IE920515A1 - Novel Entomopoxvirus Expression System - Google Patents

Abstract

The subject invention pertains to novel Entomopoxvirus (EPV) polynucleotide sequences free from association with other viral sequences with which they are naturally associated, recombinant polynucleotide vectors containing the sequences, recombinant viruses containing the sequences, and host cells infected with the recombinant viruses are provided herein, as well as methods for use thereof in the expression of heterologous proteins in both insect and mammalian host cells.

Description

NOVEL ENTOMOPOXVIRUS EXPRESSION SYSTEM Field of the Invention This invention relates generally to the field of recombinantly-produced proteins and specifically to novel, recombinant Entomopoxvirus proteins, protein regulatory sequences and their uses in expressing heterologous genes in transformed hosts.

Background of the Invention Poxviruses are taxonomically classified into the family Chordopoxvirinae, whose members infect vertebrate hosts, e.g., the Orthopoxvirus vaccinia, or into the family Entomopoxvirinae. Very little is known about members of the Entomopoxvirinae family other than the insect host range of individual members. One species of Entomopoxvirus (EPV) is the Amsacta moorei Entomopoxvirus (AmEPV), which was first isolated from larvae of the red hairy caterpillar Amsacta moorei [Roberts and Granados, J. Invertebr. Pathol.. 12;141-143 (1968)]. AmEPV is the type species of genus B of EPVs and is one of three known EPVs which will replicate in cultured insect cells [R. R. Granados et al, Replication of Amsacta moorei Entomopoxvirus and Autographa californica Nuclear Polyhedrosis Virus in Hemocyte Cell Lines from Estigmene acrea, in Invertebrate Tissue Culture Applications in Medicine, Biology, and Agriculture. E. Kurstak and K. Maramorosch (ed.), Academic Press, New York, pp. 379-389 (1976); T. Hukuhara et al, J, Invertebr. Pathol.. 56:222-232 (1990); and T.

Sato, Establishment of Eight Cell Lines from Neonate Larvae of Torticids (Lepidoptera), and Their Several Characteristics Including Susceptibility to Insect Viruses, in Invertebrate Cell Systems Applications, J.

Mitsuhashi (ed.), Vol. II, pp. 187-198, CRC Press, Inc., Boca Raton, Florida (1989)].

AmEPV is one of the few insect poxviruses which can replicate in insect cell culture; AmEPV is unable to replicate in vertebrate cell lines. The AmEPV doublestranded DNA genome is about 225 kb unusually A+T rich (18.5% G+C) [W. H. R. Langridge et al, Virology. 76:616620 (1977)]. Recently, a series of restriction maps for AmEPV were published [R. L. Hall et al, Arch. Virol.. 110;77-90 (1990)]. No DNA homology to vaccinia has been detected [W. H. Langridge, J. Invertebr. Pathol.. 42:7782 (1983); W. H. Langridge, J. Invertebr. Pathol.. 43:4146 (1984)].

The viral replication cycle of AmEPV resembles that of other poxviruses except for the appearance of occluded virus late in infection. For AmEPV, once a cell is infected, both occluded and extracellular virus particles are generated. The mature occlusion body particle, which is responsible for environmentally protecting the virion during infection, consists of virus embedded within a crystalline matrix consisting primarily of a single protein, spheroidin. Spheroidin, the major structural protein of AmEPV, has been reported to be 110 kDa in molecular weight and to consist of a high percentage of charged and sulfur-containing amino acids [Langridge and Roberts, J. Invertebr. Pathol.. 39:346-353 (1982)]. The use of viruses and virus proteins in eukaryotic host-vector systems has been the subject of a considerable amount of investigation and speculation.

Many existing viral vector systems suffer from significant disadvantages and limitations which diminish their utility. For example, a number of eukaryotic viral vectors are either tumorigenic or oncogenic in mammalian systems, creating the potential for serious health and safety problems associated with resultant gene products and accidental infections. Further, in some eukaryotic host-viral vector systems, the gene product itself exhibits antiviral activity, thereby decreasing the yield of that protein.

In the case of simple viruses, the amount of exogenous DNA which can be packaged into a simple virus is limited. This limitation becomes a particularly acute problem when the genes used are eukaryotic. Because eukaryotic genes usually contain intervening sequences, they are too large to fit into simple viruses. Further, because they have many restriction sites, it is more difficult to insert exogenous DNA into complex viruses at specific locations.

Vaccinia virus has recently been developed as a eukaryotic cloning and expression vector [M. Mackett et al, DNA Cloning. Vol. II, ed. D. M. Glover, pp. 191-212, Oxford: IRL Press (1985); D. Panicali et al, Proc. Natl. Acad. Sci. USA, 88:5364-5368 (1982)]. Numerous viral antigens have been expressed using vaccinia virus vectors [E. Paoletti et al, Proc. Natl. Acad. Sci. USA, 81:193197 (1984); A. Piccine et al, BioEssays, 5:248-252 (1986)] including, among others, HBsAg, rabies G protein and the gpl20/gp41 of human immunodeficiency virus (HIV). Regulatory sequences from the spruce budworm EPV have been used previously with vaccinia [L. Yuen et al, Virology. 175:427-433 (1990)].

Additionally, studies with vaccinia virus have demonstrated that poxviruses have several advantageous features as vaccine vectors. These include the ability of poxvirus-based vaccines to stimulate both cellmediated and humoral immunity, minimal cost to mass produce vaccine and the stability of the lyophilized vaccine without refrigeration, ease of administration under non-sterile condition, and the ability to insert at least 25,000 base pairs of foreign DNA into an infectious recombinant, thereby permitting the simultaneous expression of many antigens from one recombinant.

There exists a need in the art for additional viral compositions and methods for use in expressing heterologous genes in selected host cells, and in performing other research and production techniques associated therewith.

Summary of the Invention As one aspect, the invention provides an Entomopoxvirus polynucleotide sequence, free from other viral sequences with which it is associated in nature, which comprises a sequence encoding the Entomopoxvirus spheroidin gene and/or its regulatory sequences, an allelic variant, an analog or a fragment thereof. In a particular embodiment, the spheroidin DNA sequence is isolated from the Amsacta moorei Entomopoxvirus and is illustrated in Fig. 2.

Another aspect of the invention is the polynucleotide sequence encoding the Entomopoxvirus spheroidin promoter or an allelic variant, analog or fragment thereof. The spheroidin promoter sequence is characterized by the ability to direct the expression of a heterologous gene to which the sequence or fragment is operably linked in a selected host cell.

As another aspect, the present invention provides a recombinant polynucleotide sequence comprising a sequence encoding the Entomopoxvirus spheroidin protein and/or its regulatory sequences, an allelic variant, analog or fragment thereof, linked to a second polynucleotide sequence encoding a heterologous gene.

One embodiment of this polynucleotide sequence provides the spheroidin promoter sequence operably linked to the heterologous gene to direct the expression of the heterologous gene in a selected host cell. Another embodiment provides the sequence encoding the spheroidin protein linked to the heterologous gene in a manner permitting expression of a fusion protein. Still another embodiment provides the heterologous gene inserted into a site in the spheroidin gene so that the heterologous gene is flanked on both termini by spheroidin sequences.

As yet a further aspect, the invention provides an Entomopoxvirus polynucleotide sequence free from other viral sequences with which it is associated in nature, comprising a sequence encoding the Entomopoxvirus thymidine kinase (tk) gene and/or its regulatory sequences, an allelic variant, an analog or a fragment thereof. In a particular embodiment, the sequence originates from the Amsacta moorei Entomopoxvirus and is illustrated in Fig. 3.

In still another aspect the sequence encodes the Entomopoxvirus tk promoter, allelic variant or a fragment thereof. The tk promoter sequence is characterized by the ability to direct the expression of a heterologous gene to which the sequence or fragment is operably linked in a selected host cell.

Yet a further aspect of the invention provides a recombinant polynucleotide sequence described above encoding the Entomopoxvirus tk gene and/or its regulatory sequences, an allelic variant, or a fragment thereof, linked to a heterologous gene. One embodiment of this polynucleotide sequence provides the tk promoter sequence operably linked to the heterologous gene to direct the expression of the heterologous gene in a selected host cell. Another embodiment provides the sequence encoding the tk protein linked to the heterologous gene in a manner permitting expression of a fusion protein. Still another embodiment provides the heterologous gene inserted into a site in the tk gene so that the heterologous gene is flanked on both termini by tk sequences.

Another aspect of the invention is an Entomopoxvirus spheroidin polypeptide, a fragment thereof, or an analog thereof, optionally fused to a heterologous protein or peptide. Also provided is an Entomopoxvirus tk polypeptide, a fragment thereof, or an analog thereof, optionally linked to a heterologous protein or peptide.

Yet another aspect of the invention is provided by recombinant polynucleotide molecules which comprise one or more of the polynucleotide sequences described above. This molecule may be an expression vector or shuttle vector. The molecule may also contain viral sequences originating from a virus other than the Entomopoxvirus which contributed the spheroidin or tk polynucleotide sequence, e.g., vaccinia.

In another aspect, the present invention provides a recombinant virus comprising a polynucleotide sequence as described above. Also provided are host cells infected with one or more of the described recombinant viruses.

The present invention also provides a method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus, as described above, and recovering said polypeptide from the culture medium.

As a final aspect, the invention provides a method for screening recombinant host cells for insertion of heterologous genes comprising infecting the cells with a recombinant virus containing a polynucleotide molecule comprising the selected heterologous gene sequence linked to an incomplete spheroidin or tk polynucleotide sequence or inserted into and interrupting the coding sequences thereof so that the heterologous gene is flanked at each termini by an Entomopoxvirus spheroidin or tk polynucleotide sequence. The absence of occlusion bodies formed by the expression of the spheroidin protein in the spheroidin containing cell indicates the integration of the heterologous gene. Alternatively, the absence of the thymidine kinase function, i.e., resistance to methotrexate or a nucleotide analogue of methotrexate, formed by the integration of the inactive thymidine kinase sequence indicates the insertion of the heterologous gene.

Other aspects and advantages of the present invention are described further in the following detailed description of embodiments of the present invention.

Brief Description of the Drawings 15 Fig. 1 is a physical map of AmEPV illustrating restriction fragments thereof and showing the spheroidin gene just to the right of site #29 in the Hindlll-G fragment.

Fig. 2 provides the AmEPV DNA sequence of the 20 Amsacta moorei Entomopoxvirus spheroidin gene and flanking sequences, the deduced amino acid sequences of the spheroidin protein, and five additional open reading frames (ORFs).

Fig. 3 provides the DNA sequence of the Amsacta 25 moorei Entomopoxvirus thymidine kinase (tk) gene and flanking sequences, the deduced amino acid sequences of the tk protein, and two additional ORFs.

Fig. 4 provides the nucleotide sequences of the synthetic oligonucleotides designated RM58, RM82, RM83, RM92, RM118, RM165, RM03, RM04, and RM129.

Fig. 5 is a schematic map of an AmEPV fragment illustrating the orientation of the spheroidin ORF on the physical map and indicating homologies.

Detailed Description of the Invention The present invention provides novel Entomopoxvirus (EPV) polynucleotide sequences free from association with other viral sequences with which they are naturally associated. Recombinant polynucleotide vectors containing the sequences, recombinant viruses containing the sequences, and host cells infected with the recombinant viruses are also disclosed herein. These compositions are useful in methods of the invention for the expression of heterologous genes and production of selected proteins in both insect and mammalian host cells.

Novel polynucleotide sequences of the invention encode the EPV spheroidin gene and/or its flanking sequences, including sequences which provide regulatory signals for the expression of the gene. The invention also provides novel polynucleotide sequences encoding the EPV thymidine kinase (tk) gene and/or its flanking sequences. The polynucleotide sequences of this invention may be either RNA or DNA sequences. More preferably, the polynucleotide sequences of this invention are DNA sequences.

Specifically disclosed by the present invention are spheroidin and tk polynucleotide sequences obtained from the Amsacta moorei Entomopoxvirus (AmEPV). While this is the presently preferred species for practice of the methods and compositions of this invention, it is anticipated that, utilizing the techniques described herein, substantially homologous sequences may be obtained by one of skill in the art from other available Entomopoxvirus species.

The AmEPV spheroidin DNA sequence, including flanking and regulatory sequence, is reported in Fig. 2 as spanning nucleotides # 1 through 6768. Within this sequence, the spheroidin gene coding sequence spans nucleotides #3079 to #6091. Another fragment of interest falls between nucleotides #3080 - 6188. A fragment which is likely to contain the promoter sequences spans nucleotide #2780 - 3200. Other regions of that sequence have also been identified as putative coding regions for other structural or regulatory genes associated with spheroidin. These other fragments of interest include the following sequences: nucleotide # 1472 through 2148 encoding the G2R ORF; nucleotide #2502 through 2984 encoding the G4R ORF; and the following sequences transcribed left to right on Fig. 2: nucleotide #68 through through through 1459 2475 6769 encoding the GIL ORF; encoding the G3L ORF; nucleotide #2242 and nucleotide #6260 All ORFs are encoding the G6L ORF. 15 indicated on Fig. 2.

The AmEPV ORF G4R which is immediately upstream of the spheroidin gene has significant homology to the capripoxvirus HM3 ORF. A homolog of the HM3 ORF is found in vaccinia virus just upstream of a truncated version of the cowpox virus ATI gene. Therefore, the microenvironments in this region are similar in the two viruses. Two other ORFs relate to counterparts in vaccinia virus. These ORFs include the 17 ORF of the vaccinia virus HindIII-Ι fragment (17) [J. F. C. Schmitt et al, J. Virol. . 62.:1889-1897 (1988)] which relates to the AmEPV GIL ORF and the NTPase I (NPH I) ORF of the Hindlll-D fragment which relates to the AmEPV G6L ORF [S. S. Broyles et al, J. Virol.. 61:1738-1742 (1987); and J. F. Rodriguez et al, Proc. Natl. Acad. Sci. USA, 83.:956630 9570 (1986)]. The genomic location of the AmEPV ORFs compared with that of the vaccinia virus ORFs suggests that the arrangement of essential core genes, which are centrally located and colinear in many, if not all, of the vertebrate poxviruses on a more macroscopic scale, is quite different in the insect virus.

As set out in detail in the accompanying examples below, the spheroidin gene of AmEPV was identified through direct microsequencing of the protein, and the results were used for the design of oligonucleotide probes. Transcription of the spheroidin gene is inhibited by cycloheximide, suggesting it is a late gene. Consistent with this prediction are the observations that spheroidin transcripts were initiated within a TAATG motif (See Fig. 2, nucleotide #307710 3082) and that there was a 5* poly(A) sequence, both characteristic of late transcripts.

The AmEPV tk DNA sequence, including flanking and regulatory sequence, is reported in Fig. 3, as spanning nucleotides #1 through 1511. Within this sequence, the tk gene coding sequence spans nucleotides # 237 to 782 (transcribed right to left on Fig. 3). Another fragment of interest may include nucleotides #782 through #849 of that sequence or fragments thereof. A fragment likely to contain the promoter regions spans nucleotide #750 - 890. Other regions of that sequence have also been identified as putative coding regions for other structural or regulatory genes associated with tk. These other fragments of interest include the following sequences (transcribed left to right on Fig. 3: nucleotide # 21 through 218 encoding ORF Ql); and nucleotide # 853 through 1511 encoding ORF Q3.

The location of the AmEPV tk gene maps in the EcoRI-0 fragment near the left end of the physical map of the AmEPV genome (Fig. 1) [see, also, R. L. Hall et al, Arch. Virol.. 110:77-90 (1990), incorporated by reference herein]. Because of the orientation of the gene within the AmEPV genome, transcription of the gene is likely to occur toward the terminus. There are believed to be similar tk genes, or variations thereof, in other systems, including mammalian systems. As set out in detail in the examples below, the tk gene of AmEPV was identified through direct microsequencing of the protein, and the results were used for the design of oligonucleotide probes.

The term polynucleotide sequences when used with reference to the invention can include the entire EPV spheroidin or tk genes with regulatory sequences flanking the coding sequences. The illustrated AmEPV sequences are also encompassed by that term. Also included in the definition are fragments of the coding sequences with flanking regulatory sequences. The definition also encompasses the regulatory sequences only, e.g., the promoter sequences, transcription sites, termination sequences, and other regulatory sequences.

Sequences of the invention may also include all or portions of the spheroidin or tk genes linked in frame to a heterologous gene sequence. Additionally, polynucleotide sequences of the invention may include sequences of the spheroidin or tk genes into which have been inserted a foreign or heterologous gene sequence, so that the EPV sequences flank the heterologous gene sequence.

Polynucleotide sequences of this invention also include sequences which are capable of hybridizing to the sequences of Figs. 2 and 3, under stringent conditions, which sequences retain the same biological or regulatory activities as those of the figures. Also sequences capable of hybridizing to the sequences of Figs. 2 and 3 under non-stringent conditions may fall within this definition providing that the biological or regulatory characteristics of the sequences of Figs. 2 and 3, respectively, are retained. Examples of stringent and non-stringent conditions of hybridization are conventional [See, e.g., Sambrook et al, Molecular Cloning. A Laboratory Manual. 2d edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989)].

Similarly, polynucleotide sequences of this invention include allelic variations (naturally-occurring base changes in the EPV species population which may or may not result in an amino acid change) of DNA sequences encoding the spheroidin or tk protein sequences or DNA sequences encoding the other ORFs or regulatory sequences illustrated in Figs. 2 and 3. Similarly, DNA sequences which encode spheroidin or tk proteins of the invention but which differ in codon sequence due to the degeneracies of the genetic code or variations in the DNA sequences which are caused by point mutations or by induced modifications to enhance a biological property or the usefulness of a desired polynucleotide sequence encoded thereby are also encompassed in the invention.

Utilizing the sequence data in Fig. 2 or 3, as well as the denoted characteristics of spheroidin or thymidine kinase, it is within the skill of the art to obtain other DNA sequences encoding these polypeptides.

For example, the structural gene may be manipulated by varying individual nucleotides, while retaining the correct amino acid(s), or varying the nucleotides, so as to modify the amino acids, without loss of enzymatic activity. Nucleotides may be substituted, inserted, or deleted by known techniques, including, for example, in vitro mutagenesis and primer repair.

The structural gene may be truncated at its 31terminus and/or its 5’-terminus while retaining its biological activity. It may also be desirable to ligate a portion of the polypeptide sequence to a heterologous coding sequence, and thus to create a fusion peptide.

The polynucleotide sequences of the present invention may be prepared synthetically or can be derived from viral RNA or from available cDNA-containing plasmids by chemical and genetic engineering techniques or combinations thereof which are standard in the art.

The AmEPV proteins, spheroidin, thymidine kinase and their respective regulatory sequences, as described herein, may be encoded by polynucleotide sequences that differ in sequence from the sequences of Figs. 2 and 3 due to natural allelic or species variations. Thus, the terms spheroidin or tk polypeptides also refer to any of the naturally occurring 10 sequences and various analogs, e.g., processed or truncated sequences or fragments, including the mature spheroidin or tk polypeptides and mutant or modified polypeptides or fragments that retain the same biological activity and preferably have a homology to Fig. 2 or 3, respectively, of at least 80%, more preferably 90%, and most preferably 95%.

Another aspect of the present invention is provided by the proteins encoded by the EPV spheroidin and tk polynucleotide sequences. Putative amino acid sequences of the two EPV proteins as well as additional putative proteins encoded by the ORFs of these sequences which are identified in Figs. 2 and 3, respectively. EPV spheroidin has no significant amino acid homology to any previously reported protein, including the polyhedrin protein of baculovirus. Both spheroidin and tk are nonessential proteins, which makes them desirable as sites for insertion of exogenous DNA.

Comparison of the AmEPV tk amino acid sequence with other tk genes reveals that the AmEPV tk gene is not highly related to any of the vertebrate poxvirus tk genes (43.4 to 45.7%). The relatedness of the vertebrate tk proteins to AmEPV is still lower (39.3 to 41.0%), while African Swine Fever (ASF) showed the least homology of all the tk proteins tested (31.4%). Although ASF has many similarities to poxviruses, and both ASF and AmEPV infect vertebrate hosts, the tk genes indicate little commonality and/or indication of common origin stemming from invertebrate hosts.

The spheroidin and thymidine kinase polypeptide 5 sequences may include isolated naturally-occurring spheroidin or tk amino acid sequences identified herein or deliberately modified sequences which maintain the biological or regulatory functions of the AmEPV polypeptides, respectively identified in Figs. 2 and 3.

Therefore, provided that the biological activities of these polypeptides are retained in whole or part despite such modifications, this invention encompasses the use of all amino acid sequences disclosed herein as well as analogs thereof retaining spheroidin or tk biological activity. Typically, such analogs differ by only 1, 2, 3, or 4 codon changes. Similarly, proteins or functions encoded by the other spheroidin or tk ORFs may include sequences containing minor amino acid modifications but which retain their regulatory or other biological functions.

Examples of such modifications include polypeptides with minor amino acid variations from the natural amino acid sequence of Entomopoxvirus spheroidin or thymidine kinase; in particular, conservative amino acid replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.

For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on biological activity, especially if the replacement does not involve an amino acid at an active site of the polypeptides.

As used herein, the term polypeptide refers 10 to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post-expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.

The proteins or polypeptides of the present invention may be expressed in host cells and purified from the cells or media by conventional means [Sambrook et al, cited above].

This invention also relates to novel viral recombinant polynucleotide molecules or vectors, which permit the expression of heterologous genes in a selected host cell. Such a polynucleotide vector of the invention comprises the polynucleotide sequence encoding all or a portion of the spheroidin or tk gene, the RNA polymerase from a selected poxvirus, and the polynucleotide sequence encoding a desired heterologous gene. Preferably, the sequence includes the regulatory region, and most preferably, the promoter region, of either the EMV spheroidin or tk gene. In addition, the source of the polymerase is not limited to EMV; rather, any poxvirus RNA polymerase may be utilized.

Therefore, the viral vectors may contain other viral elements contributed by another poxvirus, either vertebrate or invertebrate, with the only EPV sequences being provided by the presence of the EPV spheroidin or tk gene sequences, or fragments thereof. Numerous conventional expression viral vectors and expression systems are known in the art. Particularly desirable vectors systems are those of vertebrate or invertebrate poxviruses. The Entomopoxvirus spheroidin and tk gene regulatory sequences may be used in other virus vector systems which contain a poxvirus RNA polymerase to enhance the performance of those systems, e.g., in vaccinia vectors. Methods for the construction of expression systems, in general, and the components thereof, including expression vectors and transformed host cells, are within the art. See, generally, methods described in standard texts, such as Sambrook et al, supra. The present invention is therefore not limited to any particular viral expression system or vector into which a polynucleotide sequence of this invention may be inserted, provided that the vector or system contains a poxvirus RNA polymerase.

The vectors of the invention provide a helper independent vector system, that is, the presence or absence of a functional spheroidin or tk gene in a poxvirus contributing elements to the vector, e.g., contributing the RNA polymerase, does not affect the usefulness of the resulting recombinant viral vector.

Because both spheroidin and tk are non-essential genes, the viral vectors of this invention do not require the presence of any other viral proteins, which in helperIE 920515 dependent systems are contributed by additional viruses to coinfect the selected host cell.

Selected host cells which, upon infection by the viral vectors will permit expression of the heterologous gene, include insect and mammalian cells.

Specifically, if the viral vector comprises the EPV spheroidin or tk gene sequences of the invention inserted into any member of the family Entomopoxvirinae, e.g., EPVs of any species, the host cell will be limited to cells of insects normally infected by EPVs. If the viral vector comprises the EPV spheroidin or tk gene sequences of the invention inserted into a vertebrate poxvirus, such as vaccinia or swinepox, the host cells may be selected from among the mammalian species normally infected by the wild-type vertebrate poxvirus. Most desirably, such mammalian cells may include human cells, rodent cells and primate cells, all known and available to one of skill in the art.

According to one aspect of the subject invention, therefore, vectors of the present invention may utilize a fragment of the polynucleotide sequence of EPV spheroidin, particularly the promoter and ancillary regulatory sequences which are responsible for the naturally high levels of expression of the gene.

Desirably, spheroidin sequences may be found within the sequence of Fig. 2, more particularly within the region of nucleotides # 2780 through 3200. Smaller fragments within that region may also provide useful regulatory sequences. The desired spheroidin promoter sequence can be utilized to produce large quantities of a desired protein by placing it in operative association with a selected heterologous gene in viral expression vectors capable of functioning in either a vertebrate or invertebrate host cell.

As used herein, the term operative association defines the relationship between a regulatory sequence and a selected protein gene, such that the regulatory sequence is capable of directing the replication and expression of the protein in the appropriate host cell. One of skill in the art is capable of operatively associating such sequences by resort to conventional techniques.

Where the spheroidin polynucleotide sequence in 10 the vector contains all or a portion of the spheroidin coding sequence in association with, or linked to, the heterologous gene, the resulting protein expressed in the host cell may be a fusion protein consisting of all or a portion of the spheroidin protein and the heterologous protein. Where the spheroidin polynucleotide sequence in the vector does not contain sufficient coding sequence for the expression of a spheroidin protein or peptide fragment, the heterologous protein may be produced alone.

In an analogous manner, the promoter and regulatory sequences of tk (Fig. 3) may be employed in the construction of an expression vector to drive expression of a heterologous protein, or a fusion protein, in a selected known expression system. These tk regulatory sequences are desirably obtained from the sequence of Fig. 3, particularly in the fragment occurring between nucleotide #750 through 890. Smaller fragments within that region may also provide useful regulatory sequences.

An advantage of the use of the novel EPV spheroidin or tk promoter sequences of this invention is that these regulatory sequences are capable of operating in a vertebrate poxvirus (e.g., vaccinia)-mammalian cell expression vector system. For example, the strong spheroidin promoter can be incorporated into the vaccinia virus system through homologous recombination. Unlike the promoter for the baculovirus polyhedrin gene, the promoter for the EPV spheroidin gene can be utilized directly in the vaccinia or swinepox virus expression vector.

To construct a vector according to the present invention, the spheroidin or tk polynucleotide sequence may be isolated and purified from a selected Entomopoxvirus, e.g., AmEPV, and digested with appropriate restriction endonuclease enzymes to produce a fragment comprising all or part of the spheroidin or tk gene. Alternatively such a fragment may be chemically synthesized.

Still alternatively, the desired AmEPV sequences may be obtained from bacterial cultures containing the plasmids pRH512, pMEGtk-1 or pRH7. The construction of the plasmid pRH512 is described in the examples below. This plasmid contains the 4.51 kb Bglll fragment AmEPV DNA sequence inserted into a BamHI site in the conventional vector pUC9. The plasmid pRH7 was constructed by digesting AmEPV genomic DNA, obtained as described in Example 1, with Bspl286I. and the resulting fragments with Haell. T4 DNA polymerase is employed to blunt end the AmEPV DNA and the fragment containing the spheroidin gene is ligated to the large fragment of a Smal digested pUC9 fragment. This fragment contains the entire spheroidin open reading frame and some flanking sequence, included within the nucleotide sequence spanning #2274-6182 of Fig. 2. The construction of plasmid pMEGtk-1 comprising the regulatory sequences of the tk gene as well as the structural gene is described below in Example 8. It was constructed by inserting the EcoRI-Q fragment of AmEPV into the conventional vector pUC18.

Bacterial cultures containing plasmids pRH512, pMEG tk-1, and pRH7 have been deposited in the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, USA. The deposited cultures are as follows: Culture Accession No. Deoosit Date 5 E. coli SURE strain (Stratagene) pMEG-tkl ATCC 68532 26 Feb 91 10 E. coli SURE strain (Stratagene) pRH512 E. coli SURE strain (Stratagene) pRH7 ATCC 68533 ATCC 26 Feb 91 The plasmids can be obtained from the deposited bacterial cultures by use of standard procedures, for example, using cleared lysate-isopycnic density gradient procedures, and the like.

These ATCC deposits were made under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademark to be entitled thereto under 37 CFR 1.14 and 35 USC 122.

The deposits will be available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by government action.

Further, the subject culture deposit will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., it will be stored with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture. The depositor acknowledges the duty to replace the deposit should the depository be unable to furnish a sample when requested, due to the condition of the deposit. All restrictions on the availability to the public of the subject culture deposit will be irrevocably removed upon the granting of a patent disclosing it.

The molecular biology procedures referred to herein in describing construction of the vectors of this invention are standard, well-known procedures. The various methods employed in the preparation of the plasmid vectors and transformation or infection of host organisms are well-known in the art. These procedures are all described in, for example, Sambrook et al, cited above. Thus, it is within the skill of those in the genetic engineering art to extract DNA from microbial cells, perform restriction enzyme digestions, electrophorese DNA fragments, tail and anneal plasmid and insert DNA, ligate DNA, transform cells, prepare plasmid DNA, electrophorese proteins, and sequence DNA.

Because the AmEPV genome has no known unique restriction sites into which selected genes may be effectively introduced in a site-specific manner so as to be under the control of the spheroidin or tk promoter sequences, such restriction sites must be introduced into desired sites in the selected EPV polynucleotide sequence. For example, the unique BstBl site located at nucleotide #3172 downstream from the start of the spheroidin gene is the closest site to genetically engineer a usable insertion sequence for cloning.

Therefore, restriction sites closer to the initiating Met of the spheroidin gene must be deliberately inserted.

Methods for the insertion of restriction sites are known to those of skill in the art and include, the use of an intermediate shuttle vector, e.g., by cloning the EPV sequence into the site of an appropriate cloning vehicle. It will be recognized by those skilled in the art that any suitable cloning vehicle may be utilized provided that the spheroidin or tk gene and flanking viral DNA may be functionally incorporated.

A spheroidin shuttle vector may be constructed to include elements of the spheroidin structural gene, a cloning site located or introduced in the gene to enable the selected heterologous gene to be properly inserted into the viral genome adjacent to, and under the control of, the spheroidin promoter, and flanking viral DNA linked to either side of the spheroidin gene to facilitate insertion of the spheroidin-foreign geneflanking sequence into another expression vector. The presence of flanking viral DNA also facilitates recombination with the wild type Entomopoxvirus, allowing the transfer of a selected gene into a replicating viral genome.

The shuttle vectors may thereafter be modified for insertion of a selected gene by deleting some or all of the sequences encoding for spheroidin or tk synthesis near the respective transcriptional start sites.

Examples of such sites in spheroidin are nucleotides #3077 and 3080 and in tk includes nucleotide #809.

Conventional procedures are available to delete spheroidin or tk coding sequences.

As an alternative to or in addition to the restriction site, a variety of synthetic or natural oligonucleotide linker sequences may be inserted at the site of the deletion. A polynucleotide linker sequence, which may be either a natural or synthetic oligonucleotide, may be inserted at the site of the deletion to allow the coupling of DNA segments at that site. One such linker sequence may provide an appropriate space between the two linked sequences, e.g., between the promoter sequence and the gene to be expressed. Alternatively, this linker sequence may encode, if desired, a polypeptide which is selectively cleavable or digestible by conventional chemical or enzymatic methods. For example, the selected cleavage site may be an enzymatic cleavage site, including sites for cleavage by a proteolytic enzyme, such as enterokinase, factor Xa, trypsin, collegenase and thrombin. Alternatively, the cleavage site in the linker may be a site capable of being cleaved upon exposure to a selected chemical, e.g. cyanogen bromide or hydroxylamine. The cleavage site, if inserted into a linker useful in the sequences of this invention, does not limit this invention. Any desired cleavage site, of which many are known in the art, may be used for this purpose. In another alternative, the linker sequence may encode one or a series of restriction sites.

It will be recognized by those skilled in the art who have the benefit of this disclosure that linker sequences bearing an appropriate restriction site need not be inserted in place of all or a portion of the spheroidin structural sequence, and that it would be possible to insert a linker in locations in the Entomopoxvirus genome such that both the sequence coding for the selected polypeptide and the spheroidin structural sequence would be expressed. For instance, the sequence coding for the selected polypeptide could be inserted into the tk gene in place of all or a portion of the tk structural sequence and under the transcriptional control of the tk promoter.

Polymerase chain reaction (PCR) techniques can also be used to introduce convenient restriction sites into the EPV DNA, as well as to amplify specific regions of the EPV DNA. These techniques are well known to those skilled in this art. See, for example, PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, (1990).

By use of these techniques, a variety of alternative modified shuttle vectors into which a selected gene or portion thereof may be incorporated may be suitably utilized in the present invention.

As one embodiment of the invention, therefore, the polynucleotide sequence, described above, may be used as a shuttle vector to transfer a selected heterologous gene to a selected virus. In this embodiment, the polynucleotide sequence encoding the EMV spheroidin gene or EMV tk gene, or a fragment thereof, is linked to a heterologous gene. The polynucleotide sequence further contains a flanking region on either side of the spheroidin-heterologous gene or tk-heterologous gene to enable ready transfer into a selected virus. This resulting construct is termed a cassette. Such a flanking region fflay be derived from EPV, or alternatively, may be complementary to the target virus.

For example, if it is desirable to insert a selected heterologous gene into a vaccinia virus to create a recombinant virus, one would utilize flanking regions complementary to the targeted vaccinia virus. Similarly if the heterologous gene is inserted within the EPV spheroidin or tk gene, so that the selected EPV regulatory sequence and heterologous gene are flanked by the EPV gene's own sequences, this cassette may be used for transfer into a wild type EPV having homologous sequences to the flanking sequences.

The insertion or linkage of the foreign gene into the tk or spheroidin sequences of the present invention or the linkage of flanking sequences foreign to the spheroidin or tk genes may be accomplished as described above. The vectors of the subject invention may use cDNA clones of foreign genes, because poxvirus genes contain no introns, presumably as a consequence of a totally cytoplasmic site of infection.

In accordance with standard cloning techniques, any selected gene may be inserted into the vector at an available restriction site to produce a recombinant shuttle vector. Virtually any gene of interest could be inserted into the vectors described herein in order to obtain high expression of the desired protein.

Restriction sites in the fragment may thereafter be 10 removed so as to produce a preferred spheroidin or tk shuttle vector, having one or more cleavage or cloning sites located in the 3' direction downstream from the spheroidin promoter sequence. Thus, the present invention is not limited by the selection of the heterologous gene.

Alternatively, a vector of this invention may comprise a heterologous gene which is inserted into all or a portion of the EMV spheroidin or tk protein coding sequence to interrupt the protein’s natural processing.

However, when the vector is transferred to another virus which contains a wild-type spheroidin or tk gene, expression of the inserted heterologous gene is obtained. Thus, the Entomopoxvirus spheroidin gene (Fig. 2) and/or the tk gene (Fig. 3) can be used as the location for the insertion of exogenous or heterologous DNA in any of the above-mentioned expression systems. A vector so constructed may be useful as a marker for research and production techniques for identifying the presence of successfully integrated heterologous genes into the selected expression system.

The tk gene is a particularly desirable site for insertion of a selected heterologous gene. Unlike spheroidin, tk is produced early in infection and in lesser quantities. Additionally, many poxviruses possess tk genes which may be sufficiently homologous to the EPV tk to provide easy recombination. For example, in vaccinia virus expression systems for mammalian cells, the vaccinia tk gene is a common insertion site. Therefore, the use of this gene is particularly desirable for construction of a shuttle vector to shuttle selected genes directly between vector systems. More specifically, a foreign gene may be desirably inserted into the EPV tk gene sequence between nucleotide #460 and #560 (See Fig. 3).

Insertion of cassettes containing foreign genes into wild-type poxviruses can be accomplished by homologous recombination. The homologous recombination techniques used to insert the genes of interest into the viruses of the invention are well known to those skilled in the art. The shuttle vectors, when co-infected into host cells with a wild-type virus, transfer the cassette containing the selected gene into the virus by homologous recombination, thereby creating recombinant virus vectors.

Expression of a selected gene is accomplished by infecting susceptible host insect cells with the recombinant viral vectors of this invention in an appropriate medium for growth. An EPV expression vector is propagated in insect cells or insects through replication and assembly of infectious virus particles. These infectious vectors can be used to produce the selected gene in suitable insect cells, thus facilitating the efficient expression of the selected DNA sequence in the infected cell. If the EPV spheroidin gene (or tk gene) - heterologous gene fragment is inserted into a vertebrate poxvirus by the same methods as described above, the recombinant virus may be used to infect mammalian cells and produce the heterologous protein in the mammalian cells.

For example, a gene inserted into the tk site of a vaccinia virus system could be transferred directly to the tk locus of an Entomopoxvirus vector of the subject invention, or vice versa. This shuttling could be accomplished, for example, using homologous recombination. Similarly insertion of a selected gene into the spheroidin gene or tk gene in a viral vector permits the gene to be shuttled into other viruses having homologous spheroidin or tk sequences, respectively.

The following description illustrates an exemplary vector of this invention, employing the gene coding for human β-interferon (IFN-β) synthesis as the heterologous gene. A DNA fragment containing the IFN-β gene is prepared conventionally with restriction enzyme digested or blunt ended termini and cloned into a suitable site in the AmEPV spheroidin gene, into which a restriction site has been engineered by the methods described above.

The insertion of the IFN-β gene produces a hybrid or fused spheroidin-IFN-β gene capable of producing a fused polypeptide product if only a portion of the spheroidin gene was deleted as described above.

If the entire spheroidin structural sequence was deleted, only interferon will be produced. Further, the hybrid gene may comprise the spheroidin promoter, the IFN-β protein coding sequences, and sequences encoding a portion of the polypeptide sequence of the spheroidin protein, provided all such coding sequences are not deleted from the particular shuttle vector utilized.

The resulting shuttle vector contains the AmEPV spheroidin gene sequence coupled to the IFN-β gene. The hybrid spheroidin-IFN-β gene of the recombinant shuttle vector is thereafter transferred into the genome of an appropriate Entomopoxvirus, such as the preferred Entomopoxvirus AmEPV, to produce a recombinant viral expression vector capable of expressing the gene encoding for 0-interferon in a host insect cell. Transfer of the hybrid gene to a wild-type virus is accomplished by processes which are well known to those skilled in the art. For example, appropriate insect cells may be infected with the wild type Entomopoxvirus. These infected cells are then transfected with the shuttle vector of the subject invention. These procedures are described, for example, in DNA Cloning: A Practical Approach. Vol. II, Edited by D. M. Glover, Chapter 7, 1985. A person skilled in the art could choose appropriate insect cells to be used according to the subject invention. By way of example, salt marsh caterpillars and cultured gypsy moth cells can be used.

During replication of the AmEPV DNA after transfection, the hybrid gene is transferred to the wildtype AmEPV by homologous recombination between the recombinant shuttle vector and AmEPV DNA. Accordingly, a mixture is produced comprising wild-type, nonrecombinant EPVs and recombinant EPVs capable of expressing the IFN-/3 gene.

While transfection is the preferred process for transfer of the hybrid gene into the EPV genome, it will be understood by those skilled in the art that other procedures may be suitably utilized so as to effect the insertion of the gene into the EPV genome and that recombination may be accomplished between the recombinant shuttle vector and other strains of EPV (or other poxviruses) so long as there is sufficient homology between the sequence of the hybrid gene and the corresponding sequence of the other strain to allow recombination to occur.

The preferred recombinant AmEPV expression vector, comprising a hybrid spheroidin-IFN-β gene incorporated into the AmEPV genome, can thereafter be selected from the mixture of nonrecombinant and recombinant Entomopoxviruses. The preferred, but by no means only, method of selection is by screening for plaques formed by host insect cells infected with viruses that do not produce viral occlusions. Selection may be performed in this manner because recombinant EPV viruses which do not contain sufficient uninterrupted coding sequence for spheroidin are defective in the production of viral occlusions due to the insertional inactivation of the spheroidin gene.

Also, the selection procedure may involve the use of the 0-galactosidase gene to facilitate color selection. This procedure involves the incorporation of the E« coli 0-galactosidase gene into the shuttle vector and is well known to those skilled in the art. This technique may be of particular value if the exogenous DNA is inserted into the tk gene so that the spheroidin gene is still expressed. It will be recognized by those skilled in the art that alternative selection procedures may also be utilized in accordance with the present invention.

Accordingly, the DNA from a recombinant virus is thereafter purified and may be analyzed with appropriate restriction enzymes, or PCR technology, to confirm that the recombinant AmEPV vector has an insertion of the selected gene in the proper location.

The vectors and methods provided by the present invention are characterized by several advantages over known vectors and vector systems. Advantageously, such the EPV viral vectors of the present invention are not oncogenic or tumorigenic in mammals. Also, the regulatory signals governing Amsacta moorei Entomopoxvirus (AmEPV) gene expressions are similar to those of vaccinia. Therefore, it is possible to transfer the strongly expressed spheroidin gene, or the thymidine kinase gene, as an expression cassette, not only in insect cells, but for use in vertebrate poxviruses such as vaccinia and swinepox virus.

Based on reported data with vaccinia, herpes 5 and baculovirus vector systems, which suggest that up to kb can be transferred without disrupting the vector viability, the normal limitation on the amount of exogenous DNA which can be packaged into a virus is not anticipated to be encountered when using the novel EPV vectors and methods of the subject invention.

Another advantage is that for the novel vectors of the subject invention, the transcription and translation of foreign proteins is totally cytoplasmic. Still another advantage lies in the expression power of the EPV spheroidin regulatory sequences, which when in operative association with a heterologous gene in a vector of this invention, should produce high levels of heterologous protein expression in the selected host cell.

The EPV vectors of this invention and methods for employing them to express selected heterologous proteins in insect cells, as described above, are characterized by the advantage of replication in insect cells, which avoids the use of mammalian viruses, thereby decreasing the possibility of contamination of the product with mammalian virus. The expression system of this invention is also a helper independent virus expression vector system. These two characteristics are shared by known baculovirus expression systems. However, as shown in Table 1, the EPV expression system (EEVS) using the vectors of this invention has some important distinguishing features compared to the baculovirus expression systems (BEVS).

Table 1 Differences between EEVS and BEVS EEVs BEVS Site of replication: Virus family: Sites for insertion of foreign genes Shuttle possibilities between vertebrate and insect systems: cytoplasm Poxviridae spheroidin & thymidine kinase (tk) yes (Orthopoxviruses) (Leporipoxviruses) (Suipoxviruses) (Avipoxviruses) nucleus Baculoviridae polyhedrin & plO No mammalian counterparts.

Baculovirus is not known to contain a tk gene. Polyhedrin is not found in mammalian systems.

The present invention also provides a method for screening recombinant host cells for insertion of heterologous genes is provided by use of the recombinant viral polynucleotide molecules of this invention. The viral molecules containing the selected heterologous gene sequence linked to the polynucleotide sequence encoding less than all of the Entomopoxvirus spheroidin protein. The heterologous gene may be linked to the spheroidin or tk regulatory sequences in the absence of the complete coding sequences, or it may be inserted into the spheroidin or tk gene coding sequences, thus disrupting the coding sequence. The cell infected with the recombinant vector is cultured under conditions suitable for expression of the heterologous protein, either unfused or as a fusion protein with a portion of the spheroidin sequence. The absence of occlusion bodies ,E 920515 which would ordinarily be formed by the expression of the intact spheroidin protein indicates the integration of the heterologous gene.

If the viral vector similarly contained either 5 incomplete or interrupted EPV tk encoding sequence, the absence of thymidine kinase function (e.g., resistance to methotrexate or an analogue thereof) formed by the integration of the inactive thymidine kinase sequence indicates the insertion of the heterologous gene.

Alternatively, if a parent virus is deleted of part of its tk or spheroidin gene, and is thereafter mixed with a viral vector containing intact tk or spheroidin fused to the foreign gene, recombinants would express the methotrexate resistance or produce occlusion bodies, respectively, thus indicating integration of the active tk or spheroidin genes and the foreign gene.

The above-described selection procedures provide effective and convenient means for selection of recombinant Entomopoxvirus expression vectors.

Another embodiment of the present invention involves using novel EPV expression vectors and methods of the subject invention for insect control. Control of insect pests can be accomplished by employing the vectors and methods of the invention as described above. For example, a gene coding for an selected insect toxin may be inserted into the viral expression vector under the control of the spheroidin or tk regulatory sequences or within either of the two genes for purposes of recombination into a selected virus having homologous flanking regions.

Genes which code for insect toxins are well known to those skilled in the art. An exemplary toxin gene isolated from Bacillus thurinqiensis (B.t.) can be used according to the subject invention. B.t. genes are described, for example, in U. S. Patent Nos. 4,775,131 and 4,865,981. Other known insect toxins may also be employed in this method.

The resulting EPV vector containing the toxin gene is applied to the target pest or its surroundings.

Advantageously, the viral vector will infect the target pest, and large quantities of the toxin will be produced, thus resulting in the control of the pest. Particularly large quantities of the toxin protein can be produced if the regulatory sequences of the Entomopoxvirus spheroidin gene are used to express the toxin.

Alternatively, the spheroidin gene can be left intact and the toxin gene inserted into a different Entomopoxvirus gene such as the tk gene. In this construct, the toxin will be produced by the system and then effectively coated or encapsulated by the natural viral production of spheroidin. This system thus produces a toxin which will advantageously persist in the environment to prolong the availability to the target pest.

In addition to the novel Entomopoxvirus expression vectors and methods for their use described herein, the subject invention pertains to the use of novel regulatory elements from Entomopoxvirus to construct novel chimeric vaccinia and swinepox vaccines and expression systems which are functional across genera of mammalian poxviruses. The polynucleotide sequences of the invention can also be used with viral vaccines, e.g., known vaccinia virus vaccines, to enhance the effectiveness of these vaccines. Such vaccines have been described for use in controlling rabies and other infectious diseases in mammals. Specifically, it is anticipated that the introduction of the EPV spheroidin promoter sequences into known viral vectors which are used to express selected proteins in a mammalian host in vivo may enable the powerful spheroidin promoter to increase expression of the protein in the viral vaccine. This aspect of the invention provides a significant improvement over other expression systems, including the baculovirus expression system (BEVS).

The following examples illustrate the compositions and procedures, including the best mode, for practicing the invention. These examples, should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. The restriction enzymes disclosed herein can be purchased from Bethesda Research Laboratories, Gaithersburg, MD, or New England Biolabs, Beverly, MA. The enzymes are used according to the instructions provided by the supplier. Klenow fragment of DNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase were obtained from New England Biolabs and Promega.

EXAMPLE 1; PREPARATION OF AmEPV DNA The replication of AmEPV has been described previously [R. H. Goodwin et al, J. Invertebr. Pathol.. 56:190-205 (1990)]. The gypsy moth (Lvmantria dispar) cell line IPLB-LD-652 [Insect Pathology Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD] is maintained at 26 to 28°C in EX-CELL 400 [JRH Biosciences, Lenexa, KS] supplemented with 10% fetal bovine serum, 100 U of penicillin, and 100 Mg of streptomycin per ml. Other insect cell lines are well known to those skilled in the art and can be used according to the subject invention.

The AmEPV inoculum for cell culturing was from an AmEPV-infected, freeze-dried E. acrea larva stored at -70°C [R. L. Hall et al, Arch. Virol., 110:77-90 (1990)]. The larva was crushed and macerated in 5 ml of EX-CELL 400 (with penicillin and streptomycin but without fetal bovine serum) to which 0.003 g of cysteine-HCl had been added to prevent melanization. The debris was pelleted at 200 x g for 5 minutes, and the supernatant was passed through a 0.45-Mm-pore-size filter.

The gypsy moth cells were infected with AmEPV by addition of the inoculum to a preconfluent monolayer of cells (about 0.1 to 1 PFU per cell), with occasional agitation of the dish during the first day. Infected cells were harvested 5 to 6 days postinfection.

AmEPV DNA was prepared from the infected cells by one of two methods. The first method involved in situ digestion of infected cells embedded within agarose plugs, after which the released cellular and viral DNAs were separated by pulsed-field electrophoresis [Bio-Rad CHEF-II-DR system]. IPLB-LD-652 cells were infected with first-cell-culture-passage AmEPV. Infected cells were harvested 6 days postinfection by centrifugation at 200 x g for 5 minutes, rinsed, and resuspended in modified Hank's phosphate-buffered saline (PBS), which contained g of glucose per liter, but no Ca2+ or Mg2+.

For embedding of the infected cells in agarose plugs, 1% SeaPlaque GTG agarose (prepared in modified Hank's PBS and equilibrated at 37°C) was mixed 1:1 with infected cells to yield 5 x 106 cells per ml in 0.5% agarose. Digestion to release DNA was done by gentle shaking of the inserts in 1% Sarkosyl-0.5 M EDTA-1 mg of proteinase K per ml at 50°C for 2 days [C. L. Smith et al, Methods Enzymol.. 151:461-489 (1987)]. The CHEF-IIDR parameters for DNA separation were 180 V, a pulse ratio of 1, 50 initial and 90 second final pulse times, and a run time of 20 to 25 hours at 4°C. The separating gel was 1% SeaKem GTG agarose in 0.5x TBE buffer [Sambrook et al, supra1. Viral DNA bands were visualized by ethidium bromide staining and electroeluted [W. B.

Allington et al, Anal. Biochem.. 85:188-196 (1978)]. The recovered DNA was used for plasmid cloning following ethanol precipitation.

The second method of viral DNA preparation used the extracellular virus found in the infected-cell5 culture supernatant. The supernatant from 10-daypostinfection cell cultures was clarified by centrifugation at 200 x g for 5 minutes. Virus was collected from the supernatant by centrifugation at 12,000 x g. Viral pellets were resuspended in 6 ml of lx TE. DNase I and RNase A (10 and 20 Mg/ml final concentrations, respectively) were added, and the mixture was incubated at 37°C for 30 minutes. The mixture was heated to 50°C for 15 minutes. SDS and proteinase K (1% and 200 Mg/ml, respectively) were then added. The sample was incubated to 50°C overnight and extracted three times with buffer-saturated phenol and once with SEVAG [Sambrook et al, supra1. The DNA was ethanol precipitated and resuspended in lx TE (pH 8).

For routine virus quantitation, 1 ml of an appropriate virus dilution (prepared in unsupplemented EX-CELL 400) was added to a preconfluent monolayer of cells in a 60 mm culture dish, with intermittent agitation over a 5 hour adsorption period at 26 to 28 °C. The virus inoculum was removed, and 5 ml of a 0.75% SeaPlaque agarose [FMC BioProducts, Rockland, ME] overlay prepared with 2x EX-CELL 400 and equilibrated at 37°C was added to the monolayer. Plaques were visualized after 5 days of incubation at 26°C by inspection with a stereomicroscope.

The DNA prepared according to either method was then cut with a variety of restriction endonuclease enzymes, e.g., BamHl. EcoRI. Hindlll. Pstl and Xhol. generating the various fragments which appear on the physical map of Fig. 1. Hereafter, reference to each restriction fragment will refer to the enzyme and the applicable letter, e.g., BamHI-A through BamHI-Ε. EcoRI-A through EcoRI-S. etc.

EXAMPLE 2 - ISOLATION OF THE SPHEROIDIN GENE To localize the spheroidin gene, a purified 5 preparation of occlusion bodies (OBs) from infected caterpillars was solubilized and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) [J. K. Laemmli, Nature (London), 227:680-685 (1970)] with a 4% acrylamide stacking gel and a 7.5% separating gel. The acrylamide used to prepare spheroidin for protein microsequencing was deionized with AG501X8 resin [Bio-Rad, Richmond, CA]. The gels were polymerized overnight at 4°C. For sample preparation, 2x Laemmli sample buffer consisting of 125 mM Tris-HCl (pH 6.8), 4% SDS (w/v), 10% β-mercaptoethanol (v/v), and 20% glycerol (v/v) was used.

OB suspension samples were diluted 1:1 with 2x Laemmli sample buffer and boiled for 5 minutes. Several lanes of an OB protein preparation were separated electrophoretically. The spheroidin protein (113 kDa) was the predominant protein of the purified OBs. Spheroidin within SDS-polyacrylamide gels was tested for glycosylation by periodic acid-Schiff staining [R. M. Zacharius et al, Anal. Biochem.. 20:149-152 (1969)].

Following electrophoretic separation, several lanes in the unstained gel were transferred to an Immobilon polyvinylidene difluoride (PVDF) membrane with a Bio-Rad TransBlot apparatus at 90 V for 2 hours in a buffer consisting of 10 mM morpholinepropanesulfonic acid (pH 6.0) and 20% methanol. Spheroidin was visualized on the PVDF membrane by Coomassie blue staining.

The region of the PVDF membrane containing spheroidin was excised from the membrane, and direct protein microsequencing was done with an Applied Biosystems gas-phase sequencer. Microsequencing of the intact protein was unsuccessful, presumably because the N terminus of the protein was blocked.

Cyanogen bromide cleavage was performed on 5 samples of spheroidin eluted from the PVDF membrane to generate internal peptide fragments for sequencing.

Major polypeptides of 15, 9, 8, and 6.2 kDa were produced.

EXAMPLE 3 - SEQUENCING, HYBRIDIZATIONS All DNA sequencing was done by the dideoxy chain termination method [F. Sanger et al, Proc. Natl. Acad. Sci. USA. 74:5463-5467 (1977)] with [a-35S]dATP and Sequenase [US Biochemical, Cleveland, OH]. Standard sequencing reactions with Sequenase were carried out in accordance with the instructions of the supplier, US Biochemical.

A reliable amino acid sequence was obtained from the 9, 8, and 6.2 kDa polypeptides produced as described in Example 3. The 8 and 9 kDa polypeptides represented overlapping partial CNBr cleavage products which together yielded the longest continuous amino acid sequence: Met-Ala-(Asn or Arg)-Asp-Leu-Val-Ser-Leu-LeuPhe-Met-(Ans or Arg)-(?)-Tyr-Val-(Asn?)-Ile-Glu-Ile-AsnGlu-Ala-Val-(?)-(Glu?). The amino acid sequence obtained from the 6.2 kDa fragment was Met-Lys-Ile-Thr-Ser-SerThr-Glu-Val-Asp-Pro-Glu-Tyr-Val-(Thr or lie)-Ser-(Asn?).

A partial sequence for the 15 kDa fragment was also obtained: (Asn?)-Ala-Leu-Phe-(Phe?)(Asn?)-Val-Phe. All sequences were ultimately located within the spheroidin gene sequence.

EXAMPLE 4 - PLASMID PRH512 A Bglll AmEPV DNA library was prepared by digesting the genomic AmEPV DNA with Bglll according to manufacturer's instructions. Plasmid pUC9 [GIBCO; Bethesda Research Labs] was BamHI-diqested and phosphatase-treated. The genomic Bglll cut AmEPV was shotgun cloned into the BamHI site of pUC9. Escherichia coli SURE [Stratagene, La Jolla, CA] was transformed by electroporation with a Bio-Rad Gene Pulser following the instructions provided by the manufacturer with the shotgun ligation, containing a variety of recombinant plasmids. Mini-preparations of plasmids were made by a conventional alkaline lysis procedure [Sambrook et al, supra]. These plasmids were cut with EcoRI-Sall to release the insert and run on a gel. The resulting plasmid DNA was southern blotted to a nylon membrane, producing a number of clones.

Among the fragments produced from the restriction enzyme digestions of the genomic DNA was a 4.4 Bglll fragment and an EcoRI-D fragment. In order to locate a desirable clone from among those produced above, the sequence derived from the 6.2 kDa CNBr fragment was used to design a degenerate oligonucleotide for use as a hybridization probe to locate the spheroidin gene in a clone. The nucleotide sequence of this probe called RM58 was GA5GT7GA6CC7GA5TA6GT, where 5 represents A or G, 6 represents C or T, and 7 represents A, G, C, or T. The peptide sequence of the probe was: Glu-Val-Asp-Pro-GluTyr-Val.

The DNA probe was radiolabeled either with [a32P]dCTP by the random oligonucleotide extension method [A. P. Feinberg et al, Anal. Biochem.. 132:6-13 (1983)] 0 or with [γ-32Ρ]ΑΤΡ and T4 polynucleotide kinase [Sambrook et al, supra1. These same procedures were used for all other oligonucleotide probes described below. Both types of probes were purified by passage through spun columns of Sephadex G-50.

Southern transfer was done with Hybond-N [Amersham]; the transferred DNA was fixed to the membrane by UV cross-linking. Southern hybridization was performed both with transferred DNA including the restriction fragments described above, as well as the Bglll library of AmEPV DNA cloned into BamHI-digested plasmid pUC9 as described above. Hybridization with the oligonucleotide probe was done at 37 or 45°C with BLOTTO [Sambrook et al, supra] and was followed by two washes at room temperature with 0.3 M NaCl-0.06 M Tris (pH 8)-2 mM EDTA for 5 minutes.

The RM58 probe hybridized to the 4.4 kb Bglll fragment and the EcoRI-D fragment of AmEPV DNA [See Fig. 1]. A plasmid produced by the shotgun cloning, recombinant pRH512 (a Bglll 4.56 kb fragment inserted into the BamHI site of pUC9 which contains about 1.5 kb of the 5’ end of the spheroidin gene) was also identified by this hybridization with the RM58 oligonucleotide.

The 4.51 kb pRH512 Bglll insert was isolated, radiolabeled as described above, and hybridized back to various AmEPV genomic digests as follows. The DNA-DNA hybridization was done at 65°C with BLOTTO [Sambrook et al, supra] and was followed by two washes at room temperature with 0.3 M NaCl-0.06 M Tris (pH 8)-2 mM EDTA for 5 minutes, two washes for 15 minutes each at 65°C but with 0.4% SDS added, and two washes at room temperature with 0.03 M NaCl-0.06 M Tris (pH 8)-0.2 mM EDTA. Hybridization was observed to the BamHI-A. EcoRI-D, Hindlll-G and -J, Pstl-A. and Xhol-B fragments of AmEPV DNA. The results of these hybridizations indicated that the 4.51 kb fragment in pRH512 was substantially identical to the 4.4 kb fragment produced by Bglll digestion of genomic DNA.

The 4.51 kb Bglll insert of pRH512 was thereafter sequenced by two procedures. One is the double-stranded plasmid sequencing method [M. Hattori et al, Anal. Biochem.. 152:232-238 (1986)] performed with miniprep [Sambrook et al, supra1 DNA and 1 pmol of universal, reverse, or custom-designed oligonucleotide primer in each sequencing reaction. Nested exonuclease II deletions [S. Henikoff, Methods Enzymol.. 155:156-165 (1987)] were used to sequence plasmid pRH512 according to this method. Deletions were made from the universal primer end. For making these deletions, the DNA was cut with EcoRI. filled in with α-thiophosphate dNTPs [S. D.

Putney et al, Proc. Natl. Acad. Sci. USA. 78:7350-7354 (1981)] by use of the Klenow fragment of E. coli DNA polymerase, cut with Smal. and treated with exonuclease III. Samples were removed every 30 seconds, re-ligated, and used to transform E, coli SURE cells by electroporation. Sequencing reactions were carried out with the universal primer. When a primer complementary to that sequence was prepared and used to sequence back through the RM58 binding site (bases 3983 to 4002), the generated sequence, when translated, yielded the amino acid sequence generated from microsequencing the 6.2 kDa CNBr polypeptide fragment.

A second sequencing method was performed using a combination of M12 shotgun sequencing with standard and universal and reverse M13 primers into M13 phage to permit single-stranded sequencing as follows. Plasmid pRH512 was sonicated to produce random fragments, repaired with bacteriophage T4 DNA polymerase, and these fragments were shotgun cloned into Smal-cut M13mpl9 [GIBCO]. Plaque lifts were screened with a radiolabeled probe prepared from the 4.5 kb insert found in pRH512 to identify appropriate clones for shotgun single stranded sequencing [see, e.g., Sambrook et al, supra1.

Sequencing of the Bglll insert of pRH512 isolated it to nucleotides # 0 to 4505, thus extending the sequence 5’ and 3’ to the spheroidin gene (Fig. 2).

EXAMPLE 5 - OBTAINING ADDITIONAL AmEPV SEQUENCE A Dral AmEPV DNA library was prepared by 5 digesting genomic DNA with Oral. These Dral fragments were shotgun cloned into Smal-digested. phosphatasetreated vector M13mpl9. Preparations of M13 virus and DNA were made by standard procedures [J. Sambrook et al, supra 1. Ligation and heat shock transformation procedures were performed conventionally [Sambrook et al, supra.1. resulting in the shotgun cloned fragments being transformed into the bacterial strain, E. coli UT481 [University of Tennessee] or the SURE strain.

Standard PCR [Innis et al, supra1 with 400 ng of genomic AmEPV DNA as a template was used to prepare a probe to identify a 586 bp Dral clone from nitrocellulose filter replicas (plaque lifts) [Micron Separations, Inc.] of the M13 shotgun library of Dral-cut AmEPV fragments. This was done to isolate a clone spanning a central unsequenced region of the spheroidin gene. The standard PCR primers used for this reaction were RM92 (GCCTGGTTGGGTAACACCTC) and RM118 (CTGCTAGATTATCTACTCCG). This sequencing revealed that there was a single Hindlll site at base 931 and that the 2' end of the spheroidin open reading frame (ORF) was truncated (Fig. 2).

The technique of inverse polymerase chain reaction (PCR) [M. A. Innis et al, PCR protocol, a guide to methods and applications. Academic Press, Inc. San Diego, CA (1990)] was used with Clal-digested AmEPV DNA fragments which were ligated into a circle, to prepare a probe to identify clones containing a flanking sequence or to verify the absence of an intervening sequence between adjacent clones. The primers used in inverse PCR were RM82 and RM83, which were taken from the pRH5l2 sequence. The sequence of RM82 was TTTCAAATTAACTGGCAACC and that of RM83 was GGGATGGATTTTAGATTGCG.

The specific PCR reaction conditions for 34 cycles were as follows: 30 seconds at 94°C for denaturation, 30 seconds at 37°C for annealing, and 1.5 minutes at 72°C for extension. Finally, the samples were incubated at 72°C to 8.5 minutes to complete extensions. The concentration of each primer was 1 μΜ.

The resulting 2.2 kb inverse PCR product was 10 digested with Clal. and a 1.7 kb fragment was gel purified. The 1.7 kb PCR fragment was sequenced with RM83 as a primer. Additional PCR primers were made to the new sequence as it was identified. The sequencing process employed Sequenase, 5 pmol of each primer, and 10 to 50 ng of template. Prior to being sequenced, the PCR products were chloroform extracted and purified on spun columns [Sambrook et al, supra1 of Sephacryl S-400. The DNA sequence was assembled and aligned, and consensus sequence was produced [R. Staden, Nucleic Acids Res.. :4731-4751 (1982)]. Both strands were completely sequenced; the PCR product sequence was verified by conventional sequence.

The relevant Clal sites of the 1.7 kb PCR fragment are at positions 3485 and 6165. This fragment was radiolabeled and used as a probe to locate additional clones, i.e., pRH827 (307 bp), pRH85 (1.88 kb), and pRH87 (1.88 kb) from the Bqlll fragment library. Plasmids pRH85 and pRH87 were sequenced using the same nested exonuclease II deletions and sequencing procedure, as described above for pRH512. Sequencing of the inverse PCR products with custom-designed primers confirmed that plasmids pRH85 and pRH87 represented the same 1.88 kb Bglll DNA insert in opposite orientations, but also revealed a missing 80 bp between pRH827 and pRH85. This bp DNA fragment was identified in the Dral fragment, as extending from bases 4543 to 5128 cloned into M13.

The orientation of the spheroidin ORF on the physical map is shown in Fig. 1. It is interesting to note that the 1.7 kb inverse PCR fragment only hybridized to the AmEPV Hindlll-G fragment. The amino acid sequence derived from the 8 and 9 kDa overlapping CnBr-generated polypeptides is found from nucleotide positions 4883 to 4957. That derived from the 6.2 kDa polypeptide is found from nucleotides 3962 to 4012, and that derived from the kDa polypeptide is found from nucleotides 4628 to 4651. Therefore, all sequences obtained from protein microsequencing were ultimately found to lie within the spheroidin ORF.

EXAMPLE 6 - SPHEROIDIN GENE TRANSCRIPTION The start site for spheroidin gene transcription was determined. A primer complementary to the spheroidin gene sequence beginning 65 bp downstream of the predicted initiating methionine was prepared and used for a series of primer extensions.

A. Preparation of RNA and primer extension reactions.

Six 150 mm dishes of subconfluent cells were prepared. The culture media were aspirated, and 2 ml of viral inoculum was added to each dish. The virus concentration was about 0.1 to 1 PFU per cell. The dishes were occasionally agitated during a 3 hour adsorption period. At the end of this period, the cells were rinsed with 5 ml of modified PBS. The media were replaced, and the infected cells were incubated for 72 hours at 27°C. Total RNA from the infected cells was isolated by the guanidinium thiocyanate-cesium chloride procedure [J. M. Chirgwin et al, Biochemistry. 18:52945299 (1979)].

Primer extension reactions were carried out with primer RM165, a 35-base oligonucleotide (GTTCGAAACAAGTATTTTCATCTTTTAAATAAATC) beginning and ending 100 and 65 bp downstream, respectively, of the initiating methionine codon found in the TAAATG motif.

The primer was end labeled with [7~32P]ATP and T4 polynucleotide kinase and purified on a spun column [Sambrook et al, supra1♦ For annealing, 40 pg of total infected-cell RNA and 106 cpm of radiolabeled primer were coprecipitated with ethanol. The pellet was resuspended in 25 μί of hybridization buffer [80% formamide, 40 mM piperazine-N,N1-bisf2-ethanesulfonic acid) (pH 6.4), 400 mM NaCl, 1 mM EDTA (pH 8.0)], denatured at 72°C for 15 minutes, and incubated at 30°C for 18 hours.

For primer extension, the RNA-primer hybrids were ethanol precipitated, resuspended, and used for five individual reactions. Each reaction contained 8 pg of total infected-cell RNA, 50 mM Tris-HCl, (pH 8.3), 50 mM KC1, 10 mM dithiothreitol, 10 mM MgCl2, 4 U of avian myeloblastosis virus reverse transcriptase (Life Sciences), 8 U of RNasin (Promega), 0.25 mM each deoxynucleoside triphosphate (dNTP), and the appropriate dideoxynucleoside triphosphate (ddNTP), except for a control reaction, which contained no ddNTP. The dNTP/ddNTP ratios were 4:1, 5:1, 5:1, and 2:1, for the C, T, A, and G reactions, respectively. The reactions were carried out at 42°C for 30 minutes.

One microliter of chase buffer (4 pi of 5 mM dNTP mixture and 1 pi of 20-U/gl reverse transcriptase) was added to each reaction mixture, which was then incubated for an additional 30 minutes at 42°C. Reaction products were separated on a sequencing gel (8% acrylamide containing 7 M urea) and visualized by autoradiography. Complementarity was observed until the AAA of the upstream TAAATG motif, indicating that transcription of the gene initiates within the TAAATG element of the proposed late promoter element.

Immediately upstream is a 5' tract of noncoded poly(A) on the transcripts. The average length of the poly(A) is greater than 6bp.

EXAMPLE 7: ANALYSIS OF SPHEROIDIN SEQUENCE The spheroidin ORF (G5R) was initially identified by sequencing back through the RM58 oligonucleotide primer binding region as described above.

Examination of the AmEPV spheroidin gene sequence (ORF G5R) revealed a potential ORF of 3.0 kb capable of encoding 1,003 amino acids or a protein of about 115 kDa. The ORF consists of 29% G+C, in contrast to the 18.5% reported for the entire AmEPV genome [Langridge, W.H.R., R.F. Bozarth, D.W. Roberts [1977] Virology 76:616-620].

Inspection of the 92 bases upstream of the initiating ATG revealed only 7 G or C residues. Also detected was the presence of known vertebrate poxvirus regulatory sequences within the 92 bp 5' of the spheroidin ORF.

Included are three TTTT TNT early gene termination signals and TAAATG, which presumably represents a late transcription start signal used to initiate transcription and translation of the spheroidin gene. Several adjacent translation termination codons are also present within the 92 bp upstream of the spheroidin ORF.

Analysis of the sequence upstream of the spheroidin gene revealed four additional potential ORFs, GIL, G2R, G3L, and G4R (Fig. 2). No significant homologies were found for the small potential polypeptides encoded by ORF G2R or G3L. ORF GIL, however, exhibited a significant degree of homology to ORF 17 found within the HindIII-Ι fragment of vaccinia virus, whose function is unknown. ORF G4R showed homology to ORF HM3 of capripoxvirus. In vaccinia virus, the ORF HM3 homolog was found very near the site of an incomplete ATI gene. The partial G6L ORF to the right of the spheroidin gene exhibited good homology to vaccinia virus NTPase I. Much better homology (78.4% identity over 162 amino acids) was found between the partial G6L ORF and NPH I of CbEPV [Yuen, L. et al, Virol.. 182:403406 (1991)], another insect poxvirus.

EXAMPLE 8 - ISOLATION AND SEQUENCING OF THE AMEPV ECORI-Q FRAGMENT CONTAINING THE TK GENE Sequencing of the EcoRI-Q fragment of genomic AmEPV of Example 1 was performed using techniques described above for spheroidin. The sequencing showed 1511 bp containing two complete and one partial ORF. Analysis of the DNA sequence of ORF Q2 indicates the sites where the identifying degenerate oligonucleotides (RM03 and RM04) might hybridize. Two oligonucleotides, RM03 and RM04, based on different but strongly conserved regions of the tk genes of several poxviruses and vertebrates [C. Upton et al, J, Virol.. 60:920-927 (1986); D. B. Boyle et al, Virology. 156:355-365 (1987)] were prepared by the methods referred to above. RM03 was the 32-fold degenerate oligonucleotide GA(T/C)GA(G/A)GG(G/A)GG(G/A)CA(G/A) TT(C/T)TT corresponding to the amino acid residues in the vaccinia tk protein from the aspartic acid at position 82 to the phenylalanine at position 87. RM04 was (GGNCCCATGTT(C/T)TCNGG with 32-fold degeneracy and corresponded to the region from the glycine at position 11 to the glycine at position 16 in vaccinia. These probes were radiolabeled as described above for the RH58 probe.

The AmEPV thymidine kinase (tk) gene was identified by hybridization with the degenerate oligonucleotide probes RM03 and RM04 to a Southern blot of the EcoRI-digested EPV DNA. The EcoRI band of interest (EcoRI-Q) was isolated, purified, and ligated into a pUC18 vector (GIBCO), previously digested with EcoRI and treated with calf intestinal alkaline phosphatase. Recombinant clones were identified by the size of the insert and by hybridization to the radioactive labeled oligonucleotide probes.

One such clone was called pMEGtk-1 (Fig. 6).

The recombinant clones containing the EcoRI-0 fragment oriented in both directions relative to the pUC18 vector sequences were used for sequencing. Sequential nested deletions were generated by the method of Henikoff, cited above, as described for pRH512. These clones were used for sequencing the entire EcoRI-0 fragment.

Subsequently, these oligonucleotides and another, RM129 is a non-degenerate oligonucleotide GGTGCAAAATCTGATATTTC prepared from the ORF Ql, were employed as sequencing primers to confirm their positioning as indicated in ORF Q2. ORF Q2 potentially encodes for a protein of 182 amino acids (21.2 kDa). ORF Q3 potentially encodes a polypeptide of at least 68 amino acids but is incomplete and is transcribed in the opposite direction from ORF Q2. ORF Ql potentially encodes a small peptide of 66 amino acids (7.75 kDa).

Further analysis of the EcoRI-0 fragment reveals several other points. First, the A+T content is very high (80%). For ORF Q2, the 100 nucleotides upstream of the start codon for translation are 90% A+T. Some potential poxvirus transcription signals were found between ORFs Ql and Q2. The five bases immediately preceding the start codon for ORF Ql are TAAATG which comprise a consensus late poxvirus promoter. A potential poxvirus early transcription termination signal sequence (TTTTTAT) is located 2 nt past the translation stop codon of Q2.

The deduced amino acid sequence for the tk encoded by the ORF Q2 of the EcoRI-Ο fragment can be compared to the tk genes for the poxviruses swine pox [W. M. Schnitzlein et al, Virol.. 181:727-732 (1991); J. A.

Feller et al, Virol.. 183:578-585 (1991)]; fowlpox [Boyle et al., supra; Μ. M. Binns et al, J. Gen. Virol., 69:1275-1283 (1988)]; vaccinia [J. P. Weir et al, J. Virol.. 46:530-537 (1983); D. E. Hruby et al, Proc. Natl. Acad. Sci. USA. 80:3411-3415 (1983)]; variola and monkeypox [J. J. Esposito et al, Virol.. 135:561-567 (1984)]; capripoxvirus [P. D. Gershon et al, J. Gen. Virol.. 70:525-533 (1989)]; Shope fibroma virus [Upton et al., supra1: the cellular thymidine kinases of humans [H. D. Bradshaw et al, Mol. Cell. Biol.. 4:2316-2320 (1984); E. Flemington et al, Gene. 52.:267-277 (1987)]; the tk of mouse [P. F. Lin et al, Mol Cell. Biol.. 5.:3149-3156 (1985)]; the tk of chicken [T. J. Kwoh et al, Nucl. Acids Res.. 12:3959-3971 (1984)]; ASF [R. Blasco et al, Virol.. 178:301-304 (1990); A. M. Martin Hernandez et al, L Virol.. 65:1046-1052 (1991)].

EXAMPLE 9 - EXPRESSION OF THE AmEPV tk GENE IN A VACCINIA VIRUS The AmEPV tk gene was tested functionally by cloning the gene into a vaccinia virus strain tk' mutant, as follows.

The EcoRI-Q fragment of AmEPV, described above, was inserted in both possible orientations into shuttle plasmid pHGN3.1 [D. D. Bloom et al, J. Virol., 65:15301542 (1991)] which had been isolated from bacterial cells by the alkaline lysis method. This EcoRI-Q DNA fragment contains the AmEPV tk open reading frame (ORF). The cloning was performed conventionally. The resulting plasmid was designated pHGN3.1/EcoRI-Q.

The plasmid was transfected by Lipofectin [GIBCO] as described specifically below into mammalian cells infected with vaccinia virus. The cells were either rat tk', human 143 tk', or CV-1 cell lines onto which the vaccinia virus VSC8 was propagated. These cells were maintained in Eagle's Minimal Essential Medium with Earle's salts [Massung et al, Virol.. 180:347-354 (1991) incorporated by reference herein].

The VSC8 vaccinia strain [Dr. Bernard Moss] contains the B-galactosidase gene driven by the vaccinia PH promoter (Pn-Lac Z cassette) inserted into the viral tk gene. While VSC8 contains an inactive tk gene due to the insertion of the β-galactosidase, portions of the vaccinia tk sequence remain. VSC8 is thus tk- and, upon staining with X-Gal (5-bromo-4-chloro-3-indoyl-B-Dgalactopyranoside), will form blue plaques (Bgalactosidase positive).

Cells were grown to 80% confluence (4 x 106 per 60 mm dish). Lipofectin solution (20 pg of Lipofectin in 50μ1 of dH2O) was added to 10/xg plasmid DNA (pHGN3.1/AmEPV EcoRI-Q) in 50μ1 of dH2O and incubated for 15 minutes at room temperature. After a 2 hour period of viral adsorption (m.o.i. of 2, 37°C), the monolayers were washed three times with serum-free OptiMEM. Three milliliters of serum-free OptiMEM was then added to each mm dish. The Lipofectin/DNA mixture was slowly added dropwise with gentle swirling and incubated an additional 12 to 18 hours at 37°C. Fetal bovine serum was then added (10% final) and the infected cells were harvested at 48 hours postinfection.

Recombinant viruses, containing the EcoRI-Q fragment inserted into the hemagglutinin (HA) gene of vaccinia, were identified by hybridization of AmEPV EcoRI-0 fragments, radioactively labeled by procedures described above, to replicas of nitrocellulose lifts of virus plaques from the infected monolayer. Potential recombinants were isolated from replica filters and plaque-purified several times before testing.

The tk of AmEPV exhibits some degree of 5 homology with the tk of vaccinia. To confirm that insertion of the AmEPV tk gene was within the HA gene of vaccinia rather than within residual tk sequences remaining in VSC8, the recombinants were examined by a series of Southern hybridizations to Hindlll digests of the various viruses. When DNA from wild-type virus was hybridized to a vaccinia virus tk probe, hybridization was observed exclusively within the »5 kb Hindlll-J fragment of AmEPV.

When either VSC8 or either of the AmEPV tk containing recombinants was examined using the vaccinia tk probe, hybridization occurred instead to an ~8 kb fragment consistent with polymerase in the presence of radiolabeled substrates. Extension will terminate at the end of the Pstl-F fragment.

The radiolabeled product was then hybridized to an EcoRI digest of AmEPV DNA. If orientation of the gene is such that the tk ORF reads toward the end of the genome, hybridization would be expected to the EcoRI-E fragment; whereas if the gene is read toward the center of the genome, hybridization would be expected to the EcoRI-I fragment.

The results indicate hybridization not only to the EcoRI-E fragment, but also to the EcoRI-Α fragment. These results infer that the orientation of the tk gene is with reading toward the left end of the genome.

Hybridization of the run-off extension product also to the EcoRI-A fragment is consistent with the presence of an inverted terminal repetition, common in poxviruses, with identical sequences residing in both the EcoRI-A and the EcoRI-E fragments.

The optimal growth temperature for AmEPV in the laboratory is 28°C, whereas that of the vertebrate poxviruses is 37°c. As described herein, when the AmEPV DNA fragment containing the entire tk gene was cloned into the tk' strain of vaccinia virus, the recombinant virus was capable of growing at 37°C in the presence of methotrexate [Sigma], indicative of a tk+ phenotype.

This example demonstrates that the Entomopoxvirus tk gene can be successfully transferred into mammalian expression systems, and that AmEPV tk is functionally active over a considerable temperature range.

It should be understood that the examples and embodiments described herein are for illustrative purposes only. Various modifications or changes in light thereof will be suggested to persons skilled in the art by this specification. The subject invention encompasses recombinant polynucleotide sequences, plasmids, vectors, and transformed hosts which are equivalent to those which are specifically exemplified herein in that the characteristic expression features are retained in said equivalent constructs even if inconsequential modifications to the DNA sequence have been made. For example, it is within the skill of a person trained in the art to use a fragment of the spheroidin gene's non25 coding region which is upstream of the structural gene in order to achieve the desired level of expression. Such fragments of the regulatory sequences fall within the scope of the current invention, so long as the desired level of expression which is characteristic of this system is retained. Furthermore, inconsequential changes to the nucleotide sequences can be made without affecting the disclosed functions of these sequences. Such modifications also fall within the scope of the current invention and are to be included within the spirit and purview of this application and the scope of the appended claims.

Claims (43)

1. CLAIMS 1. An Entomopoxvirus spheroidin gene polynucleotide sequence free from association with other viral nucleotide sequences with which it is associated in 5 nature.
2. 2. The sequence according to claim 1 selected from the group consisting of one or more of a spheroidin gene coding sequence, a spheroidin gene regulatory sequence, a spheroidin gene promoter sequence, an allelic 10 variant or fragment thereof.
3. 3. The sequence according to claim 1 wherein said polynucleotide sequence is a DNA sequence.
4. 4. The sequence according to claim 1 wherein said sequence is derived from the Amsacta moorei 15 Entomopoxvirus.
5. 5. The sequence according to claim 4 selected from the group consisting of the sequence spanning nucleotide #1 through #6773 of Fig. 2, the sequence spanning nucleotide #3080 through #6091 of Fig. 2, an 20 allelic variant, analog or fragment thereof.
6. 6. The sequence according to claim 2 characterized by the ability to direct the expression of a heterologous gene to which said sequence or fragment is operably linked in a selected host cell. 25
7. 7. A polynucleotide sequence comprising a first polynucleotide sequence comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant or a fragment thereof associated with a second polynucleotide sequence encoding a heterologous gene.
8. 8. An Entomopoxvirus thymidine kinase gene polynucleotide sequence free from association with other 5 viral nucleotide sequences with which it is associated in nature.
9. 9. The sequence according to claim 1 selected from the group consisting of one or more of a thymidine kinase gene coding sequence, a thymidine kinase gene 10. Regulatory sequence, a thymidine kinase gene promoter sequence, an allelic variant or fragment thereof.
10. 10. The sequence according to claim 8 wherein said polynucleotide seguence is a DNA sequence.
11. 11. The sequence according to claim 8 wherein 15 said sequence is derived from the Amsacta moorei Entomopoxvirus.
12. 12. The sequence according to claim 11 selected from the group consisting of the sequence spanning nucleotide #1 through #1511 of Fig. 3, 20 nucleotide #236 through #782 of Fig. 3, nucleotide #782 through #849 of Fig. 3, an allelic variant, a or a fragment thereof.
13. 13. The sequence according to claim 9 characterized by the ability to direct the expression of 25 a heterologous gene to which said sequence or fragment is operably linked in a selected host cell.
14. 14. A polynucleotide sequence comprising a first polynucleotide sequence comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant or a fragment thereof associated with a second polynucleotide sequence encoding a heterologous gene. 5
15. 15. An Entomopoxvirus spheroidin polypeptide, a fragment thereof, or an analog thereof.
16. 16. The polypeptide according to claim 15 fused to a heterologous protein or peptide.
17. 17. An Entomopoxvirus thymidine kinase 10 polypeptide, a fragment thereof, or an analog thereof.
18. 18. The polypeptide according to claim 17, fused to a heterologous protein or peptide.
19. 19. A recombinant polynucleotide molecule comprising a polynucleotide sequence encoding the 15. Entomopoxvirus spheroidin promoter sequence, an allelic variant or a fragment thereof, wherein said promoter sequence is operably linked to a selected heterologous gene sequence, said promoter sequence being capable of directing the replication and expression of said gene in 16. 20 a selected host cell or virus.
20. 20. A recombinant polynucleotide molecule comprising a polynucleotide sequence encoding the Entomopoxvirus thymidine kinase promoter sequence, an allelic variant, or a fragment thereof, wherein said 25 promoter sequence is operably linked to a selected heterologous gene sequence, said promoter sequence being capable of directing the replication and expression of said gene in a selected host cell. 17.
21. 21. A recombinant molecule comprising a polynucleotide sequence encoding the Entomopoxvirus spheroidin gene, an allelic variant, or a fragment thereof, linked in frame to a polynucleotide sequence 5 encoding a selected heterologous gene sequence. 18.
22. 22. A recombinant molecule comprising a polynucleotide sequence encoding the Entomopoxvirus thymidine kinase gene, an allelic variant, or a fragment thereof, linked in frame to a polynucleotide sequence 10 encoding a selected heterologous gene sequence. 19.
23. 23. A recombinant molecule comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, into which a selected heterologous gene sequence has been inserted. 15 20.
24. 24. A recombinant molecule comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant, or a fragment thereof, into which a selected heterologous gene sequence has been inserted. 20
25. 25. A recombinant virus comprising a polynucleotide sequence comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant or a fragment thereof, optionally linked to a selected heterologous gene sequence. 21. 25 22.
26. 26. The virus according to claim 25, which is a poxvirus selected from the group consisting of a vertebrate poxvirus, orthopoxvirus, suipoxvirus, vaccinia virus and entomopoxvirus. 23.
27. 27. A recombinant virus comprising a polynucleotide sequence comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant or a fragment thereof, optionally linked to a 5 selected heterologous gene sequence. 24.
28. 28. The virus according to claim 27, which is a poxvirus selected from the group consisting of a vertebrate poxvirus, orthopoxvirus, suipoxvirus, vaccinia virus and entomopoxvirus. 10 25.
29. 29. A cell infected with a recombinant virus comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, optionally linked to a selected heterologous gene sequence. 15
30. 30. The cell according to claim 29 selected from the group consisting of insect cells and mammalian cells.
31. 31. A cell infected with a recombinant virus comprising an Entomopoxvirus thymidine kinase gene 20 polynucleotide sequence, an allelic variant, or a fragment thereof, optionally linked to a selected heterologous gene sequence.
32. 32. The cell according to claim 31 selected from the group consisting of insect cells and mammalian 25 cells.
33. 33. A method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant, or a fragment thereof, operably linked to a heterologous gene sequence encoding said selected polypeptide, and recovering said polypeptide from the culture medium. 5
34. 34. A method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, operably 10 linked to a selected heterologous gene sequence encoding said selected polypeptide, and recovering said polypeptide from the culture medium.
35. 35. A method for screening recombinant host cells for insertion of heterologous genes comprising 15 transforming said cells with a polynucleotide molecule comprising the selected heterologous gene sequence inserted into the polynucleotide sequence encoding entomopox spheroidin, wherein the absence of occlusion bodies normally formed by the expression of the 20 spheroidin protein indicates the integration of the heterologous gene.
36. 36. A method for screening recombinant host cells for insertion of heterologous genes comprising infecting said cells with a polynucleotide molecule 25 comprising the selected heterologous gene sequence inserted into the polynucleotide sequence encoding entomopox thymidine kinase, wherein the presence of thymidine kinase function formed by the integration of the inactive thymidine kinase sequence indicates the 26. 30 insertion of the heterologous gene.
37. 37. A sequence according to any one of claims 1, 7, 8 or 14, substantially as hereinbefore described with reference to the accompanying drawings.
38. 38. A polypeptide as claimed in claim 15 or 17, substantially as hereinbefore described and exemplified.
39. 39. A recombinant polynucleotide molecule according to any one of claims 19-24, substantially as hereinbefore described and exemplified.
40. 40. A recombinant virus according to claim 25 or 27, substantially as hereinbefore described.
41. 41. A method according to claim 33 or 34 for producing a selected polypeptide, substantially as hereinbefore described and exemplified.
42. 42. A selected polypeptide whenever produced by a method claimed in any one of claims 33, 34 or 41.
43. 43. A method according to claim 35 or 36 for screening recombinant host cells, substantially as hereinbefore described and exemplified.