CA2103550A1 - Entomopoxvirus expression system comprising spheroidin or thymidine-kinase sequences - Google Patents

Abstract

The subject invention pertains to novel Entomopoxvirus (EPV) polynucleotide sequences free from association with other viral sequences with which they are naturally associated, recombinant polynucleotide vectors containing the sequences, recombinant viruses containing the sequences, and host cells infected with the recombinant viruses are provided herein, as well as methods for use thereof in the expression of heterologous proteins in both insect and mammalian host cells.

Description

W092/1~18 2 1 ~ 3 ~ 5 ~ PCT/US92/~SS

NOVEL ENTOMOPOXVIRUS EXPRESSION SYSTEM

Field of the Invention This invention relates generally to the field of recombinantly-produced proteins and specifically to novel, recombinant Entomopoxvirus proteins, protein regulatory sequences and their uses in expressing heterologous genes in transformed hosts.

Backaround of the Invention Poxviruses are taxonomically classified into the family Chordopoxvirinae, whose members infect vertebrate hosts, e.g., the Orthopoxvirus vaccinia, or into the family Entomopoxvirinae. Very little is known about members of the Entomopoxvirinae family other than the ~nsect host range of individual members. one species of Entomopoxvirus (EPV) is the Amsacta moorei Entomopoxvirus (AmEPV), which was first isolated from larvae of the red hairy caterpillar Amsacta moorei ~Roberts and Granados, J. Invertebr. Pathol., 1~:141-143 (1968)~. AmEPV is the type species of genus B of EPVs and i8 one of three known EPVs which will replicate in cultured insect cells tR. R. Granados et al, "Replication of Amsacta moorei Entomopoxvirus and Autographa californica Nuclear Polyhedrosis Virus in Hemocyte Cell Lines from Estigmene acrea", in ~nvertebrate Tissue Culture A~lications in Medicine. Bioloav. an~
Aariculture, E. Kurstak and K. Maramorosch (ed.), Academic Press, New York, pp. 379-389 (1976); T. Hukuhara et al, J. Invertebr. Pathol., 56:222-232 ~1990); and T.
Sato, "Establishment of Eight Cell Lines from Neonate Larvae of Torticids (Lepidoptera), and Their Several Char~cteristics Including Susceptibility to Insect Viruses", in Invertebrate Cell Svstems A~lications, J.

SUBSTITVTE SHEET

~'`. ' . . `
; ~ - ' : , .. ' ~ ' `.

.
~ :~ r WO92/1~18 PCT/US92/~855 21~3~

Mitsuhashi (ed.), Vol. II, pp. 187-198, CRC Press, Inc., Boca Raton, Florida (1989)].
AmEPV is one of the few insect poxviruses which can replicate in insect cell culture; AmEPV is unable to -5 replicate in vertebrate cell lines. The AmEPV double-stranded DNA genome is about 225 kb unusually A+T rich (18.5% G+C) [W. H. R. Langridge et al, Viroloqv, 76:616-620 (1977)]. Recently, a series of restriction maps for AmEPV were published [R. L. Hall et al, Arch. Virol., 110:77-90 (1990)]. No DNA homology to vaccinia has been detected [W. H. Langridge, J. Invertebr. Pathol., 42:77-82 (1983); W. H. Langridge, J. Invertebr. Pathol., 43:41-46 (1984)].
The viral replication cycle of AmEPV resembles that of other poxviruses except for the appearance of occluded virus late in infection. For AmEPV, once a cell is infected, both occluded and extracellular virus particles are generated. The mature occlusion body particle, which is responsible for environmentally protecting the virion during infection, consists of virus embedded within a crystalline matrix consisting primarily of a single protein, spheroidin. Spheroidin, the major structural protein of AmEPV, has been reported to be 110 kDa in molecular weight and to consist of a high -~
percentage of charged and sulfur-containing amino acids t~angridge and Roberts, J. Invertebr. Pathol., 39:346-353 (1982)]. The use of viruses and virus proteins in eukaryotic host-vector systems has been the subject of a considerable amount of investigation and speculation.
Many existing viral vector systems suffer from significant disadvantages and limitations which diminish their utility. For example, a number of eukaryotic viral vectors are either tumorigenic or oncogenic in mammalian systems, creating the potential for serious health and safety problems associated with resultant gene products SU8STllrUTE SHEET

.. ' ~ . :,: . . ... : . ..
.

, .. .. : .
- ~
.

WO92/1~18 PCT/US92/~8S~
21~;.5~

and accidental infections. Further, in some eukaryotic host-viral vector systems, the gene product itself exhibits antiviral activity, thereby decreasing the yield of that protein.
In the case of simple viruses, the amount of exogenous ~NA which can be pac~aged into a simple virus is limited. This limitation becomes a particularly acute problem when the genes used are eukaryotic. 8ecause eukaryotic genes usually contain intervening sequences, they are too large to fit into simple viruses. Further, because they have many restriction sites, it is more difficult to insert exogenous DNA into complex viruses at specific locations.
Vaccinia virus has recently been developed as a eukaryotic cloning and expression vector [M. Mackett et -al, DNA Cloning, Vol. II, ed. D. M. Glover, pp. 191-212, Oxford: IRL Press (1985); D. Panicali et ~al, Proc. Natl.
Acad. Sci. USA, 88:5364-5368 (1982)]. Numerous viral antigens have been expressed using vaccinia virus vectors [E. Paoletti et al, Proc. Natl. Acad. Sci. USA, 81:193-197 (1984); A. Piccine et al, BioEssavs, 5:248-252 (1986)] including, among others, HBsAg, rabies G protein and the gpl20/gp41 of humsn immunodeficiency virus (HIV).
Regulatory sequences from the spruce budworm EPV have been used previously with vaccinia tL. Yuen et al, Viroloay, 175:427-433 (1990)].
Additionally, studies with vaccinia virus have demonstrated that poxviruses have several advantageous features as vaccine vectors. These include the ability of poxvirus-based vaccines to stimulate both cell-mediated and humoral immunity, minimal cost to mass produce vaccine and the stability of the lyophilized vaccine without refrigeration, ease of administration under non-sterile condition, and the ability to insert at least 25,000 base pairs of foreign DNA into an infectious , WO92/1~18 PCT/US92/~85S~

~ 3 ~

recombinant, thereby permitting the simultaneous expression of many antigens from one recombinant.
There exists a need in the art for additional viral compositions and methods for use in expressing heterologous genes in selected host cells, and in performing other research and production techniques associated therewith.

Summarv of the Invention As one aspect, the invention provides an Entomopoxvirus polynucleotide sequence, free from other viral sequences with which it is associated in nature, which comprises a sequence encoding the Entomopoxvirus spheroidin gene and/or its regulatory seguences, an allelic variant, an analog or a fragment thereof. In a particular embodiment, the spheroidin DNA sequence is isolated from the Amsacta moorei Entomopoxvirus and is illustrated in Fig. 2 [SEQ ID NO:l].
Another aspect of the invention is the polynucleotide sequence encoding the Entomopoxvirus spheroidin promoter or an allelic variant, analog or fragment thereof. The spheroidin promoter sequence is characterized by the ability to direct the expression of a heterologous gene to which the sequence or fragment is operably linked in a selected host cell.
As another aspect, the present invention provides a recombinant polynucleotide sequence comprising a sequence encoding the Entomopoxvirus spheroidin protein and/or its regulatory sequences, an allelic variant, analog or fragment thereof, linked to a second polynucleotide sequence encoding a heterologous gene.
One embodiment of this polynucleotide sequence provides the spheroidin promoter sequence operably linked to the heterologous gene to direct the expression of the heterologous gene in a selected host cell. Another .. ; .. . . . .
- : .
. . ` :
` . :

-: .~

W092/1~18 PCT/US92/~855

2 ~335~

embodiment provides the sequence encoding the spheroidin protein linked to the heterologous gene in a manner permitting expression of a fusion protein. Still another embodiment provides the heterologous gene inserted into a site in the spheroidin gene so that the heterologous gene is flanked on both termini by spheroidin sequences.
As yet a further aspect, the invention provides an Entomopoxvirus polynucleotide sequence free from other viral sequences with which it is associated in nature, comprising a sequence encoding the Entomopoxvirus thymidine kinase ttk) gene and/or its regulatory sequences, an allelic variant, an analog or a fragment thereof. In a particular embodiment, the sequence originates from the Amsacta moorei Entomopoxvirus and is illustrated in Fig. 3 tSEQ ID NO:8].
In still another aspect the sequence encodes the Entomopoxvirus tk promoter, allelic variant or a fragment thereof. The tk promoter sequence is characterized by the ability to direct the expression of a heterologous gene to which the sequence or fragment is operably linked in a selected host cell.
Yet a further aspect of the invention provides a recombinant polynucleotide sequence described above encoding the Entomopoxvirus tk gene and/or its regulatory sequences, an allelic variant, or a fragment thereof, linked to a heterologous gene. One embodiment of this polynucleotide sequence provides the tk promoter sequence operably linked to the heterologous gene to direct the expression of the heterologous gene in a selected host cell. Another embodiment provides the sequence encoding the tk protein linked to the heterologous gene in a manner permitting expression of a fusion protein. Still another embodiment provides the heterologous gene inserted into a site in the tk gene so that the : . . ~ - , .

.

W092/1~18 PCT/US92/~S~
2~3~0 heterologous gene is flanked on both termini by tk sequences.
Another aspect of the invention is an Entomopoxvirus spheroidin polypeptide, a fragment thereof, or an analog thereof, optionally fused to a heterologous protein or peptide. Also provided is an Entomopoxvirus tk polypeptide, a fragment thereof, or an analog thereof, optionally linked to a heterologous protein or peptide.
Yet another aspect of the invention is provided by recombinant polynucleotide molecules which comprise one or more of the polynucleotide sequences described above. This molecule may be an expression vector or shuttle vector. The molecule may also contain viral sequences originating from a virus other than the Entomopoxvirus which contributed the spheroidin or tk polynucleotide sequence, e.g., vaccinia. ~
In another aspect, the present invention provides a recombinant virus comprising a polynucleotide sequence as described above. Also provided are host cells infected with one or more of the described recombinant viruses.
The present invention also provides a method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus, as described above, and recovering said polypeptide from the culture medium.
As a final aspect, the invention provides a method for screening recombinant host cells for insertion of heterologous genes comprising infecting the cells with a recombinant virus containing a polynucleotide molecule comprising the selected heterologous gene sequence linked to an incomplete spheroidin or tk polynucleotide sequence or inserted into and interrupting the coding sequences thereof so that the heterologous gene is flanked at each 8UB~TITUTE SHEET

.

.,., ~ . ~

, ., . ;
- .~ . . . .

WO92/~18 PCT/US92/~855 21 ~3~53 termini ~y an Entomopoxvirus spheroidin or tk polynucleotide sequence. The absence of occlusion bodies formed by the expression of the spheroidin protein in the spheroidin containing cell indicates the integration of the heterologous gene. Alternatively, the absence of the thymidine kinase function, i.e., resistance to methotrexate or a nucleotide analogue of methotrexate, formed by the integration of the inactive thymidine kinase sequence indicates the insertion of the heterologous gene.
Other aspects and advantages of the present invention are described further in the following detailed description of embodiments of the present invention.

Brief Description of the Drawinas Fig. 1 is a physical map of AmEPV illustrating restriction fragments thereof and showing the spheroidin gene just to the right of site t29 in the HindIII-G
fragment.
Fig. 2 provides the AmEPV DNA sequence of the Amsacta moorei Entomopoxvirus spheroidin gene and flanking sequences tSEQ ID NO:l], the deduced amino acid sequences of the spheroidin protein ~SEQ ID NO:6], and five additional open reading frames (ORFs).
Fig. 3 provides the DNA seguence of the Amsacta moorei Entomopoxvirus thymidine kinase (tk) gene and flanking sequences tSEQ ID NO:8], the deduced amino acid sequences of the tk protein [SEQ ID NO:ll], and two additional ORFs.
Fig. 4 provides the nucleotide sequences of the synthetic oligonucleotides designated RM58 [SEQ ID
NO:12], RM82 [SEQ ID NO:13], RM83 tSEQ ID NO:14], RM92 ~SEQ ID NO:15], RM118 [SEQ ID NO:16], RM165 [SEQ ID
NO:17], RM03 tSEQ ID NO:18], RM04 tSEQ ID NO:l9], and RM129 tSEQ ID NO:20].

8UBSTITUTE SHE~T

- . . . . ~ . ... . .

. . . .
... . . . . . , . . . . ~ .

- . .

.~ . . .
. . :
.
.

W092/14818 PCT/US92/~855 2~ ~3~

Fig. 5 is a schematic map of an AmEPV fragment illustrating the orientation of the spheroidin ORF on the physical map and indicating homologies.

Detailed Descri~tion of the Invention S The present invention provides novel Entomopoxvirus (EPV) polynucleotide sequences free from association with other viral sequences with which they are naturally associated. Recombinant polynucleotide vectors containing the sequences, recombinant viruses containing the sequences, and host cells infected with the recombinant viruses are also disclosed herein. These compositions are useful in methods of the invention for the expression of heterologous genes and production of selected proteins in both insect and mammalian host lS cells.
Novel polynucleotide sequences of the invention encode the EPV spheroidin gene and/or its flanking sequences, including sequences which provide regulatory signals for the expression of the gene. The invention also provides novel polynucleotide sequences encoding the EPV thymidine kinase (tX) gene and/or its flanking sequences. The polynucleotide sequences of this invention may be either RNA or DNA sequences. More preferably, the polynucleotide sequences of this invention are DNA sequences.
Specifically disclosed by the present invention are spheroidin and tk polynucleotide sequences obtained from the Amsacta moorei Entomopoxvirus (AmEPV). While this is the presently preferred species for practice of the methods and compositions of this invention, it is anticipated that, utilizing the techniques described herein, substantially homologous sequences may be obtained by one of skill in the art from other available Entomopoxvirus species.

~UBSTITUTE SHEET

WO92Jl~18 PCT/US92/~8S5 2 ~ ~ 3 .; 5 ~

The AmEPV spheroidin DNA sequence, including flanking and regulatory sequence, is reported in Fig. 2 as spanning nucleotides # 1 through 6768 [SEQ ID NO:1].
Within this sequence, the spheroidin gene coding sequence spans nucleotides #3080 to #6091 [SEQ ID NO:21]. A
fragment which is likely to contain the promoter sequences spans nucleotide ~2781-3199 [SEQ ID NO:22].
Other regions of that se~uence have also been identified as putative coding regions for other structural or regulatory genes associated with spheroidin. These other fragments of interest include the following sequences:
nucleotide # 1472 through 2151 [SEQ ID NO:23] encoding the G2R ORF [SEQ ID NO:3]; nucleotide #2502 through 2987 [SEQ ID NO:24] encoding the G4R ORF [SEQ ID NO:5]; and the following sequences transcribed left to right on Fig.
2: nucleotide #65 through 1459 [SEQ ID NO:25] encoding the GlL ORF [SEQ ID NO:2]; nucleotide #2239 through 2475 [SEQ ID NO:26] encoding the G3L ORF [SEQ ID NO:4];
and nucleotide #677 through 6768 [SEQ ID NO:27] encoding the G6L ORF [SEQ ID NO:7]. These ORFs are identified in Fig. 2.
The AmEPV ORF G4R [SEQ ID NO:5] which is immediately upstream of the spheroidin gene has s~gnificant homology to the capripoxvirus HM3 ORF. A
homolog of the HM3 ORF is found in vaccinia virus just upstream of a truncated version of the cowpox virus ATI
- gene. Therefore, the microenvironments in this region are similar in the two viruses. Two other ORFs relate to counterparts in vaccinia virus. These ORFs include the I7 ORF of the vaccinia virus HindIII-I fragment (I7) tJ. F. C. Schmitt et al, J. Virol., 62:1889-1897 (1988)]
which relates to the AmEPV GlL ORF [SEQ ID NO:2] and the NTPase I (NPH I) ORF of the HindIII-D fragment which relates to the AmEPV G6L ORF [SEQ ID NO:7] [S. S. Broyles et al, J. Virol., 61:1738-1742 (1987); and J. F.

- . .
.
, ~
-:: ~ - ,: , . , :: -- : , .

W092/14818 2 1 ~ 3 3~ PCT/US92/~8SS

Rodriguez et al, Proc. Natl. Acad. Sci. USA, 83:9566-9570 (1986)]. The genomic location of the AmEPV ORFs compared with that of the vaccinia virus ORFs suggests that the arrangement of essential "core genes", which are centrally located and colinear in many, if not all, of the vertebrate poxviruses on a more macroscopic scale, is quite different in the insect virus.
As set out in detail in the accompanying examples below, the spheroidin gene of AmEPV was identified through direct microsequencing of the protein, and the results were used for the design of oligonucleotide probes. Transcription of the spheroidin gene is inhibited by cycloheximide, suggesting it is a late gene. Consistent with this prediction are the observations that spheroidin transcripts were initiated within a TAATG motif (See Fig. 2, nucleotide #3077-3082) and that there was a 5' poly(A) sequence, both characteristic of late transcripts.
The AmEPV tk DNA sequence, including flanking and regulatory sequence, is reported in Fig. 3, as spanning nucleotides #1 through 1511 [SEQ ID NO:8].
Within this sequence, the tk gene coding sequence spans nucleotides # 234 to 782 tSEQ ID NO:28] (transcribed right to left on Fig. 3). Another fragment of interest may include nucleotides #783 through #851 tSEQ ID NO:29]
of that sequence or fragments thereof. A fragment likely to contain the promoter regions spans nucleotide #750 -890 tSEQ ID NO:30]. Other regions of that sequence have also been identified as putative coding regions for other structural or regulatory genes associated with tk. These 8UBSTITUTE S~EET

. ~ - -, . .

.

W092/~18 PCT/US92/~8S5 2103~0 other fragments of interest include the following sequences (transcribed left to right on Pig. 3:
nucleotide # 18 through 218 [SEQ ID NO:31] encoding ORF
Q1 tSEQ ID NO:10]); and nucleotide # 8S2 through lS11 [SEQ ID NO:32] encoding ORF Q3 [SEQ ID NO:10].
The location of the AmEPV tk gene maps in the EcoRI-Q fragment near the left end of the physical map of the AmEPV genome (Fig. 1) ~see, also, R. L. Hall et al, Arch. Virol., 110:7?-90 (1990), incorporated by reference herein~. Because of the orientation of the gene within the AmEPV genome, transcription of the gene is likely to occur toward the terminus. There are believed to be t similar tk genes, or variations thereof, in other systems, including mammalian systems. As set out in detail in the examples below, the tk gene of AmEPV was identified through direct microsequencing of the protein, and the results were used for the design of oligonucleotide probes.
The term "polynucleotide sequences" when used with reference to the invention can include the entire EPV spheroidin or tk genes with regulatory sequences flanking the coding sequences. The illustrated AmEPV
sequences are also encompassed by that term. Also included in the definition are fragments of the coding sequences with flanking regulatory sequences. The definition also encompasses the regulatory sequences only, e.g., the promoter sequences, transcription sites, termination sequences, and other regulatory sequences.
Sequences of the invention may also include all or portions of the spheroidin or tk genes linked in frame to a heterologous gene sequence. Additionally, polynucleotide sequences of the invention may include sequences of the spheroidin or tk genes into which have been inserted a foreign or heterologous gene sequence, so . . . . .

'. . ' ' . .' .- :. - '. '~ ~ : . ' .

~, , .

WO92/1~18 PCT/US92/~8S5 , 21~35~

that the EPV sequences flank the heterologous gene sequence.
Polynucleotide sequences of this invention also include sequences which are capable of hybridizing to the sequences of Figs. 2 and 3, under stringent conditions, which sequences retain the same biological or regulatory activities as those of the figures. Also sequences capable of hybridizing to the sequences of Figs. 2 and 3 under non-stringent conditions may fall within this definition providing that the biological or regulatory characteristics of the sequences of Figs. 2 and 3, respectively, are retained. Examples of stringent and non-stringent conditions of hybridization are conventional ~See, e.g., Sambrook et al, Molecular Clonina. A Laboratory Manual, 2d edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989)].
Similarly, polynucleotide sequences of this invention also include allelic variations (naturally-occurring base changes in the EPV species population which may or may not result in an amino acid change) of DNA sequences encoding the spheroidin or tk protein sequences or DNA sequences encoding the other ORFs or regulatory sequences illustrated in Figs. 2 and 3.
Similarly, DNA seguences which encode spheroidin or tk proteins of the invention but which differ in codon sequence due to the degeneracies of the genetic code or variations in the DNA sequences which are caused by point mutations or by induced modifications to enhance a biological property or the usefulness of a desired polynucleotide sequence encoded thereby are also encompassed in the invention.
Utilizing the sequence data in Figs. 2 or 3, as well as the denoted characteristics of spheroidin or thymidine kinase, it is within the skill of the art to obtain other DNA sequences encoding these polypeptides. -.. . . .
.

, ,, - ~ .
.
' - - . . : .

WO92/14818 PCT/US92/~8SS
21 ~i3~5~

For example, the structural gene may be manipulated by varying individual nucleotides, while retaining the correct amino acid(s), or varying the nucleotides, so as to modify the amino acids, without loss of enzymatic activity. Nucleotides may be substituted, inserted, or deleted by known techniques, including, for example, in vitro mutagenesis and primer repair.
The structural gene may be truncated at its 3'-terminus and/or its 5'-terminus while retaining its biological activity. It may also be desirable to ligate a portion of the polypeptide sequence to a heterologous coding sequence, and thus to create a fusion peptide.
The polynucleotide sequences of the present invention may be prepared synthetically or can be derived from viral RNA or from available cDNA-containing plasmids by chemical and genetic engineering techniques or combinations thereof which are standard i~ the art.
The AmEPV proteins, spheroidin, thymidine kinase and their respective regulatory sequences, as described herein, may be encoded by polynucleotide sequences that differ in sequence from the sequences of Figs. 2 and 3 due to natural allelic or species variations. ~hus, the terms spheroidin or tk polypeptides also refer to any of the naturally occurring sequences and various analogs, e.g., processed or truncated sequences or fragments, including the mature spheroidin or tk polypeptides and mutant or modified polypeptides or fragments that retain the same biological activity and preferably have a homology to Fig. 2 or 3, respectively, of at least 80%, more preferably 90%, and most preferably 95%.
Another aspect of the present invention is provided by the proteins encoded by the EPV spheroidin and tk polynucleotide sequences. Putative amino acid sequences of the two EPV proteins as well as additional 8U8~TITUTE 8HEET

. ' ' ! ' , ~ :

.: ' ' ', ' : '. ~ ' '` . ' ' ' , , WO 92tl4818 2 ~ 0 3 ~ ~ ~ PCT/US92/~SS~

putative proteins encoded by the ORFs of these sequences which are identified in Figs. 2 and 3, respectively. EPV
spheroidin has no significant amino acid homology to any previously reported protein, including the polyhedrin protein of baculovirus. Both spheroidin and tk are nonessential proteins, which makes them desirable as sites for insertion of exogenous DNA.
Comparison of the AmEPV tk amino acid sequence with other tk genes reveals that the AmEPV tk gene is not highly related to any of the vertebrate poxvirus tk genes (43.4 to 45.7%). The relatedness of the vertebrate tk proteins to AmEPV is still lower (39.3 to 41.0~), while African Swine Fever (ASF) showed the least homology of all the tk proteins tested (31.4%). Although ASF has many similarities to poxviruses, and both ASF and AmEPV
infect vertebrate hosts, the tk genes indicate little commonality and/or indication of common origin stemming from invertebrate hosts.
The spheroidin and thymidine kinase polypeptide sequences may include isolated naturally-occurring spheroidin or tk amino acid sequences identified herein or deliberately modified sequences which maintain the biological or regulatory functions of the AmEPV
polypeptides, respectively identified in Figs. 2 and 3.
Therefore, provided that the biological activities of these polypeptides are retained in whole or part despite such modifications, this invention encompasses the use of all amino acid sequences disclosed herein as well as analogs thereof retaining spheroidin or tk biological activity. Typically, such analogs differ by only 1, 2,

3, or 4 codon changes. Similarly, proteins or functions encoded by the other spheroidin or tk ORFs may include sequences containing minor amino acid modifications but which retain their regulatory or other biological - functions.

:: :

WO92/1~18 PCT/US92/~55 2~3~50 Examples of such modifications include polypeptides with minor amino acid variations from the natural amino acid sequence of Entomopoxvirus spheroidin or thymidine kinase; in particular, conservative amino acid replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into four families:
(l) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are lS sometimes classified jointly as aromatic amino acids.
For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on biological activity, especially if the replacement does not involve an amino acid at an active site of the polypeptides.
As used herein, the term "polypeptide" refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post-expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications 8UB8TITUTE SHEEl--. ~ , ; ..

, ~ , .
- - . ,` . . .

:- , . - . ::. :.-.. - :.. , - .

. .

WO92/14818 PCT/US92/~8SS
2~ 0~5~

known in the art, both naturally occurring and non-naturally occurring.
The proteins or polypeptides of the present invention may be expressed in host cells and purified from the cells or media by conventional means [Sambrook et al, Molecular Clonina. A Laboratory Manual, 2d edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989)].
This invention also relates to novel viral recombinant polynucleotide molecules or vectors, which permit the expression of heterologous genes in a selected host cell. Such a polynucleotide vector of the invention comprises the polynucleotide sequence encoding all or a ;
portion of the spheroidin or tk gene, the RNA polymerase from a selected poxvirus, and the polynucleotide seguence encoding a desired heterologous gene. Preferably, the sequence includes the regulatory region, and most preferably, the promoter region, of either the EMV
spheroidin or tk gene. In addition, the source of the polymerase is not limited to EMV; rather, any poxvirus RNA polymerase may be utilized.
Therefore, the viral vectors may contain other viral elements contributed by another poxvirus, either vertebrate or invertebrate, with the only EPV sequences being provided by the presence of the EPV spheroidin or tk gene sequences, or fragments thereof. Numerous conventional expression viral vectors and expression systems are known in the art. Particularly desirable vectors systems are those of vertebrate or invertebrate poxviruses. The Entomopoxvirus spheroidin and tk gene regulatory sequences may be used in other virus vector systems which contain a poxvirus RNA polymerase to enhance the performance of those systems, e.g., in vaccinia vectors. Methods for the construction of expression systems, in general, and the components - . ;.

,~..

WO92/1~18 PCT/US92/~855 21 Q3~5~

thereof, including expression vectors and transformed host cells, are within the art. See, generally, methods described in standard texts, such as Sambrook et al, supra. The present invention is therefore not limited to any particular viral expression system or vector into which a polynucleotide sequence of this invention may be inserted, provided that the vector or system contains a poxvirus RNA polymerase.
The vectors of the invention provide a helper independent vector system, that is, the presence or absence of a functional spheroidin or tk gene in a poxvirus contributing elements to the vector, e.g., contributing the RNA polymerase, does not affect the usefulness of the resulting recombinant viral vector.
Because both spheroidin and tk are non-essential genes, the viral vectors of this invention do not require the presence of any other viral proteins, which in helper-dependent systems are contributed by additional viruses to coinfect the selected host cell. -~
Selected host cells which, upon infection by -the viral vectors will permit expression of the heterologous gene, include insect and mammalian cells.
Specifically, if the viral vector comprises the EPV
spheroidin or tk gene sequences of the invention inserted into any member of the family Entomopoxvirinae, e.g., EPVs of any species, the host cell will be limited to cells of insects normally infected by EPVs. If the viral vector comprises the EPV spheroidin or tk gene sequences of the invention inserted into a vertebrate poxvirus, such as vaccinia or swinepox, the host cells may be selected from among the mammalian species normally infected by the wild-type vertebrate poxvirus. Most desirably, such mammalian cells may include human cells, rodent cells and primate cells, all known and available to one of skill in the art.

-, . , . - - ~ .. . . .

-. . ., , .. , ~ . .
.. .. ...
~ . , , -- . .
.. ... - ~ . . ...
: . . .
... .. .. : - :' ' :

. . ., . ~ ., ... Y . . ,. ... , ~ . .

W092/~4818 PCT/US92/~8SS~

21~335!~

According to one aspect of the subject invention, therefore, vectors of the present invention may utilize a fragment of the polynucleotide sequence of EPV spheroidin, particularly the promoter and ancillary regulatory sequences which are responsible for the naturally high levels of expression of the gene.
Desirably, spheroidin sequences may be found within the sequence of Fig. 2 tSEQ ID NO:1], more particularly within the region of nucleotides # 2781 through 3199 [SEQ
ID NO:22]. Smaller fragments within that region may also provide useful regulatory sequences. The desired spheroidin promoter sequence can be utilized to produce large quantities of a desired protein by placing it in operative association with a selected heterologous gene in viral expression vectors capable of functioning in either a vertebrate or invertebrate host cell.
As used herein, the term "operative association" defines the relationship between a regulatory sequence and a selected protein gene, such that the regulatory sequence is capable of directing the replication and expression of the protein in the appropriate host cell. One of skill in the art is capable of operatively associating such sequences by resort to conventional techniques.
Where the spheroidin polynucleotide sequence in the vector contains all or a portion of the spheroidin coding sequence in association with, or linked to, the heterologous gene, the resulting protein expressed in the host cell may be a fusion protein consisting of all or a portion of the spheroidin protein and the heterologous protein. Where the spheroidin polynucleotide sequence in the vector does not contain sufficient coding sequence for the expression of a spheroidin protein or peptide fragment, the heterologous protein may be produced alone.
.

8UBS~ITUTE SHEET

;.. ~....
.

.... - ~ . . ~

WO92~14818 PCT/US92/~855 2~ 035~a In an analogous manner, the promoter and regulatory sequences of tk (Fig. 3 SEQ ID N0:8) may be employed in the construction of an expression vector to drive expression of a heterologous protein, or a fusion protein, in a selected known expression system. These tk regulatory sequences are desirably obtained from the sequence of Fig. 3 [SEQ ID N0:8], particularly in the fragment occurring between nucleotide #750 through 890 ~SEQ ID N0:30]. Smaller fragments within that region may also provide useful regulatory sequences.
An advantage of the use of the novel EPV
spheroidin or tk promoter sequences of this invention is that these regulatory sequences are capable of operating in a vertebrate poxvirus (e.g., vaccinia)-mammalian cell expression vector system. For example, the strong spheroidin promoter can be incorporated into the vaccinia virus system through homologous recombination. Unlike the promoter for the baculovirus polyhedrin gene, the promoter for the EPV spheroidin gene can be utilized directly in the vaccinia or swinepox virus expression vector.
To construct a vector according to the present invention, the spheroidin or tk polynucleotide sequence may be isolated and purified from a selected Entomopoxvirus, e.g., AmEPV, and digested with appropriate restriction endonuclease enzymes to produce a fragment comprising all or part of the spheroidin or tk gene. Alternatively such a fragment may be chemically synthesized.
Still alternatively, the desired AmEPV
sequences may be obtained from bacterial cultures containing the plasmids pRH512, pMEGtk-l or pRH7. ~he construction of the plasmid pRH512 is described in the examples below. This plasmid contains the 4.51 kb BqlII
fragment AmEPV DNA sequence inserted into a BamHI site in .. . . .

.. ' , ' : , ' ' . . . ~ ,. .. ' ,, ,. :
. ' . , . ' ' , . . .

WO92/1~18 PCT/US92/~855 21~

the conventional vector pUC9. The plasmid pRH7 was constructed by digesting AmEPV genomic DNA, obtained as described in Example 1, with Bspl286I, and the resulting fragments with HaeII. T4 DNA polymerase is employed to blunt end the AmEPV DNA and the fragment containing the spheroidin gene is ligated to the large fragment of a SmaI digested pUC9 fragment. This fragment contains the entire spheroidin open reading frame and some flanking sequence, included within the nucleotide sequence spanning #2274-6182 ~SEQ ID N0:33] of Fig. 2. The construction of plasmid pMEGtk-l comprising the regulatory sequences of the tk gene as well as the structural gene is described below in the Example 8. It was constructed by inserting the EcoRI-Q fragment of AmEPV into the conventional vector pUCl8.
Bacterial cultures containing plasmids pRH512, pMEG tk-l, and pRH7 have been deposited in the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, USA. The deposited cultures are as follows:
-----_ _____________________ ~ulture Accession No. De~osit Date E. coli SURE strain ATCC 68532 26 Feb 91 (Stratagene) pMEG-tkl E. coli SURE strain ATCC 68533 26 Feb 91 (Stratagene) pRH512 E. coli SURE strain ATCC
(Stratagene) pRH7 _______________________________________________________ The plasmids can be obtained from the deposited bacterial cultures by use of standard procedures, for example, using cleared lysate-isopycnic density gradient procedures, and the like.
These ATCC deposits were made under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademark W092/1~18 PCT/US92/~5~
2 ~ 5 0 to be entitled thereto under 37 CFR 1.14 and 35 USC 122.
The deposits will be available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by government action.
Further, the subject culture deposit will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., it will be stored with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture. The depositor acknowledges the duty to replace the deposit should the depository be unable to furnish a sample when requested, due to the condition of the deposit. All restrictions on the availability to the public of the subject culture deposit will be irrevocably removed upon the granting of a patent disclosing it.
The molecular biology procedures referred to herein in describing construction of the vectors of this invention are standard, well-known procedures. The various methods employed in the preparation of the plasmid vectors and transformation or infection of host organisms are well-known in the art. These procedures are all described in, for example, Sambrook et al, cited above. Thus, it is within the skill of those in the genetic engineering art to extract DNA from microbial cells, perform restriction enzyme digestions, electrophorese DNA fragments, tail and anneal plasmid and 8UBSTITUTE SHE~T

.

- . . :
.
- . . .

WO92/1~18 PCT/US92/~855 210'~55U

insert DNA, ligate DNA, transform cells, prepare plasmid DNA, electrophorese proteins, and sequence DNA.
Because the AmEPV genome has no known unique restriction sites into which selected genes may be effectively introduced in a site-specific manner so as to be under the control of the spheroidin or tk promoter sequences, such restriction sites must be introduced into desired sites in the selected EPV polynucleotide sequence. For example, the unique BstBl site located at nucleotide #3172 downstream from the start of the spheroidin gene is the closest site to genetically engineer a usable insertion sequence for cloning.
Therefore, restriction sites closer to the initiating Met of the spheroidin gene must be deliberately inserted.
Methods for the insertion of restriction sites are known to those of skill in the art and include, the use of an intermediate shuttle vector, e.g., by cloning the EPV sequence into the site of an appropriate cloning vehicle. It will be recognized by those skilled in the art that any suitable cloning vehicle may be utilized provided that the spheroidin or tk gene and flanking viral DNA may be functionally incorporated.
A spheroidin shut*le vector may be constructed to include elements of the spheroidin structural gene, a cloning site located or introduced in the gene to enable the selected heterologous gene to be properly inserted into the viral genome adjacent to, and under the control of, the spheroidin promoter, and flanking viral DNA
linked to either side of the spheroidin gene to facilitate insertion of the spheroidin-foreign gene-flanking se~uence into another expression vector. The presence of flanking viral DNA also facilitates recombination with the wild type Entomopoxvirus, allowing the transfer of a selected gene into a replicating viral genome.

8UBSTITUTE SHE~T

, . . . ~ .

. ~ .

WO92/1~18 PCTtUS92~855 21~3~

The shuttle vectors may thereafter be modified for insertion of a selected gene by deleting some or all of the sequences encoding for spheroidin or tk synthesis near the respective transcriptional start sites.
S Examples of such sites in spheroidin are nucleotides #3077 and 3080 and in tk includes nucleotide #809.
Conventional procedures are available to delete spheroidin or tk coding sequences.
As an alternative to or in addition to the restriction site, a variety of synthetic or natural oligonucleotide linker sequences may be inserted at the site of the deletion. A polynucleotide linker sequence, which may be either a natural or synthetic oligonucleotide, may be inserted at the site of the deletion to allow the coupling of DNA segments at that site. One such linker sequence may provide an appropriate space between the two linked sequences, e.g., between the promoter sequence and the gene to be expressed. Alternatively, this linker sequence may encode, if desired, a polypeptide which is selectively cleavable or digestible by conventional chemical or -;
enzymatic methods. For example, the selected cleavage site may be an enzymatic cleavage site, including sites for cleavage by a proteolytic enzyme, such as enterokinase, factor Xa, trypsin, collegenase and thrombin. Alternatively, the cleavage site in the linker may be a site capable of being cleaved upon exposure to a selected chemical, e.g. cyanogen bromide or hydroxylamine. The cleavage site, if inserted into a linker useful in the sequences of this invention, does not limit this invention. Any desired cleavage site, of which many are known in the art, may be used for this purpose. In another alternative, the linker sequence may encode one or a series of restriction sites.

..
..
.. . .

W092/1~18 PCT/US92/~85S
2 ~

It will be recognized by those skilled in the art who have the benefit of this disclosure that linker sequences bearing an appropriate restriction site need not be inserted in place of all or a portion of the spheroidin structural sequence, and that it would be possible to insert a linker in locations in the Entomopoxvirus genome such that both the sequence coding for the selected polypeptide and the spheroidin structural sequence would be expressed. For instance, the sequence coding for the selected polypeptide could be inserted into the tk gene in place of all or a portion of the tk structural sequence and under the transcriptional - control of the tk promoter.
Polymerase chain reaction (PCR) techniques can also be used to introduce convenient restriction sites into the EPV DNA, as well as to amplify specific regions of the EPV DNA. These techniques are well known to those skilled in this art. See, for example, PCR Protocols: A
Guide to Methods and Applications, M. A. Innis, D. H.
Gelfand, J. J. Sninsky, and T. J. White, (l990).
By use of these techniques, a variety of alternative modified shuttle vectors into which a selected gene or portion thereof may be incorporated may be suitably utilized in the present invention.
As one embodiment of the invention, therefore, -the polynucleotide sequence, described above, may be used as a shuttle vector to transfer a selected heterologous gene to a selected virus. In this embodiment, the polynucleotide sequence encoding the EMV spheroidin gene or EMV tk gene, or a fragment thereof, is linked to a heterologous gene. The polynucleotide sequence further contains a flanking region on either side of the spheroidin-heterologous gene or tk-heterologous gene to enable ready transfer into a selected virus. This resulting construct is termed a cassette. Such a . .

WO92~14818 PCT~US92~8S5 21~3.~

flanking region may be derived from EPV, or alternatively, may be complementary to the target virus.
For example, if it is desirable to insert a selected heterologous gene into a vaccinia virus to create a recombinant virus, one would utilize flanking regions complementary to the targeted vaccinia virus. Similarly if the heterologous gene is inserted within the EPV
spheroidin or tk gene, so that the selected EPV
regulatory sequence and heterologous gene are flanked by the EPV gene's own sequences, this cassette may be used for transfer into a wild type EPV having homologous sequences to the flanking sequences.
The insertion or linkage of the foreign gene into the tk or spheroidin sequences of the present invention or the linkage of flanking sequences foreign to the spheroidin or tk genes may be accomplished as described above. The vectors of the subject invention may use cDNA clones of foreign genes, because poxvirus genes contain no introns, presumably as a consequence of a totally cytoplasmic site of infection.
In accordance with standard cloning techniques, any selected gene may be inserted into the vector at an available restriction site to produce a recombinant shuttle vector. Virtually any gene of interest could be inserted into the vectors described herein in order to obtain high expression of the desired protein.
Restriction sites in the fragment may thereafter be removed so as to produce a preferred spheroidin or tk shuttle vector, having one or more cleavage or cloning sites located in the 3' direction downstream from the spheroidin promoter sequence. Thus, the present invention is not limited by the selection of the heterologous gene.
Alternatively, a vector of this invention may comprise a heterologous gene which is inserted into all .
, :, " :-. : .
- : ..
,, . . ~ , ~ - :,, .
- - : -.

WO92/14818 PCT/US92/~8S5 2~ Q~

or a portion of the EMV spheroidin or tk protein encoding sequence to interrupt the protein's natural processing.
However, when the vector is transferred to another virus which contains a wild-type spheroidin or tk gene, expression of the inserted heterologous gene is obtained.
Thus, the Entomopoxvirus spheroidin gene (Fig. 2 SEQ ID
NO:l) and/or the tk gene (Fig. 3 SEQ ID N0:8) can be used as the location for the insertion of exogenous or heterologous DNA in any of the above-mentioned expression systems. A shuttle vector so constructed may be useful as a marker for research and production techniques for identifying the presence of successfully integrated heterologous genes into the selected expression system.
The tk gene is a particularly desirable site for insertion of a selected heterologous gene. Unlike spheroidin, tk is produced early in infection and in lesser quantities. Additionally, many poxviruses possess tk genes which may be sufficiently homologous to the EPV -tk to provide easy recombination. For example, in vaccinia virus expression systems for mammalian cells, the vaccinia tk gene is a common insertion site.
Therefore, the use of this gene is particularly desirable for construction of a shuttle vector to shuttle selected genes directly between vector systems. More specifically, a foreign gene may be desirably inserted into the EPV tk gene sequence between nucleotide #460 and #560 (See Fig. 3).
Insertion of cassettes containing foreign genes into wild-type poxviruses can be accomplished by homologous recombination. The homologous recombination techniques used to insert the genes of interest into the viruses of the invention are well known to those skilled in the art. The shuttle vectors, when co-infected into host cells with a wild-type virus, transfer the cassette containing the selected gene into the virus by homologous 8UB~TITUTE 8HEET

,. . .
:

,-W092/1~18 PCT/US92/~855 2~0~5~

recombination, thereby creating recombinant virus vectors.
Expression of a selected gene is accomplished by infecting susceptible host insect cells with the recombinant viral vector of this invention in an appropriate medium for growth. An EPV expression vector is propagated in insect cells or insects through replication and assembly of infectious virus particles.
These infectious vectors can be used to produce the selected gene in suitable insect cells, thus facilitating the efficient expression of the selected DNA sequence in the lnfected cell. If the EPV spheroidin gene (or tk gene) - heterologous gene fragment is inserted into a vertebrate poxvirus by the same methods as described above, the recombinant virus may be used to infect mammalian cells and produce the heterologous protein in the mammalian cells.
For example, a gene inserted into the tk site of a vaccinia virus system could be transferred directly to the tk locus of an Entomopoxvirus vector of the subject invention or vice versa. ~his shuttling could be accomplished, for example, using homologous recombination. Similarly insertion of a selected gene into the spheroidin gene or tk gene in a viral vector permits the gene to be shuttled into other viruses having homologous spheroidin or tk sequences, respectively.
The following description illustrates an exemplary vector of this invention, employing the gene coding for human ~-interferon (IFN-~) synthesis as the heterologous gene. A DNA fragment containing the IFN-~gene is prepared conventionally with restriction enzyme digested or blunt ended termini and cloned into a suitable site in the AmEPV spheroidin gene, into which a restriction site has been engineered by the methods 3S described above.

'.' ~` ' "

':. , .

W092/1~18 PCT/US92/~8S5 2~3~

The insertion of the IFN-~ gene produces a hybrid or fused spheroidin-IFN-~ gene capable of producing a fused polypeptide product if only a portion of the spheroidin gene was deleted as described above.
If the entire spheroidin structural sequence was deleted, only interferon will be produced. Further, the hybrid gene may comprise the spheroidin promoter, the IFN-~protein coding sequences, and sequences encoding a portion of the polypeptide sequence of the spheroidin protein, provided all such coding sequences are not deleted from the particular shuttle vector utilized.
The resulting shuttle vector contains the AmEPV
spheroidin gene sequence coupled to the IFN-~ gene. The hybrid spheroidin-IFN-~ gene of the recombinant shuttle vector is thereafter transferred into the genome of an appropriate Entomopoxvirus, such as the preferred Entomopoxvirus AmEPV, to produce a recombinant viral expression vector capable of expressing the gene encoding for ~-interferon in a host insect cell. Transfer of the hybrid gene to a wild-type virus is accomplished by processes which are well known to those skilled in the art. For example, appropriate insect cells may be infected with the wild type Entomopoxvirus. These infected cells are then transfected with the shuttle vector of the subject invention. These procedures are described, for example, in DNA Clonina: A Practical Ap~roach, Vol. II, Edited by D. M. Glover, Chapter 7, 1985. A person skilled in the art could choose appropriate insect cells to be used according to the sub;ect invention. By way of example, salt marsh caterpillars and cultured gypsy moth cells can be used.
During replication of the AmEPV DNA after transfection, the hybrid gene is transferred to the wild-type AmEPV by homologous recombination between the recombinant shuttle vector and AmEPV DNA. Accordingly, a SUBSTITUTE SHEET

WO92/14818 PCT/US92/~W~5 21~5~

mixture is produced comprising wild-type, nonrecombinant EPVs and recombinant EPVs capable of expressing the IFN-~gene.
While transfection is the preferred process for transfer of the hybrid gene into the EPV genome, it will be understood by those skilled in the art that other procedures may be suitably utilized so as to effect the insertion of the gene into the EPV genome and that recombination may be accomplished between the recombinant shuttle vector and other strains of EPV (or other poxviruses) so long as there is sufficient homology between the sequence of the hybrid gene and the - -corresponding sequence of the other strain to allow recombination to occur.
The preferred recombinant AmEPV expression vector, comprising a hybrid spheroidin-IFN-~ gene incorporated into the AmEPV genome, can thereafter be selected from the mixture of nonrecombinant and -~
recombinant Entomopoxviruses. The preferred, but by no means only, method of selection is by screening for plaques formed by host insect cells infected with viruses that do not produce viral occlusions. Selection may be -performed in this manner because recombinant EPV viruses which contain the spheroidin or tk protein coding sequences interrupted by the heterologous gene are defective in the production of viral occlusions due to the insertional inactivation of the spheroidin gene.
Also, the selection procedure may involve the use of the ~-galactosidase gene to facilitate color selection. This procedure involves the incorporation of the E. coli ~-galactosidase gene into the shuttle vector and is well known to those skilled in the art. This technique may be of particular value if the exogenous DNA
is inserted into the tk gene so that the spheroidin gene is still expressed. It will be recognized by those 8UB8mUTE 8HEET

,. -............................ , ~ . .

i:.

W092/1~18 PCT/US92/~85S
2103~

skilled in the art that alternative selection procedures may also be utilized in accordance with the present invention.
Accordingly, the DNA from a recombinant virus is thereafter purified and may be analyzed with appropriate restriction enzymes, or PCR technology, to confirm that the recombinant AmEPV vector has an insertion of the selected gene in the proper location.
The vectors and methods provided by the present invention are characterized by several advantages over known vectors and vector systems. Advantageously, such EPV viral vectors of the present invention are not oncogenic or tumorigenic in mammals. Also, the regulatory signals governing Amsacta moorei Entomopoxvirus (AmEPV) gene expressions are similar to those of vaccinia. Therefore, it is possible to transfer the strongly expressed spheroidin gene, or the thymidine kinase gene, as an expression cassette, not only in insect cells, but for use in vertebrate poxviruses such as vaccinia and swinepox virus.
Based on reported data with vaccinia, herpes and baculovirus vector systems, which suggest that up to 30 kb can be transferred without disrupting the vector viability, the normal limitation on the amount of exogenous DNA which can be packaged into a virus is not anticipated to be encountered when using the novel EPV
vectors and methods of the subject invention.
Another advantage is that for the novel vectors of the subject invention, the transcription and translation of foreign proteins is totally cytoplasmic. t Still another advantage lies in the expression power of the EPV spheroidin regulatory sequences, which when in operative association with a heterologous gene in a vector of this invention, should produce high levels of 8U8STITUTE 8HEEl-`., - . .. : .;, .
.. . .
- , ~ . , , . . -..

.

W092/1~18 PCT/US92/~8S~
2 1 `~ 3 ~

heterologous protein expression in the selected host cell.
The EPV vectors of this invention and methods for employing them to express selected heterologous proteins in insect or mammalian cells, as described above, are characterized by the advantage of replication in insect cells, which avoids the use of mammalian viruses, thereby decreasing the possibility of contamination of the product with mammalian virus. The expression system of this invention is also a helper independent virus expression vector system. These two characteristics are shared by known baculovirus expression systems. However, as shown in Table 1, the EPV expression vector system (EEVS) using the vectors of this invention has some important distinguishing features compared to the baculovirus expression systems (BEVS).
_______________________________________________________ ~able 1 Differences between EEVs and BEVS

EEVs BEVS
Site of replication: cytoplasm nucleus Virus family: Poxviridae Baculoviridae Sites for insertion spheroidin & polyhedrin of foreign genes thymidine & plO
kinase (tk) Shuttle possibilities yes No mammalian between vertebrate (Orthopoxviruses) counterparts.
and insect systems: (Leporipoxviruses) Baculovirus (Suipoxviruses) is not known (Avipoxviruses) to contain a tk gene.
Polyhedrin is not found in mammalian systems.
______________________________________ ________________ 8UB~ TE SHEET

... . . . . .
. : . . .
.... - . :.
:

.. . . .
- . : .. .- .: : ' .

WO92/1~18 PCT/US92/~8SS
21~3550 The present invention also provides a method for screening recombinant host cells for insertion of heterologous genes is provided by use of the recombinant viral polynucleotide molecules of this invention. The viral molecules containing the selected heterologous gene sequence linked to the polynucleotide sequence encoding less than all of the Entomopoxvirus spheroidin protein.
The heterologous gene may be linked to the spheroidin or tk regulatory sequences in the absence of the complete coding sequences, or it may be inserted into the spheroidin or tk gene coding sequences, thus disrupting the coding sequence. The cell infected with the recombinant vector is cultured under conditions suitable for expression of the heterologous protein, either unfused or as a fusion protein with a portion of the spheroidin sequence. The absence of occlusion bodies which would ordinarily be formed by the expression of the intact spheroidin protein indicates the integration of the heterologous gene.
If the viral vector similarly contained either incomplete or interrupted EPV tk encoding sequence, the absence of thymidine kinase function (e.g., resistance to methotrexate or an analogue thereof) formed by the integration of the inactive thymidine kinase sequence indicates the insertion of the heterologous gene.
Alternatively, if a parent virus is deleted of part of its tk or spheroidin gene, and is thereafter mixed with a viral vector containing intact tk or spheroidin fused to the foreign gene, recombinants would express the methotrexate resistance or produce occlusion bodies, respectively, thus indicating integration of the active tk or spheroidin genes and the foreign gene.
The above-described selection procedures provide effective and convenient means for selection of recombinant Entomopoxvirus expression vectors.

8UBSTITUTE 8HE~T

- . . . . . .. . ;.

~ - :.
... . .
.

WO92/14818 PCT/US92/~855 ~J ~

Another embodiment of the present invention involves using novel EPV expression systems of the subject invention for insect control. Control of insect pests can be accomplished by employing the vectors and S methods of the invention as described above. For example, a gene coding for an selected insect toxin may be inserted into the viral expression vector under the control of the spheroidin or tk regulatory sequences or within either of the two genes for purposes of recombination into a selected virus having homologous flanking regions.
Genes which code for insect toxins are well ~nown to those skilled in the art. An exemplary toxin gene isolated from Bacillus thurinaiensis (B.t.) can be used according to the subject invention. B.t. genes are described, for example, in U. S. Patent Nos. 4,775,131 and 4,865,981. Other known insect toxins may also be employed in this method.
The resulting EPV vector containing the toxin gene is applied to the target pest or its surroundings.
Advantageously, the viral vector will infect the target pest, and large quantities of the toxin will be produced, thus resulting in the control of the pest. Particularly large quantities of the toxin protein can be produced if the regulatory sequences of the Entomopoxvirus spheroidin gene are used to express the toxin.
Alternatively, the spheroidin gene can be left intact and the toxin gene inserted into a different Entomopoxvirus gene such as the tk gene. In this construct, the toxin will be produced by the system and then effectively coated or encapsulated by the natural viral production of spheroidin. This system thus produces a toxin which will advantageously persist in the environment to prolong the availability to the target pest.

'. . . ~: ' :: ,, :`' -.
: :.

WO92/1~18 2 1 ~ 3 5 5 ~ PCT/US92/~85~

In addition to the novel Entomopoxvirus expression vectors and methods for their use described herein, the subject invention pertains to the use of novel regulatory elements from Entomopoxvirus to construct novel chimeric vaccinia and swinepox vaccines and expression systems which are functional across genera of mammalian poxviruses. The polynucleotide sequences of the invention can also be used with viral vaccines, e.g., known vaccinia virus vaccines, to enhance the effectiveness of these vaccines. Such vaccines have been described for use in controlling rabies and other infectious diseases in mammals. Specifically, it is anticipated that the introduction of the EPV spheroidin promoter sequences into known viral vectors which are used to express selected proteins in a mammalian host n v vo may enable the powerful spheroidin promoter to increase expression of the protein in the viral vaccine. r This aspect of the invention provides a significant improvement over other expression systems, including the baculovirus expression system (BEVS).
The following examples illustrate the compositions and procedures, including the best mode, for practicing the invention. These examples, should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. The restriction enzymes disclosed herein can be purchased from Bethesda Research Laboratories, Gaithersburg, MD, or New England Biolabs, Beverly, MA. The enzymes are used according to the instructions provided by the supplier. Klenow fragment of DNA polymerase, T4 polynucleotide kinase, and T4 DNA
ligase were obtained from New England Biolabs and Promega.

, ' , , . ' ' ' !
: : ' ` . ' ` ' '~. :, ' ' , ' ' :.' '' . ' ~ . ' ' ' .
~' ` ' , ' ~ ~ ' '' '' . ' , `
.
.

WO92/14818 PCT/US92/~8S~
21~sa EXAMPLE 1: PREPARATION OF AmEPV DNA
The replication of AmEPV has been described previously tR. H. Goodwin et al, J. Invertebr. Pathol., 56:190-205 (199O)]. The gypsy moth (Lymantria dispar) cell line IPLB-LD-652 [Insect Pathology Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD~ is maintained at 26 to 28C
in EX-CELL 400 tJRH Biosciences, Lenexa, KS] supplemented with 10% fetal bovine serum, 100 U of penicillin, and lO0 ~g of streptomycin per ml. Other insect cell lines are well known to those skilled in the art and can be used according to the subject invention.
The AmEPV inoculum for cell culturing was from an AmEPV-infected, freeze-dried E. acrea larva stored at -70C ~R. L. Hall et al, Arch. Virol., 110:77-90 (1990)]. ~he larva was crushed and macerated in 5 ml of EX-CELL 400 (with penicillin and streptomycin but without fetal bovine serum) to which 0.003 g of cysteine-HCl had been added to prevent melanization. The debris was pelleted at 200 x g for 5 minutes, and the supernatant was passed through a 0.45-~m-pore-size filter.
The gypsy moth cells were infected with AmEPV
by addition of the inoculum to a preconfluent monolayer of cells (about 0.1 to 1 PFU per cell), with occasional agitation of the dish during the first day. Infected cells were harvested 5 to 6 days postinfection.
AmEPV DNA was prepared from the infected cells by one of two methods. The first method involved in situ digestion of infected cells embedded within agarose pluqs, after which the released cellular and viral DNAs were separated by pulsed-field electrophoresis tBio-Rad -CHEF-II-DR system]. IPLB-LD-652 cells were infected with first-cell-culture-passage AmEPV. Infected cells were harvested 6 days postinfection by centrifugation at 200 x g for 5 minutes, rinsed, and resuspended in modified ` ~.. . . ` ::

,, . : ' ' .~ . ~
.. , . . : - ~

.. . .
.. `,.

WO92~14818 PCT/US92/~85~ 1 21 Q355~ .

Hank's phosphate-buffered saline (PBS), which contained 15 g of glucose per liter, but no Ca2' or Mg2+.
For embedding of the infected cells in agarose plugs, 1% SeaPlaque GTG agarose (prepared in modified Hank's PBS and equilibrated at 37C) was mixed 1:1 with infected cells to yield 5 x 106 cells per ml in 0.5%
agarose. Digestion to release DNA was done by gentle shaking of the inserts in 1% Sarkosyl-0.5 M EDTA-l mg of proteinase K per ml at 50C for 2 days [C. L. Smith et al, Methods EnzYmol., 151:461-489 (1987)]. The CHEF-II-DR parameters for DNA separation were 180 V, a pulse ratio of 1, 50 initial and 90 second final pulse times, and a run time of 20 to 25 hours at 4C. The separating gel was 1% SeaKem GTG agarose in 0.5x TBE buffer tSambrook et al, supra]. Viral DNA bands were ~isualized by ethidium bromide staining and electroeluted [W. B.
Allington et al, Anal. Biochem., 85:188-196 (1978)]. The recovered DNA was used for plasmid cloning following ethanol precipitation.
The second method of viral DNA preparation used the extracellular virus found in the infected-cell-culture supernatant. The supernatant from 10-day-postinfection cell cultures was clarified by centrifugation at 200 x g for 5 minutes. Virus was collected from the supernatant by centrifugation at 12,000 x g. Viral pellets were resuspended in 6 ml of lx TE. DNase I and RNase A (10 and 20 ~g/ml final concentrations, respectively) were added, and the mixture was incubated at 37C for 30 minutes. The mixture was heated to 50C for 15 minutes. SDS and proteinase K (1~
and 200 ~g/ml, respectively) were then added. The sample was incubated to 50C overnight and extracted three times with buffer-saturated phenol and once with SEVAG
~Sambrook et al, supra~. The DNA was ethanol precipitated and resuspended in lx TE (pH 8).

~IJBSTITUTE SHEET

.; : . ~ : . . :
. ~. . . . ~ ' : . ' !

WO92/1~18 PCT/US92/~855 2 ~ 5 ~

For routine virus quantitation, 1 ml of an appropriate virus dilution (prepared in unsupplemented EX-CELL 400) was added to a preconfluent monolayer of cells in a 60 mm culture dish, with intermittent agitation over a 5 hour adsorption period at 26 to 28C.
The virus inoculum was removed, and 5 ml of a 0.75%
SeaPlaque agarose [FMC BioProducts, Rockland, ME] overlay prepared with 2x EX-CELL 400 and equilibrated at 37C was added to the monolayer. Plaques were visualized after 5 days of incubation at 26C by inspection with a stereomicroscope.
The DNA prepared according to either method was then cut with a variety of restriction endonuclease enzymes, e.g., Bam HI, EcoRI, HindIII, RstI and XhoI, generating the various fragments which appear on the physical map of Fig. 1. Hereafter, reference to each restriction fragment will refer to the enzyme and the applicable letter, e.g., BamHI-A through ~_HI-E, EcoRI-A
through EcoRI-S, etc.

EXAMPLE 2 - ISOLATION OF ~E SPHEROIDIN GENE
To localize the spheroidin gene, a purified preparation of occlusion bodies (OBs) from infected caterpillars was solubilized and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [J. K. Laemmli, Nature (London), 227:680-685 (1970)] with a 4% acrylamide stacking gel and a 7.5%
separating gel. The acrylamide used to prepare spheroidin for protein microsequencing was deionized with AG501X8 resin ~Bio-Rad, Richmond, CA]. The gels were polymerized overnight at 4C. For sample preparation, 2x Laemmli sample buffer consisting of 125 mM Tris-HCl (pH
6.8), 4% SDS (w/v), 10% ~-mercaptoethanol (v/v), and 20%
glycerol (v/v) was used.

: .
- ~
. . . ~ -.: ,. . ~ . :
`, , ~: ..
.

WO92/14818 PCTtUS92/~855~
21~33~

OB suspension samples were diluted 1:1 with 2x Laemmli sample buffer and boiled for 5 minutes. Several lanes of an OB protein preparation were separated electrophoretically. The spheroidin protein (113 kDa) t was the predominant protein of the purified OBs.
Spheroidin within SDS-polyacrylamide gels was tested for glycosylation by periodic acid-Schiff staining [R. M.
Zacharius et al, Anal. Biochem., 30:149-152 (1969)].
Following electrophoretic separation, several lanes in the unstained gel were transferred to an I D obilon polyvinylidene difluoride (PVDF) membrane with a Bio-Rad TransBlot apparatus at 90 V for 2 hours in a buffer consisting of 10 mM morpholinepropanesulfonic acid (pH 6.0) and 20% methanol. Spheroidin was visualized on the PVDF membrane by Coomassie blue staining.
The region of the PVDF membrane containing spheroidin was excised from the membrane, and direct protein microsequencing was done with an Applied Biosystems gas-phase sequencer. Microseguencing of the -intact protein was unsuccessful, presumably because the N
terminus of the protein was blocked.
Cyanogen bromide cleavage was performed on samples of spheroidin eluted from the PVDF membrane to generate internal peptide fragments for sequencing.
Major polypeptides of 15, 9, 8, and 6.2 kDa were produced.

EXAMPLE 3 - SEOUENCING, HYBRIDIZATIONS
All DNA sequencing was done by the dideoxy chain termination method [F. Sanger et al, Proc. Natl.
Acad. Sci. USA, 74:5463-5467 (1977)] with [~-35S]dATP and -Sequenase tUS Biochemical, Cleveland, OH]. Standard sequencing reactions with Sequenase were carried out in accordance with the instructions of the supplier, US
Biochemical.

~;UB~TITUTE SHEET

.

WO92/1~18 PCT/US92/~5~
2 ~ ~3 3 ~ ~ 9 A reliable amino acid sequence was obtained from the 9, 8, and 6.2 kDa polypeptides produced as described in Example 3. The 8 and 9 kDa polypeptides represented overlapping partial CNBr cleavage products which together yielded the longest continuous amino acid ~equence: Met-Ala-(Asn or Arg)-Asp-Leu-Val-Ser-Leu-Leu-Phe-Met-(Asn or Arg)-(?)-Tyr-Val-(Asn?)-Ile-Glu-Ile-Asn-Glu-Ala-Val-(?)-(Glu?) ~SEQ ID NO:34]. The amino acid sequence obtained from the 6.2 kDa fragment was Met-Lys-Ile-Thr-Ser-Ser-Thr-Glu-Val-Asp-Pro-Glu-Tyr-Val-(Thr or Ile)-Ser-(Asn?) [SEQ ID N0:35]. A partial sequence for the 15 kDa fragment was also obtained: (Asn?)-Ala-Leu-Phe-(Phe?)(Asn?)-Val-Phe [SEQ ID NO:36]. The question marks in the above sequences indicated undetermined or unconfirmed amino acids. All sequences were ultimately located within the spheroidin gene sequence.

EXAMPLE 4 - PLASMID pRH512 A BalII AmEPV DNA library was prepared by digesting the genomic AmEPV DNA with BalII according to manufacturer's instructions. Plasmid pUC9 tGIBCO;
Bethesda Research Labs] was ~g~HI-digested and phosphatage-treated. The genomic ~glII cut AmEPV was shotgun cloned into the ~mHI site of pUC9. Escherichia oli SURE tstratagene, La Jolla, CA] was transformed by electroporation with a Bio-Rad Gene Pulser following the instructions provided by the manufacturer with the shotgun ligation, containing a variety of recombinant plasmids. Mini-preparations of plasmids were made by a conventional alkaline lysis procedure tSambrook et al, suDra]. These plasmids were cut with EcoRI-SalI to release the insert and run on a gel. The resulting plasmid DNA was southern blotted to a nylon membrane, producing a number of clones.

, WO92/l4818 2 ~ ~ 3 5 ~ ~ PCT/US92/~8SS t Among the fragments produced from the restriction enzyme digestions of the genomic DNA was a

4.4 BalII fragment and an EcoRI-D fragment. In order to locate a desirable clone from among those produced above, the sequence derived from the 6.2 kDa CNBr fragment was used to design a degenerate oligonucleotide for use as a hybridization probe to locate the spheroidin gene in a clone. The nucleotide sequence of this probe called RM58 [SEQ ID NO:12] was GA5GT7GA6CC7GA5TA6GT, where 5 represents A or G, 6 represents C or T, and 7 represents A, G~ C, or T. The peptide sequence of the probe was: -Glu-Val-Asp-Pro-Glu-Tyr-Val [SEQ ID NO:37].
The DNA probe was radiolabeled either with t~-32P]dCTP by the random oligonucleotide extension method [A. P. Feinberg et al, Anal. Biochem., 132:6-13 (1983)]
or with [~-32P]ATP and T4 polynucleotide kinase tSambrook et al, supra]. These same procedures were used for all other oligonucleotide probes described below. Both types of probes were purified by passage through spun columns -of Sephadex G-50.
Southern transfer was done with Hybond-N -[Amersham]; the transferred DNA was fixed to the membrane by W cross-linking. Southern hybridization was performed both with transferred DNA including the restriction fragments described above, as well as the - ~ BalII library of AmEPV DNA cloned into ~gEHI-digested -~
plasmid pUC9 as described above. Hybridization with the oligonucleotide probe was done at 37 or 45C with BLOTTO
[Sambrook et al, suDra] and was followed by two washes at room temperature with 0.3 M NaCl-0.06 M Tris (pH 8)-2 mM
EDTA for 5 minutes.
The RM58 probe [SEQ ID NO:12] hybridized to the 4.4 kb BalII fragment and the EcoRI-D fragment of AmEPV
DNA [See Fig. 1]. A plasmid produced by the shotgun cloning, recombinant pRH512 (a BalII 4.56 kb fragment ~ -~, . .. . .
,; : - - : ~ , .. . . . . , ,., - , : - . . . ..

. . . ..
. . : ~. ` - :

WO92/1~18 PCT/US92/~8S5 2 ~ â O

inserted into the BamHI site of pUC9 which contains about 1.5 kb of the 5' end of the spheroidin gene) was also identified by this hybridization with the RM58 oligonucleotide [SEQ ID NO:12].
The 4.51 kb pRH512 BalII insert was isolated, radiolabeled as described above, and hybridized back to various AmEPV genomic digests as follows. The DNA-DNA
hybridization was done at 65C with BLOTTO [Sambrook et al, su~ra] and was followed by two washes at room temperature with 0.3 M NaCl-0.06 M Tris (pH 8)-2 mM EDTA
for 5 minutes, two washes for 15 minutes each at 65C but with 0.4% SDS added, and two washes at room temperature with 0.03 M NaCl-0.06 M Tris (pH 8)-0.2 mM EDTA.
Hybridization was observed to the BamHI-A, EcoRI-D, ~n_III-G and -J, PstI-A, and XhoI-B fragments of AmEPV
DNA. The results of these hybridizations indicated that the 4.51 kb fragment in pRH512 was substantially identical to the 4.4 kb fragment produced by BalII
digestion of genomic DNA.
~0 The 4.51 kb BalII insert of pRH512 was thereafter sequenced by two procedures. One is the double-stranded plasmid sequencing method [M. Hattori et al, Anal. Biochem., 152:232-238 (1986)] performed with "miniprep" tSambrook et al, suDra] DNA and 1 pmol of universal, reverse, or custom-designed oligonucleotide primer in each sequencing reaction. Nested exonuclease II deletions tS. Henikoff, Methods Enzymol., 155:156-165 (1987)] were used to sequence plasmid pRH512 according to this method. Deletions were made from the universal primer end. For making these deleticns, the DNA was cut with EcoRI, filled in with ~-thiophosphate dNTPs tS. D.
Putney et al, Proc. Natl. Acad. Sci. USA, 78:7350-7354 (1981)] by use of the Klenow fragment of E. coli DNA
polymerase, cut with Em~I, and treated with exonuclease III. Samples were removed every 30 seconds, re-ligated, 8UB8TITUTE SHEEr .. , .j..... . . . .

. : .
- ~`
; . ~ . . ;. .

WO92/1~18 PCT/US92/~S~ -21~;5~ ;-and used to transform E. coli SURE cells byelectroporation. Sequencing reactions were carried out with the universal primer.
When a primer complementary to that sequence was prepared and used to sequence back through the RM58 binding site (bases 3983 to 4002), the generated sequence, when translated, yielded the amino acid sequence generated from microsequencing the 6.2 kDa CNBr polypeptide fragment.
A second sequencing method was performed using a combination of M12 shotgun sequencing with standard and universal and reverse M13 primers into M13 phage to permit single-stranded sequencing as follows. Plasmid pRH512 was sonicated to produce random fragments, repaired with bacteriophage T4 DNA polymerase, and these fragments were shotgun cloned into SmaI-cut M13mpl9 tGIBCO]. Plaque lifts were screened with a radiolabeled probe prepared from the 4.5 kb insert found in pRH512 to identify appropriate clones for shotgun single stranded sequencing tsee, e.g., Sambrook et al, suDra].
Sequencing of the B~lII insert of pRH512 isolated it to nucleotides # 0 to 4505, thus extending the sequence 5' and 3' to the spheroidin gene (Fig. 2).

EXAMPLE 5 - Q~aINING ADDITIONAL AmEPV SEOUENCE
A DraI AmEPV DNA library was prepared by digesting genomic DNA with DraI. These ~I fragments were shotgun cloned into SmaI-digested, phosphatase-treated vector M13mpl9. Preparations of M13 virus and DNA were made by standard procedures [J. Sambrook et al, supra]. Ligation and heat shock transformation procedures were performed conventionally [Sambrook et al, suDra.], resulting in the shotgun cloned fragments being transformed into the bacterial strain, E. coli UT481 ~University of Tennessee] or the SURE strain.

.:. - . ~
.. .. .. . ~ .: . .
. . . . . . .

,. . . .. . : . .-- : - .: ~ . . . ... . .
. . . , . ~ . . . : .
, WO92/1~18 PCT/US92/~855 2~ ~33~0 Standard PCR tInnis et al, supra] with 400 ng of genomic AmEPV DNA as a template was used to prepare a probe to identify a 586 bp DraI clone from nitrocellulose filter replicas (plaque lifts) tMicron Separations, Inc.]
S of the M13 shotgun library of DraI-cut AmEPV fragments.
This was done to isolate a clone spanning a central unsequenced region of the spheroidin gene. The standard PCR primers used for this reaction were RM92 ~SEQ ID
NO:15] (GCCTGGTTGGGTAACACCTC) and RM118 tSEQ ID NO: 16]
(CTGCTAGATTATCTACTCCG). This sequencing revealed that there was a single HindIII site at base 931 and that the 2' end of the spheroidin open reading frame (ORF) was truncated (Fig. 2).
The technique of inverse polymerase chain reaction (PCR) tM. A. Innis et al, PCR protocol a auide to methods and applications, Academic Press, Inc. San Diego, CA (1990)] was used with ClaI-digested AmEPV DNA
fragments which were ligated into a circle, to prepare a probe to identify clones containing a flanking sequence or to verify the absence of an intervening seguence between adjacent clones. The primers used in inverse PCR
were RM82 and RM83, which were taken from the pRH512 sequence. The sequence of RM82 [SEQ ID NO:13] was m CAAATTAACTGGCAACC and that of RN83 tSEQ ID NO:14~ was GGGATGGATTTTAGATTGCG.
The specific PCR reaction conditions for 34 cycles were as follows: 30 seconds at 94C for denaturation, 30 seconds at 37C for annealing, and 1.5 minutes at 72C for extension. Finally, the samples were incubated at 72~C to 8.5 minutes to complete extensions.
The concentration of each primer was 1 ~M.
The resulting 2.2 kb inverse PCR product was digested with ClaI, and a 1.7 kb fragment was gel purified. The 1.7 kb PCR fragment was sequenced with RM83 as a primer. Additional PCR primers were made to 8UB~3mUTE SHEET

.

WO92/14818 PCT/US92/~8S5 2 ~ 5 ~ ~3 the new sequence as it was identified. The sequencing process employed Sequenase, 5 pmol of each primer, and 10 to 50 ng of template. Prior to being sequenced, the PCR
products were chloroform extracted and purified on spun columns ~Sambrook et al, su~ra] of Sephacryl S-400. The DNA sequence was assembled and aligned, and consensus sequence was produced [R. Staden, Nucleic Acids Res., 10:4731-4751 (1982)]. Both strands were completely sequenced; the PCR product sequence was verified by conventional sequence.
The relevant ClaI sites of the 1.7 kb PCR
fragment are at positions 3485 and 6165. This fragment was radiolabeled and used as a probe to locate additional clones, i.e., pRH827 (307 bp), pRH85 (1.88 Xb), and pRH87 (1.88 kb) from the BalII fragment library. Plasmids pRH85 and pRH87 were sequenced using the same nested exonuclease II deletions and sequencing procedure, as described above for pRH512. Sequencing of the inverse PCR products with custom-designed primers confirmed that plasmids pRH85 and pRH87 represented the same 1.88 kb BalII DNA insert in opposite orientations, but also revealed a missing 80 bp between pRH827 and pRH85. This 80 bp DNA fragment was identified in the DraI fragment, as extending from bases 4543 to 5128 cloned into M13.
The orientation of the spheroidin ORF on the physical map is shown in Fig. 1. It is interesting to note that the 1.7 kb inverse PCR fragment only hybridized to the AmEPV ~ III-G fragment. ~he amino acid seguence derived from the 8 and 9 kDa overlapping CnBr-generated polypeptides is found from nucleotide positions 4883 to 4957 [SEQ ID NO:38]. That derived from the 6.2 kDa polypeptide is found from nucleotides 3962 to 4012 ~SEQ
ID NO:39]~ and that derived from the 15 kDa polypeptide is found from nucleotides 4628 to 4651 [SEQ ID NO:40].
Therefore, all sequences obtained from protein 8UB~TITUTE SHEET

. . .

:. ` .

. -. - . . .
. ... . . . . ~.
~-. ;
~: . , . . : .: ~. :' . : .
:

WO92/14818 PCT/US92/~5~
2~3~ iV

microsequencing were ultimately found to lie within the spheroidin ORF.

The start site for spheroidin gene transcription was determined. A primer complementary to the spheroidin gene sequence beginning 65 bp downstream of the predicted initiating methionine was prepared and used for a series of primer extensions.
A. Preparation of RNA and primer extension reactions.
Six 150 mm dishes of subconfluent cells were prepared. The culture media were aspirated, and 2 ml of viral inoculum was added to each dish. The virus concentration was about 0.1 to 1 PFU per cell. The dishes were occasionally agitated during a 3 hour adsorption period. At the end of this period, the cells were rinsed with 5 ml of modified PBS. The media were replaced, and the infected cells were incubated for 72 hours at 27C. Total RNA from the infected cells was isolated by the guanidinium thiocyanate-cesium chloride procedure tJ. M. Chirgwin et al, Biochemistry, 8:5294-5299 (1979)]-Primer extension reactions were carried outwith primer RM165 tSEQ ID NO:17], a 35-base oligonucleotide (GTTCGAAACAAGTATTTTCATCTTTTAAATAAATC) beginning and ending 100 and 65 bp downstream, respectively, of the initiating methionine codon found in the TAAATG motif. The primer was end labeled with [~-32P]ATP and T4 polynucleotide kinase and purified on a "spun column" [Sambrook et al, su~ra]. For annealing, 40 ~g of total infected-cell RNA and 106 cpm of radiolabeled primer were coprecipitated with ethanol. The pellet was resuspended in 25 ~1 of hybridization buffer ~80~
formamide, 40 mM piperazine-~ -bis(2-ethanesulfonic ~ ' ' :, ''~

WO92/1~18 PCT/US92/~S5 21033~J

acid) (pH 6.4), 400 mM NaCl, 1 mM EDTA (pH 8.0)], denatured at 72C for 15 minutes, and incubated at 30C
for 18 hours.
For primer extension, the RNA-primer hybrids were ethanol precipitated, resuspended, and used for five individual reactions. Each reaction contained 8 ~g of total infected-cell RNA, 50 mM Tris-HCl, (pH 8.3), 50 mM
KCl, 10 mM dithiothreitol, 10 mM MgCl2, 4 U of avian myeloblastosis virus reverse transcriptase (Life Sciences), 8 U of RNasin (Promega), 0.25 mM each deoxynucleoside triphosphate (dNTP), and the appropriate dideoxynucleoside triphosphate (ddNTP), except for a control reaction, which contained no ddNTP. The dNTP/ddNTP ratios were 4:1, 5:1, 5:1, and 2:1, for the C, T, A, and G reactions, respectively. The reactions were carried out at 42C for 30 minutes.
one microliter of chase buffer (4 ~1 of 5 mM
dNTP mixture and 1 ~1 of 20-U/~l reverse transcriptase) was added to each reaction mixture, which was then incubated for an additional 30 minutes at 42C. Reaction products were separated on a sequencing gel (8%
acrylamide containing 7 M urea) and visualized by autoradiography. Complementarity was observed until the AAA of the upstream TAAATG motif, indicating that transcription of the gene initiates within the TAAATG
element of the proposed late promoter element.
Immediately upstream is a 5' tract of noncoded poly(A) on the transcripts. The average length of the poly(A) is greater than 6bp.

EXAMPLE 7: ANALYSIS OF SPHEROIDIN SEOUENCE
The spheroidin ORF (G5R) was initially identified by sequencing back through the RM58 oligonucleotide primer binding region as described above.
Examination of the AmEPV spheroidin gene sequence (O~F

.

: . .. . ~ . . . :

WO92/14818 PCT/US92/~855 2 ~ O ~

G5R) revealed a potential ORF of 3.0 kb capable of encoding 1,003 amino acids or a protein of about 115 kDa.
The ORF consists of 29% G+C, in contrast to the 18.5%
reported for the entire AmEPV genome tLangridge, W.H.R., R.F. Bozarth, D.W. Roberts tl977] Virology ~6:616-620].
Inspection of the 92 bases upstream of the initiating ATG
revealed only 7 G or C residues. Also detected was the presence of known vertebrate poxvirus regulatory sequences within the 92 bp 5' of the spheroidin ORF.
Included are three TTTT TNT early gene termination signals and ~AAATG, which presumably represents a late transcription start signal used to initiate transcription and translation of the spheroidin gene. Several adjacent translation termination codons are also present within the 92 bp upstream of the spheroidin ORF.
Analysis of the sequence upstream of the spheroidin gene revealed four additional potential ORFs, GlL [SEQ ID NO:25], G2R tSEQ ID NO:23], G3L tSEQ ID
NO:26], and G4R tSEQ ID NO:24], discussed above. The putative amino acid sequences of these ORFs are reported in Fig. 2 tSEQ ID NO: 2, 3, 4 and 5, respectively]. No significant homologies were found for the small potential polypeptides encoded by ORF G2R tSEQ ID NO:23] or G3L
[SEQ ID NO:26]~ ORF GlL ~SEQ ID NO:25~, however, exhibited a significantldegree of homology to ORF 17 found within the HindIII-I fragment of vaccinia virus, whose function is unknown. ORF G4R ~SEQ ID NO:24] showed homology to ORF HM3 of capripoxvirus. In vaccinia virus, the ORF HM3 homolog was found very near the site of an incomplete ATI gene. The partial G6L ORF [SEQ ID NO:27]
to the right of the spheroidin gene exhibited good homology to vaccinia virus NTPase I. Much better homology (78.4% identity over 162 amino acids) was found between the partial G6L ORF [SEQ ID NO:27] and NPH I of SUBSmUTE SHEET

, .. ,~
, .

:

WO92/1~18 PCT/US92/~85~
-.
~1~3~sa CbEPV ~Yuen, L. et al, Virol., 182:403-406 (1991)], another insect poxvirus.

ExamDle 8 - Isolation and Sequencina of the AmEPV EcoRI-O
Fra~ment Containina the tk Gene Sequencing of the EcoRI-Q fragment of genomic AmEPV of Example 1 was performed using technigues described above for spheroidin. The sequencing showed 1511 bp containing two complete and one partial ORF.
Analysis of the DNA sequence of ORF Q2 [SEQ ID NO:28]
indicates the sites where the identifying degenerate oligonucleotides (~M03 SEQ ID NO:18 and RM04 SEQ ID
NO:l9) might hybridize. Two oligonucleotides, RM03 and RM04, based on different but strongly conserved regions of the tk genes of several poxviruses and vertebrates tc.
15 Upton et al, J. Virol., 60:920-927 (1986); D. B. Boyle et al, Viroloay, 156:355-365 (1987)] were prepared by the methods referred to above. RM03 was the 32-fold degenerate oligonucleotide [SEQ ID NO: 18]
GA(T/C)GA(G/A)GG(G/A)GG(G/A)CA(G/A) TT(C/T)TT
corresponding to the amino acid residues in the vaccinia tk protein from the aspartic acid at position 82 to the phenylalanine at position 87. RM04 [SEQ ID NO:19] was (GGNCCCATGTT(C/T)TCNGG with 32-fold degeneracy and corresponded to the region from the glycine at position 11 to the glycine at position 16 in vaccinia. These probes were radiolabeled as described above for the RH58 probe.
The AmEPV thymidine kinase (tk) gene was identified by hybridization with the degenerate oligonucleotide probes RM03 and RM04 to a Southern blot of the EcoRI-digested EPV DNA. The EcoRI band of interest (EcoRI-Q) was isolated, purified, and ligated into a pUC18 vector (GIBCO), previously digested with EcoRI and treated with calf intestinal alkaline 8UE~STITUTE SHEET

~ . .. .... ~ , . .
. .

.:
, , WO92/1~18 PCT/US92/~SS
5i~

phosphatase. Recombinant clones were identified by the size of the insert and by hybridization to the radioactive labeled oligonucleotide probes.
One such clone was called pMEGtk-1. The recombinant clones containing the EcoRI-Q fragment oriented in both directions relative to the pUC18 vector sequences were used for sequencing. Sequential nested deletions were generated by the method of Henikoff, cited above, as described for pRH512. These clones were used for sequencing the entire EcoRI-Q fragment.
Subsequently, these oligonucleotides and another, RMl29 is a non-degenerate oligonucleotide GGTGCAAAATCTGATATTTC [SEQ ID NO:20] prepared from the ORF
Q1, were employed as sequencing primers to confirm their positioning as indicated in ORF Q2 [SEQ ID NO:28]. ORF
Q2 potentially encodes for a protein of 182 amino acids ~21.2 kDa) [SEQ ID NO:10]. ORF Q3 potentially encodes a polypeptide of at least 68 amino acids but is incomplete and is transcribed in the opposite direction from ORF Q2.
ORF Q1 tSEQ ID NO:31] potentially encodes a small peptide of 66 amino acids (7.75 kDa) [SEQ ID NO:9].
Further analysis of the EcoRI-Q fragment reveals several other points. First, the A~T content is very high (80%). For ORF Q2, the 100 nucleotides upstream of the start codon for translation are 90% A+T.
Some potential poxvirus transcription signals were found between ORFs Ql and Q2. The five bases immediately preceding the start codon for ORF Ql are TAAATG which comprise a consensus late poxvirus promoter. A potential poxvirus early transcription termination signal sequence (TTTTTAT) is located 2 nt past the translation stop codon of Q2.
The deduced amino acid sequence for the tk encoded by the ORF Q2 of the EcoRI-Q fragment can be compared to the tk genes for the poxviruses swine pox [W.

. .~ :, . .

., ,, :

WO92/1~18 PCT/US92/~855 2 1 ~ 3 ~ V i, M. Schnitzlein et al, Virol., 181:727-732 (1991); J. A.
Feller et al, Virol., 183:578-585 (1991)]; fowlpox tBoyle et al., supra; M . ~ . Binns et al, J. Gen. Virol., 69:1275-1283 (1988)]; vaccinia [J. P. Weir et al, J.
Virol., 46:530-537 (1983); D. E. Hruby et al, Proc. Natl.
Acad. Sci. USA, 80:3411-3415 (1983)]; variola and monkeypox [J. J. Esposito et al, Virol., 135:561-567 (1984)]; capripoxvirus [P. D. Gershon et al, J. Gen.
Virol., 70:525-533 (1989)~; Shope fibroma virus tUpton et al., supra~; the cellular thymidine kinases of humans [H.
D. Bradshaw et al, Mol. Cell. Biol., 4:2316-2320 (1984);
E. Flemington et al, Gene, 52:267-277 (1987)~; the tk of mouse [P. F. Lin et al, Mol Cell. Biol., 5:3149-3156 (1985)]; the tk of chicken tT. J. Kwoh et al, Nucl. Acids -Res., 12:3959_3971 (1984)]; ASF [R. Blasco et al, Virol., 178:301-304 (1990); A. M. Martin Hernandez et al, J.
Virol., 65:1046-1052 (1991)~.

EXAMPLE 9 - EXPRESSION OF THE AmEPV tk GENE IN A VACCINIA
VIRUS
The AmEPV tk gene was tested functionally by cloning the gene into a vaccinia virus strain tk- mutant, as follows.
The EcoRI-Q fragment of AmEPV, described above, was inserted in both possible orientations into shuttle plasmid pHGN3.1 [D. D. Bloom et al, J. Virol., 65:1530-1542 (1991)~ which had been isolated from bacterial cells by the alkaline lysis method. This EcoRI-Q DNA fragment contains the AmEPV tk open reading frame (ORF). The cloning was performed conventionally. The resulting plasmid was designated pHGN3.1/~coRI-Q.
The plasmid was transfected by Lipofectin [GIBCO] as described specifically below into mammalian cells infected with vaccinia virus. The cells were either rat tk, human 143 tk-, or CV-1 cell lines onto .. . . ..
.
; ,.

W092/~l8 PCT/US92/~855 2~ ~5~) which the vaccinia virus Vsc8 was propagated. These cells were maintained in Eagle's ~inimal Essential Medium with Earle's salts tMassung et al, Virol., 180:347-354 (1991) incorporated by reference herein].
The VSC8 vaccinia strain [Dr. Bernard Moss]
contains the B-galactosidase gene driven by the vaccinia P~l promoter (P~-Lac Z cassette) inserted into the viral tk gene. While VSC8 contains an inactive tk gene due to the insertion of the B-galactosidase, portions of the vaccinia tk sequence remain. VSC8 is thus tk- and, upon staining with X-Gal (5-bromo-4-chloro-3-indoyl-~-D-galactopyranoside), will form blue plaques (B-galactosidase positive).
Cells were grown to 80% confluence (4 x lo6 per lS 60 mm dish). Lipofectin solution (20 ~g of Lipofectin in 50~1 of dH2O) was added to lO~g plasmid DNA (pHGN3.1/AmEPV
EcoRI-Q) in 50~1 of dH20 and incubated for 15 minutes at room temperature. After a 2 hour period of viral adsorption (m.o.i. of 2, 37C), the monolayers were washed three times with serum-free optiMEN. Three milliliters of serum-free optiMEM was then added to each 60 mm dish. The Lipofectin/DNA mixture was slowly added dropwise with gentle swirling and incubated an additional 12 to 18 hours at 37C. Fetal bovine serum was then added (10% final) and the infected cells were harvested at 48 hours postinfection.
Recombinant viruses, containing the EcoRI-Q
fragment inserted into the hemagglutinin (HA) gene of vaccinia, were identified by hybridization of AmEPV
EcoRI-Q fragments, radioactively labeled by procedures described above, to replicas of nitrocellulose "lifts" of virus plaques from the infected monolayer. Potential recombinants were isolated from replica filters and plaque-purified several times before testing.

8UB~TITUTE 8HEET

WO92/14818 PCT/US92/~8SS~

2~5~0 The tk of AmEPV exhibits some degree of homologv with the tk of vaccinia. To confirm that insertion of the AmEPV tk gene was within the HA gene of vaccinia rather than within residual tk sequences remaining in VSC8, the recombinants were examined by a series of Southern hybridizations to HindIII digests of the various viruses. When DNA from wild-type virus was hybridized to a vaccinia virus tk probe, hybridization was observed exclusively within the ~5 kb HindIII-J
fragment of AmEPV.
When either VSC8 or either of the AmEPV tk containing recombinants was examined using the vaccinia tk probe, hybridization occurred instead to an ~8 kb fragment consistent with polymerase in the presence of radiolabeled substrates. Extension will terminate at the end of the PstI-F fragment.
The radiolabeled product was then~hybridized to an EcoRI digest of AmEPV DNA. If orientation of the gene is such that the tk ORF reads toward the end of the genome, hybridization would be expected to the EcoRI-E
fragment; whereas if the gene is read toward the center of the genome, hy~ridization would be expected to the _RI-I fragment.
~he results indicate hybridization not only to the EcoRI-E fragment, but also to the EcoRI-A fragment.
These results infer that the orientation of the tk gene is with reading toward the left end of the genome.
Hybridization of the run-off extension product also to the EcoRI-A fragment is consistent with the presence of an inverted terminal repetition, common in poxviruses, with identical sequences residing in both the EcoRI-A and the EcoRI-E fragments.
The optimal growth temperature for AmEPV in the laboratory is 28C, whereas that of the vertebrate poxviruses is 37C. As described herein, when the AmEPV

~,.. , ;, ~ ; -,. - . - .~-' ~ - . :
, ', ' .

WO92/1~18 PCT/US92/~8S5 2.~3~a DNA fragment containing the entire tk gene was cloned into the tk- strain of vaccinia virus, the recombinant virus was capable of growing at 370c in the pre~ence of methotrexate [Sigma], indicative of a tk+ phenotype.
This example demonstrates that the Entomopoxvirus tk gene can be successfully transferred into mammalian expression systems, and that AmEPV tk is functionally active over a considerable temperature range.
It should be understood that the examples and embodiments described herein are for illustrative purposes only. Various modifications or changes in light thereof will be suggested to persons skilled in the art by this specification. The subject invention encompasses recombinant polynucleotide sequences, plasmids, vectors, and transformed hosts which are equivalent to those which are specifically exemplified herein in that the characteristic expression features are retained in said equivalent constructs even if inconsequential modifications to the DNA sequence have been made. For example, it is within the skill of a person trained in the art to use a fragment of the spheroidin gene's non-coding region which is upstream of the structural gene in order to achieve the desired level of expression. Such fragments of the regulatory sequences fall within the scope of the current invention, so long as the desired level of expression which is characteristic of this system is retained. Furthermore, inconsequential changes to the nucleotide sequences can be made without affecting the disclosed functions of these sequences. Such modifications also fall within the scope of the current invention and are to be included within the spirit and purview of this application and the scope of the appended claims.

~ `-` .

WO 92/14818 PCI-/US92~008SS_ I

:
2103~

SEQUENCE LISTING
(1) CENERAL INFORMATIONs (1l APPLICANT~ Unlv-rslty of Florida (11) TITLE OF INVENTIONs Novel Entomopoxvlrus Expre-~lon 8y~tem ~111) NUMBER OF SEQUEN OE ss 40 ~lv) CORRESPONDEN OE ADDRESSs ~A) ADDRE88EEs Davld R. Sal~wanchlk ~B) 8TREETs 2421 N.W. 41st Street, 8ulte A-l C CITYs aaln-c~llle D 8TATEs Florlda E COUNTRY~ U.8.A.

~v) COMPUTER READABLE FORM~
(A) M~DIUM TYPE: Floppy dl~k ~B) COMPUTBRs IBM PC compatlble ~C) OPERATING SY8TEMs PC-DOS/MS-DOS
~D) 80FTWARes PatentIn Relea~e Jl.0, Vor~lon ~1.2s~
~) CURRENT APP~ICATION DATAs ~A) APPLICATION NUMBER~
~B) FILINC DATE-~C) CLA88IFI Q TIONs ~vll) PRIOR APPLICATION DATA~
A) APPLI Q TION NUMBBRs U8 07/657,584S U9 07/
B) FTLINa DATE~ l9-FEB-1991~ 30-JAN-1992 ~vlll) ATToRNEy/AaBNT INFORNATION-A) NAMEs Sallwanch~k, Davld R.
B REaI8TRATIoN NVMBBRs 3~,794 C REFBAENCE/DOCXET NUMBBRs UF/8~8-114.C2 ~lx) T~LBCOMNUNICATION INFORNATIONs (A) TELEPHON2s ~904) 375-8100 (B) 5ELEFAXs (904) 372-5800 ~2) lNFORMATION FOR 8BQ ID Notls ~1) 8BQUEN OE CHARACrERI8TIC8s (A) I~NGT~s 6768 ba-e palr~
B TYPEs nucl-lc acld C 8TRAND~DNE88s doubla D TOPOLCGYs unknown ~11) MOLECULE TYPEs DNA (g-nomlc) (vl) ORIGINAL 60URCEs ?
~A) ORGANI8Ms A~acta ~oorel entomopoxvlru~

~lx) FEATURBs (A) NAMe/~EYs CDS
~B) LOCATIONs compl~ent (65..14S9) ~lx) FEATUREs ~A) NANE/~EYs CDS
~B5 ~OCATIONs 1474..2151 .

.,.. ,,.......... ." I
, . , , . - - . .
- . , ~ ~ . . .. . - . -., : . .. ~ . . .
' , ! . ' !.~;~., ; '.
': , ' /,,. ;, ' '' ' ' :
., ,, , ' . ' ~ .. .
"' ", ' : ' '~ ~ .
, WO 92/14818 PCT/US92/0085~
2133~J

~xl FEATURE:
(A) NAME/KEY: CDS
- ~B) LOCATION: complement (2239.. 2475) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2502..2987 (ix) FEATURE:
(A) NAME/XEY: CDS
(B) LOCATION: 3080..6091 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: c~mplem~nt (6277..6768) (x~) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GTAATTCAAA AGTATTAAAA AAGTAATAAT TTACATTTTT AAATATATCA m AAATATT 480 TATGGC m T TATAGTCATA TCAGATTCAA TAAACATATA TTTTTTATTT TGTTTTATAA 600 G m ATCTAT TACGCAACAA GTAAAATGAT CATTATAAAT TATAGGAAAC ATAAAAAATC 720 GCGGTATTCC TATTTGAGCA TCCAAATCAT CATAAATTGT GGCAAATGTA GAaAAATCTC 1020 .. .. . . .. - .
: .~. ' ~ , -.: .
. .
.. ~
~ . .
-W O 92/14818 PCT/US92/00855_ 2~ ~3~5a ATAACATAGA CATAAAATTA ATACCACATT CTGGCATTTT TAAATTTTTA TTTGGAaATC 1440 Met Phe Leu Val Tyr Phe A-n Thr Phe Leu Ile Ile Ile Leu Leu Phe Gly Ile Ile Gly Ile Tyr Ile 10 lS 20 Leu Thr Phe Val Phe Asn Ile A~p Phe L-u Ile A-n Asn A~n LYD Ile Tyr Ile Leu Ser Tyr A~n Ala Thr A-n Ile Asn A~n Ile A-n A-n Leu Asn Leu Tyr A-p Tyr Ser ABP Ile Ile Phe Leu Thr Asn Phe Asn Ile AAT AAT AAT CTT TTA GTA ACA CAA GCT AaT AAT TTA CAA GAT ATA CCA 1734 A-n A-n A~n Leu Leu Val Thr Gln Ala A-n Asn Leu Gln ABP Ile Pro ~S 80 8S

Ile Phe A~n Val Asn Asn Ile Ile Ser A~n Gln Tyr A~n Phe Tyr Ser Al- Ser Ser A~n A~n Val A~n Ile L-u Leu Gly Leu Arg Ly~ Thr LHU
lOS 110 11S

A-n Ile A-n Arg A-n Pro Phe Leu Leu Phe Arg A-n Thr Ser Leu Ala Il- Val Phe A~n Asn A-n Glu Thr Phe Nis Cy~ Tyr Ile Ser S-r A~n Gln Asn Ser ABP Val Leu A~p Ile Val Ser His Ile Glu Phe M t Ly-S-r Arg Tyr A-n Ly~ Tyr Val Ile Ile Gly Glu Ile Pro Val A-n A-n A~n Il- Ser Ile A~n A-n Ile Leu A-n A~n Phe Ala Ile Ile Thr Asn Val Arg Leu Ile Asp Ly- Tyr A~n Ser Ile Ile Ser Phe Leu A-n Ile A~n Val Gly Thr Leu Phe Val Ile A-n Pro TAACATATTT TTTATTAaAA TGAATAaAAT ATATATTGTT ATTGTCAATA TTTTATATCA 2228 .-. . .

WO 92/14818 PCI`/US92/0085S
2 ~ ~ 3 .J ~ O

Met Ser Ile Phe Ile Tyr Tyr Ile Phe Asn A-n Arg Phe Tyr Ile Tyr Lys Arg Met Asn Thr Val Gln Ile Leu Val Val Ile Leu Ile Thr Thr Ala Leu Ser Phe Leu Val Phe Gln Leu Trp Tyr Tyr Ala Glu Asn Tyr Glu Tyr ~le Leu Arg Tyr Asn Asp Thr Tyr Ser Asn Leu Gln Phe Ala Arg Ser Ala Asn Ile Asn Phe Asp Asp Leu Thr Val Phe A-p Pro Asn Asp Asn Val Phe Asn Val Glu Glu Lys Trp Arg Cys Ala Ser Thr Ann Asn Asn Ile Phe Tyr Ala Val S-r Thr Phe Gly Phe Leu Ser Thr Glu Ser Thr Gly Ile A-n L-u Thr 105 110 115 t Tyr Thr A-n Ser Arg Asp Cy- Ile Ile A~p Leu Phe Ser Arg Ile Ile Ly- Ile Val Tyr A~p Pro Cy- Thr Val Glu Thr Ser Asn Asp Cys Arg L-u LQU Arg Leu Leu Met Ala A-n Thr Ser Met Ser A-n Val Pro LQU Ala Thr Ly- Thr Ile Arg Ly- Leu Ser Asn Arg Ly- Tyr Glu Ile Lys Ile Tyr Leu Lys Asp Glu .
, . ~ . -: : ; -- .
. ~
. ... :
.~ . ; . . . .
. -WO 92/14818 PCl'/US92/00855 21~3~0 A~n Thr Cy~ Phe Glu Arg Val Val Aep Met Val Val Pro Leu Tyr Asp Val Cy~ Asn Glu Thr SeOr Gly Val Thr Leu G55u Ser Cyg Ser 60 Ilo Glu Val Ile Glu L-u A-p ADn Thr H~ Val Arg Ile Ly~ Val Hi~

Gly A-p Thr LHU Ly~ Glu Met Cy~ Phe Glu Leu Leu Phe Pro Cy~ A-n Val A~n Glu Ala Gln Val Trp Ly- Tyr Val Ser Arg Leu L-u Leu A~p AAT GTA TCA CAT AAT GAC GTA AAA TAT AaA TTA GCT AAT TTT AGA CTG 3451 Asn Val Ser His A~n Asp Val Ly~ Tyr Lys Leu Ala A~n Phe Arg Leu Thr L-u A~n Gly Ly~ H~ L-u Ly~ Leu Lys Glu Ile A~p Gln Pro Leu Phe Ile Tyr Phe Val Asp Asp Leu Gly A~n Tyr Gly Leu I1Q Thr Lyn Glu ADn Ile Gln A-n Asn Asn Leu Gln Val A~n Lys A~p Ala Ser Phe Ile Thr Ile Phe Pro Gln Tyr Ala Tyr Ile Cys Leu lG85y Arg Lys Val Tyr L u A~n Glu Lys Val Thr Phe Aup Val Thr Thr Aap Ala Thr A~n Ile Thr Leu Asp Phe Asn Lys Ser Val Asn Ile Ala Val Ser Phe Leu A~p Ile Tyr Tyr Glu Val A~n A-n A~n Glu Gln Ly~ A~p Leu Leu Ly-A-p Leu Leu Lys Arg Tyr Gly Glu Phe Glu Val Tyr A~n Ala Asp Thr Gly Leu Ile Tyr Ala Ly~ A~n Leu Ser Ile Lys A-n Tyr A~p Thr Val Ile Gln Val Glu Arg Leu Pro Val A~n Leu Lys Val Arg Ala Tyr Thr f , . . , , , ,' ~ - , - ' ' :
' ', ' ' . . : ' ' .:
. . .
.

WO 92/14818 PCI'/US92/008SS
21 ~33~) Ly~ Asp Glu A~n Gly Arg Asn Leu CYB Leu Met Lys Ile Thr Ser Ser ACA GAA GTA GAC CCC GAG TAT GTA ACT AGT AAT AAT GCT TTA $TG GGT 4027 Thr Glu Val ABP Pro Glu Tyr Val Thr Ser A~n A~n Ala Leu Leu Gly Thr L-u Arg Val Tyr Lys Ly- Phe ABP Ly~ Ser His Leu Lys Ile Val Met H~- A-n Arg Gly S-r Gly A-n Val Phe Pro L-u Arg S-r L-u Tyr Leu Glu Leu Ser A~n Val Ly~ Gly Tyr Pro Val LYB Ala S-r A~p Thr Ser Arg Leu ABP Val Gly Ile Tyr Ly~ Leu Asn LYB Ile Tyr Val A~p A~n A-p Glu A~n Lys Ile Ile Leu Glu Glu Ile Glu Ala Glu Tyr Arg 385 390 395 t TGC GGA AGA CAA GTA TTC CAC GAA CGT GTA AaA CTT AAT AAA CAC CAA 4315 Cy~ Gly Arg Gln Val Phe Hi- Glu Arg Val LYB Leu Asn Ly~ Hi- Gln 400 405 410 ~
TGT AaA TAT ACT CCC AAA TGT CCA TTC CAA TTT GTT GTA AAC AGC CCA 4363 Cy- Ly~ Tyr Thr Pro Ly~ Cy~ Pro Phe Gln Phe Val Val A-n Ser Pro A-p Thr Thr Il- His Leu Tyr Gly Ile Ser A-n Val CYB L-u Ly~ Pro Ly- Val Pro Ly- A-n L-u Arg Leu Trp Gly Trp Il- L-u A~p CYD A~p Thr S-r Arg Ph- Ile Ly~ His M-t Ala A-p Gly S-r A-p ABP Leu A-p Leu A-p Val Arg Leu A-n Arg A-n A-p Il- Cy9 Leu Ly- Gln Ala Ile AaA CAA CAT TAT ACT AAT GTA ATT ATA TTA GAG TAC GCA AAT ACA TAT 4603 Ly- Gln Hi- Tyr Thr A!n Val Il- Il- Leu Glu Tyr Ala Asn Thr Tyr Pro A-n Cy~ Thr Leu Ser Leu Gly A~n A~n Arg Phe Asn A-n Val Ph-GAT ATG AAT GAT AAC AAA ACT ATA TCT GAG TAT ACT AAC TTT ACA AAA 4699A-p Met Asn A~p A-n Ly~ Thr Il- S-r Glu Tyr Thr Asn Ph- Thr LYB

: . . : , : .
, . . . .

: `~ , :
:
~ .: - ~; ;:

WO 92/14818 PCr/US92/008SS.
21~3~50 Ser Arg Gln A~p Leu A~n Asn Met Ser CYB Ile Leu Gly Ile Asn Ile Gly Asn Ser Val A-n Ile Ser Ser Leu Pro Gly Trp Val Thr Pro Hi~

GAA GCT AAA ATT CTA AGA TCT GGT TGT GCT AGA GTT AGA GAA m TGT 4843 Glu Ala Lys Ile Leu Arg Ser Gly Cys Ala Arg Val Arg Glu Phe Cy~

Lys S-r Phe Cys Asp LQU Ser A-n Lys Arg Phe Tyr Ala Met Ala Arg A3p Leu Val Ser Leu Leu Phe Met Cy8 Asn Tyr Val Asn Ile Glu Ile Asn Glu Ala Val Cys Glu Tyr Pro Gly Tyr Val Ile Leu Phe Ala Arg Ala Ile Lys Val Ile A~n A~p Leu Leu Leu Ile Asn Gly Val Asp Asn Leu Ala Gly Tyr Ser Ile Ser L-u Pro Ile H1- Tyr Gly S-r Thr Glu AAG ACT CTA CCA AAT GAA AAG TAT GGT GGT GTT GA2 AAG AAA m AAA 5131 Lys Thr Leu Pro Asn Glu Lys Tyr Gly Gly Val Asp Lys Ly- Ph- Ly~

Tyr L-u Phe L-u Ly~ A~n Ly- L-u Lys A~p L--u M-t Arg A-p Ala Asp 2TT GTC CAA CCT CCA TTA TAT ATT TCT ACT TAC m AGA ACT TTA TTG 5227 Ph- V~l Gln Pro Pro Lou Tyr Ile S-r Thr 2yr Ph- Arg Thr Leu Leu A-p Ala Pro Pro Thr A-p A-n 2yr Glu Lys Tyr Lou Val A-p S-r Ser Val Gln Ser Gln A-p Val Leu Gln Gly Leu L-u A-n 2hr Cys A-n 2hr Ile A-p Thr Asn Ala Arg Val Ala Ser Ser Val Ilo Gly Tyr Val Tyr Glu Pro Cy- Gly Thr Ser Glu Hi- Ly- Ile Gly Ser Glu Ala Leu Cys Ly- Met Ala Lys Glu Ala Ser Arg Leu Gly Asn Leu Gly L-u Val Asn 8UE~STITUTE 8HEET

. .. ~ .. ... .

- . ~ .
: . . .
.

::

.
.

2~ ~3~,5V

Arg Ile Asn Glu Ser A~n Tyr Asn Lys Cy~ A~n Ly~ Tyr Gly Tyr Arg Gly Val Tyr Glu A~n Asn Ly- Leu Lyn Thr Ly- Tyr Tyr Arg Glu Ile Phe A~p Cy- A-n Pro Asn A-n A-n A-n Glu Leu Ile Ser Arg Tyr Gly Tyr Arg Ilo ~Set A-p Leu His LYD Ile Gly Glu Ile Ph- Ala A-n Tyr 845 850 855 860 ~, A~p Glu Ser Glu Ser Pro Cy~ Glu Arg Arg Cyr His Tyr Leu Glu A-p Arg Gly Leu Leu Tyr Gly Pro Glu Tyr Val His Hil~ Arg Tyr Gln Glu Ser Cy~ Thr Pro Asn Thr Phe Gly A-n A-n Thr A-n Cy- Val Thr Arg A-n Gly Glu Gln Hi~ Val Tyr Glu A-n Ser Cy- Gly A-p A-n Ala Thr Cy~ Gly Arg Arg Thr Gly Tyr Gly Arg Arg Ser Arg Arp Glu Trp Asn A~p Tyr Arg Ly- Pro Hi- Val Tyr Asp A-n Cy- Ala A-p Ala Arn S~r Ser S-r Ser A~p Ser Cys Ser Asp Ser Ser Ser Ser Ser Glu Ser Glu S-r A~p S-r A-p Gly Cys Cy- Asp Thr A-p Ala Ser Leu A~p Ser A~p I le Glu A-n Cy~ Tyr Gln A-n Pro Ser Ly- Cy- A-p Ala Gly Cy-8UB~TITUTE 8HEEl-: .. . .. ~ .. .. .
.: . . . : . , : ~ -.
. . -. . . . . .
.. . . . :
. .: . ..

WO 92/14818 ` PCI'/US92/008SS
21 ~33a~

TTAAAAAATG AACGTTAACA TATCTATATT CTTGTGGTAA ATC m ATGA GAATTTAATC 6758 (2~ INFORMATION FOR SEQ ID NO 2 (I) SEQUENCE CNARACTERISTICS
(A) LENGTH 464 amino acLd~
(8) TYPE: amLno acid (D) TOPOLOGY linear (iL~ MOLECULE TYPE protein (xi) SEQUENCE DESCRIPTION SEQ ID NO 2 et A-n A-n Ly~ Ile Arg Arg Phe Pro A-n Ly- A~n Leu Ly~ Met Pro lu Ser Gly Ile A-n Phe Met Ser Met Leu Phe Phe Ser Ly- Ile A-p 30 `
A-n Met Val Tyr Phe Ile Aen Pro Ile Ly- Tyr A-n Thr A-n Ala A-n Ile Ala Ile Leu Glu Ly~ Ile A-p A-p A~p A-p Glu Thr Arg Gly Ly~
Val Thr Phe Ile Pro Ile Ly~ Tyr Leu Glu Ile Leu Tyr A-n Glu Leu al Leu A~p Pro A~n NLs Ile A-n A-n Ile A~n Phe Glu A-n A-n Ile Ly- Arg Ly- Phe Phe Leu Phe Trp lT0hr5 Ile Ly~ Ly- Tyr l;u0 Gln A p Ly- A~n Ile A-n Ile A-n Thr Phe Ile Thr Ser Ly- Ly Tyr Ly~ Gly Ile Pro Leu Val Tyr Met Arg Ly~ Ser Phe Leu Ly~ Ser Glu Leu Ser Ly- Thr Arq A-p Phe Ser Thr Phe Ala Thr Ile Tyr A-p Asp L-u A-p 145 150 lS5 160 la Gln Ile Gly Ile Pro Pro Leu Gly Phe ADn Pro Ly- Pro Ly- Ala yr Pro Arg Lys Hi~ AQP Ly- Ser Thr Trp Leu Ser Ser Gly A-p Ile ~ ~ ~ 3 ~

Tyr Asn Cys Ile Tyr Pro Leu Thr Met Ile A-n Thr Asp Tyr Asp Tyr t Phe H$s L-u Ile Leu Phe Glu Lys Thr Asp Lys Asn Ile Ala Thr Val Ala Ser Ser Met Arg Cys Tyr Lys Leu Glu ABP Arg Val Ly- Phe Phe Leu M t Asn Asp Ly~ Lys Arg Phe Phe Met Phe Pro Ile Ile Tyr Asn Asp Hi~ Ph- Thr Cys Cys Val Ile Asp Lys His Phe A-p Lys A~p Lys Lys Ala Ala Tyr Phe Phe Asn Ser Ser Gly Tyr Ile Pro Glu Leu Ile Lys Gln A-n Lys Lys Tyr Met Phe Ile Glu Ser Asp Met Thr Ile Lys Ser Hls Lys H~s Tyr A~n Ser Thr Pro Asn Thr Asn Tyr Ala Tyr Leu Tyr Ile A-p Val Leu Ser Glu Tyr Leu Asn Asp Ile Phe Ly- A-n Val A-n Tyr Tyr Phe Phe A~n Thr Phe Glu Leu Gln Tyr A-p Ser Pro Asp Cy- Gly Met Phe Asn Ile Il- Phe Leu Tyr Tyr Ile Val Tyr Phe A-n Ile Ly~ S-r Lys Phe Glu Phe LYB Ly- Leu Tyr Tyr Ser M-t S-r Phe Il- Gly A-p Leu L-u Ala S-r Ser Tyr Arg Gly Ala Leu Phe Ile Ser Arg Tyr A-p Ile A-n Ser lle Asp Glu Phe Lys Asn Thr L-u Glu Ile -Ph- A-n Ile Ly- Asn Lys Lys Phe Met Glu Leu Ile Asp Met Tyr Lys Ly- A-n Ser A-n Arg Ile Met Asn Val Cys Ser Ly- Ile Ly- A-n Asp Tyr A-p S-r Tyr Il- Aap A-n Glu Ly- A-n Ser Leu Glu Ser A-n Ile ~2) INFORMATION FOR SEQ ID NO 3 (1) SEQUENCE CHARACTERISTICS
~A) LENCTH 226 amlno aclds ~B) TYPE amino aoid (D) TOPOLOGY llnear (ii) MOLECULE TYPE prot-in .. ~. .. .. . .. . . .
- .. .. . . . . . , . . . . ~ " . . ~ .
, ~ . . . . .

.
- - . . .

,;
. .
;; ... .
... . . .

WO 92/14818 PCI'/US92/008SS
2~ ~3~5~` -~xl) SEQUENCE DESCRIPTION SEQ ID NO 3 Met Phe Leu Val Tyr Phe Asn Thr Phe Leu Ile Ile Ile Leu Leu Phe Gly Ile Ile Gly Ile Tyr Ile Leu Thr Phe Val Phe Asn Ile A~p Phe Leu Il- A~n A~n A~n Lys Ile Tyr Ile Leu Ser Tyr Asn Ala Thr Asn Ile Asn Asn Ile A~n Asn Leu Asn Leu Tyr Asp Tyr Ser A-p Ile Ile Phe Leu Thr Asn Phe A~n Ile A~n Asn Asn Leu Leu Val Thr Cln Ala Asn A-n Leu Gln Asp Ile Pro Ile Phe Asn Val Asn Asn Ile Ile Ser Asn Gln Tyr A~n Phe Tyr Ser Ala Ser Ser Asn A~n Val Asn Ile Leu Leu Gly Leu Arg Ly~ Thr Leu A~n Ile A~n Arg Asn Pro Phe Leu Leu Phe Arg Asn Thr Ser Leu Ala Ile Val Phe Asn Asn Asn Glu Thr Phe His Cys Tyr Ile Ser Ser Asn Gln Asn Ser Asp Val Leu A~p Ile Val Ser Nis Ile Clu Phe Met Lys S-r Arg Tyr A~n Lys Tyr Val I1- Ile Gly Glu IIe Pro Val A~n A~n A-n Ile S-r Il- Asn Asn Ile L-u A~n Asn Phe Ala Ile Ile Thr A~n Val Arg Leu Ile A~p Lys Tyr A~n Ser Ile Il- S-r Phe Leu Asn Ile Asn Val Gly Thr L-u Ph- Val Ile Asn Pro (2) INFORMATION FOR SEQ ID NOs4 (i) SEQUENCE CNMACTERISTICS
(A) LENGTN 78 amino acid~
(8) TYPE amino acid (D) TOPOLOGY lin-ar (ii) MOLECULE TYPE prot-in (x~) SEQUENCE DESCRIPTION SEQ ID NO 4 Met S-r Ser Ser Ly~ Ly~ Asn A~n L-u Gly Tyr Phe Asn Asn Leu Ly~

~UB~TITUTE 8HEET

.; ' ,.

:

WO 92/14818 PC~/US92/008SS

2103'~J50 Thr Glu Glu Val Ser Gln Ser Gln Val Phe Lys Asp A-n Tyr Arg Pro Gly Tyr Tyr Cly Leu A-p Thr A-n Ala Ala A-n Pro Ala A-p Val Tyr A~n Thr Glu Ser Asn Lys Pro Ser Thr Val Asp Val Trp Gly A3p Lys Arg Leu Glu Gly Lys Ile Ile Pro Ly- Ser Lys Lys Ly- Lys (2) INFORMATION FOR SEQ ID NO 5 ~i) SEQUENCE CHARiACTSRISTICS
(A) LENGTH 162 amino acids ~B) TYPE amino acid (D) TOPOLOGY lLnear ~il) MOLECULE TYPE protein ~xi) SEQUENOE DESCRIPTION SEQ ID NO 5 Met Ser Ile Phe Ile Tyr Tyr Ile Phe Asn Asn Arg Phe Tyr Ile Tyr y~ Arg M-t A-n Thr Val Gln Ile Leu Val Val Ile Leu Ile Thr Thr Ala Leu Ser Phe Leu Val Phe Gln Leu Trp Tyr Tyr Ala Glu A-n Tyr Glu Tyr Ile Leu Arg Tyr A-n A~p Thr Tyr Ser Asn Leu Gln Ph- Ala Arg Ser Ala Asn Ile Asn Phe A~p A~p Leu Thr Val Phe A-p Pro A~n ~p A-n Val Phe A-n Val Glu Glu Lys Trp Arg Cys Ala Ser Thr Asn -n A~n Il- Phe Tyr Ala Val Ser Thr Phe Gly Phe Leu Ser Thr Glu Ser Thr Gly Ile A-n Leu Thr Tyr Thr A~n Ser Arg A~p Cy~ Ile A-p Leu Phe Ser Arg Ile Ile Ly- Ile Val Tyr A-p Pro Cys Thr Val Glu Thr Ser A~n A~p Cy~ Arg Leu Leu Arg Leu Leu Met Ala A-n Thr Ser (2) INFORMATION FOR SEQ ID NO 6 (i) SEQUENCE CHARACTERISTICS
(A) LENGTH 1003 amino acids (B) TYPE amino acid (D) TOPOLOGY linear ~UBSTITVTE SHE~

..

- : ' ~ ' ' : ' ' .
. ~ .: . , . ;
. . . ..

WO 92/14818 PCl'~US92/008SS
2103S5~

( li ) MOLECULE TYPE protein ~xi) SEQUENCE DESCRIPTION SEQ ID NO 6 Het Ser Asn Val Pro Leu Ala Thr Lys Thr Ile Arg Lys Leu Ser Asn Arg Lys Tyr Glu I le Lys I le Tyr Leu Lys Asp Glu Asn Thr Cy~ Phe Glu Arg Val Val A~p Met Val Val Pro Leu Tyr Asp Val Cys A~n Glu Thr Ser Gly Val Thr Leu Glu S-r Cys S-r Pro Asn Ile Glu Val Ile Glu L-u Asp A~n Thr His Val Arg Ile Lys Val Hi~ Gly Asp Thr Leu Lys Glu Met Cys Phe Glu Leu Leu Phe Pro Cys Asn Val Asn Glu Ala Gln Val Trp Lys Tyr Val Ser Arg Leu Leu Leu Asp Asn Val Ser HiE~

Asn Asp Val Lys Tyr Lys Leu Ala Asn Phe Arg Leu Thr Leu A~n Gly Ly~ His Leu Ly~l Leu Lys Glu Ile At~p Gln Pro Leu Phe Ile Tyr Phe Val A-p Asp Leu Gly Asn Tyr Gly Leu Ile Thr Lys Glu Asn Ile Gln Asn A~n Asn Leu Gln Val A~n Lys Asp Ala Ser Phe Ile Thr Il- Phe Pre Gln Tyr Ala Tyr Ile Cy- L-u Gly Arg Lys Val Tyr L u A~n Glu Ly- Val Thr Phe A~p Val Thr Thr Asp Ala Thr A~n Tle Thr Leu Asp Ph- A-n Lys Ser Val A~n Ile Ala Val Ser Phe L-u Asp Ile Tyr Tyr Glu Val A-n Asn ADn Glu Gln Lys A-p L-u Leu Lys A-p L-u L-u Lys Arg Tyr Gly Glu Ph- Glu Val Tyr A-n Ala Asp Thr Gly L-u Ile Tyr Ala Ly~ Asn L-u Ser Ile Ly~ Asn Tyr Asp Thr Val Il- Gln Val Glu Arg L-u Pro Val Asn Leu Ly~ Val Arg Ala Tyr Thr LyD A~p Glu A~n Gly Arg Ann Leu Cys L-u Met Ly~ Ile Thr Ser Ser Thr Glu Val Asp Pro Glu Tyr Val Thr Ser A~n Asn Ala Leu Leu Gly Thr L-u Arg Val 8UBSTITUTE SHEEr - ;~ .. .. .
.

;. . ~ i :

.

.. .

2 ~ 9 3 ~ 3 ~

Tyr Lye Lye Phe Aep Ly~ Ser His Leu Ly~ Ile Val Net Hi~ A~n Arg Gly Ser Gly Aen Val Phe Pro Leu Arg Ser Leu Tyr Leu Glu Leu Ser 340 34s 350 Aen Val Lye Gly Tyr Pro Val Lys Ala Ser A~p Thr Ser Arg Leu A~p 355 360 36s Val Gly Ile Tyr Lys Leu A-n Ly~ Ile Tyr Val A-p A~n A-p Glu A~n 3~0 375 380 Ly~ Ile Ile Leu Glu Glu Ile Glu Ala Glu Tyr Arg Cy~ Gly Arg Gln 38s 390 39s 400 Val Phe Hi~ Glu Arg Val Lys Leu A~n Ly~ Hi~ Gln Cy8 LYB Tyr Thr Pro Ly- Cy~ Pro Phe Gln Phe Val Val Asn Ser Pro A-p Thr Thr Sle H$- Leu Tyr Gly Ile Ser A~n Val Cy~ Leu Lys Pro LYB Val Pro LYD

ADn L u Arg Leu Trp Gly Trp I le Lou A-p Cyl~ A p Thr Ser Arg Phe I le Ly- Hi~ Met Ala A~p Gly Ser A-p A~p Leu A~p Leu Asp Val Arg ~
465 470 47s . 480 -.
Leu A~n Arg A~n Asp Ile Cy~ Leu Ly~ Gln Ala Ile Ly- Gln Hi- Tyr 48s 490 49s Thr A-n Val Ile Ile L-u Glu Tyr Ala A-n Thr Tyr Pro Asn Cy- Thr soo 505 510 Leu Ser L--u Gly Aen A~n Arg Phe A-n A-n Val Phe A-p Met A-n A-p A~n Ly- Thr I le Ser Glu Tyr Thr A-n Phe Thr Ly~ Ser Arg Gln A-p s30 535 540 .
Leu A-n A~n M t Ser Cy- Ile Leu Gly Ile A-n Ile Gly A-n Ser Val 545 sso 55s 560 A-n Il- S-r S-r Leu Pro Gly Trp Val Thr Pro Hi- Glu Ala Ly- Ile s65 s7o 575 Leu Arg ser Gly Cys Ala Arg Val Arg Glu Phe Cyr Ly- S-r Phe Cy~
s80 s8s 590 A-p L-u S-r Arn Ly~ Arg Phe Tyr Ala Met Ala Arg Arp L-u Val Ser Leu L-u Phe M t Cyl~ A-n Tyr Val A-n Ile Glu Ile A-n Glu Ala Val Cy~ Glu Tyr Pro Gly Tyr Val Ile Leu Ph- Ala Arg Ala Ile Lye Val Ile A-n A-p Leu Leu Leu Ile A~ln Gly Val A-p A-n Leu Ala Gly Tyr 645 650 6ss 8UB8TITUTE SHE~T
.. ~.. .
. , .

~: - . , ~ .. , ;-, .. .... ,`. . ..

.~ . .
.
. ~ , . -- . - . : :

WO 92/14818 PCI`/US92/008SS
21035~0 er Ile Ser Leu Pro Ile Hil3 Tyr Gly Ser Thr Glu Lyfl Thr Leu Pro A~n Glu LYR Tyr Gly Gly Val A~p Lys Ly~ Phe Lys Tyr Leu Phe Leu Ly9 A9n Ly9 Leu Ly3 A~p Leu Net Arg A~p Ala A~p Phe Val Gln Pro Pro Leu Tyr Ile Ser Thr Tyr Phe Arg Thr Leu Leu A~p Ala Pro Pro hr Asp Asn Tyr Glu Ly~ Tyr Leu Val A~p Ser Ser Val Gln Ser Gln sp Val Leu Gln Gly Leu Leu A~n Thr Cy~ A~n Thr Ile A~p Thr Aun Ala Arg Val Ala Ser Ser Val Ile Gly Tyr Val Tyr Glu Pro Cye Gly Thr Ser Glu HLf3 Lya Ile Gly Ser Glu Ala Leu Cy- Ly~ Met Ala Ly~

Glu Ala Ser Arg Leu Gly Asn Leu Gly Leu Val A~ln Arg Ile Asn Glu er Ann Tyr A~n Lyu Cy~ Asn Ly~ Tyr Gly Tyr Arg Gly Val Tyr Glu ~n A~n Lys Leu Ly~ Thr Ly~ Tyr Tyr Arg Glu Ile Phe A~p Cys A~n Pro A~n Ann Ann Ann Glu Leu Ile Ser Arg Tyr Gly Tyr Arg Ile Met Anp Leu HL~ Ly~ Ile Gly Glu Ile Ph- Ala Asn Tyr A-p Glu Ser Glu Ser Pro Cy~ Glu Arg Arq Cyll HLI~ Tyr Leu Glu A~p Arg Gly Leu Leu yr Gly Pro Glu Tyr Val HL~ HL- Arg Tyr Gln Glu Ser Cy- Thr Pro ~n Thr Ph- Gly A~n A-n Thr A~n Cy~ Val Thr Arg A~n Gly Glu Gln 900 905 9~0 Hi~l Val Tyr Glu A~n Ser Cy~ Gly A-p A-n Ala Thr Cy- Gly Arg Arg Thr Gly Tyr Gly Arg Arg Ser Arg A~p Glu Trp A-n Anp Tyr Arg Ly~

Pro HL- Val Tyr A~p Asn Cy~ Ala A~p Ala A3n Ser Ser Ser Ser A~p er Cy~ Ser Asp Ser Ser Ser Ser Ser Glu Ser Glu Ser A~p Ser A~p 8U8SmUTE 8HEET

. .

.

WO 92tl4818 PCI'/US92/008SS
21~3~

Gly Cys Cys Asp Thr A~p Ala Ser Leu Asp Ser Asp Ile Glu Asn Cy~

Tyr Gln Asn Pro Ser Lys Cys Asp Ala Gly Cy~

(2) INFORMATION FOR SEQ ID NO 7 ~i) SEQUENCE CRARACTERISTICS
(A) LENGTH 163 amLno aclds (B) TYPE amino acid (D) TOPOLOGY linear (ii) MOLECULE TYPE protein (xi) SEQUENCE DESCRIPTION SEQ TD NO 7 Arg Ser Ile Arg Leu A-n Ser H~ 8 Ly~ Asp Leu Pro Gln Glu Tyr Arg Tyr Val A-n Val Hi~ Phe Leu I1Q Ser Tyr Thr A-n A-n Arg Lys Ser Val Asp Lys Glu Ile Leu Asp Ile Ile Lys Asp Lys Gln Gly Lys Ile A~n Val Ile Phe Asp Leu Leu Ly~ Ser Ser Ser Ile Glu Ser Ile Hi8 A~n Thr Tyr Ly- Tyr Ile Glu Pro Ala Glu A-n Glu Ile Ile Phe A-p Thr Ile Arg LYJ Thr Arg Met Lys Glu Met Asn Val Ser A~n Val Ile Il- Ann Ile Lys L-u Tyr Pro Ile S r Tyr Cy- Lys A~p Tyr A-p Arg Ala Thr Il- Leu Lys Gly Leu Leu A-n Lys Asp Thr A-n Ile Val Tyr Ly~ A~p A~n Thr Ala Val Ala Ly~ Leu M t Ile A-p Lys A~p A-n Ile Pro Il- Phe Ile Ile Glu A-n A-p Thr Leu Il- Tyr Ile Ala A~p Asp Tyr Tyr Glu (2) INFORMATION FOR SEQ ID NOs8 (1) SEQ~ENCE CHARACTERISTICS
~A) LENGTH 1511 base pairs ~B) TYPE nucl-lc acid ~C) STRANDEDNESS double ~D~ TOPOLOGY unknown ~il) MOLECULE TYPE DNA ~genomic) ~vi) ORIGINAL SOURCE
~A) ORGANISM Am-acta moorei entemopox~irus 8UB8TITUTE 8HE~

.. . ..
.- . . , .''' . ~ ' ,' ' ' ' ., ., ' ' '' '' ' ' ' ,, ' ~,'. ' ' ' ' ', , ' ~

~ ' ~ . ' ' ~ . .' WO 92/14818 PCI'/US92/008S5 2 ~ ~ 3 ,, ~ ~
~o (ix) FEATURE
(A) NAME/KEY CDS
(B) LOCATION complement (18 218) (lx) FEATURE
(A) NAME/XEY CDS
(B) LOCATION complement (234 782) (ix) FEATURE
(A) NAME/KEY CDS
(B) LOCATION 852 1511 (xi) SEQUENCE DESCRIPTION SEQ ID NO 8 TTATCTATAT TATGAGTTAT AATTACACAT TTTTGATTAG ATAAAA~ATA TCTATTAATT 720 ATTTTTTTTT ATTATTTGAT ATATTTTTTC AA~AAUAAAT TAATCAATGA AAAAAAAATA 840 Met A~p LQU Leu A~n Ser A~p 11e Ile Leu Ile Afln Ile L-u Lys Tyr Tyr A~n Leu Ly- Lyq Ile Ile Ile A~n Arg A-p A~n Val Il- A-n Il- A-n Ile L-u Ly~ Ly~ Leu Val A~n L-u Glu Glu L-u Hia Il- Il- Tyr Tyr Asp Acn A~n Ile Leu A~n A~n Ile Pro Glu A~n Ile Ly~ S-r L-u Tyr Ile Ser A-n Leu A~n Ile Ile A~n Leu A~n Phe Ile 8UB~TITUTE SHEET

WO 92/14818 PCT~US92/008SS
2 ~ 0~ 3 ~J~

Thr Lys Leu Lys Asn Ile Thr Tyr Leu Asp Ile Ser Tyr Asn Lys Asn Ser Asn Ile Ser Asn Ile Ile Leu Pro 8is Ser Ile Glu Phe Leu Asn Cys Glu Ser Cys Asn Ile Asn Asp Tyr Asn Phe Ile Asn A~n Leu Val Asn Leu Lys Lys Leu Ile Ile Ser Lys A~n Lys Phe Gly A~n Phe A~n A~n Val Phe Pro Ile Ser Ile Val Glu Leu Asn Met Glu Ser Ile Gln Ile Ly~ A-p Tyr Lys Phe Ile Glu Lys Leu Ile Asn Leu Lys Ly~ Leu GAT ATA TCT TTC AAT CTT AAA AaA AAT AAT ATA CAT TTG ATA AAA TTT 1418 Asp Ile Ser Phe Asn Val Lys Lys Asn Asn Ile His Leu Ile Ly~ Phe Pro Lys Ser Ile Thr His Leu Cy~ Asp Tyr Gln Ser Tyr Lys Glu Asn Tyr A~n Tyr Leu Ly~ Asn Leu Ser A~n I~le Ile Glu Tyr Glu Phe (2) INFORMATION FOR SEQ ID NO 9 (i) SEQUENCE CHARACTERISTICS
(A) LENGT~ 67 amino acld~
(8) TYPE: amlno acld ~D) TOPOLOGY linear (ii) MOLECULE TYPE: prot-ln ~xl) SEQUENCE DESCRIPTION SEQ ID NO:9 Met Gln A-n A~n A~p Asn Tyr Tyr Ser Asp Ile Glu Gly Ala Lys Ser A~p Ile Ser L-u Val Asp Arg Lys Lys Lys Ile Gly Lys M t Ile Asn A~n Ile Val A~n Ile AJn A~n Glu Leu A~n Lys Gln L-u Scr Aon A~n A~n Ly~ Met Leu Ly~ A~n Leu Leu Asp Ser Leu Lys Lys Tyr Asp Cys Cys Leu 8UBSmUTE 8HEET

.

--.. . .
. . . ~ . .
. : ~ :

WO 92/14818 PCI~/US92/008S~
21~3550 (2) INFORMATION FOR SEQ ID NO 10 ~1) SEQUENOE CHARACTERISTICS
~A) LENG~H 183 amino acids ~B) TYPE amino acid (D) TOPOLWY linear ~il) MOLECULE TYPE protein ~xi) SEQUENCE DESCRIPTION SEQ ID NO 10 M-t S-r 11- 01u L-u Il- Il- 01y Pro M-t rh. 5-r 01y ~y- ~hr ~hr lu Leu Met Arg Ly~ Ile Asn Arg Tyr Ile Leu Ser Asn Gln Lys Cy~

Val Ile Ile Thr His A~n Ile A~p Asn Arg Phe Ile A-n Lys A~n Ile Ile Asn His Asp Gly Asn Ile Leu A~n Ly~ Glu Tyr Leu Tyr Ile Ly~

Thr A~n A-n Leu Ile A~n Glu Ile Asn Ile Val A~p A~n ~yr Asp Ile le Gly Ile A~p Glu Cys Gln Phe Phe Glu Glu A~n Asp Leu Glu Gin he Cys Asp Lys Met Ala Asn Asn Ly~ Ly~ Ly~ Val Ile Val Ala Gly Leu Asn Cys Asp Phe A~n Arg Asn Ile Phe A~n Ser Ile Ser Lys Leu Ile Pro Lys Val Glu Ly~ Ile Lys Ly~ Leu Gln Ala Ile Cy~ Gln Phe Cy~ Tyr Ly- A~p Ala S-r Phe Thr Ile Ly~ Ly- His A~n Lys A~n Gln Ile Il- Glu Ile Gly Gly Gln A~p Leu Tyr Val Pro Val Cy~ Arg Leu y- Tyr A~n Asn Ser Tyr 2) INFORMATION FOR SEQ ID NO ll ~i) SEQUENCE CHARACTERISTICS
(A) LENGTH 220 amino acids ~B) TYPEs amino acid ~D) TOPOLWY l~near ~li) MOLECULE TYPE prote~n ~xl) SEQUENCE DESCRIPTION SEQ ID NO ll et A~p Leu Leu Asn Ser Asp Ile Ile Leu Ile AQn Ile Leu Ly~ Tyr 8U88mUTE 8HEET

, .

WO 92/14818 2 ~ a 3 ~ ~ ~ PCT/US92/008SS

yr A~n Leu Lys Ly~ Ile Ile Ile A~n Arg A~p A~n Val Ile A~n Ile A~n Ile Leu Ly9 Ly9 Leu Val A~n Leu Glu Glu Leu Hi~ Ile Ile Tyr Tyr A-p ADn Asn Ile Leu Acn A~n Ile Pro Glu A~n Ile Ly~ Ser Leu Tyr Ile Ser A~n Leu Aan Ile Ile A~n Leu Asn Phe Ile Thr Ly~ Leu y~ A~n Ile Thr Tyr Leu Asp Ile Ser Tyr Asn Ly- A-n Ser A-n Ile er Asn Ile Ile Leu Pro Hi~ Ser Ile Glu Pbe Leu A~n Cy~ Glu Ser Cy~ Asn Ile A~n A~p Tyr A~n Phe Ile A~n A~n Leu Val A~n Leu Lys Ly~ Leu Ile Ile Ser Ly~ A~n Ly~ Phe Gly A~n Ph- A~n Asn Val Phe Pro Ile Ser Ile Val Glu Leu A~n Met Glu Ser Ile Gln Ile Ly~ Acp 145 150 155 l60 yr LYD Phe Ile Glu LYQ Leu Ile Asn Leu Lys Ly~ Leu A~p Ile Ser he Asn Val Ly- Ly~ A~n A~n Ile Hi~ Leu Ile LYD Phe Pro Lyc Ser le Thr Hi- Leu Cy~ A~p Tyr Gln Ser Tyr LYB Glu A~n Tyr Acn Tyr Leu Ly~ A~n Leu Ser A~n Ile Ile Glu Tyr Glu Phe -2) INFORMATION POR SEQ ID NO 12 ~i~ SEQUENCE CHARACTERISTICS
(A) LENGTH 20 ba-- pair~
~B) TYPE nucl-ic acid ~C) STRANDEDNESS: ~ingle (D) TOPOLWY unknown (ii) ~OLECULE TYPE DNA (genomlc) (xi) SEQUENCE DESCRIPTION: SEQ ID NO 12 2) INFORMATION FOR SEQ ID NO:13 (i) SEQUENCE CHMACTERISTICS
(A) LENGTH 20 ba~e pair~
(B) TYPE nucl-ic acid (C) STRANDEDNESS ~ingle (D) TOPOLOGY unknown 8UB8TtTUTE SHEET

... ., . . ~ . . .

, : ~ :
, . . ~ . . . -WO 92/14818 PCI'/US92/00855 2~ ~5~0 (ii) MOLECULE TYPE: DNA (genomi (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENOE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid ~C~ STRANDEDNESS: ~ingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) ` (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 baHe pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: ingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (qenomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 ba~e pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 ba-e pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: ingle (D) TOPOLOGY: unknown (ii) MOEECULE TYPE: DNA (genomic) 8UBSmUTE SHEET

. .

.- r WO 92t14818 2 ~ ~ 3 ., 3 i~ PCI'/US92/008SS

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

(2J INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 bane pairs (B) TYPE: nucleie aeid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA ~genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

(2) INFORMATION FOR SEQ ID NO:l9: .. -(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 ba~e pair~
(B) TYPE: nueleie aeid (C) STRANDEDNESS: aingle (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:

(2) INFORMATION FOR SEQ ID NO:20:
i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 ba3e pair~
~B) TYPE: nueleie aeid (C) STRANDEDNESS: cingle ~D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomLc) - .
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

(2) INFORMATION FOR SEQ ID NO:21:
(1) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 3012 ba~e pairs (8) TYPE: nuel-ie aeid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomie) . . . ` , . . .

, ~ .

.. ', . .
':, WO 92/14818 PCI~/US92/00855 21 ~3~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

: ,. t , WO 92/14818 PCr/US92/0085S
2 ~ ~ 3 5 ~ ~

CCTATACATT ATGGATCTAC TGAAAAGACT CTACCA~ATG AAaAGTATGG TGGTGTTGAT 2040 GGATATGTTT ATGAACCATG.CGGAACATCA GAACATAAAA TTGGTTCAGA AGCATTGTGT 2340 AAaATGGCTA AAGAAGCATC TAGATTAGGA AATCTAGGTT TAGTAAATCG TATTAATGAA 2400 TCCAGATATG GATATAGAAT AATGGATTTA CATAAaATTG GAGAAATTTT TGCAAATTAC 2580 GACTATAGAA AACCCCACGT TTATGACAAT TGTGCCGATG CAaATAGTTC ATCTTCAGAT 2880 ACAGATGCTA GTTTAGATTC TGATATTGAA AATTGTTATC AaAATccATc AAaATGTGAT 3000 (2~ INFORMATION FOR SEQ ID NO:22:
~i) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 419 ba-- pair~
~8) TYPE: nucl-~c acid ~C) STRANDEDNESS: double (D) TOPOLOGY: unknown ~ii) MOLECULE TYPE: DNA ~gcnomic) ~xi) SEQUENCE DESCRIPTION: SEQ ID No:22:

ATTATAaAAA TAGTATATGA TCCTTGTACT GTCGAAACAT CTAACGATTG TAGATTATTA 180 8UB8mUTE 8HEEl-.. . ..

.

, . . .
.
-, ~

- ' , ` .. ~ ~:

WO 92/14818 PCI'~US92/008S5 .. ~
~035.~ `

~2) INFORMATION FOR SEQ ID NO:23:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 678 baDe pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOEOGY: unknown (ii) MOLECU~E TYPE: DNA (genomic) ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 486 ba~- pair~
(E) TYPE: nucleic acid (C) STRANDEDNESS; doub~e (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

,, , , ,-- . ..
. .. - ~ .

2 ~ ~ 3 ~ ~

(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) L~NGTH: 1395 ba~e pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: un~nown (ii) MOLECULE TYPE: DNA (genomic) (x~) SEQUENCE DESCRIPTION: SEQ ID NO:25:

.... .
.
- - -`; ~ .
. . . . ~ - .

- . : . , WO 92/14818 PCI'/US92/0085S
2~33~

(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 237 base pair~
(B) TYPE: nuclelc acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) txi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

TTCTTCAGTT TTTAAATTAT TAAAATATCC AAGATTATTT T m TTGATG AAGACAT 237 (2) INFORMATION FOR SEQ ID No:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 492 bac- pair~
(B) TYPE: nucleic acld (C) STRANDEDNESS: doubl~
(D) TOPOLOGY: unknown ~li) MOLECULE TYPE: DNA (genomic) ~xi~ SEQUENCE DESCRIPTION: SEQ ID NO:27:

TGTGTCTTTG TTTAATAAAC CTTTTAATAT AGTGGCTCTA TCATAATC~T TACAATATGA 180 TTTATCTTTT ATAATATCTA ATATTTCTTT ATCTACAGaT m CTGTTGT TGGTATATGA 420 .. . . -. . .. .
.
.. . .. . . . ..

. .
' ~

WO 92t14818 2 ~ fj PCI-/US92/008SS

(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHMACTERISTICS:
(A) LENGTH: 549 base pairD
(8) TYPE: nucleic acid ~C) STRANDEDNESS: double (D) TOPOLOGY: unknown ~. -(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
T$AATA$GAA TTATTATAAC ATAATCTACA CACAGGAACA TATAAATCTT GTCCACCTAT 60 TATGCCAATA ATATCATAAT TATCTACGAT ATTGATTTCA TTAATTAaAT TATTTGTTTT 360 (2) INFORMATION POR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 69 ba-e pair-(B) TYPE: nucleic acid ~C) STRANDEDNESS: double (D) TOPOLOGY: unknown (li) MOLECULE TYPE: DNA ~genomic) (xl) SEQUENCE DESCRIPTION: SEQ ID NO:29:

(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 141 ba-e pair~
(B) TYPE: nucl-ic acid (C) STRANDEDNESS: doubl-(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) ..

.. . . . . . .. . .
..

.. . . .
. ~ . . : . : . .::
.
.-. : :

WO 92/14818 PCl~/US92/00855 - 21~5~ 82 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
AaAcATAGGA CCAATTATTA ATTCTATCGA CATTTTTTTT TATTATTTGA TATATTTTTT 60 C~A~AA~A TTAATCAATG AAPU~AA~AT AAaATTATCA AAATGGATTT ACTAAATTCT 120 ~2) INFORMATION FOR SEQ ID NO:31:
(1) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 201 ba~e pair~
(B) TYPE: nucle$c ac~d (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xl) SEQUENCE DESCRIPTION: SEQ ID NO:31:
TTATAAACAA CAATCATATT TTTTTAaAGA ATcTAATAaA TTTTTTAACA TTTTATTATT 60 (2) INFORMATION FOR SEQ ID NO:32:
(l) SEQUENCE cHaRAcTERIsTIcs:
(A) LENGTH: 660 ba-e pair~
(S) TYPE: nucl-lc acid (C) STRANDEDNESS: double ~D) TOPOLOGY: unknown ~li) MOLECULE TYPE: DNA (genom~c) (xl) SEQUENCE DESCRIPTION: SEQ ID No:32:

AaAATAATAA TAAACAGAGA TAATGTTATT AATATTAATA TATTAAAAAA ATTAGTTAAT 120 ATTAaAAGTT TATATATTTC AAATTTAAAT ATTATTAATT TAAATTTTAT AACAAAATTA 240 AaAAATATAA CATATTTAGA TATATCTTAT AACAAAAATA GCAATATAAG TAATATTATA 300 TATAAATTTA TAGAaAAATT AATTAATTTA AAAAaATTAG ATATATCTTT CAATGTTAAA 540 .
.: ,..... ~ ~ . .:

., .- ~ . , ~ : : : . . : .
, WO 92t14818 PCI~/US92/008S5 2l~3~sa ~2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3907 ba~e pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (~enomic) - (x~) SEQUENCE DESCRIPTION: SEQ ID No:33:

TTTAAAAACT TGGGATTGAG ATACTTCTTC AGTTTTTAaA TTATTAAAAT ATCCAAGATT 180 CCGAAAATTA CGAATATATA TTAAGATATA ATGATACATA TTCAAATTTA CAA m GCGA 420 GAAGCGCAAA TATAAATTTT GATGA m AA CTGTTTTTGA TCCCAACGAT AATG m TTA 480 CTTT$GGATT TTTAAGTACA GAAAGTACTG GTATTAATTT AACATATACA AATTCTAGAG 600 ATAATATTAT TATAATATCA ATCATAA m TTATATATAT TTTATCTAaA AGGACTTTTT 780 AAAATTATCA AATCGAAAAT ATGAAATAaA GATTTA m A AAAGATGAAA ATACTTGTTT 900 AATcAaAGTT CACGCCGATA CATTAAAAGA AATGTGTTTT GAATTATTGT TCCCGTGTAA 1080 TAATGACGTA AAATATAAAT TAGCTAATTT TAGACTGACT CTTAATGGAA AACATTTAaA 1200 ATTAAAAGAA ATCGATCAAC CGCTA m AT TTATTTTGTC GATGATTTGG GAAATTATGG 1260 TATTACTATA m CCACAAT ATGCGTATAT TTGTTTAGGT AGAAAAGTAT ATTTAAATGA 1380 8UB~TITUTE ~HEET

.... . .

. - ~ , , -. . , .
.
.

' WO 92/14818 PCI'/US92/008S~
21935~ ~

SURSTITUTE SHEET

; ` ` - ` :

`
.

WO 92/14818 PCI'/US92/008SS
2 ~ 335~

ATCATGTACG CCTAATACGT TTGGAAATAA CACAaATTGT GTAACAAGAA ATGGTGAACA 3540 (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (lx) FEATURE:
(A) NAME~XEY: Region (B) LOCATIONs 3 (D) OTHER INFORMATION: /note= ~Thi~ amino ncid may be either A-n or Arg. n lx ) FEATURE:
~A) NAME/XEY: Region ~B) LOCATION: 12 (D) OTHER INFORMATION: /note~ ~Thi~ amino acid may be either A~n or Arg.~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
Met Ala Xaa A~p Leu Val Ser Leu Leu Phe Met Xaa Xaa Tyr Val Asn Ile Glu Ile A~n Glu Ala Val Xaa Glu (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTN: 17 amino acid3 ~8) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: pept$de . . . ~ . - .
.

.
: . .
-, 21~33~

(ix) FEATURE:
~A) NAME/XEY: Region ~B) LOCATION: 15 ~D) OTHER INFORMATION: /note= "This amino acid may be either Thr or Ile. n (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Met Lys Ile Thr Ser Ser Thr Glu Val Asp Pro Glu Tyr Val Xaa Ser Acn (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCS CHARACTERISTICS:
~A) LENGT~: 8 amino acido ~8) TYPE: amino acLd ~D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
Arn Ala Leu Phe Phe Asn Val Phe (2) INFORMATION FOR SEQ ID NO:37:
~i) SEQUENCE CHA~ACTERISTICS:
~A) LENGTH: 7 amino acids ~8) TYPE: amino acid ~D) TOPOLOGY: unknown --(ii) MOLECULE TYPE: p ptide ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
Glu Val Asp Pro Clu Tyr V~l ~2) INFORMATION FOR SEQ ID NO:38:
~l) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 66 base pairs ~8) TYPE: nucleic acid ~C) STRANDEDNESS: double ~D) TOPOLOGY: unknown ~i) MOLECULE TYPE: DNA ~genomic) ~xl) SEQUENCE DESCRSPTION: SEQ ID NO:38: :.
ATG6CTAGAG ATCTCGTAAG TTTACTA m ATGTGTAACT ATGTTAATAT TGAAATTAAC 60 ~UBSTITUTE SHEET

... . .. . . . . . .. .

, -:
. . . . ~ ' ~ .
,, 21~3~Q

(2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: Sl base pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) M9LECULE TYPE: DNA (genomic) (xl) SEQUENCE DESCRIPTION: SEQ ID NO:39:
ATGAAAATAA CATCTAGTAC AGAAGTAGAC CCCGAGTATG TAACTAGTA~ T S1 (2) INFORMATION FOR SEQ ID No:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 ba~e pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:

~UBSTITUTE SHEET

,... . . . . .

WO 92/14818 PCr/US92/008S5 2t 03~5~

American ~ype CcIlture Collection -1r ~1~D~ ID l~mus~ 7~ 51-T~b~ -015~ rccNollTH F~XI J~l.n~

SUDAPi-:ST TREATY ON TH E INTERNATIONAL RECOGNlTlON OF
THE DEPOS~T OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
INTERN~TlON~iL FOR~.~

,'\ND VIA~ TY STA~E~MENT ISSUi 1;~ rURSUANT TO RULE 10.2 To (Name ana AorJress or ueposllor or Altorney~
Unlversily of Florida Allenlion Richnrd W Moyer Ph D
Dep-rlmonl of Immunology and Medieal Mieroblology Colle6e of Medicine Box J-256 J Hillia Miller Heal(h Center Galneavllle FL 32610-0266 Depoalted on Behalf of Unlversily of Florida Identlfieallon Referenee by Deposilor ATCC Designallon Escherichia coli SURE slrain Slralagene pMEG-tk1 68532 Escherlehia col~ jSlralagene SURE slrain) pRH512 6a533 The depo~lts were aeeompanled by _ a scienlific descripllon X a proposed laxonomic deacriptlon Indicated above The deposlta were received Februarv 26 1991 by Ihis Inlernalional Deposilory Au~horlty and have b-en accepted AT YOUR REOUEST
X We wlll Inform you of r-quesls lor Ihe slrains for 30 years The dr-lna wlll be m-de v-ibble If a pa~enl offlce signalory lo Ihe Budapesl Trealy cerlifles on- a ri~hl lo receive or if a U S Palenl is bsued cilin~ Ihe slrains U the cullures ahould die or be deslroyed during Ihe effeclive lerm ol Ihe deposil il shall be your reaponaiblllly lo replace Ihem wilh living cullures of Ihe same The dralns will be mainlalned lor a period ot al leas~ 30 years aller Ihe date of depoail and tor a period ol al le-al five years aher the mosl recenl request lor a sample The Uniled Slates and many olher eounlriea are sionalory lo tho Budapesl Treaty The vlablllly ol the cullures elled above was lealed March 11 1991 On 1hal date the eullures w ra vl-ble Int-rndlon-l Deposltoly Authorlly Amerlcon Type Cullure Colleclion Rochville Md 20852 USA

SlsLn-ture of person h-vino uthorily to represenl ATCC
~ ~ ~~ D~le March 13 1991 Bobbh A i3r-ndon He-d AjTCC Palenl Deposilory ee Roman Saliwanchlk~
i3ruce Cbry . . .
. . . . . . . .

.
-. " ' .

, . . . . .
. ::

Claims (36)

1. An Entomopoxvirus spheroidin gene polynucleotide sequence free from association with other viral nucleotide sequences with which it is associated in nature.

2. The sequence according to claim 1 selected from the group consisting of one or more of a spheroidin gene coding sequence, a spheroidin gene regulatory sequence, a spheroidin gene promoter sequence, an allelic variant or fragment thereof.

3. The sequence according to claim 1 wherein said polynucleotide sequence is a DNA sequence.

4. The sequence according to claim 1 wherein said sequence is derived from the Amsacta moorei Entomopoxvirus.

5. The sequence according to claim 4 selected from the group consisting of the sequence SEQ ID NO:1 spanning nucleotide #1 through #6768 of Fig. 2, the sequence spanning nucleotide SEQ ID N0:21 #3080 through #6091 of Fig. 2, an allelic variant, analog or fragment thereof.

6. The sequence according to claim 2 characterized by the ability to direct the expression of a heterologous gene to which said sequence or fragment is operably linked in a selected host cell.

7. A polynucleotide sequence comprising a first polynucleotide sequence comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant or a fragment thereof associated with a second polynucleotide sequence encoding a heterologous gene.

8. An Entomopoxvirus thymidine kinase gene polynucleotide sequence free from association with other viral nucleotide sequences with which it is associated in nature.

9. The sequence according to claim 1 selected from the group consisting of one or more of a thymidine kinase gene coding sequence, a thymidine kinase gene regulatory sequence, a thymidine kinase gene promoter sequence, an allelic variant or fragment thereof.

10. The sequence according to claim 8 wherein said polynucleotide sequence is a DNA sequence.

11. The sequence according to claim 8 wherein said sequence is derived from the Amsacta moorei Entomopoxvirus.

12. The sequence according to claim 11 selected from the group consisting of the sequence SEQ ID
NO:8 spanning nucleotide #1 through #1511 of Fig. 3, SEQ
ID NO:28 nucleotide #234 through #782 of Fig. 3, SEQ ID
NO:29 nucleotide #783 through #851 of Fig. 3, an allelic variant, a or a fragment thereof.

13. The sequence according to claim 9 characterized by the ability to direct the expression of a heterologous gene to which said sequence or fragment is operably linked in a selected host cell.

14. A polynucleotide sequence comprising a first polynucleotide sequence comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant or a fragment thereof associated with a second polynucleotide sequence encoding a heterologous gene.

15. An Entomopoxvirus spheroidin polypeptide, a fragment thereof, or an analog thereof.

16. The polypeptide according to claim 15 fused to a heterologous protein or peptide.

17. An Entomopoxvirus thymidine kinase polypeptide, a fragment thereof, or an analog thereof.

18. The polypeptide according to claim 17, fused to a heterologous protein or peptide.

19. A recombinant polynucleotide molecule comprising a polynucleotide sequence encoding the Entomopoxvirus spheroidin promoter sequence, an allelic variant or a fragment thereof, wherein said promoter sequence is operably linked to a selected heterologous gene sequence, said promoter sequence being capable of directing the replication and expression of said gene in a selected host cell or virus.

20. A recombinant polynucleotide molecule comprising a polynucleotide sequence encoding the Entomopoxvirus thymidine kinase promoter sequence, an allelic variant, or a fragment thereof, wherein said promoter sequence is operably linked to a selected heterologous gene sequence, said promoter sequence being capable of directing the replication and expression of said gene in a selected host cell.

21. A recombinant molecule comprising a polynucleotide sequence encoding the Entomopoxvirus spheroidin gene, an allelic variant, or a fragment thereof, linked in frame to a polynucleotide sequence encoding a selected heterologous gene sequence.

22. A recombinant molecule comprising a polynucleotide sequence encoding the Entomopoxvirus thymidine kinase gene, an allelic variant, or a fragment thereof, linked in frame to a polynucleotide sequence encoding a selected heterologous gene sequence.

23. A recombinant molecule comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, into which a selected heterologous gene sequence has been inserted.

24. A recombinant molecule comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant, or a fragment thereof, into which a selected heterologous gene sequence has been inserted.

25. A recombinant virus comprising a polynucleotide sequence comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant or a fragment thereof, optionally linked to a selected heterologous gene sequence.

26. The virus according to claim 25, which is a poxvirus selected from the group consisting of a vertebrate poxvirus, orthopoxvirus, suipoxvirus, vaccinia virus and entomopoxvirus.

27. A recombinant virus comprising a polynucleotide sequence comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant or a fragment thereof, optionally linked to a selected heterologous gene sequence.

28. The virus according to claim 27, which is a poxvirus selected from the group consisting of a vertebrate poxvirus, orthopoxvirus, suipoxvirus, vaccinia virus and entomopoxvirus.

29. A cell infected with a recombinant virus comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, optionally linked to a selected heterologous gene sequence.

30. The cell according to claim 29 selected from the group consisting of insect cells and mammalian cells.

31. A cell infected with a recombinant virus comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant, or a fragment thereof, optionally linked to a selected heterologous gene sequence.

32. The cell according to claim 31 selected from the group consisting of insect cells and mammalian cells.

33. A method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus comprising an Entomopoxvirus thymidine kinase gene polynucleotide sequence, an allelic variant, or a fragment thereof, operably linked to a heterologous gene sequence encoding said selected polypeptide, and recovering said polypeptide from the culture medium.

34. A method for producing a selected polypeptide comprising culturing a selected host cell infected with a recombinant virus comprising an Entomopoxvirus spheroidin gene polynucleotide sequence, an allelic variant, or a fragment thereof, operably linked to a selected heterologous gene sequence encoding said selected polypeptide, and recovering said polypeptide from the culture medium.

35. A method for screening recombinant host cells for insertion of heterologous genes comprising transforming said cells with a polynucleotide molecule comprising the selected heterologous gene sequence inserted into the polynucleotide sequence encoding entomopox spheroidin, wherein the absence of occlusion bodies normally formed by the expression of the spheroidin protein indicates the integration of the heterologous gene.

36. A method for screening recombinant host cells for insertion of heterologous genes comprising infecting said cells with a polynucleotide molecule comprising the selected heterologous gene sequence inserted into the polynucleotide sequence encoding entomopox thymidine kinase, wherein the presence of thymidine kinase function formed by the integration of the inactive thymidine kinase sequence indicates the insertion of the heterologous gene.