CN1065293A - New entomopoxvirus expression system - Google Patents

Abstract

The present invention relates to new insect pox virus (EPV) polynucleotide sequence, it does not contain other virus sequences of natural link with it; The present invention also provides the recombinant nucleotide vector that contains this sequence, the recombinant virus that contains this sequence, by the host cell of this recombinant virus infection, and their proteic using method of expressing heterologous in insect and mammalian host cell.

Description

New entomopoxvirus expression system

The present invention generally relates to reorganization and produces proteinic field, especially relates to new recombinant entomopoxvirus protein, and albumen is regulated sequence and their application in the expression of heterologous genes in the host of conversion.

In notochord poxvirus du family, its member infects the vertebra host according to the taxonomy Poxvirus, as the true poxvirus of cowpox (Orthopoxvirus vaccinia), or belongs to entomopoxvirus family.Except indivedual members' insect host scope, very few for member's understanding of entomopoxvirus family.A kind of insect pox virus (EPV) is mulberry red edge lights moth (Amsacta moorel) entomopoxvirus (AmEPV), it is [the Roberts and Granados that separates from the larva of mulberry red edge lights moth at first, J.Invertebr.Pathol., 12:141-143(1968)].AmEPV is that a kind of typical B belongs to EPV, and be one of three kinds of known EPV that can in the insect cell of cultivating, duplicate [R.R.Granados et al, " Replication of Amsacta moorei Entomopoxvirus and Autographa californica Nuclear Polyhedrosis Virus in Hemocyte Cell Lines from Estigmene acrea ", in Invertebrate Tissue Cuture Applications in Medicine, Bioloqy, and Agriculture, E.kurstak and K.Maramorosch(ed.), Academic Press, New York, pp.379-389(1976); T.Hukuharaet al, J.Invertebr.Pathol., 56:222-232(1990); And T.Sato, " Establishment of Eight Cell Lines from Neonate Larvae of Torticids(Lepidoptera); and Their several Characteristics Including Susceptibility to Insect Viruses ", in Invertebrate Cell Systems Applications, J.Mitsuhashi(ed.), Vol. II, pp.187-198, CRC Press, Inc., Boca Raton, Florida(19889)].

AmEPV is one of the entomopoxvirus that can duplicate in insect cell culture of minority; AmEPV can not duplicate in vertebrate cells system.This AmEPV distrand DNA genome is approximately 225kb, is rich in very much A-T(18.5%G+C) [W.H.R.Langridge et al, Virolegy, 76:616-620(1977)].The restriction map [R.L.Hall et al, Arch.Virol., 110:77-90(1990)] of a series of AmEPV is disclosed recently.Do not detect and the homology of vaccinia virus DNA [W.H.Langride, J.Invertebr.Pathol., 42:77-82(1983): W.H.Langridge, J.Invertebr.Pathol., 43:41-46(1984)].

The virus replication of AmEPV is similar to the virus replication cycle of other poxvirus, different just in course of infection closed virus occur later.For AnEPV, in case infected cell, closed all can produce with extracellular virion.Sophisticated closed shape particle plays the environment protection effect to virus particle in course of infection, it is by being embedded in viral composition the in the crystal substrate, and this matrix is that spheroidin is formed by a kind of protein mainly then.It is reported, as the proteinic spheroidin molecular weight of AmEPV primary structure is 110 kilodaltons (KD), contain charged at high proportion sulfur-containing amino acid [Langridge and Roberts, J.Invertbr.Pathol., 39:346-353(1982)].Virus and viral protein are used for the major subjects that the eucaryon host carrier system is big quantity research and exploration always.Many existing virus carrier systems have limited its practicality owing to having significant disadvantages and limitation.For example, many eucaryon virus vector have tumorigenesis or carcinogenesis in the lactation system, will produce the serious health and safety problem relevant with inadvertent contamination with the gained gene product.And in some eucaryon host one virus carrier system, itself shows antiviral activity gene product, thereby has reduced this proteinic output.

For simple virus, the amount that can be packaged into the exogenous DNA that goes in the simple virus is limited.If used gene is an eucaryon, this restriction can become the problem of especially severe.Because eukaryotic gene contains insertion sequence usually, be unsuitable for being assembled to because of they are too big among the simple virus.And, because they have many cleavage sites, thus with exogenous DNA be inserted into specific position in the complex virus can be more difficulty.

Vaccinia virus has been prepared into recently eukaryotic cloning and expression vector [M.Mackett.et al, DNA cloning, Vel, II, ed.D.M.Glover, pp.191-212, oxford:IRLPress(1985); D.Panicali et al, Proc.Natl, Acad.Sci, USA, 88:5364-5368(1982)].Used vaccinia virus vector expressed many virus antigens [E.Paoletti et al, Proc.Natl.Acad.Sci.USA, 81:193-197(1984); A.Piccine et al, BioEssags, 5:248-252(1986)], the gp120/gp41 that also comprises HBsAg, rabies G albumen and human immune deficiency venereal disease poison (HIV) in addition.Once will derive from the adjusting sequence of dragon spruce budworm (Spruce budworm) and vaccinia virus [L.Yuen et al, Virdogy, 175:427-433(1990)] in the past is used in combination.

In addition, for studies show that of vaccinia virus, have several superiority as vaccine carrier with poxvirus.These characteristics comprise: based on the vaccine of poxvirus can the irritation cell immunity and humoral immunization, with least cost mass production vaccine and freeze dried vaccine, the stability under the non-freezing conditions, under non-sterile condition convenient drug administration, and can in the recombinant chou that infects, be inserted into rare 25, the foreign DNA of 000 base pair, thus many antigens can be expressed in a recombinant chou simultaneously.

Need to develop other viral composition and the method that is used in selected host cell expression of heterologous genes in the art, and the method for implementing relative other researchs and production technology.

One aspect of the present invention provides an entomopoxvirus polynucleotide sequence, it does not contain other virus sequences of natural link with it, and contain the sequence of coding insect pox virus spheroidin gene and/or it regulates sequence, its allelic variant, and analogue or fragment.In a particular, from mulberry red edge lights moth entomopoxvirus, isolated the spheroidin dna sequence dna and in Fig. 2, be illustrated.

The present invention provides coding entomopoxvirus spheroidin promotor or its allelic variant, analogue or segmental polynucleotide sequence on the other hand.The feature of spheroidin promoter sequence is can control operably to have connected this sequence or the expression of segmental heterologous gene in the host cell of selecting.

On the other hand, the invention provides a recombination of polynucleotide sequence, it contains the sequence of a coding entomopoxvirus spheroidin and/or it regulates sequence, its allelic variant, and analogue or fragment, and this sequence is connected on the second multinuclear glycosides sequence of code separated source gene.A representational this polynucleotide sequence provides the spheroidin promotor little son who operably is connected on the heterologous gene sequence, and it can control the expression of this heterologous gene in selected host cell.Another embodiment provides the sequence of a coding spheroidin, and this sequence is connected on the heterologous gene in a kind of mode of expressing fusion protein that allows.Embodiment provides and has been inserted into the heterologous gene on certain site in the spheroidin gene, thereby makes this heterologous gene be connected to the spheroidin sequence in its both sides.

On the other hand, the invention provides a kind of entomopoxvirus polynucleotide sequence, it does not contain other virus sequences of natural link with it, and contains sequence and/or its adjusting sequence of coding entomopoxvirus thymidine kinase (LK) gene, its allelic variant, or its analogue or fragment.In a specific embodiment, this sequence derives from mulberry red edge lights moth entomopoxvirus and is illustrated in Fig. 3.

On the other hand, this sequence encoding insect pox virus tK promotor, its allelic variant or its fragment.The feature of this tK promoter sequence is that it can instruct the expression of heterologous gene in selected host cell that operably is connected on this sequence or the fragment.

Another aspect of the present invention also provides above-mentioned polynucleotide sequence and/or its adjusting sequence of the reorganization of coding entomopoxvirus tK gene, its allelic variant or its fragment, and this sequence has been connected on certain heterologous gene.A kind of embodiment of this polynucleotide sequence provides the tK promoter sequence that operably is connected on the heterologous gene, in order to instruct the expression of this heterologous gene in the host cell of selecting.Another embodiment provides in the mode that allows expressed fusion protein matter and has been connected to the proteinic sequence of coding tK on the heterologous gene.Another embodiment provides and has been inserted into the heterologous gene on a certain site in the tK gene, so that this heterologous gene has the tK sequence at its two end.

Another aspect of the present invention provides the entomopoxvirus spheroidin polypeptide that can be fused on heterologous protein or the peptide, with its fragment, or its analogue.The entomopoxvirus tK that selectively is connected on heterologous protein or the peptide also is provided polypeptide, and fragment or its analogue.

Another aspect of the present invention provides the recombination of polynucleotide that contains one or more above-mentioned polynucleotide sequences molecule.This molecule can be a kind of expression vector or shuttle vectors.This molecule also can contain except that deriving from entomopoxvirus that spheroidin or tK polynucleotide sequence can be provided such as the virus sequence the vaccinia virus.

On the other hand, the invention provides the recombinant virus that contains above-mentioned polynucleotide sequence.Host cell with one or more described recombinant virus infections also is provided.

The present invention also provide prepare selected more than the method for peptide, comprise the host cell of cultivating with the selection of above-mentioned recombinant virus infection, and from substratum the said polypeptide of recovery.

At last, the invention provides the method that screening is used to insert the recombinant host cell of heterologous gene, comprise with the recombinant virus-infected cell that contains certain peptide molecule, this peptide molecule contains the heterologous gene sequence that is connected to the selection on imperfect spheroidin or the tK polynucleotide sequence or is inserted into and interrupts its encoding sequence, thereby makes this heterologous gene have an entomopoxvirus spheroidin or the many thuja acid nuclear of tK sequence at its each end.In containing the cell of spheroidin, lack because of expressing the closed shape that spheroidin forms, shown the integration of heterologous gene.Also we can say, do not have the thymidine kinase function, promptly do not exist yet because of non-activity chest kinase sequence integrate formed to the ammonia first resistance of mountain range or its nucleotide analog of talking endlessly, thereby shown the insertion of heterologous gene.

In following detailed description of the present invention to base of the present invention aspect him and advantage be further described.

Description of drawings

Fig. 1 is the physical map of the restriction fragment of explanation AmEPV, and has shown the spheroidin gene that just in time is arranged in Hind III-right side, G fragment the 29th site.

Fig. 2 provides the AmEPV dna sequence dna and the flanking sequence of mulberry red edge lights moth insect pox virus spheroidin gene, and sign indicating number (ORF) is read in the spheroidin aminoacid sequence of supposition and other five openings.

Fig. 3 provides the dna sequence dna and the flanking sequence of mulberry red edge lights moth insect pox virus thymidine kinase (tK) gene, the aminoacid sequence of the proteinic supposition of this tK, and two other ORF.

Fig. 4 provides the nucleotide sequence of synthetic oligonucleotide, respectively called after RM58, RM82, RM83, RM92, RM118, RM165, RM03, RM04 and RM129.

Fig. 5 shows the segmental structure sketch map of AmEPV, and it has illustrated the location of spheroidin ORF on physical map, and has shown homology.

The invention provides new entomopoxvirus (EPV) nucleotide acid sequence, it does not contain other virus sequence of natural link with it. The invention also discloses the recombinant nucleotide vector that contains this sequence, contain the restructuring virus of this sequence and with host's cell of this recombinant virus infection. These compositions are applicable to the inventive method, in order to the protein of expressing heterologous gene in insect and mammalian host cell and generation selection.

New polynucleotides sequence coding EPV filefish protamine gene of the present invention and/or its flanking sequence are included as the sequence that this gene is expressed provides conditioning signal. The present invention also provides the new polynucleotide sequence of coding EPV thymidine kinases (tK) gene and/or its flanking sequence. Polynucleotide sequence of the present invention can be RNA or dna sequence dna. Polynucleotide sequence of the present invention is more preferably dna sequence dna.

Filefish protamine and tK polynucleotide sequence that the present invention settles sth. according to policy or law especially and obtains from mulberry red edge lights moth insect pox virus (AmEPV). Although present it be the preferred kind of implementing the inventive method and composition,, those skilled in the art can utilize the techniques described herein, obtain the basically sequence of homology from the existing insect pox virus of other kind.

This AmEPV filefish protamine dna sequence dna comprises that the adjusting sequence of side is shown in Fig. 1 as the sequence of crossing over from nucleotides 1 to 6768. In this sequence, filefish protamine gene coded sequence is crossed over nucleotides 3079 to 6091. Another meaningful fragment is between nucleotides 3080-6188. The fragment that may contain promoter sequence is crossed over nucleotides 2780-3200. Other structures that other zones of this sequence are considered to be associated with the filefish protamine or the supposition code area of regulatory gene. These have Other fragments of meaning comprise following sequence: the nucleotides 1472 to 2148 of coding G2R ORF; The nucleotides 2502 to 2984 of coding G4R ORF; And the following sequence of in Fig. 2, describing from left to right, the nucleotides 68 to 1459 of coding G1L ORF, the nucleotides 2242 to 2475 of coding G3L ORF; Nucleotides 6260 to 6769 with coding G6L ORF. All ORF are all shown in Figure 2.

Just in time AmEPV ORF G4R and he-goat poxvirus (capripoxvirus) the HM3 ORF at filefish protamine upstream region of gene has high homology. Find that in vaccinia virus the homology part of HM3 ORF just in time is positioned at the upstream of the truncate variant of vaccinia virus ATI gene. Therefore, the microenvironment in this zone is similar in two-strain. Two other ORF are relevant with the counterpart in the vaccinia virus. These two ORF comprise 17 ORF[J.F.C.Schmitt et al of the vaccinia virus Hind III relevant with AmEPV G1L ORF-I fragment (17), J.Virol., 62:1889-1897(1988)], NTPase I (NPHI) ORF[S.S.Broyles et al with the Hind III relevant with AmEPV G62 ORF-D fragment, J.Virol., 61:1738-1742(1987); With J.F.Rodriguez et al, Proc.Natl.Acad.Sci.USA, 83:9566-9570(1986)]. The genome position of AmEPV ORF compared with the gene location of vaccinia virus ORF show, be in many cases the center and locate and be basic " core gene " of the vertebrate poxvirus of synteny, see that from more macroscopical level their arranging insect virus differ widely.

Described in detail as following embodiment, can identify the filefish protamine gene of AmEPV by the direct microcosmic sequence analysis to protein, and can design oligonucleotide probe according to this result. Transcribing of filefish protamine gene can be suppressed by actinomyces ketone, shows that it is gene in a kind of late period. The discovery consistent with this prediction is that the filefish protamine is transcribed originally initial in a basic sequence of TAATG (seeing Fig. 2, nucleotides 3077-3082), and also has one 5 ' poly(A) sequences, the two has the feature of transcribing this late period.

AmEPV tK dna sequence dna comprises its flank and regulates sequence, is expressed as in Fig. 3 from nucleotides 1 to 1511. In this sequence, the tK gene coded sequence is crossed over nucleotides 237-782(and is described from left to right in Fig. 3). Another meaningful fragment may comprise the nucleotides 782 to 849 of this sequence or its fragment. May contain the fragment that starts the subarea is nucleotides 750-890. Other zones of this sequence also have been accredited as the code area of the deduction of other structures of being associated with tK or regulatory gene. These other meaningful fragment comprises following sequence (describing from left to right) in Fig. 3: the nucleotides 21 to 218 of coding ORF Q1; Nucleotides 853 to 1511 with coding ORF Q3.

AmEPV tK gene figure is positioned (Fig. 1) near the AmEPV physical map of genome left end the EcoR I-Q fragment [referring to R.L.Hall et al, Arch.Virol., 110:77-90(1990), classify this paper list of references as]. Based on the direction of this gene in the AmEPV genome, this gene possibly terminad direction is transcribed. It is believed that in comprising other systems of mammlian system to have similar tK gene or its variant. Described in detail as the following examples, analyze by the direct microcosmic sequence to protein, can identify the tK gene of AmEPV, and can design oligonucleotide probe according to this result.

Term " polynucleotide sequence " is when being used for can comprising complete EPV filefish protamine when of the present invention or being connected to the tK gene of regulating sequence at the coded sequence flank. The AmEPV sequence of explanation is also included within this term as an example. This definition comprises that also flank is with the fragment of the coded sequence of regulating sequence. This definition also comprises only having the adjusting sequence, and such as promoter sequence, transcription site stops sequence and other regulate sequence.

Sequence of the present invention also can comprise the tK gene that links to each other with the allos gene order on all or part of filefish protamine or the structure. In addition, polynucleotide sequence of the present invention Can comprise the sequence of filefish protamine or insert therein the tK gene of external or allos gene order, thereby make the EPV sequence be positioned at the both sides of allos gene order.

Polynucleotide sequence of the present invention also comprises can be under strict condition and the sequence of the sequence hybridization of Fig. 2 and 3, and this sequence can keep identical biological of sequence to that indicated in the drawings or regulate active. And, under non-strict condition can with the sequence of sequence hybridization shown in Fig. 2 and 3, as long as possess respectively biology or the control characteristic of sequence shown in Fig. 2 and 3, also belong within this range of definition, strict and non-stringent hybridization condition all be conventional condition [referring to, such as Sambrook et al, Molecular cloning.A Laboratory Mannual, 2d edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York(1989)].

Equally, polynucleotide sequence of the present invention comprises that other ORF shown in the dna sequence dna of coding filefish protamine or tK protein sequence or code pattern 2 and 3 or its regulate the allelic variation (sequence change of naturally-occurring in the EPV population, this kind change can or can not cause amino acid change) of the dna sequence dna of sequence. Equally, the present invention also comprises the dna sequence dna of code book invention filefish protamine or tK albumen, but owing to the sudden change simple and property or dna sequence dna of genetic code makes the codon sequence of these DNA different, wherein said sudden change is because rite-directed mutagenesis or the modification effect of inducing cause, thus increased by biological characteristic or the purposes of required polynucleotide sequence of coding.

The sequence data of utilization among Fig. 2 or 3, and the feature of pointed spheroidin or thymidylate kinase are as known in the art with the technology of other dna sequence dnas of these polypeptide that obtain encoding.For example can come the operating structure gene, or keep the correct amino acid whose while, Nucleotide be changed, so that under the situation of not losing enzymic activity, amino acid is modified by changing single Nucleotide.Available known technology replaces, inserts or lack Nucleotide, for example comprises vitro mutagenesis or primer reparation.

Can its 3 '-terminal and/or 5 '-terminally prune structure gene, and keep its biological activity simultaneously.Also a part of peptide sequence can be connected on the allogeneic coding sequence, thereby produce fusogenic peptide.

Can prepare polypeptide nucleotide sequence of the present invention with artificial synthetic method,, make polynucleotide sequence of the present invention from viral RNA or from the plasmid of the existing cDNA of containing perhaps by chemistry as known in the art and gene engineering or both.

As described herein, can by because the equipotential of nature or plant variation and with the different polypeptide nucleotide sequence of the sequence of Fig. 2 and 3 encode AmEPV protein, spheroidin, thymidine kinase and regulate sequence accordingly.Therefore, term spheroidin or tK polypeptide also refer to any spontaneous sequence and various analogue, that for example cross or pruned sequence or fragment through processing treatment, comprise ripe spheroidin or tk polypeptide and remain with identical bioactive mutant or modified polypeptide or fragment, they better have at least 80%, better have 90% with sequence shown in Fig. 2 or 3 separately, and 95% homology is preferably arranged.

Another aspect of the present invention provides the protein by EPV spheroidin and tK polynucleotide sequence coding.In Fig. 2 and 3, shown the aminoacid sequence of two kinds of proteinic deductions of EPV respectively and by the protein of other coded deductions of the ORF of these sequences.The EPV spheroidin does not have tangible amino acid identity with the protein of reporting in the past, comprises the polyhedrin of baculovirus.Spheroidin and tK are non-proteins necessary, and this makes them be suitable for as the site of inserting foreign DNA.

The aminoacid sequence of AmEPV tK and other tK genes comparison shows that AmEPV tK gene and any vertebrates poxvirus du tK gene do not have high correlation (43.4-45.7%).The dependency of vertebrates tK protein and AmEPV still lower (39.3-41.0%), and African pig heat (ASF) virus shows minimum homology (31.4%) in all tested tK albumen.Although ASF and poxvirus du have many similarities, and ASF and AmEPV infect vertebrate host.But common point is seldom arranged between the tK gene, and/or show from the indication in the common source of non-vertebrate host.

Spheroidin and thymidine kinase peptide sequence can comprise the tK aminoacid sequence that isolating spontaneous spheroidin or the present invention identify, or remain with the biology of AmEPV polypeptide or the specific modification sequence of regulatory function (these sequences are shown in respectively in Fig. 2 and 3).Therefore, although this modification is arranged, as long as kept the biological activity of these polypeptide whole or in part, the present invention then comprise to all aminoacid sequences disclosed herein with and remain with the utilization of the analogue of spheroidin or tK biological activity.Generally speaking, the difference of these analogues just is the change of 1,2,3 or 4 codons.Equally, by other spheroidins or tK ORF encoded protein matter or function also can comprise contain a small amount of amino acid modified but keep the sequence that its adjusting or other biological are learned function.

The example of this modification comprises and having from the natural acid sequence of entomopoxvirus spheroidin or thymidine kinase and the polypeptide that a small amount of amino acid change is arranged that comes; Especially the aminoacid replacement of conservative property.The conservative property replacement is meant that those occur in the replacement in the amino acid family relevant with its side chain.The amino acid of genetic coding generally is divided into four classes: (1) tart: aspartic acid, L-glutamic acid; (2) alkalescence: Methionin, arginine, Histidine; (3) nonpolar: L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane; (4) uncharged polare Aminosaeren: glycine, l-asparagine, glutamine, Gelucystine, Serine, Threonine, tyrosine.Phenylalanine, tryptophane and tyrosine are divided into the die aromatischen Aminosaeuren class sometimes.For example, have reason to imagine, leucine and Isoleucine or Xie Ansuan, aspartic acid and L-glutamic acid, the replacement that separates of Threonine and Serine, perhaps relevant amino acid whose similar conservative property replaces on certain seed amino acid and another structure, and biological activity is not had bigger influence, especially when this replacement does not relate to amino acid on the polypeptide active site.

Term used herein " polypeptide " is meant aminoacid polymers, rather than singly refers to the product of length-specific; Therefore, peptide, oligopeptides and protein all belong within the range of definition of polypeptide.This term is modified after neither referring to or comprise polypeptide expression, for example glycosylation, acetylize, products such as phosphorylation.Be included in and in this range of definition be, for example, contain the polypeptide of certain amino acid whose one or more analogues (as comprising alpha-non-natural amino acid etc.), have the polypeptide that replaces key, and other modified outcomes known in the art, comprise product naturally occurring and that non-natural exists.

Protein of the present invention or polypeptide can use ordinary method (Sambrook et al, document is the same) to express in host cell and purifying and obtaining from cell or substratum.

The invention still further relates to new virus recombinant polynucleotide molecule or carrier, they can allow the host cell inner expression heterologous gene in certain selection.Polynucleotide carrier of the present invention comprises the polynucleotide sequence of coding all or part of spheroidin or tK gene, derives from the RNA polymerase of poxvirus du of certain selection and the polynucleotide sequence of certain required heterologous gene of encoding.Such sequence better comprises the regulatory region of EMV spheroidin or tK gene, and preferably includes their promoter region.In addition, the source of this polysaccharase not only is confined to EMV, but any poxvirus du RNA polymerase can be used.

Therefore, virus vector can contain by another kind of poxvirus du, no matter be also other viral compositions of being provided of the vertebrate poxvirus du of right and wrong of vertebra, and have only the EPV sequence to be because EPV spheroidin or tK gene order, or its segmental existence provide.Many conventional virus expression carriers and expression system are as known in the art.Especially the carrier system of Shi Yonging is the carrier system of those vertebras or non-vertebrates poxvirus du.Insect pox virus spheroidin and tK sequential gene regulating can be used for containing other virus carrier systems of poxvirus du RNA polymerase,, for example, be used for vaccinia virus vector to improve the usefulness of those systems.In general, being used for the method for the host cell of construction expression system and composition thereof such as expression vector and conversion, all is known in the art.Generally can be referring to the method described in the standard textbook, people's such as Sambrook as described above document.Therefore, the present invention is not limited to any specific virus expression system or carrier that can insert nucleotide sequence more than the present invention, but as long as this carrier or system contain the poxvirus du RNA polymerase.

Carrier of the present invention is a kind of carrier that does not need auxiliary composition, that is to say, providing composition to carrier, as providing in the poxvirus du of RNA polymerase, existing or do not exist functional spheroidin or tK gene can not influence use the recombinant viral vector that is produced.Because spheroidin and tK are dispensable genes, so virus vector of the present invention does not need the existence of any other virus protein, rely in the carrier system of auxiliary composition, these virus proteins can be provided by other virus with the selected host cell of co-infected.

After by viral vector infection, the host cell that comprises the selection of insect and mammalian cell will allow expression of heterologous genes, specifically, if this virus vector contain insert any member of insect pox virus family (as, the EPV of any kind of) EPV spheroidin of the present invention or tK gene order, then host cell will be limited to the insect cell that is normally infected by EPV.Contain EPV spheroidin of the present invention or the tK gene order of inserting in certain vertebrates poxvirus (as cowpox or pig pox virus) as virus vector, then host cell can be to be selected from by the normal mammalian cell that infects of wild-type vertebrates poxvirus du.This class mammalian cell is the known and available human cell of those skilled in the art, rodent cells and primate cell.

Therefore, according to an aspect of the present invention, carrier of the present invention can utilize a fragment of nucleotide sequence more than the EPV spheroidin, especially is responsible for the promotor and the auxiliary adjustment sequence of natural this gene of high level expression.Preferred filefish protein sequence is present among the sequence shown in Figure 2, more preferably in the zone of Nucleotide 2780 to 3200.Fragment littler in this zone also can be as regulating sequence.Can use the spheroidin promoter sequence of expection, its heterologous gene with certain selection operationally is associated in, inserting can be in vertebrates or non-vertebrate host cell in the virus expression carrier of performance function, with the required protein of a large amount of generations.

Term used herein " operational contact " is meant the relation of regulating between sequence and the selected protein gene, and this relation makes the adjusting sequence can control this protein and duplicates and express in proper host cell.Those skilled in the art can utilize routine techniques to come these sequences of operational contact.

If the spheroidin polynucleotide sequence in the carrier contains all or part of spheroidin encoding sequence of getting in touch with heterologous gene or being connected, the protein that then produces in host cell can be by the fused protein of being made up of all or part of spheroidin and heterologous protein.If the spheroidin polynucleotide sequence in the carrier does not contain the encoding sequence that spheroidin or peptide fragment are expressed in enough being used to, then can only produce heterologous protein.

With similar method, the structure that promotor and the adjusting sequence (Fig. 3) of tK can be used for expression vector is expressed in the known expression system of selecting to drive heterologous protein or fused protein.This tK regulates the sequence that sequence preferably is obtained from Fig. 3, especially the fragment of 750 to 890 in Nucleotide.Littler fragment in this zone also can be as regulating sequence.

Using the new EPV spheroidin of the present invention or the advantage of tK promoter sequence is that these adjusting sequences can play a role in vertebrates poxvirus du (as vaccinia virus)-mammalian cell expression vector system.For example, can strong spheroidin promotor be attached in the vaccinia virus system by homologous recombination.Different with the promotor of baculovirus polyhedrin gene is that the promotor of EPV spheroidin gene can be directly used among cowpox or the pig pox virus expression vector.

In order to make up carrier of the present invention, can from the insect pox virus of certain selection such as AmEPV, separate and purifying spheroidin or tK polynucleotide sequence, and, contain the fragment of all or part of spheroidin or tK gene with generation with suitable restriction endonuclease digestion.Also can synthesize such fragment with chemical process.

And required AmEPV sequence also can obtain from the bacterial cultures that contains plasmid pRH512, PMEGtK-1 or pRH7.The following examples are built the thing of plasmid pRH512 and are described.This plasmid contains and is inserted into the 4.51kb Bg I II Segment A mEPV dna sequence dna on the Bam H I site among the conventional carrier PUC9.Available Bsp 1286 I digestion is used Hae then by the AmEPV genomic dna that embodiment 1 described method makes

I digests resulting fragment and makes up plasmid pRH7.Use T ₄Archaeal dna polymerase is accomplished flush end with AmEPV DNA, and the fragment that will contain the spheroidin gene is connected on the big fragment of gained after the Sma I digestion pUC9 fragment.This fragment contains complete spheroidin opening reads sign indicating number and some flanking sequence, and these sequences are included in the part of crossing among Fig. 2 between the nucleotide sequence 2274-6182.The structure of plasmid PMEG tK-1 contains the adjusting sequence of tK gene and the structure gene described in the following embodiment 8.It is inserted into the EcoRI-Q fragment of AmEPV among the conventional carrier PUC18 and is built into.

Contain plasmid pRH512, the bacterial cultures of pMEG tK-1 and pRH7 be deposited in American type culture collection (12301 Parklawn Drive, Rockville, Maryland, USA).

Culture registration number preservation date

Intestinal bacteria SURE strains A TCC68532 on February 26th, 91

（Stratagene）pMEG-tK1

Intestinal bacteria SURE strains A TCC68533 on February 26th, 91

（Stratagene）pRH512

Intestinal bacteria SURE strains A TCC

（Stratagene）pRH7

Can use standard method, for example available clarifying lysate-isodensity density gradient centrifugation obtains plasmid from the bacterial cultures of depositing.

These ATCC depositas be below under the condition preservation promptly can guarantee that in present patent application the personnel that determined by patent and trade mark committeeman obtain this culture by the regulation of 37cFR1.14 and 35USC 122 unsettled period.When the application or its subsequent application during, can require obtain deposita of the present invention according to this national patent law in certain national applications.But the available that should be pointed out that deposita does not constitute and allows to implement the present invention, and and then causes infringement act to the patent of authorizing.

In addition, culture of the present invention be according to budapest treaty about the regulation preservation of microbial preservation, and be that the public is available.That is to say, this preservation is preservation in the essential scrupulous care, so that within this culture at least five years after recently request provides the preservation sample be work and also be unpolluted, and under any circumstance, deposit at least 30 years afterwards day or any patent that may disclose this culture and can implement in the time limit, this preservation culture all is that vitality and unpolluted is arranged.When being requested sampling, in the time of can not providing owing to the condition of preservation, the depositor bears the obligation of changing deposita as the preservation center.After the patent that discloses this culture went through, all will cancel about the restricted condition that the public is obtained culture of the present invention immutablely.

The molecular biology method that is used to make up carrier of the present invention as referred to herein is known standard method.The whole bag of tricks that is used to prepare plasmid vector and conversion or infection host biology all is as known in the art.These methods all are described in for example above-mentioned people's such as Sambrook document.Therefore, from microorganism cells, extract DNA and carry out restriction enzyme digestion, dna fragmentation electrophoresis, make plasmid tailing and annealing and insert DNA, be connected DNA, transformant prepares plasmid DNA, protein electrophorese and dna sequence analysis and all belongs to known technology in the field of genetic engineering.

Part is under the control of spheroidin or tK gene because the AmEPV genome does not have gene that specific restriction site can make selection to import to effectively on this site with the locus specificity method, in the interior required site of the therefore essential EPV polynucleotide sequence that earlier such restriction site is incorporated into selection.For example, be positioned at the particular B st B1 site at 3172 Nucleotide places, spheroidin gene starting point downstream, exactly with genetic engineering method produce the useful insertion sequence be applicable to the clone near the site.Therefore, must expressly insert the restriction site that approaches the initial Met of spheroidin gene.

The method of inserting restriction site is that those skilled in the art are known, comprises utilizing middle shuttling back and forth property carrier, as passing through the EPV sequence clone to the site of suitable cloning vector.Those of skill in the art in this area should understand, as long as can be on function spheroidin or tK gene and flank viral DNA be combined, any suitable cloning vector all can use.

Can make up the spheroidin shuttle vectors, make it to comprise spheroidin structure gene part, be arranged in or be incorporated into this gene cloning site so that selected heterologous gene can suitably be inserted into viral genome and just in time be positioned near the spheroidin promotor, and under its control, but also comprise the flank viral DNA that is connected on the arbitrary end of spheroidin gene, so that spheroidin foreign gene flanking sequence is inserted in another expression vector.The existence of flank viral DNA also helps and wild-type insect pox virus reorganization, thus with the transgenosis selected in the replication-competent virus genome.

Can modify so that insert the gene of certain selection shuttle vectors then, method is near corresponding transcription initiation site, the sequence of deletion or all encode spheroidin or tK, this site can be in spheroidin between 3077 and 3080 Nucleotide, then comprises 809 Nucleotide in tK.Can delete spheroidin or tK encoding sequence with ordinary method.

Except restriction site, also can insert various synthetic or natural oligonucleotide joint sequence in addition at the deletion segment place.Can insert a polynucleotide joint sequence (can be synthetic or natural) at the deletion segment place, so that dna fragmentation is in this site phase coupling.Such joint sequence can be two connected sequences, as providing a suitable interval district between promoter sequence and the gene that will express.If desired, this joint sequence polypeptide that also can encode and optionally to cut or to digest with conventional chemical or enzymatic means.For example, the cleavage site of selection can be a restriction enzyme site, comprises the site of being cut by proteolytic ferment, and these proteolytic ferments can be enteropeptidase, Xa factor, trypsinase, collagenase and zymoplasm.Cleavage site in the joint also can be the site that can be cut when the chemical substance that is exposed to certain selection (as cyanogen bromide or azanol) in addition.A cleavage site if be inserted in the joint of certain sequence that is applicable to the present invention, does not limit the present invention.Any needed cleavage site may be used to the present invention, and wherein many all be known in the art.Another kind of situation is, this joint sequence can encode one or a series of restriction site.

Those skilled in the art should recognize when reference is of the present invention, do not need to insert the joint sequence that has certain suitable restriction site and replace all or part of spheroidin structure sequence, and joint might be inserted on certain position in the entomopoxvirus genome, making coding select more than the sequence of peptide and the structure sequence of spheroidin all can express.For example, the sequence of peptide be inserted in the tK gene replacing all or part of tK structure sequence more than coding can being selected, and makes it to be in the transcribing under the control of tK promotor.

Also can use polymerase chain reaction (PCR) technology that suitable restriction site is imported among the EPV DNA, and the specific region of this EPV DNA that increases.These methods are known for the those of skill in the art in this area, for example referring to PCR Protocols:AGuide to Methods and Applications, M.A.Innis, D.H.Gelfand, J.J.Sninsky, and T.J.White(1990).

Utilize these technology, several different shuttle vectorss of selecting to modify that insert certain gene or its part can be used for the present invention.

Therefore, one embodiment of the invention are, the heterologous gene of certain selection to be transferred in the virus of selection as shuttle vectors with aforesaid polynucleotide sequence.In this scheme, coding EMV spheroidin gene or EMV tK gene or its segmental polynucleotide sequence are connected on the gene of source.This polynucleotide sequence also has a flank region at the either side of spheroidin heterologous gene or tK-heterologous gene, so that easily transfer in the virus of certain selection.This construct that is produced is called as gene magazine (Cassette).Such flanking region can be to obtain from EPV, or can with target virus complementary.For example, if wish in vaccinia virus, to insert a heterologous gene of selecting, can use and target vaccinia virus complementary flanking region to produce recombinant virus.Equally, if heterologous gene is inserted in EPV spheroidin or the tK gene, so that make selected EPV adjusting sequence and heterologous gene flank be connected to the sequence of EPV gene own, then can use this gene magazine to transfer to and have among the wild-type EPV of homologous sequence with flanking sequence.

Can be according to above-mentioned method, foreign gene inserted or be connected on tK of the present invention or the spheroidin sequence or with external flanking sequence be connected on spheroidin or the tK gene.Carrier of the present invention can use the cDNA clone of foreign gene, because the poxvirus du gene does not contain intron, this intron is the sequence of following of whole tenuigenin infection site by inference.

Can be according to the cloning process of standard, the gene of any selection is inserted in the existing restriction site of carrier to produce recombinant shuttle vector.Finally any meaningful gene can be inserted in the carrier as herein described and express with the height that obtains desired protein.Afterwards the restriction site in the fragment is removed, so that produce preferred spheroidin or shuttling back and forth property of tK carrier, this carrier has one or more cuttings or cloning site in 3 ' downstream of spheroidin promoter sequence.Therefore, the present invention is not subjected to the restriction that heterologous gene is selected.

Carrier of the present invention can also contain a kind of heterologous gene that has been inserted in all or part of EMV spheroidin or the tK protein coding sequence, to disturb this proteinic natural process.But, in the time of in this carrier being transferred to the virus that another kind contains wild-type spheroidin or tK gene, can be expressed the heterologous gene that is inserted into.Therefore, can be with entomopoxvirus spheroidin gene (Fig. 2) and/or tK gene (Fig. 3) as the position of in any above-mentioned expression system, inserting external source or foreign DNA.Can whether heterologous gene successfully be inserted in the selected expression system to identify with the mark of the carrier that so makes up as a kind of research and production method.

The tK gene is the especially site of expectation of inserting the heterologous gene of certain selection.Different with spheroidin is that tK is early stage and living with less volume production what infect.In addition, many poxvirus dus contain the tK gene that enough homologys are arranged with EPVtK, thereby are convenient to reorganization.For example, be used for the vaccinia virus expression system of mammalian cell, cowpox tK gene is that common inserts the site.Therefore, for making up a shuttle vectors when directly coming and going the gene of selecting between carrier system, this gene is especially suitable.Particularly, wish an alien gene is inserted (see figure 3) in the EPVtK gene order between nucleic acid 460 to 560.

The insertion of gene magazine in wild-type virus that utilizes the homologous recombination method to finish to contain foreign gene.The homologous recombination technique that is used for meaningful gene is inserted in the virus of the present invention is well known to those skilled in the art.When shuttle vectors and wild-type virus co-infected during, can transfer in the virus by the gene magazine that homologous recombination will contain the gene of selection, thereby produce recombinant viral vector to host cell.

In suitable growth medium, infect the susceptible host insect cell to finish selected expression of gene with recombinant viral vector of the present invention.The EPV expression vector by infecting virus particle assembling and be replicated in insect cell or insect in breed.Can suitably produce the gene of selecting in the insect cell with these infectious vectors, thereby the dna sequence dna that impels selection is at infected intracellular effective expression.If EPV spheroidin gene (or tK gene)-heterologous gene fragment is inserted in the vertebrates poxvirus du with above-mentioned same quadrat method, promptly available this recombinant virus infection mammal cell, and in mammalian cell, produce heterologous protein.

For example, can be directly will insert transgenosis in the tK site of vaccinia virus system to the tK seat of insect pox virus carrier of the present invention, vice versa.For example, available homologous recombination method is finished this process of shuttling back and forth.Equally the gene of certain selection is inserted in the spheroidin gene or tK gene in the virus vector, this gene is transferred to has respectively in other viruses of homology spheroidin or tK sequence.

Describe the present invention's representational carrier below for example, it is as heterologous gene with coding human (IFN-β) synthetic gene., and it is cloned in the appropriate site of AmEPV spheroidin gene with restriction enzyme digestion or accomplish tack and contain the dna fragmentation of IFN-β gene by traditional method, has wherein transformed restriction site with above-mentioned methods engineeringization with preparation.

The insertion of IFN-β gene produces the spheroidin-IFN-β gene of heterozygosis or fusion, if only some spheroidin gene is deleted as stated above, just then this gene can produce a kind of polypeptide product of fusion.If all the spheroidin structure sequence is deleted, then can only produce Interferon, rabbit.In addition, this heterozygous genes can contain the sequence of one of spheroidin promotor, IFN-beta protein encoding sequence and coding spheroidin part of polypeptide sequence, as long as the not deletion from used specific shuttle vectors of all these encoding sequences.

The shuttle vectors that is produced contains and IFN-β gene link coupled AmEPV spheroidin gene order.Then in the genome of insect pox virus that can the heterozygosis spheroidin-IFN-β transgenosis to of recombinant shuttle vector is suitable (as preferred AmEPV insect pox virus), to produce the recombinant virus expression vector of the gene that can in the host insect cell, express the coding beta-interferon.Finish the transfer of heterozygous genes with the method that those of skill in the art in this area know to wild-type virus.For example, can infect suitable insect cell with the wild-type insect pox virus.Use these infected cells of shuttle vectors transfection of the present invention then.As referring to DNA cloning:A Practical Approach, the Vol. II, D.M.Glorer edited, chapter 7,1985.Those of skill in the art in this area can select to be applicable to suitable insect cell of the present invention.The gypsymoth cell that for example can use saltmarsh Candle-sticks (solt marsh caterpillars) and cultivate.

In the reproduction process of AmEPV DNA after transfection, heterozygous genes is transferred among the wild-type AmEPV by the homologous recombination between recombinant shuttle vector and the AmEPV DNA.Therefore, produce and contain wild-type, non-reorganization EPV and the mixture that can express the reorganization EPV of IFN-β gene.

Though transfection is that heterozygous genes is transferred to preferred method in the EPV genome, but, those of skill in the art in this area can recognize, additive method also can be inserted into gene in the EPV genome effectively, and, can be at recombinant shuttle vector and EPV(or other poxvirus dus as long as between the corresponding sequence of heterozygous genes sequence and other virus strain, there are enough homologys to take place to allow reorganization) other strains between recombinate.

Can from the mixture of non-reorganization and reorganization insect pox virus, select to contain the preferred reorganization AmEPV expression vector of the heterozygosis spheroidin-IFN-β gene that is incorporated in the AmEPV genome then.Preferred but be not that only system of selection is, screening is by the formed plaque of host insect cell of the virus infection that does not produce viral closed shape.Why selecting by this way, is because the insertion inactivation of spheroidin gene, does not contain the enough not reorganization EPV virus of the spheroidin encoding sequence of interruption and can not produce viral closed shape effectively and make.

In addition, this system of selection can comprise that using beta-galactosidase gene selects so that carry out color.This method comprises e.coli is attached in the shuttle vectors, and is that those of skill in the art know.If exogenous DNA is inserted in the tK gene still can expresses the spheroidin gene again, just this method is especially valuable.Those of skill in the art also can be used according to the invention other system of selection.

Then, purify DNA from recombinant virus, and analyze with suitable restriction enzyme or round pcr, inserted the gene of selecting in position with the AmEPV carrier that confirms reorganization.

Carrier provided by the present invention and method are characterised in that to compare with carrier system with known carrier and have many advantages.Its advantage is that EPV virus vector of the present invention does not have carcinogenic or oncogenicity effect in Mammals.And the conditioning signal of control mulberry red edge lights moth insect pox virus (AmEPV) genetic expression is similar to cowpox.Therefore, not only might in insect cell, shift the spheroidin gene of strongly expressed as the expression magazine, or thymidine kinase gene, and can be used for vertebrates poxvirus du such as cowpox and pig pox virus.

Data according to the relevant cowpox of having reported, bleb and baculovirus vector system, prompting is shifted 30Kb under the situation of not destroying the carrier viability, when using new EPV carrier of the present invention and method, just can not be subjected to being packaged in the virus outside the restriction of NL of source DNA amount.

Another advantage is, for new carrier of the present invention, exogenous protein transcribe and translation is wholely cytoplasmicly to transcribe and translate.Also have an advantage then to be, regulate sequence when being combined in the carrier of the present invention with the source genetically manipulated when the EPV spheroidin, its ability to express can cause the high level expression of heterologous protein in the host cell of selection.

As mentioned above, the method of EPV carrier of the present invention and the heterologous protein selected in expressed in insect cells with them, have the advantage that in insect cell, to duplicate, so just avoided the use mammalian virus, thereby reduced the possibility of mammalian virus pollution products.Expression system of the present invention still is a kind of virus expression carrier system that does not rely on auxiliary composition.Known baculovirus expression system also has this two features.But, as shown in table 1, utilize the EPV expression system (EEVS) of carrier of the present invention to compare and have some important prominent feature with baculovirus expression system (BEVS).

Table 1

Difference between EEV and BEV

EEV BEV

Duplicate the position: the tenuigenin nucleus

Viraceae: Poxviridae Rhabdoviridae

The spheroidin of alien gene and polyhedrin and

Insert the position: thymidine kinase (tK) P10

Vertebrates and can not have the Mammals counterpart;

(true poxvirus) the known baculovirus of shuttling back and forth between the insect system does not contain

Possibility (rabbitpox virus) tK gene; Do not find

Have in (pig pox virus) mammlian system

(fowlpox virus) polyhedron

The present invention also provides a kind of method of screening recombinant host cell, is utilized recombinant virus polynucleotide molecule of the present invention to insert heterologous gene whereby.The viruses molecule that will contain the heterologous gene sequence of selection is connected on the less polynucleotide sequence of the sequence of the whole entomopoxvirus spheroidins of encoding ratio.This heterologous gene can perhaps be inserted in spheroidin or the tK gene coded sequence, thereby interrupt this encoding sequence being connected under the situation that does not have complete encoding sequence on spheroidin or the tK adjusting sequence.Under the condition that is suitable for expressing exogenous protein (nonfused or as the protein that merges with part spheroidin sequence), cultivate the cell that is infected by recombinant vectors.Do not exist and show by the formed closed shape of The expressed spheroidin usually and integrated heterologous gene.

If virus vector contains EPVtK encoding sequence incomplete or that interrupt equally, the thymidine kinase function that produces because of the integration of non-activity thymidine kinase sequence (as, to the resistance of methotrexate or its analogue) disappearing promptly shows and has inserted heterologous gene.

Perhaps, if parental virus is deleted its part tK or spheroidin gene, mix with the complete tK of foreign gene fusion or the virus vector of spheroidin with containing then, recombinant chou then can be expressed the methotrexate resistance respectively or be produced closed shape so, thereby confirms the integration of active tK or spheroidin and foreign gene.

Above-mentioned system of selection provides means effectively easily for selecting the recombinant entomopoxvirus expression vector.

Another embodiment of the invention comprises, uses new EPV expression vector of the present invention and method to control insect.Can utilize the carrier of the invention described above and method to implement control to insect pest.For example, the gene of the insect toxins of certain selection of coding can be inserted and be in spheroidin or tK and regulate in the virus expression carrier under the sequence control, perhaps be inserted in any in above-mentioned two genes, so that in the virus with its selection of recombinating to homology flanking region.

The gene of coding insect toxins is known for the those of skill in the art in this area.Can use according to the present invention for example a kind of from bacillus thuringiensis (Bacillus thuringiensis) (B.t.) isolating toxin gene.For example United States Patent (USP) 4,775, and No. 131 and 4,865, the B.t. gene of describing in No. 981.Other known insect toxins also can be used for present method.

With the resulting EPV vector administration of toxin gene that contains in target insect or its surrounding environment.Its advantage is that this virus vector can infect the target insect, thereby produces a large amount of toxin, and realizes the control to insect.If the adjusting sequence with insect pox virus spheroidin gene is expressed this toxin, can produce a large amount of especially toxin protein.

Perhaps, spheroidin is kept perfectly and toxin gene is inserted in different the insect pox virus gene such as tK gene.In this construct, will produce toxin by this system, then topped effectively or parcel by the spheroidin of natural generation.Therefore this system can produce the toxin that can continue existence in environment, thereby has prolonged the touch opportunity with the target insect.

Except the present invention new entomopoxvirus expression vector and above-mentioned using method, the invention still further relates to the expression system that makes up new chimeric cowpox and swine pox vaccine and can in multiple Mammals poxvirus, play a role with the new adjusting composition that derives from entomopoxvirus.Also polynucleotide sequence of the present invention can be used with virus vaccines (vaccinia virus vaccine as is known), to strengthen the effect of these vaccines.These vaccines have been used for controlling rabies and other communicable diseases that occurs in Mammals.Particularly can expect EPV spheroidin promoter sequence is used for expressing in mammalian hosts in the proteinic known viruse carrier of selection external importing to, thereby can make strong spheroidin promotor promote the expression of this albumen in virus vaccines.The present invention comprises that than other expression systems baculovirus expression system (BEVS) has tangible improvement in this respect.

The following examples have been described and have been implemented composition of the present invention and method, comprise best embodiment.These embodiment should not become limitation of the present invention.Except indicating in addition, all per-cent all refers to weight percent, and all dissolved mixing rates all by volume calculate.Restriction enzyme disclosed herein can be from Bethesda Research Laboratories, Gaithersburg, and MD, or New England Biolabs, Beverly, MA has bought.Can use these enzymes according to the specification sheets that producer provides.The Klenew fragment of archaeal dna polymerase, T ₄Polynucleotide kinase and T ₄Dna ligase all obtains from New England and Promega company.

Embodiment 1. preparation AmEPV DNA

The duplicating of AmEPV [R.H.Goodwin et al, J.lnvertebr.Pathol., 56:190-205(1990)] once described in the past.With gypsymoth (Lymantria dispar) clone IPLB-LD-652[Inseet Pathology Laboratory, Agricultural Research Service, U.S.Department of Agriecelture, Beltsville, MD] at every milliliter of EX-CELL400[JRH Bioseionces that adds 10% foetal calf serum, 100U penicillin and 100 μ g Streptomycin sulphates, Lencxa, KS] in 26 to 28 ℃ of insulations down.Other insect cell line is that those of skill in the art are known in this area, and can be used for the present invention.The AmEPV inoculum that is used for cell cultures derive from that AmEPV infected in-70 ℃ of E.acren larvas that store lyophilizes [P.L.Hall et al, Arch, Virol.110:77-90(1990)].The crushing of this larva is soaked in 5meEX-CELL400(to be contained penicillin and Streptomycin sulphate but not to contain foetal calf serum) in, the cysteine hydrochloride that has wherein added 0.003g is to prevent black become (melaniration).With centrifugal 5 minutes shards of 200 * g rotating speed, with the strainer of supernatant by 0.45 μ m aperture.

Add inoculum (each cell about 0.1 is to 1PFU) on the cell monolayer before joining, in first day, stir plate every now and then, so that infect the gypsymoth cell with AmEPV.Infect the cell of back results infection in 5 to 6 days.

With one of two kinds of methods preparation AmEPV DNA from the cell that infects.First method is that the cells infected that is embedded in the agar filler is carried out original position digestion, separates cell and the viral DNA that discharges with pulsed electrical field electrophoretic method [Bio-Rad CHEF-II-DR system].Infect the IPLB-LD-652 cell with the AmEPV that the first time, cell culture went down to posterity.Collected cell, the washing of infecting in centrifugal 5 minutes with 200 * g rotating speed and it is suspended in the HankShi phosphate buffered saline buffer (PBS) of improvement back 6 days of infection, wherein every liter contains 15g glucose, but does not contain Ca ²⁺And Mg ²⁺

For the cell embedding that will infect in agar filler, with the cell of 1%Sea Plague GTG agarose (with improved Hank's PBS preparation and 37 ℃ of following balances) and infection mixed, obtain every ml and contain 5 * 10 with 1: 1 ⁶0.5% agar of individual cell.By inset is contained 1%Sarkosyl-0.5MEDTA-1mg proteolytic enzyme at every ml

Solution under 50 ℃, vibrate gently and digested in 2 days, to discharge DNA[C.L.Smith et al., Methods Enzymol.151:461-489(1987)].Isolating CHEF-II-the DR parameter is 180V to be used for DNA, and the pulse ratio is 1, and 50 seconds initial pulse time, in final 90 seconds burst lengths, electrophoresis carried out under 4 ℃ 20 to 25 hours.Separating gel is 1%Seakem GTG agarose and 0.5 * tbe buffer liquid [Sambrook et al, document is the same].Observe viral DNA bands of a spectrum [W.B.Allington et al, Anal.Biochem.85:188-196(1978)] by electroelution and bromine second pyridine dyeing.After ethanol sedimentation, the DNA that reclaims is used for plasmid clone.

Second kind of method for preparing viral DNA is to use the extracellular virus that is present in the infected cell culture supernatant.By from infect the cell culture after 10 days, obtaining clarifying supernatant liquor with centrifugal 5 minutes of 200 * g.With the centrifugal virus of from supernatant, collecting of 12,000 * g.With sedimentary viral resuspending in 6ml1 * TE.Adding DNase I and RNaseA(ultimate density is respectively 10 and 20 μ g/ml), mixed solution is incubated 30 minutes down at 37 ℃.With mixture heating up to 50 ℃ maintenance 15 minutes, add SDS and Proteinase K (being respectively 1% and 200 μ g/ml) then.Be incubated this sample down at 50 ℃ and spend the night, use the saturated phenol extraction of damping fluid three times, extract 1 time (Sambrook et al, document is the same) with SEVAG again.Use ethanol sedimentation DNA, and again it is suspended in 1 * TE(PH8).

In order to carry out conventional virus quantitatively, add the suitable viral dilution liquid of 1ml (do not adding among the EX-CELL 400 of other compositions preparation) before the junction in a 60mm culture dish on the cell monolayer, under 26 to 28 ℃, stir the absorption phase discontinuously through 5 hours.Remove the virus inoculation thing, will prepare with 2 * EX-CELL400 then and cover on the cell monolayer at the 5ml 0.75%Sea Plaque agarose [FMC BioProducts, Rockland, ME] that 37 ℃ of following balances are crossed.Use the stereoscopic microscope observing plaque in insulation under 26 ℃ after 5 days.

DNA with above-mentioned any method preparation of various restriction endonuclease (as BamH I, EcoR I, Hind III, Pst I and Xho I) cutting obtains various fragments, and these segmental physical maps are shown among Fig. 1.All use corresponding restriction endonuclease and suitable letter representation when hereinafter mentioning each restriction fragment) as BennH I-A to BamH I-E, EcoR I-A to EcoR I-S etc.

Embodiment 2: separate the spheroidin gene

For the spheroidin gene is positioned, the closed shape (OBs) of dissolving purifying preparation from the caterpillar that infects, and carry out sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [J.K.Laemmli, Nature(London) 227:680-685(1970] with 4% acrylamide spacer gel (staeking gel) and 7.5% separating gel.[Bio-Rad, Richmond CA) make through the isolating spheroidin deionization that is used to carry out the protein micro-sequence analysis of acrylamide with AQ 501 * 8 resins.Gel is spent the night 4 ℃ of following polymerizations.Use is by 125 μ M Tris-Hcl(PH6.8), 4%SDS(W/V), 2 * Laemmli sample buffer of forming of 10% beta-mercaptoethanol (V/V) and 20% glycerine prepares sample.

With 2 * Laemmli sample buffer OB suspension sample is carried out dilution in 1: 1, and boiled 5 minutes.Electrophoretic separation OB protein product obtains several bands of a spectrum.Spheroidin (113KDa) is the main protein component of the OB of purifying.Acidity-Schiff (Schiff) staining by interval property.[R.M.Zacharius et al, Anal.Biochem., 30:149-152(1969)] detects the whether glycosylation of spheroidin in the SDS-polyacrylamide gel.

After the electrophoretic separation, transfer on poly-difluoroethylene (PVDF) film of a kind of Immobilon with several bands of a spectrum that Bio-Rad Trans Blot equipment will be unstained on the gel, be included in the damping fluid that contains 10mM propanesulfonic acid morpholine (PH6.0) and 20% methyl alcohol with 90V electrophoresis 2 hours.On pvdf membrane, observe spheroidin by the blue dyeing of coomassie back.

The zone of containing spheroidin on the pvdf membrane is downcut from this film, directly carry out the protein micro-sequence analysis with Applied Biosystems gas phase sequentor.The micro-sequence analysis of whole protein is success not, may be because due to this proteic N-terminal is closed.

Spheroidin sample to wash-out from pvdf membrane carries out the cyanogen bromide cutting, is used for the internal peptide fragment of sequential analysis with generation.The result has obtained 15,9,8 and the main polypeptide of 6.2KDa.

Embodiment 3: sequential analysis, hybridization

With [α- ³⁵S] d ATP and sequence enzyme [VS Bio-chemical, Cleveland, OH] carry out sequential analysis by dideoxy-chain terminating method [F.Sanger et al, Proc.Natl.Acad.Sci.USA, 74:5463-5467(1977)] to all DNA.The specification sheets that provides according to U.S. Biochemics Inc. (Bio-chemical) carries out the standard sequence analytical reaction with the sequence enzyme.

From embodiment 39 of generation; 8 and the 6.2KDa polypeptide in obtain a reliable aminoacid sequence.8 and 9KDa polypeptide have represented the CNBr cleaved products of lap, have also produced simultaneously the longest continuous amino acid sequence: Met-Ala-(Asn or Arg)-Asp-Leu-Val-Ser-Leu-Leu-Phe-Met-(Ans or Arg)-()-Tyr-Val-(Asn)-Ile-Glu-Ile-Asn-Glu-Ala-Val-()-(Glu). the amino acid sequence that obtains from the 6.2KDa fragment is: Met-Lys-Ile-Thr-Ser-Ser-Thr-Glu-Val-Asp-Pro-Glu-Tyr-Val-(Thr or Ile)-Ser-(Asn). the partial sequence that obtains from the 15KDa fragment is: (Asn)-Ala-Leu-Phe-(Phe) (Asn)-Val-Phe. All sequences finally all is positioned within the spheroidin gene order.

Embodiment 4: plasmid pRH512

The specification sheets that provides according to producer digests genome AmEPV DNA with preparation Bgl II AmEPV DNA library with the Bgl II.To plasmid pUC9[GIBCO; Bethesda Research Labs] carry out Bam HI digestion and Phosphoric acid esterase processing.The genome AmEPV of Bgl II cutting is robbed on the BamH I site that the formula method is cloned into pUC9 with shot.The shot that provides according to producer is robbed formula ligation method specification sheets and is come transformed into escherichia coli SURE[Stratagene by electroporation, La Jolla, CA with the Bio-Rad gene pulse instrument (Gene Pulser) that contains different recombinant plasmids].Available conventional alkali dissolution method prepares plasmid in a small amount.Cut these plasmids with EcoR I-Sal I and insert section to discharge, and electrophoretic separation it.The plasmid DNA that produces is carried out the reaction of Southern trace on nylon membrane, produce many clones.

It is 4.4Bgl II fragment and EcoR I-D fragment that genomic dna is carried out the fragment that restriction enzyme digestion produced.For the needed clone in location from those clones that as above produce, use the sequences Design one degeneracy oligonucleotide that from 6.2KDa CNBr fragment, obtains, be used as probe in the clone, to determine the position of spheroidin gene.The nucleotide sequence of the probe of this RM58 of being called is GA5GT7GA6CC7GA5TA6GT, wherein 5 represents A or G, and on behalf of C or T and 7,6 represent A, G, C or T, and the peptide sequence of this probe is: Glu-Val-Asp-Pro-Glu-Tyr-Val.

With [α- ³²P] dcTP by oligonucleotide extension method at random [A.P.Feinberg et al, Anal.Biochem., 132:6-13(1983)] or with [γ- ³²P] ATP and T ₄Polynucleotidase [Sambrook et al, document is the same] carries out radio-labeling to dna probe.The mark that uses the same method every other oligonucleotide probe described below.By the Sephadex-G50 post two types probe is carried out purifying.

Use Hybond-N[Amersham] carry out Southern and shift; By the UV cross connection DNA that shifts is fixed on the film.The Bgl II library that comprises above-mentioned restriction fragment and be cloned into the AmEPV DNA among the plasmid pUC9 of above-mentioned BamH I digestion with the DNA(that shifts) carrying out Southern hybridizes.Hybridize down at 37 or 45 ℃ with bovine lacto transfer technique optimizer [Bambrook et al., document is the same], use 0.3M NaCl-0.06M Tris(PH8 then with oligonucleotide probe)-2mM EDTA at room temperature washes twice, each 5 minutes.

RM58 probe hybridization [seeing Fig. 1] on the 4.4kbBgl II fragment of Am EPV DNA and the EcoR I-D fragment.Through also having identified a plasmid that is produced by shotgun formula cloning with the hybridization of RM58 oligonucleotide, promptly Chong Zu pRH512(is as being inserted into the Bal II 4.56kb fragment that contains in the pUC9BamH I site that is about 1.5kb spheroidin gene 5' end).

Separate 4.51Kb pRH512 Bal II and insert section, and as stated above radio-labeling it, hybridize to again as follows then on the various AmEPV genome digestion product.Use bovine lacto transfer technique optimizer [Sambrook et al down at 65 ℃, document is the same] carry out DNA-DNA hybridization, at room temperature use 0.3M NaCl-0.06M Tris(PH8 then)-2mM EDTA washes twice, each 5 minutes, washed twice each 15 minutes down at 65 ℃ again, at room temperature use 0.03M NaCl-0.06M Tris(PH8 then with the above-mentioned damping fluids of adding 0.4%SDS)-0.2mM EDTA washes twice again.Observed with BamH I-A, the EcoR I-D of AmEPV DNA, Hind III-G and-J, Pst I-A and the segmental hybridization of Xho I-B.The result of these hybridizations shows that the 4.51Kb fragment among the pRH512 is basic identical with the 4.4Kb fragment that is produced by Bgl II digested genomic dna.

With two kinds of methods the 4.51Kb Bgl II of pRH512 is inserted section then and carry out sequential analysis.One is bifilar plasmid sequence analytical procedure [M.Hatlori et al, Anal.Biochem., 152:232-238(1986)], this method is used " small-sized preparation " [Sambrook et al. document is the same] DNA and 1pmol is general, oligonucleotide primer that reverse or conventional design in each sequential analysis reaction.Through nested exonuclease II disappearance [S.Henikoff.Methods Enlymol., 155:156-165[(1987)] plasmid pRH512 is carried out sequential analysis according to the method.This disappearance is to begin from general primer is terminal.For preparing these disappearances, with EcoR I cutting DNA, utilize the Klenow fragment filling α-thiophosphate d NTP[S.D.Putney et al of e. coli dna polymerase, Proc.Natl.Acad.Sci.U.S.A, 78:7350-7354(1981)], with the cutting of Sma I, handle with exonuclease then.Sampling in per 30 seconds this, make it to connect again, and by electroporation in order to transformed into escherichia coli SURE cell.Carry out the sequential analysis reaction with general primer.If prepare one and this sequence complementary primer, and carry out sequential analysis by RM58 binding site (base 3983 to 4002) backspace, the sequence that is produced is as being translated, and then can obtain 6.2 KDa CNBr polypeptide fragments are carried out little sequence and the aminoacid sequence that produces.

Second kind of sequence analysis method be, by the following described M12 of being used in combination shotgun formula sequence analysis and standard with general and converse M13 primer is entered in the MB phage, to carry out the single stranded sequence analysis.Plasmid pRH512 is carried out supersound process produce random fragment, use phage T ₄Archaeal dna polymerase is repaired, and these fragment shotgun formulas is cloned into the M of Sma I cutting ₁₃Mp19[GIBCO] in.The 4.5Kb that use sees among the pRH512 inserts the radio-labeled probe of section preparation, and the screening plaque is analyzed [as referring to Sambrook et al, document is the same] to identify suitable clone with shotgun formula single stranded sequence.The sequential analysis of the Bgl II of pRH512 being inserted section is partitioned to Nucleotide 0 to 4505 with it, thereby makes it 5' and 3' extends to spheroidin gene place (Fig. 2).

Embodiment 5: the AmEPV sequence that obtains other

With Dra I digested genomic dna with preparation Dra I AmEPV DNA library.These Dra I fragment shotgun formulas are cloned into Sma I carrier M digestion, that Phosphoric acid esterase was handled ₁₃Among the mpl9.With standard method [J.Sambrook et al, document is the same] preparation M ₁₃Virus and DNA.Connect according to a conventional method and heat-shocked conversion [Sambrook et al, document is the same], obtain being transformed into the fragment of the shotgun formula clone in intestinal bacteria UT481 bacterial strain [deriving from University of Tennessee] or the SURE bacterial strain.

Carry out Standard PC R[Innis et al with 400mg genome AmEPV DNA as template, document is the same] from the nitrocellulose filter copy (plaque sample) [Micron Separations, lnc.] of the segmental M13 shotgun of the AmEPV formula gene pool of Dra I cutting, identify the probe that 586bp Dra I is cloned with preparation.Isolate the clone in topped spheroidin gene center unknown nucleotide sequence district in this way.The Standard PC R primer that is used for this reaction is that RM92 (GCCTGGTTGGGTAACACCTC) and this sequencing of RM118 (CTGCTAGATTATCTACTCCG) show that a single Hind III site is arranged at base 931 places, and spheroidin is openly read 3 of sign indicating number (oRF) ' end and is cut into tack (Fig. 2).

With inverse PCR (PCR) method [M.A.Innis et al, PCR Protoeol, a guide to methods and applications, Academic Press, Inc.San D

CA(1990)] and the AmEPV dna fragmentation that connects into ring of Cla I digestion, the preparation probe contains the clone of flanking sequence or confirm not have interference sequence in closing on the clone in order to evaluation.The primer that uses in inverse PCR is RM82 and the RM83 that obtains from the pRH512 sequence.The sequence of RM82 is TTTCAAATTAACTGGCAACC, and the sequence of RM83 is GGGATGGATTTTAGATTGCG.

Carry out 34 and take turns the PCR reaction, its special reaction condition is: 94 ℃ of following sex change 30 seconds, annealed 30 seconds down at 37 ℃, extended 15 minutes down at 72 ℃.At last, under 72 ℃, sample is incubated 8.5 minutes to finish extension.The concentration of every kind of primer all is 1 μ M.

Digest resulting 2.2Kb inverse PCR product with the Cla I, and with gel electrophoresis purifying 1.7Kb fragment.As primer this 1.7Kb PCR fragment is carried out sequential analysis with KM83.As identify that this new sequence must prepare other PCR primers that are used for this sequence.This sequence analysis method uses the every kind of primer of sequence enzyme, 5pmol and 10 to 50ng template.Before sequential analysis, with chloroform extraction PCR product, and Sephaeryls-400 chromatography column [document is the same for Sambrook, et al] go up purifying it.Concentrate each dna sequence dna also to make it alinement, can obtain consistent sequence [S.Staden, Nucleic Acids Res., 10:4731-4751(1982)].Measured the complete sequence of two chains; Confirmed PCR product sequence with conventional sequencing method.

1.7kb the segmental relevant Cla I of PCR site is positioned at Nucleotide 3485 and 6165 places.This fragment is carried out radio-labeling, and from Bgl II sheet phase library, locatees other clone, i.e. PKR827(307bp as probe with it), PRH85(1.88Kb) and PRH87(1.88kb).Use identical nested exonuclease II disappearance and the sequencing method of the above-mentioned PRH512 of being used for that plasmid PRH85 and pRH87 are carried out sequential analysis.Primer with conventional design carries out sequencing to the inverse PCR product, confirms that plasmid pRH85 and pRH87 have represented identical and 1.88kbBgl II DNA that direction is opposite inserts section, have a 80bp disappearance but also point out between pRH827 and PRH85.Identified this 80bp dna fragmentation in Dra I fragment, it is to be cloned into to extend to 5128 fragment from base 4543 among the M13.

The orientation of spheroidin ORF on physical map as shown in Figure 1.Meaningfully find 1.7kb inverse PCR fragment only with AmEPV Hind III-G fragment hybridization.From 8 and the polypeptide that produces of the overlapping CnBr of 9KDa the aminoacid sequence that obtains see 4883 to 4957 Nucleotide.The sequence that obtains from the 6.2KDa polypeptide sees 3962 to 4012 Nucleotide, and sees 4628 to 4651 Nucleotide from the aminoacid sequence that the 15KDa polypeptide obtains.Therefore, all finally all see within the spheroidin ORF from the sequence that protein micro-sequence mensuration obtains.

Embodiment 6: the spheroidin genetic transcription

Determine the starting point of spheroidin genetic transcription.That preparation begins with the initial methionine(Met) downstream 65bp that infers, with spheroidin gene order complementary primer, and carry out a series of primer extension reactions with it.

The preparation of A.RNA and primer extension reaction.

Prepare the inferior junction Tissue Culture Dish of six 150mm.The suction substratum, the virus inoculation thing of adding 2ml in each culture dish.Virus concentration is that each cell about 0.1 is to 1PFU.Stir culture ware every now and then in 3 hours absorption process.After the absorption phase finishes, wash cell with the improved PBS of 5ml.Change substratum, under 27 ℃, cells infected is incubated 72 hours.From cells infected, separate total RNA with thiocyanic acid Guanidinium-cesium chloride method [J.M.chirgwin et al, Biochemistry, 18:5294-5299(1979)].

Carry out primer extension reaction with primer RM165, this primer is the oligonucleotide (GTTCGAAACAAGTATTTTCATCTTTTAAATAAATC) of 35 bases, and its starting point and terminating point lay respectively at 100 and the 65bp place in initial codon methionine downstream in the TAAATG main structure.With [γ- ³²P] ATP and T ₄Polynucleotide kinase carries out end mark to this primer, and " revolve system post " (" Spun Column ") (Sambrook et al, document the same) go up purifying it.In order to anneal, make total RNA and 10 of the infected cell of 4 μ g total amounts with ethanol ⁶The coprecipitation of cpm radio-labeling primer.With the throw out resuspending in 25 μ l hybridization buffer [80% methane amide, 40mM N, two (2-ethylsulfonic acid) the croak piperazines (pH6.4) of N'-, 400mM NaCl, 1mMEDTA(pH8.0)] in, make it 72 ℃ of following sex change 15 minutes, and be incubated 18 hours down at 30 ℃.

In order to carry out primer extension,, and use it in 5 single reactions with ethanol sedimentation RNA-primer hybridization product, resuspending.Every part of reaction mixture all contains total RNA, the 50mM Tris-HCl of the cell of 8 μ g infection, (pH8.3), and 50mM KCl, IOmM dithiothreitol (DTT), 10mM MgCl ₂, 4 unit bird myeloblastic leukemia virus ThermoScript II (Life Sciceces), 8 RNasin(Promcga of unit), 0.25mM deoxy-ribonucleoside triphosphate (dNTP) and the suitable triphosphoric acid di-deoxynucleoside (ddNTP) of 0.25mM, the control group reaction mixture does not then contain ddNTP.The dNTP/ddNTP ratio that is used for C, T, A and G reaction is respectively 4: 1,5: 1, and 5: 1 and 2: 1.Be reflected at and carried out under 42 ℃ 30 minutes.

What add 1 microlitre in every kind of reaction mixture appends damping fluid (4 μ l 5mM dNTP mixed solutions and 1 μ l concentration are the ThermoScript II of 20 units/μ l), then their is continued insulation 30 minutes down at 42 ℃.Go up reaction product isolated at sequencing gel (8% acrylamide that contains 7M urea), by autoradiography observation it.Observe complementarity and can show that this gene transcription is initial in the TAAATG of said late promoter composition down to the AAA of TAAATG main structure upstream.Directly the upstream is the poly(A of non-coding on the transcript) the 5' district, poly(A) mean length is greater than 6bp.

Embodiment 7: the spheroidin sequential analysis

Sequential analysis is carried out in above-mentioned RM58 Oligonucleolide primers land, to begin to identify spheroidin ORF(G5R).Check AmEPV spheroidin gene order (ORF G5K), found potential can encode 1,003 amino acid or the about proteinic 3.0Kb ORF of 1.5KDa.With the 18.5%[Langridge of the complete AmEPV gene of having reported, W, H, R., R.F.Bozarth, D.W.Roberts(1977), Virology76:618-620] compare, this DRF contains 29%G+C.92 bases to initial ATG upstream are checked, find to have only 7 G or C residue.Exist a known vertebrates poxvirus in the 92bp 5 ' district that also finds at spheroidin ORF and regulate sequence.That comprise is three TTTTTNT early gene termination signals and TAAATG, infers that it is to have represented the late transcription start signal that starts spheroidin genetic transcription and translation.In spheroidin ORF upstream 92bp, also there are several translation stop codon that face mutually.

It is G1L, G2R, G3L and G4R(Fig. 2 that the analysis of spheroidin gene upstream sequence has been disclosed other four potential ORF).Do not find tangible homology between the less potential polypeptide by ORF G2R or G3L coding.But ORF G1L and the ORF17 that is present in vaccinia virus Hind III-I fragment have homology significantly, and its function still belongs to the unknown.ORFG4R shows and the ORF HM3 of goat capripoxvirus (Sapripoxvirus) has homology.In vaccinia virus, find that ORF HM3 homologous sequence is very approaching with the site of incomplete ATI gene.The part G61 OKF that is positioned at spheroidin gene right side shows with vaccinia virus NTP enzyme I good homology.Another kind of entomopoxvirus, cbEPV[Yuen, L.et al Virol.182:403-406(1991) finds to have better homology (18.4% is equal to, totally 162 amino acid) between] part G6LORF and the NPHI.

Embodiment 8: separate and contain the AMEPV EcoR I-Q fragment of tK gene and carry out sequencing.

Use the above-mentioned method that is used for spheroidin that EcoR I-Q fragment of the genome AmEPV of embodiment 1 is carried out sequencing.Sequential analysis shows the 1151bp that contains a part of O RF of two complete sums.Dna sequence analysis to ORF Q2 shows that the site of distinctive degeneracy oligonucleotide (RM03 and RM04) may be a hybridization site.With above-mentioned two oligonucleotide RM03 of method preparation and RM04.These two oligonucleotides be with several poxvirus and vertebrates tK gene [C.Upton etal, J.Virol., 60:920-927(1986); D.B.Boyle et al, Virology, 156:355-365(1987)] difference but very conservative zone be basic.RM03 be with cowpox tK protein in from the amino-acid residue of 82 aspartic acid to 87 phenylalanines corresponding 32 heavy degeneracy oligonucleotide GA (T/C) GA (G/A) GG (G/A) GG (G/A) CC (G/A) TT (C/T) TT.RM04 be and cowpox in from regional corresponding between 11 glycine to 16 glycine and GGNCCCATGTT (C/T) TCNGG of 32 heavy degeneracys is arranged.Method with above-mentioned mark RH58 probe is carried out radio-labeling to these probes.

By Southern blot hybridization, identify thymidine kinase (tK) gene of AmEPV with the EPV DNA of degeneracy oligonucleotide probe RM03 and RM04 and ECOR I-digestion.The EcoR I band of separate, purifying is useful (EcoR I-Q), and be connected in the pUC18 carrier of handling with the digestion of EcoR I and with calf intestinal alkaline phosphatase (GIBCO).By identifying recombinant clone with the oligonucleotide probe hybridization of radioactivity mark and according to the size of inserting section.

One of them clone is called PMEGtK-1(Fig. 6).Use contains and is positioned at the segmental recombinant clone of EcoR I-Q that two related sides of pUC18 carrier sequence make progress and carries out sequencing.Use the above-mentioned Henikoff method that is used for pRH512 to produce the sequence nested deletion.With these clones complete EcoR I-Q fragment is carried out sequential analysis.

Then, it is that a nondegenerate oligonucleotide GGTGCAAAATCTGATATTTC who prepares from ORFQ1 is as the sequencing primer, to confirm that they are in the position shown in the ORF Q2 to use these oligonucleotides and another RM129(.ORF Q2 182 the amino acid whose protein (21.2KDa) of may encoding.ORF3 a kind of 68 amino acid whose polypeptide that have at least of may encoding, but it is incomplete and is to transcribe in the other direction from ORF Q2.ORF Q1 66 the amino acid whose little peptides (7.75KDa) of may encoding.

Segmental further analysis has also disclosed other some to EcoR I-Q: at first, and ATT content very high (80%).For ORF Q2, in 100 nucleic acid in translation initiation codon upstream 90%ATT is arranged.Found that in ORF Q1 and Q2 some potential poxvirus transcribe signal.Initiator codon 5 bases before that just in time are positioned at ORF Q1 are TAAATG, and it includes the poxvirus du promotor in late period that conforms to.A potential poxvirus du early transcription terminator sequence (TTTTTAT) is positioned at 2nt place after translation stop codon of Q2.

The tK aminoacid sequence of the deduction that the ORF Q2 by EcoR I-Q fragment can be encoded is compared with the tK gene of following poxvirus, and they are: the sick virus of swine pox [W.M.Schnitzlein et al, Virol., 181; 727-732(1991); J.A.Feller et al, Virol.183:578-585(1991)]; Fowl avipoxvirus [Boyle et al., document is the same; M.M.Binns et al, J.Gen.Virol., 69:1275-1283(1988)]; Vaccinia virus [J.P.Weir et al, J.Virol., 46:530-537(1983); D.E.Hruby et al, Proc.Natl.Acad.Sci.USA, 80:3411-3415(1983)]; Smallpox and monkey pox virus [J.J.Esposito et al, Virol., 135:561-567(1984)]; Goat capripoxvirus [P.D.Gershon et al, J.Gen.Virol., 70:525-533(1989)]; Shope fibroma virus [Upton et al., document is the same]; People's cell thymidine kinase [H.D.Bradshaw et al, Gene, 52:267-277(1987)]; The tK[P.F.Lin et al of mouse, Mol.Cell.Biol., 5:3149-3156(1985)]; The tK[T.J.Kwoh et al of chicken, Nucl.Acids.ReS., 12; 3959-3971(1984)]; ASF[R.Blasco et al, Virol., 178:301-304(1990); A.M.Martin Hernandez et al, J.Virol., 65; 1046-1052(1991)].

Embodiment 9: express AmEPV tK gene in vaccinia virus

As follows with Am EPV tK gene clone in vaccinia strain tK mutant, Am EPV tK gene is carried out functional check.

Above-mentioned Am EPVEcoR I-Q fragment is inserted into by alkali dissolution method isolating shuttle plasmid pHGN3.1[D.D.Bloom et al from bacterial cell with two kinds of possible directions, J.Virol., 65:1530-1542(1991)] in.This EcoR I-Q dna fragmentation contains the open sign indicating number (ORF) of reading of Am EPV tK.Clone according to a conventional method.Resulting plasmid called after pHGN3.1/EcoR I-Q.

According to following specifically described method Lipofectin[GIBCO] with plasmid transfection in the mammalian cell of vaccinia virus infection.These cells can be mouse tK, people 143tK or the CV-1 clone that vaccinia virus VSC8 is rely and bred.These cells are remained on [Massung et al, Virol. 180:347-354(1991), classify this paper reference as] in the EagleShi minimum medium that contains EarleShi salt.

VSC8 vaccinia strain [Dr.Bernard Moss] contains the cowpox P that is inserted in the viral tK gene ₁₁Promotor (P ₁₁-1acz gene magazine) Kong Zhi beta-galactosidase gene.Though VSC8 contains because of beta-galactosidase enzymes inserts deactivated tK gene, has kept part cowpox tK sequence.Therefore VSC8 is the tK feminine gender, and with x-Gal(5-bromo-4-chloro-3-indyl-β-D-galactoside) dyeing can formation blue look plaque (the beta-galactosidase enzymes positive).

Making cell grow to 80% converges and (has 4 * 10 in the plate of each 60mm ⁶Individual cell).To containing 10 μ g plasmid DNA (50 μ l dH of pHGN3.1/AmEPV E1coR I-Q) ₂Add Lipofectin solution (50 μ l dH among the O ₂Contain 20 μ g Lipofectin among the O), insulation is 15 minutes under the room temperature.Virus absorbed (m.o.i. is 2,37 ℃) after the phase in 2 hours, monolayer cell was given a baby a bath on the third day after its birth inferior with the OptiMEM that does not contain serum.And then in each 60mm plate, add 3 milliliters of serum-free OptiMEM.Dropwise slowly add the Lipofectin/DNA mixed solution and jiggle simultaneously, and under 37 ℃, be incubated 12 to 18 hours again.Add foetal calf serum (final concentration 10%) then and the cell of results infection after infecting 48 hours.

Radiolabeled AmEPVEcoR I-Q fragment as stated above and the Xerox of viral plaque on nitrocellulose filter that obtains from the cell monolayer that infects are hybridized, contain the segmental recombinant virus of EcoR I-Q that is inserted in vaccinia hemagglutinin (HA) gene with discriminating.Separate possible recombinant chou from replica filter, and before test, carry out plaque purification several times.

The tK of AmEPV and the tK of cowpox show homology to a certain degree.In order to confirm that AmEPV tK gene is inserted in the HA gene of cowpox rather than is inserted in the residual tK sequence that is retained among the USC8, carries out a series of Southern hybridizations by the Hind III digestion product with various viruses and checks recombinant chou.When DNA that derives from wild-type virus and vaccinia virus tK probe hybridization, find that hybridization all occurs in about 5kb Hind III-J fragment of AmEPV.

When with cowpox tK pin check VSC8 or when containing the AmEPV tK of recombinant chou, under the situation that the radio-labeled substrate exists, hybridization then occurs on about 8kb fragment consistent with polysaccharase.Extension will terminate in the segmental end of Pst I-F.

Make the EcoR I digestion product hybridization of radiolabeled product and AmEPV DNA then.Direction as fruit gene is to make tKORF to genomic terminal the reading, and it will be hybridized with the EcoR-E fragment; If this gene is read to genomic center, then will hybridize with EcoR I-I fragment.

The result shows not only and hybridizes with EcoR I-A and EcoR I-E fragment, but also hybridizes with EcoR I-A fragment.The reading direction that can release the tK gene from these results is towards genomic left end.The extension products that comes off also shows and has in poxvirus common oppositely terminal repetitionly and in EcoR I-E fragment identical sequence is arranged with the hybridization of EcoR I-A fragment.

In the laboratory, the optimum growth temperature of AmEPV is 28 ℃.And the optimum growth temperature of vertebrates poxvirus is 37 ℃.As described herein, when the AmEPV dna fragmentation that complete tK gene will be arranged was cloned in the tK virus strain of vaccinia virus, recombinant virus can be in growing under the situation that methotrexate (Sigma) exists under 37 ℃, and this is tK ⁺The indication of phenotype.This embodiment proof can successfully be transferred to entomopoxvirus tK gene in the mammalian expression system, and this AmEPV tK has functionally active in a bigger temperature range.

Will be clear that the just explanation for example of example as described herein such as enforcement scheme.Those of skill in the art in this area can carry out various modifications and changes according to this specification sheets.The present invention includes those and the specifically described identical recombinant nucleotide sequence of this paper embodiment, plasmid, carrier and host transformed,, still remain with its expression characteristic in the said same structure even dna sequence dna is carried out unessential modification.For example, the professional and technical personnel in this area is for the fragment of the spheroidin gene non-coding region that obtains needed expression level, can use to be positioned at this structure gene upstream.As long as obtain the required expression level of the feature of this system of reservation, these fragments of this adjusting sequence just belong within the scope of the present invention.And, under the situation of the function that does not influence disclosed these sequences, can carry out inessential change to nucleotide sequence.This modification also belongs within the scope of the present invention, and belongs within the application's the spirit and scope and within the scope of the claim that awaits the reply.

Claims (36)

1, a kind of entomopoxvirus filefish albumen polynucleotide sequence, it does not contain natural with it other viral nucleotide sequences that are associated.

2, according to the sequence of claim 1, it be selected from by one or more spheroidin gene coded sequence, spheroidin sequential gene regulating, spheroidin gene promoter sequence, with and allelic variant or fragment form one group in.

3, according to the sequence of claim 1, wherein said polynucleotide sequence is a dna sequence dna.

4, according to the sequence of claim 1, wherein said sequence comes from mulberry red edge lights moth (Amsacta Modrei) entomopoxvirus.

5, according to the sequence of claim 4, it is selected from following one group of sequence: cross over the sequence of Nucleotide 1 to 6773 among Fig. 2, Fig. 2 crosses over the sequence of Nucleotide 3080 to 6091, and allelic variant, analogue or fragment.

6,, it is characterized in that it can instruct the expression of heterologous gene in the host cell of certain selection that operably is connected with said sequence or fragment according to the sequence of claim 2.

7, polynucleotide sequence, it comprises and contains entomopoxvirus spheroidin gene polynucleotide sequence and allelic variant thereof or segmental first polynucleotide sequence and second polynucleotide sequence of the code separated source gene of contact with it.

8, entomopoxvirus thymidine kinase gene polynucleotide sequence, it does not contain other viral nucleotide sequences of natural link with it.

9, according to the sequence of claim 1, it is selected from the one group of sequence that is grouped into by following one or more one-tenth: the thymidine kinase gene encoding sequence, thymidine kinase gene is regulated sequence, thymidine kinase gene promoter sequence, and allelic variant or fragment.

10, sequence according to Claim 8, wherein said polynucleotide sequence is a dna sequence dna.

11, sequence according to Claim 8, wherein said sequence is from mulberry red edge lights moth entomopoxvirus.

12, according to the sequence of claim 11, it is selected from following one group of sequence: cross over the sequence of Nucleotide 1 to 1511 among Fig. 3, cross over the sequence of Nucleotide 236 to 782 among Fig. 3, cross over the sequence of Nucleotide 782 to 849 among Fig. 3, and allelic variant or fragment.

13,, it is characterized in that it can instruct the expression of heterologous gene in the host cell of certain selection that operably is connected with said sequence or fragment according to the sequence of claim 9.

14, polynucleotide sequence, it comprises the thymidine kinase gene polynucleotide sequence that contains entomopoxvirus and allelic variant thereof or segmental first polynucleotide sequence and second polynucleotide sequence of the code separated source gene that interrelates with it.

15, insect pox virus spheroidin polypeptide, and fragment or analogue.

16, according to the polypeptide of claim 15, it and heterologous protein or peptide merge.

17, insect pox virus thymidine kinase polypeptide, and fragment or analogue.

18, according to the polypeptide of claim 17, it and heterologous protein or peptide merge.

19, recombination of polynucleotide molecule, comprise coding insect pox virus spheroidin promoter sequence and allelic variant or segmental polynucleotide sequence, wherein said promoter sequence operably is connected on the heterologous gene sequence of selection, and said promoter sequence can instruct the duplicating and expressing in the place of selection cell or virus of said gene.

20, recombination of polynucleotide molecule, include coding insect pox virus thymidine kinase promoter sequence and allelic variant or segmental polynucleotide sequence, wherein said promoter sequence operably is connected on the heterologous gene sequence of selection, and said promoter sequence can instruct the duplicating and expressing in the host cell of selecting of said gene.

21, recombinant molecule comprises gene and the allelic variant or the segmental polynucleotide sequence of coding entomopoxvirus spheroidin, and it is connected with the polynucleotide sequence of the heterologous gene sequence of coding selection on the structure.

22, recombinant molecule comprises coding entomopoxvirus thymidine kinase gene and allelic variant or segmental polynucleotide sequence, and it links to each other with the polynucleotide sequence of the heterologous gene sequence of coding selection on the structure.

23, recombinant molecule comprises entomopoxvirus spheroidin gene polynucleotide sequence and the allelic variant or the fragment of the heterologous gene sequence of having inserted certain selection.

24, recombinant molecule comprises entomopoxvirus thymidine kinase gene polynucleotide sequence and the allelic variant or the fragment of the heterologous gene sequence of having inserted certain selection.

25, recombinant virus comprises polynucleotide sequence, and this sequence contains insect pox virus spheroidin gene polynucleotide sequence and varient or the fragment on the heterologous gene sequence that operably is connected to selection.

26, according to the virus of claim 25, it is the poxvirus du that is selected from a following papova: vertebrates poxvirus, true poxvirus (Orthopoxvirus), pig pox virus (Suipoxvirus), vaccinia virus and entomopoxvirus.

27, recombinant virus, it comprises polynucleotide sequence, and this sequence contains entomopoxvirus thymidine kinase gene polynucleotide sequence and allelic variant or the fragment on the heterologous gene sequence that operably is connected to selection.

28, according to the virus of claim 29, it is the poxvirus du that is selected from a following papova: vertebrates poxvirus, true poxvirus (Orthopoxvirus), pig pox virus (Suipoxvirus), vaccinia virus and entomopoxvirus.

29, infected cells, this cell are contained, and entomopoxvirus spheroidin gene polynucleotide sequence on the heterologous gene sequence that operably is connected to certain selection and allelic variant or segmental recombinant virus infection thereof cross.

30, according to the cell of claim 30, it is selected from insect cell and mammalian cell.

31, the cell of Gan Raning, this cell are contained entomopoxvirus thymidine kinase gene polynucleotide sequence on the heterologous gene sequence that operably is connected to certain selection and allelic variant or segmental recombinant virus infection.

32, according to the cell of claim 32, it is selected from insect cell and mammalian cell.

33, produce the method for the polypeptide of selecting, comprise and cultivate the host cell of selecting, this cell has been contained operably is connected to insect pox virus thymidine kinase gene polynucleotide sequence and allelic variant or the segmental recombinant virus infection on the heterologous gene sequence of peptide more than the said selection of coding, and reclaims said polypeptide from substratum.

34, produce the method for the polypeptide of selecting, comprise and cultivate the host cell of selecting, this cell is by recombinant virus infection, said recombinant virus comprises entomopoxvirus spheroidin gene polynucleotide sequence and allelic variant or the fragment on the heterologous gene sequence of selection that operably is connected to peptide more than the said selection of coding, and reclaims said polypeptide from substratum.

35, the method for the recombinant host cell of heterologous gene is inserted in screening, comprise with a polynucleotide molecule and transform said cell, this polynucleotide molecule comprises the heterologous gene sequence of the selection in the polynucleotide sequence that is inserted into coding insect pox virus spheroidin, and wherein the closed shape that forms with the expression that does not have under the normal circumstances because of spheroidin is indicated the integration of foreign gene.

36, the method for the recombinant host cell of heterologous gene is inserted in screening, comprise with a polynucleotide molecule and infect said cell, this polynucleotide molecule comprises the heterologous gene sequence of the selection in the polynucleotide sequence that is inserted into coding insect pox virus thymidine kinase, and wherein the thymidine kinase function that forms with the integration that does not have non-activity thymidine kinase sequence is indicated the insertion of heterologous gene.

Images