which was then dialyzed overnight to obtain the concentrated and purified recombinant protein.

Example 9 Identification of Recombinant Protein by Electron Microscopy

In Example 8, the concentrated and purified recombinant protein was used as a sample for electron microscopic confirmation. Transmission electron microscopy (TEM) confirmed the presence of foot-and-mouth pentameric subunits of about 7-8 nm in diameter (FIG. 4).

Example 10 Immunogenicity of Recombinant Proteins in Mice

When the recombinant protein prepared in Example 8 was inoculated twice into the muscles of the mice twice every three weeks, and then collected for up to 6 weeks, the ELISA was performed. However, the antibody was formed slightly lower than the mice inoculated with the inactivated foot and mouth virus. It was confirmed that the results are as shown in FIG.

According to the present invention, no special facilities and techniques are required, and the production of foot and mouth virus vaccine antigens and diagnostic antigens is possible even at a general laboratory scale. Therefore, the cost of production is drastically reduced, and there is no concern about infectivity, and thus safe antigen supply is possible.

Attach sequence list electronic file  

Claims (5)

Recombinant baculovirus comprising at least the genes encoding the structural proteins VP1, VP2, VP3 and VP4 constituting the foot-and-mouth virus and the 3C gene which is a non-structural protein A method for producing a recombinant protein by transfecting a host with a recombinant baculovirus comprising at least a gene encoding the structural proteins VP1, VP2, VP3 and VP4 constituting the foot-and-mouth virus and a 3C gene which is a non-structural protein The method of claim 2, wherein the host is an insect cell. delete The method of claim 2, wherein the structural proteins VP1, VP2, VP3 and VP4 form pentameric subunits.

Images