WO2020204427A1 - 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법 - Google Patents
신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법 Download PDFInfo
- Publication number
- WO2020204427A1 WO2020204427A1 PCT/KR2020/003855 KR2020003855W WO2020204427A1 WO 2020204427 A1 WO2020204427 A1 WO 2020204427A1 KR 2020003855 W KR2020003855 W KR 2020003855W WO 2020204427 A1 WO2020204427 A1 WO 2020204427A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- wex
- tryptophan
- amino acid
- seq
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
- C12P13/227—Tryptophan
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/15—Corynebacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
Definitions
- the present application relates to a variant of a novel protein having tryptophan-releasing activity, a microorganism expressing the protein variant, and a microorganism producing L-tryptophan, and a method of producing L-tryptophan using the microorganism.
- Tryptophan is one of the essential amino acids and has been widely used as a raw material for pharmaceuticals and health foods such as feed additives or infusions.
- direct fermentation using microorganisms is mainly used for L-tryptophan production.
- Microorganisms used for the production of L-tryptophan were initially mainly selected strains that showed resistance to analogs through chemical or physical mutations, but in the 1990s, as genetic recombination technology was rapidly developed and regulatory mechanisms at the molecular level were identified, genetic manipulation techniques Recombinant strains using is mainly used.
- the expression of a specific amino acid excreting gene has caused the productivity of the corresponding amino acid to be improved in microorganisms.
- Enhancement of the expression of the L-lysine excreting gene (lysE) in microorganisms of the genus Corynebacterium improved the productivity of lysine (WO 9723597A2).
- enhancement of the rhtC gene in Escherichia coli improved resistance to L-threonine and at the same time improved the productivity of L-homoserine, L-threonine, and L-leucine (EP1013765A1).
- One object of the present application is to investigate the L-tryptophan excretion activity in which any one or more amino acids of the amino acids corresponding to 79 to 83 in the amino acid sequence of SEQ ID NO: 1 are substituted with hydrophobic or aliphatic amino acids. It is to provide a protein variant having.
- Another object of the present application is a polynucleotide encoding the variant; And it is to provide a vector containing the same.
- One object of the present application is to provide a microorganism that expresses the protein variant and produces L-tryptophan.
- Another object of the present application is to provide a method for producing L-tryptophan comprising culturing the microorganism in a medium.
- Another object of the present application is to provide a use of the protein variant to increase L-tryptophan production.
- Figure 1 is a check of the intracellular tryptophan concentration of the coryneglutamicum bacterium mutant strains CA04-8352 and CA04-8405 according to the amount of sugar consumption.
- One aspect of the present application provides a protein variant having L-tryptophan excretion ability, including one or more mutations in the amino acid sequence of SEQ ID NO: 1.
- the mutation may include substitution of any one or more amino acids selected from the 79 th to 83 th amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 1 with another amino acid.
- the protein variant may be a protein variant having L-tryptophan excretion activity in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. Specifically, it may be a protein variant having L-tryptophan excreting activity in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with a hydrophobic amino acid or an aliphatic amino acid.
- L-tryptophan refers to an aromatic L-amino acid having a chemical formula of C 11 H 12 N 2 O 2 and is an essential amino acid that is not synthesized in the body as one of ⁇ -amino acids.
- protein having L-tryptophan excretion ability and “protein having L-tryptophan excretion activity” refer to membrane proteins having an activity capable of specifically excreting L-tryptophan out of cells.
- the protein having L-tryptophan excreting activity may be a protein having L-tryptophan excreting activity derived from Herbaspirillum rhizosphaerae .
- the protein having L-tryptophan excretion activity derived from Herbaspirillum rhizosphaerae may be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1.
- the protein comprising the amino acid sequence of SEQ ID NO: 1 may be used interchangeably with a protein having the amino acid sequence of SEQ ID NO: 1 and a protein consisting of the amino acid sequence of SEQ ID NO: 1.
- Herbaspirillum rhizosphaerae is a Gram-negative bacterium belonging to the genus Herbaspirillum , a strain isolated from Ulleungdo in Korea, and can be isolated from the rhizosphere in soil.
- the protein having L-tryptophan excretion activity in the present application is defined as a protein containing the amino acid of SEQ ID NO: 1, insignificant sequence addition before and after the amino acid sequence of SEQ ID NO: 1 or a mutation that may occur naturally, or its It is obvious to those skilled in the art that if it does not exclude silent mutations, and has the same or corresponding activity as a protein containing the amino acid sequence of SEQ ID NO: 1, it corresponds to a protein having L-tryptophan excretion activity of the present application. Do.
- the protein having L-tryptophan excretion activity herein is a protein consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 90%, 95%, or 97% homology or identity thereto. I can.
- a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the range of the protein subject to mutation of the present application. Is self-explanatory.
- the amino acid at a specific position among the proteins having the L-tryptophan protein excretion ability described above is substituted, so that the L-tryptophan excretion ability exceeds 100% compared to the pre-mutation protein. It can mean a variant that becomes.
- variants are different from the recited sequence in which one or more amino acids are conservative substitution and/or modification, but the function of the protein ( functions) or properties are maintained. Variants differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids of the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
- variants may include variants with a portion removed from the N- and/or C-terminus of a mature protein.
- variant may include terms such as variant, modified, mutated protein, variant polypeptide, mutant, etc. (modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc. in English) may be used. , If it is a term used in a mutated meaning, it is not limited thereto.
- the mutant may be one having an increased activity of a mutated protein compared to a natural wild-type or unmodified protein, but is not limited thereto.
- the term "conservative substitution” means replacing one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions can generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids having an electrically charged amino acid, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartic acid.
- nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, and polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine, glutamine, and aromatic amino acids include phenylalanine, tryptophan and tyrosine.
- variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
- the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein co-translationally or post-translationally.
- the polypeptide may be conjugated with other sequences or linkers to identify, purify, or synthesize the polypeptide.
- The'substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before substitution. That is, leucine, which is the 79th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, is an amino acid residue other than leucine, or serine, which is the 80th amino acid, is an amino acid residue other than serine, or leucine, which is the 81st amino acid, is leucine. It is not limited as long as the amino acid residue other than the amino acid residue, or the 82nd amino acid serine is substituted with an amino acid residue other than serine, or the 83rd amino acid isoleucine is substituted with an amino acid residue other than isoleucine. On the other hand, in the present application, when expressing'a specific amino acid has been substituted', it is obvious that it is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
- the protein variant may be one in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than the amino acid before substitution, other than the acidic amino acid and the basic amino acid.
- the protein variant may be a variant having an uncharged amino acid, substituted with an amino acid different from the amino acid before substitution, but is not limited thereto.
- the protein variant may be a variant in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid different from the amino acid before substitution among a hydrophobic amino acid or an aliphatic amino acid.
- the protein variant may be a variant in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with one of a hydrophobic (nonpolar) amino acid or an aliphatic amino acid.
- the aliphatic amino acid may be, for example, an amino acid selected from the group consisting of glycine, alanine, valine, leucine, and isoleucine, but is not limited thereto.
- the hydrophobic (non-polar) amino acid may be, for example, an amino acid selected from the group consisting of glycine, methionine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, and tryptophan, but is not limited thereto.
- the protein variant may be a variant in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid different from the amino acid before substitution among amino acids having a small size, but is not limited thereto. Does not.
- small amino acid includes glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, proline, and asparagine, which are relatively small amino acids among 20 amino acids.
- Glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine and proline may mean, but are not limited thereto, and more specifically, glycine, alanine, valine, leucine, isoleucine, serine, and threonine. However, it is not limited thereto.
- the protein variant may be a variant in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of alanine, valine, leucine, and isoleucine, but is not limited thereto. Does not.
- the substitution of another amino acid in the protein variant may include alanine, valine, or isoleucine from leucine, which is the 79th amino acid in the amino acid sequence of SEQ ID NO: 1; Serine, the 80th amino acid, is alanine, valine, leucine, or isoleucine; 81st amino acid leucine to alanine, valine, or isoleucine; 82nd amino acid serine is alanine, valine, leucine, or isoleucine;
- the 83rd amino acid isoleucine may be one or more substitutions selected from substitution with alanine, valine, or leucine, but is not limited thereto.
- the protein variant of the present application as described above has an enhanced L-tryptophan excretion ability compared to the pre-mutation protein.
- amino acids 79 to 83 from the N-terminus of SEQ ID NO: 1 of the present application is substituted with another amino acid, the amino acid at the position corresponding to the 79 to 83 is substituted with another amino acid It is obvious to include the modified protein variants.
- amino acids 79 to 83 of SEQ ID NO: 1 refers to any sequence, for example, 50%, 60%, 70%, 80% of SEQ ID NO: 1, Or, in a sequence having 90% or more identity, it is apparent that this can also be applied to "an amino acid at a position corresponding to amino acids 79 to 83 of SEQ ID NO: 1".
- the amino acid at the position corresponding to 79 to 83 is substituted with another amino acid
- a protein variant having 70%, 80%, 90%, or 95% or more identity with SEQ ID NO: 1 May be, but is not limited thereto.
- the protein variant in which any one or more of amino acids 79 to 83 is substituted with another amino acid may include an amino acid sequence of any one of SEQ ID NOs: 131 to 147, and specifically, the sequence It may consist essentially of the amino acid sequence of any one of numbers 131 to 147, and more specifically, may consist of the amino acid sequence of any one of SEQ ID NOs: 131 to 147, but is not limited thereto.
- the protein variant has at least one amino acid selected from amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 131 to 147 or the amino acid sequence of SEQ ID NO: 1 is fixed, and 80% or more homology or identity thereto. It may include an amino acid sequence, but is not limited thereto.
- the variant polypeptide of the present application is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99 amino acid sequence of any one of SEQ ID NOs: 131 to 147 and SEQ ID NOs: 131 to 147 Polypeptides with% homology or identity may be included.
- proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added are also the scope of the present application. It is obvious to be included within.
- the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage.
- the terms homology and identity can often be used interchangeably.
- sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and a default gap penalty established by the program used can be used together.
- Substantially, homologous or identical sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
- the homology, similarity or identity of a polynucleotide or polypeptide can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program.
- the GAP program defines the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
- the default parameters for the GAP program are (1) binary comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
- the term "to be expressed /" refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in a microorganism.
- the target protein is a protein present in a microorganism, it means a state in which its activity is enhanced compared to intrinsic or before modification.
- the "target protein” may be a variant of the protein having the aforementioned L-tryptophan excretion ability.
- introduction of a protein means that the microorganism exhibits an activity of a specific protein that the microorganism did not originally have, or exhibits an improved activity compared to the intrinsic activity of the protein or the activity before modification.
- a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into a microorganism to exhibit its activity.
- enhancing the activity means that the activity is improved compared to the intrinsic activity of a specific protein possessed by the microorganism or the activity before modification.
- “Intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain before the change in the trait of a microorganism when the trait of a microorganism changes due to genetic variation caused by natural or artificial factors.
- the enhancement of the activity of the present application is an increase in the intracellular copy number of the gene encoding the protein variant, a method of introducing a mutation into the expression control sequence of the gene encoding the protein variant, the protein having L-tryptophan excretion activity
- a method of replacing a gene expression control sequence encoding a variant with a sequence having strong activity a method of replacing a gene encoding a natural protein having L-tryptophan excretion activity on a chromosome with a gene encoding the protein variant, the protein variant
- a mutation may be additionally introduced into a gene encoding a protein, and a protein variant may be introduced into a microorganism. Not limited.
- the increase in the copy number of the gene is not particularly limited thereto, but may be performed in a form operably linked to a vector, or may be performed by being inserted into a chromosome in a host cell.
- a vector capable of replicating and functioning irrespective of the host, in which the polynucleotide encoding the protein of the present application is operably linked may be introduced into a host cell.
- a vector capable of inserting the polynucleotide into a chromosome in a host cell to which the polynucleotide is operably linked may be introduced into a chromosome of a host cell. Insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, by homologous recombination.
- modifying the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence, or It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity.
- the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling termination of transcription and translation, and the like.
- a strong promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter, but is not limited thereto.
- Examples of known strong promoters include cj1 to cj7 promoters (Korean Patent Registration No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, P L promoter, tet promoter, gapA promoter, SPL7 Promoter, SPL13 (sm3) promoter (Korean Patent No. 10-1783170), O2 promoter (Korean Patent No. 10-1632642), tkt promoter and yccA promoter, but are not limited thereto.
- modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence It may be performed by inducing or by replacing with a polynucleotide sequence modified to have stronger activity.
- the introduction and enhancement of such protein activity is generally at least 1%, 10%, 25%, 50%, based on the activity or concentration of the protein in the wild-type or unmodified microbial strain. It may be increased to 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, but is not limited thereto.
- Another aspect of the present application provides a polynucleotide encoding the protein variant.
- polynucleotide is a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a certain length or more, and more specifically, coding for the protein variant. It means a polynucleotide fragment.
- polynucleotide encoding the protein variant of the present application may be included without limitation as long as it is a polynucleotide sequence encoding a protein variant having L-tryptophan excretion capability.
- the gene encoding the amino acid sequence of the protein having L-tryptophan excretion ability may be the wex gene, may be derived from Herbaspirium rizospere, specifically encoding the amino acid sequence of SEQ ID NO: 1. It may be a nucleotide sequence, and more specifically, may be a sequence including the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
- the polynucleotide encoding the protein variant of the present application is a coding region within a range that does not change the amino acid sequence of the polypeptide due to the degeneracy of the codon or in consideration of the preferred codon in the organism to express the polypeptide.
- Various variations can be made. Specifically, any polynucleotide sequence encoding a protein variant in which one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may be included without limitation.
- the polynucleotide of the present application is a protein variant of the present application, specifically, a polynucleotide sequence encoding a protein comprising the amino acid sequence of any one of SEQ ID NOs: 131 to 147 or a polypeptide having homology or identity thereto. May be, but is not limited thereto, and more specifically described in SEQ ID NOs: 80, 81, 82, 89, 90, 91, 92, 101, 102, 103, 110, 111, 112, 113, 122, 123 and 124 It may include, but is not limited to, any one of the polynucleotide sequences.
- the homology or identity is as described above.
- a probe that can be prepared from a known gene sequence hybridizes under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence to any of amino acids 79 to 83 of the amino acid sequence of SEQ ID NO: 1
- Any sequence encoding a protein variant in which one or more amino acids are substituted with other amino acids may be included without limitation.
- stringent conditions refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, among genes with high homology, genes having a homology of 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, and particularly 99% or more Under conditions that hybridize to each other, and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1X SSC, 0.1% SDS, specifically 60°C, 0.1X SSC, 0.1% SDS, more specifically 68 DEG C, 0.1X SSC, at a salt concentration and temperature corresponding to 0.1% SDS, one time, specifically two to three times washing conditions can be enumerated. However, it is not limited thereto, and may be appropriately adjusted by a person skilled in the art according to the purpose.
- Hybridization requires that two polynucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization.
- the term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
- the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
- polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
- the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
- the appropriate stringency to hybridize a polynucleotide depends on the length of the polynucleotide and the degree of complementarity, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
- Another aspect of the present application provides a vector comprising a polynucleotide encoding the protein variant.
- vector refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable regulatory sequence so that the protein of interest can be expressed in a suitable host.
- the regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation.
- Vectors can be transformed into a suitable host cell and then replicated or function independently of the host genome, and can be integrated into the genome itself.
- the vector used in the present application is not particularly limited, and any vector known in the art may be used.
- Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
- pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
- pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
- a polynucleotide encoding a target protein in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
- a selection marker for confirming whether the chromosome is inserted may be additionally included. Selectable markers are used to select cells transformed with a vector, that is, to confirm the insertion of a nucleic acid molecule of interest, and give a selectable phenotype such as drug resistance, nutrient demand, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
- Another object of the present application is to provide a microorganism that produces L-tryptophan, which expresses the protein variant having the L-tryptophan release activity.
- a microorganism producing L-tryptophan refers to a microorganism capable of producing an excess of L-tryptophan from a carbon source in a medium compared to a wild-type or unmodified microorganism.
- the microorganism producing the L-tryptophan may be a recombinant microorganism.
- L-tryptophan its type is not particularly limited, but Enterbacter, Escherichia, Erwinia, Serratia, and Providencia ( Providencia), Corynebacterium (Corynebacterium) and Brevibacterium (Brevibacterium) may be a microorganism belonging to the genus. More specifically, it may be a microorganism belonging to the genus Corynebacterium or the genus Escherichia.
- the microorganism of the genus Escherichia may be Escherichia coli
- the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum
- L- Microorganisms belonging to the genus Escherichia or the genus Corynebacterium, which can increase the amount of L-tryptophan production by introducing or enhancing a protein having tryptophan-releasing activity may be included without limitation.
- the expression of the tktA gene is enhanced for continuous supply of precursors such as E4P (erythorse-4-phosphate) and efficient use of energy, or by blocking the side branch pathway in the biosynthetic pathway.
- precursors such as E4P (erythorse-4-phosphate)
- efficient use of energy or by blocking the side branch pathway in the biosynthetic pathway.
- a method of increasing biosynthesis or a method of using less ATP can be used.
- the parent strain of the microorganism producing the protein having L-tryptophan-releasing activity or the L-tryptophan-producing protein variant expressing/modified to express the protein variant is a microorganism producing L-tryptophan. It doesn't work.
- the L-tryptophan-producing microorganism is a competition pathway gene, a regulator of the directional pathway of the L-tryptophan operon, the L-tryptophan influx gene, the L-tryptophan influx and degradation genes.
- the activity of the regulatory gene (trpR) of the tryptophan synthase group that inhibits the expression of ( trpEDCBA ) of L-tryptophan biosynthetic genes, or the Mtr membrane protein that introduces L-tryptophan from outside the cell into the cell is weakened compared to the intrinsic activity. Or can be removed.
- Another aspect of the present application for achieving the above object relates to a method for producing tryptophan, which includes culturing a microorganism that produces L-tryptophan, which expresses the protein variant, in a medium.
- the L-tryptophan, a protein having L-tryptophan-releasing activity including the amino acid sequence of SEQ ID NO: 1, expression of the protein, and microorganisms are as described above.
- the term "culture” refers to growing the microorganism under appropriately controlled environmental conditions.
- the cultivation process of the present application may be performed according to a suitable medium and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
- the culture may be a batch type, continuous type, and fed-batch type, but is not limited thereto.
- the term "medium” refers to a material obtained by mixing nutrients required for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water, which is essential for survival and development.
- any medium and other culture conditions used for cultivation of microorganisms of the present application may be used without particular limitation as long as it is a medium used for cultivation of ordinary microorganisms.
- the microorganisms of the present application are suitable In a conventional medium containing compounds, amino acids and/or vitamins, etc., it can be cultured while controlling temperature, pH, etc. under aerobic conditions.
- the carbon source includes carbohydrates such as glucose, fructose, sucrose, and maltose; Sugar alcohols such as mannitol and sorbitol, organic acids such as pyruvic acid, lactic acid and citric acid; Amino acids such as glutamic acid, methionine, and lysine may be included.
- natural organic nutrients such as starch hydrolyzate, molasses, black strap molasses, rice winter, cassava, sugarcane residue and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e., converted to reducing sugar)
- Carbohydrates such as molasses
- other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
- nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, skim soybean cake or its degradation products, etc. Can be used. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
- inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
- Amino acids such as glutamic acid, methionine, glutamine, etc.
- organic nitrogen sources such as peptone, NZ-amine,
- the personnel may include first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
- the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used, and amino acids, vitamins, and/or suitable precursors may be included. These constituents or precursors may be added to the medium batchwise or continuously. However, it is not limited thereto.
- the pH of the medium may be adjusted.
- an antifoaming agent such as fatty acid polyglycol ester can be used to suppress the generation of air bubbles.
- oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of gas to maintain the anaerobic and microaerobic state. It is not.
- the temperature of the medium may be 20°C to 50°C, specifically 30°C to 37°C, but is not limited thereto.
- the cultivation period may be continued until the desired production amount of the useful substance is obtained, and specifically, may be 10 to 100 hours, but is not limited thereto.
- the production method may include recovering L-tryptophan from the culture medium or the microorganism.
- Recovering the tryptophan may be performed using a suitable method known in the art according to the method of culturing the microorganism of the present application, for example, a batch, continuous, or fed-batch culture method, to recover the desired L-tryptophan from the medium.
- a suitable method known in the art for example, centrifugation, filtration, treatment with a crystallized protein precipitant (salt-in method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography
- Various chromatography such as, HPLC, and methods thereof may be used in combination, but are not limited to these examples.
- the production method may include a purification process.
- the purification process can purify the recovered L-tryptophan using a suitable method known in the art.
- Another aspect of the present application is to modify the microorganism to express a protein variant having L-tryptophan excreting activity in which any one or more of amino acids 79 to 83 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. It provides a method for increasing L-tryptophan excretion capacity, including.
- Another aspect of the present application provides a use of the protein variant to increase L-tryptophan excretion ability.
- Another aspect of the present application provides the use of the protein variant to increase L-tryptophan production.
- the protein variant of the present application can increase the ability of microorganisms to excrete L-tryptophan, and thus can be used for increasing L-tryptophan production.
- the protein variant and other amino acids are as described above.
- the amino acid sequence of YdeD is used as the query sequence, and as a result of PSI-BLAST search based on the NCBI and Kegg database, 30 candidate genes considered as membrane proteins capable of releasing tryptophan and organisms having them are selected. I did. Among them, five organisms were selected as shown in Table 1 below in consideration of the biosafety level applicable to the production strain and the possibility of securing them.
- Example 2 Herbaspirium rezospere ( Herbaspirillum rhizosphaerae ) Production of microorganisms in Corynebacterium into which the derived gene was introduced
- the gene encoding the membrane protein derived from Herbaspirium rizospere selected in Example 1 has an amino acid sequence represented by SEQ ID NO: 1.
- Information on the gene encoding the membrane protein and the surrounding nucleotide sequence was obtained from the National Institutes of Health GenBank.
- a primer for inserting a gene derived from Herbaspirium rizospere into the Corynebacterium glutamicum genomic DNA was synthesized.
- PCR was performed using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 using the chromosomal DNA of the Herbaspirium rizospere strain as a template.
- SolgTM Pfu-X DNA polymerase was used, and PCR amplification conditions were subjected to denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization for 1 minute at 72°C. Polymerization was carried out at 72° C. for 5 minutes.
- PCR was performed using the primers of SEQ ID NO: 5 and SEQ ID NO: 6 using the Corynebacterium glutamicum genomic DNA as a template.
- SolgTM Pfu-X DNA polymerase SolGent co.
- PCR amplification conditions were denatured at 95°C for 2 minutes, then denatured at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 30 seconds. After repeating twice, polymerization was performed at 72° C. for 5 minutes.
- the amplified gapA promoter region, a gene fragment derived from Herbaspirium rizospere, and the vector pDZTn for chromosome transformation cut with ScaI restriction enzyme was used to obtain a recombinant plasmid by cloning, and was named pDZTn-PgapA-Hrh. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- a strain was obtained in which 1 copy of the PgapA-Hrh gene was inserted between the transposon genes on the chromosome.
- the genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the strain thus obtained was named Corynebacterium glutamicum ATCC13869::PgapA-Hrh.
- Example 3 Sudomonas Stupjeri ( Pseudomonas stutzeri ) Production of microorganisms in Corynebacterium into which the derived gene was introduced
- the gene encoding the membrane protein derived from Sudomonas sturgery selected in Example 1 has an amino acid sequence represented by SEQ ID NO: 9. Information about the gene and surrounding nucleotide sequences (registration number NC_018177.1) was obtained from the National Institutes of Health GenBank.
- a primer for inserting a gene derived from Sudomonas stag Jeri into Corynebacterium glutamicum genomic DNA was synthesized.
- PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Sudomonas stag Jeri strain as a template and using the primers of SEQ ID NO: 11 and SEQ ID NO: 12.
- the amplified gapA promoter region, a gene fragment derived from Sudomonas stag Jeri, and the vector pDZTn for chromosome transformation digested with ScaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid and named pDZTn-PgapA-Pst. . Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZTn-PgapA-Pst vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, followed by a second crossover process, and then one copy of the PgapA-Pst gene was inserted between the transposon genes on the chromosome.
- the strain was obtained.
- the genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the strain thus obtained was named Corynebacterium glutamicum ATCC13869::PgapA-Pst.
- Example 4 Alkaline Jinse Pecalis ( Alcaligenes faecalis ) Production of microorganisms in Corynebacterium into which the derived gene was introduced
- the gene encoding the membrane protein derived from Alkaligins pecalis selected in Example 1 has an amino acid sequence represented by SEQ ID NO: 14. Information on the gene and surrounding nucleotide sequences (registration number NZ_CP013119.1) was obtained from the National Institutes of Health GenBank.
- a primer for inserting a gene derived from Alkaligenes pecalis into the Corynebacterium glutamicum genomic DNA was synthesized.
- PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Alkaligenes pecalis strain as a template and using the primers of SEQ ID NO: 16 and SEQ ID NO: 17.
- PCR was performed in the same manner as in Example 2 using the primers of SEQ ID NO: 5 and SEQ ID NO: 18 using the Corynebacterium glutamicum genomic DNA as a template. Performed.
- the amplified gapA promoter region, a gene fragment derived from Alkaline Jins pecalis, and the vector pDZTn for chromosome transformation digested with ScaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, and named pDZTn-PgapA-Afa. . Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZTn-PgapA-Afa vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then one copy of the PgapA-Afa gene was inserted between the transposon genes on the chromosome through a second crossover process. Strain was obtained. The genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the strain thus obtained was named Corynebacterium glutamicum ATCC13869::PgapA-Afa.
- Example 5 Cupriabidus Necator ( Cupriavidus necator ) Production of microorganisms in Corynebacterium into which the derived gene was introduced
- the gene encoding the membrane protein derived from Cupriabidus necator selected in Example 1 has an amino acid sequence represented by SEQ ID NO: 19.
- Information on the gene and surrounding nucleotide sequences was obtained from the National Institutes of Health GenBank.
- a primer for inserting a gene derived from Cupriabidus necator into Corynebacterium glutamicum genomic DNA was synthesized.
- PCR was performed in the same manner as in Example 2 using primers of SEQ ID NO: 21 and SEQ ID NO: 22 using the chromosomal DNA of the Cupriabidus necator strain as a template.
- PCR was performed in the same manner as in Example 2 using the primers of SEQ ID NO: 5 and SEQ ID NO: 23 using the Corynebacterium glutamicum genomic DNA as a template. Performed.
- Recombinant plasmid was obtained by cloning the amplified gapA promoter region, the gene fragment derived from Cupriabidus nekator, and the vector for chromosome transformation cut with ScaI restriction enzyme, pDZTn, using the Gibson assembly method, and named pDZTn-PgapA-Cne. I did. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZTn-PgapA-Cne vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then one copy of the PgapA-Cne gene was inserted between the transposon genes on the chromosome through a second crossover process. Strain was obtained. The genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the strain thus obtained was named Corynebacterium glutamicum ATCC13869::PgapA-Cne.
- Example 6 Escherichia coli ( Escherichia coli str. K-12 substr.MG1655 ) Production of microorganisms in Corynebacterium into which the derived gene was introduced
- the gene encoding the membrane protein derived from E. coli selected in Example 1 has an amino acid sequence shown in SEQ ID NO: 24.
- Information on the gene and surrounding nucleotide sequences was obtained from the National Institutes of Health GenBank.
- a primer for inserting the E. coli-derived gene into the Corynebacterium glutamicum genomic DNA was synthesized.
- PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the E. coli strain as a template and primers of SEQ ID NO: 26 and SEQ ID NO: 27.
- PCR was performed in the same manner as in Example 2 using the primers of SEQ ID NO: 5 and SEQ ID NO: 28 using the Corynebacterium glutamicum genomic DNA as a template. Performed.
- the amplified gapA promoter region, E. coli-derived gene fragment, and the vector pDZTn for chromosomal transformation digested with ScaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, and named pDZTn-PgapA-Eco. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZTn-PgapA-Eco vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then one copy of the PgapA-Eco gene was inserted between the transposon genes on the chromosome through a second crossover process. Strain was obtained. The genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the strain thus obtained was named Corynebacterium glutamicum ATCC13869::PgapA-Eco.
- Example 7 MIC measurement of microorganism strains in Corynebacterium genus into which genes derived from various microorganisms were introduced
- ATCC13869::PgapA-Hrh Five types of Corynebacterium glutamicum strains ATCC13869::PgapA-Hrh, ATCC13869::PgapA-Pst, ATCC13869::PgapA-Afa, ATCC13869::PgapA-Cne, ATCC13869 prepared in Examples 2 to 6: : A minimum inhibitory concentration (MIC) experiment was performed using a tryptophan analog and an analog of phenylalanine, another aromatic amino acid, to confirm whether PgapA-Eco retained the tryptophan excreting activity.
- MIC minimum inhibitory concentration
- the introduction of the selected five genes allowed growth in all conditions in which the phenylalanine analog at a concentration of 2.5 mg/ml was added.
- the introduction of genes derived from Herbaspirium rizospere, Alkaline Jins pecalis, and E. coli showed the best growth potential.
- the introduction of a gene derived from Sudomonas Stupjeri showed somewhat reduced growth compared to the previous three strains, and the introduction of a gene derived from Cupriabidus necator showed the lowest growth.
- the wild strain ATCC13869 did not grow.
- the only introduction of a gene derived from Herbaspirium rizospere allowed growth.
- Glucose 10g KH 2 PO 4 1 g, K 2 HPO 4 2 g, MgSO 4 7H 2 O 0.4 g, urea 2 g, (NH 4 ) 2 SO 4 5 g, NaCl 0.5 g, nicotinamide 5 ⁇ g, calcium- Pantothenic acid 0.1 ⁇ g, biotin 0.2 ⁇ g, thiamine HCl 3 ⁇ g, trace elements solution 1ml (based on 1 liter of distilled water)
- Example 8 Preparation of expression vector for E. coli into which genes derived from various microorganisms were introduced
- each gene was cloned into pCL1920, an E. coli expression vector, and expressed with the yccA promoter of E. coli strain W3110.
- PCR was performed using SEQ ID NO:29 and SEQ ID NO:30 using the chromosomal DNA of the Herbaspirium rizospere strain as a template.
- the polymerase Solg TM Pfu-X DNA polymerase (SolGent co.) was used, and PCR amplification conditions were denatured at 95°C for 2 minutes, then denatured at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute. After repeating 27 times, polymerization was performed at 72° C. for 5 minutes.
- PCR was performed using E. coli W3110 genomic DNA as a template using SEQ ID NO: 31 and SEQ ID NO: 32.
- the polymerase Solg TM Pfu-X DNA polymerase (SolGent co.) was used, and PCR amplification conditions were denatured at 95°C for 2 minutes, then denatured at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 10 seconds. After repeating 27 times, polymerization was performed at 72° C. for 5 minutes.
- the amplified yccA promoter region, a gene fragment derived from Herbaspirium rizospere, and pCL1920 vector (pSC101 ori, Sp r ) digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, pCL1920- It was named PyccA-Hrh. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour. The obtained pCL1920-PyccA-Hrh was introduced into wild-type E. coli W3110 to prepare W3110/pCL1920-PyccA-Hrh, a transformant expressing the gene.
- PCR was performed using SEQ ID NO: 33 and SEQ ID NO: 34 using the chromosomal DNA of Sudomonas stuungjeri strain as a template.
- SEQ ID No. 35 used to secure the yccA promoter derived from E. coli W3110 to be used, all the methods were the same as those used for securing the gene fragment of the Herbaspirium rizospere strain.
- pCL1920-PyccA-Pst a recombinant plasmid was obtained, named pCL1920-PyccA-Pst, and the expression vector pCL1920-PyccA-Pst was introduced into the wild-type E. coli W3110 to prepare a transformant W3110/pCL1920-PyccA-Pst expressing the gene.
- the process of producing the transformant expressing the gene derived from the Alkalazines pecalis strain is the same as the above procedure, and the chromosomal DNA of the Alkaline genera pecalis strain for securing the fragment is used as a template, with SEQ ID NO: 36 and SEQ ID NO: 37. Only the use of primer SEQ ID NO: 38 to secure the yccA promoter was different.
- pCL1920-PyccA-Afa a recombinant plasmid in which the gene derived from Alkaligenes pecalis was cloned was obtained and named pCL1920-PyccA-Afa, and the transformant W3110/pCL1920-PyccA-Afa, a transformant in which the expression vector pCL1920-PyccA-Afa was introduced into the wild-type E. coli W3110, was obtained.
- pCL1920-PyccA-Afa a recombinant plasmid in which the gene derived from Alkaligenes pecalis was cloned was obtained and named pCL1920-PyccA-Afa
- the transformant W3110/pCL1920-PyccA-Afa a transformant in which the expression vector pCL1920-PyccA-Afa was introduced into the wild-type E. coli W3110
- PCR was performed using SEQ ID NO: 39 and SEQ ID NO: 40 using the chromosomal DNA of the Cupriabidus necator strain as a template.
- SEQ ID No. 41 used to secure the yccA promoter derived from E. coli W3110 to be used, all the methods of performing were the same as those used for securing the gene fragment of the Herbaspirium rezospere strain.
- pCL1920-PyccA-Cne a recombinant plasmid was obtained and named pCL1920-PyccA-Cne, and the expression vector pCL1920-PyccA-Cne was introduced into wild-type E. coli W3110 to prepare W3110/pCL1920-PyccA-Cne, a transformant expressing the gene.
- Escherichia coli str Using the chromosomal DNA of the K-12 substr.MG1655 strain as a template, PCR was performed using SEQ ID NO: 42 and SEQ ID NO: 43. In addition, except for using the primer SEQ ID No. 44 used to secure the yccA promoter derived from E. coli W3110 to be used, all the methods were the same as those used for securing the gene fragment of the Herbaspirium rizospere strain.
- pCL1920-PyccA-Eco a recombinant plasmid was obtained, named pCL1920-PyccA-Eco, and the expression vector pCL1920-PyccA-Eco was introduced into the wild-type E. coli W3110 to produce W3110/pCL1920-PyccA-Eco, a transformant expressing the gene.
- Example 9 MIC measurement of E. coli overexpressing membrane protein genes derived from various microorganisms
- a minimum inhibitory concentration (MIC) experiment using tryptophan and a phenylalanine analogue (analogue) was performed.
- coli strains overexpressing five kinds of genes were incubated for 15 hours at 37°C in M9 minimal liquid medium supplemented with 50 ug/ml spectinomycin, and then diluted with 10 4 and 10 5 cells to tryptophan. Spotting incubation in M9 glucose minimal solid medium (50 ug/ml spectinomycin added) to which the analog or phenylalanine analog was added. 2 mg/ml of para-fluoro-DL-phenylalanine or 0.7 ug/ml of 5-fluoro-DL-trytophan was added to the M9 minimum for the minimum low concentration experiment. It was added to the solid medium, and the growth of cells was observed after 48 hours (Table 3).
- the E. coli strain showed superior growth when the E. coli-derived gene was overexpressed, as in the Coryneglutamicum strain, and the overexpression of the Alkaligenes pecalis-derived gene also enabled significant growth.
- genes derived from Herbaspirium rizospere, Sudomonas Stupzeri, and Cupriabidus necator were overexpressed, they could not grow together with the control group W3110/pCL1920.
- overexpression of the five selected genes allowed growth in all conditions to which tryptophan analogs were added.
- the overexpression of the five genes selected from the E. coli strains showed a similar pattern to the MIC test results of the Corynebacterium glutamicum strain.
- Genes derived from Herbaspirium rizospere are specific and superior to tryptophan or tryptophan analogues in both Coryneglutamicum strains and E. coli, and the E. coli-derived excretion gene has a higher excretion in phenylalanine and its analogs than in tryptophan. Showed tolerance. From this, it was determined that the gene derived from Herbaspirium rizospere was specific for tryptophan in both the Coryneglutamicum strain and E. coli and showed superior excretion ability.
- the L-tryptophan producing strain was developed from the wild species Corynebacterium glutamicum ATCC13869.
- the wild-type Corynebacterium glutamicum does not produce L-tryptophan or produces only a very small amount of L-tryptophan even if it is produced, so the strain that strengthened the biosynthetic pathway essential for production was intended to be used as the parent strain.
- the expression of the operon of the L-tryptophan biosynthesis gene was enhanced through promoter enhancement.
- serine, amino acid 38 of trpE was substituted with arginine in order to resolve the feedback inhibition of the TrpE protein (JOURNAL OF BACTERIOLOGY, Nov. 1987, p. 5330-5332).
- trpE promoter upstream where homologous recombination occurs and a trpE 38 mutation downstream region were obtained.
- the trpE promoter upstream region using the primers of SEQ ID NO: 45 and SEQ ID NO: 46, trpE using the primers of SEQ ID NO: 47 and SEQ ID NO: 48 A gene fragment of the 38th mutation downstream (Downsteam) region was obtained through PCR.
- Solg TM Pfu-X DNA polymerase As the polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were after denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds. , Polymerization was performed at 72° C. for 5 minutes.
- PCR was performed using the synthesized promoter SPL7 (SEQ ID NO: 49) as a template and primers of SEQ ID NO: 50 and SEQ ID NO: 51.
- Solg TM Pfu-X DNA polymerase SolGent co.
- PCR amplification conditions were denatured at 95°C for 5 minutes, then denatured at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 30 seconds. After repeating 30 times, polymerization was performed at 72° C. for 5 minutes.
- the Corynebacterium glutamicum genomic DNA as a template of SEQ ID NO: 52 and SEQ ID NO: 53 PCR was performed using primers.
- SolgTM Pfu-X DNA polymerase was used, and PCR amplification conditions were subjected to denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 30 seconds. Polymerization was carried out at 72° C. for 5 minutes.
- Recombinant plasmids were obtained by cloning the amplified trpE promoter upstream and the trpE 38 mutation downstream region, the SPL7 promoter and the front fragment of trpE, and the vector pDZ for chromosome transformation digested with SmaI restriction enzyme using the Gibson assembly method. , named pDZ-PSPL7-trpE (S38R). Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZ-PSPL7-trpE (S38R) vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then the promoter of trpE on the chromosome was converted to the stronger promoter SPL7 promoter through a secondary crossover process. Then, a strain in which amino acid 38 of TrpE was replaced from serine to arginine was obtained.
- the genetic manipulation was confirmed through PCR method and genome sequencing using SEQ ID NO: 54 and SEQ ID NO: 55 that can amplify the homologous recombination upstream region and downstream region into which the gene was inserted, and this was named CA04-8325.
- tryptophan originates from the aromatic amino acid metabolic cycle, which begins with the condensation reaction of phosphoenolpyruvate and erythrose 4-phosphate. Therefore, smooth supply of the two precursors is essential for improving tryptophan production, and overexpression of the tkt gene was carried out for smooth supply of erythrose 4-phosphate, which is known to be relatively insufficient.
- Solg TM Pfu-X DNA polymerase As the polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were after denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 30 seconds. , Polymerization was performed at 72° C. for 5 minutes.
- Solg TM Pfu-X DNA polymerase As the polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were subjected to denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute and 20 seconds. After that, polymerization was performed at 72°C for 5 minutes.
- the upstream and downstream regions to additionally insert the amplified tkt gene, the tkt gene containing the tkt promoter, and the vector pDZ for chromosome transformation cut with SmaI restriction enzyme were cloned using the Gibson assembly method.
- a recombinant plasmid was obtained and named pDZ-Pn-tkt. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
- the prepared pDZ-Pn-tkt vector was transformed into CA04-8325 strain by electroporation, followed by a second crossover process to obtain a strain in which the tkt gene including the tkt promoter was inserted on the chromosome.
- the genetic manipulation was confirmed through PCR and genome sequencing using primers SEQ ID NO: 62 and SEQ ID NO: 63 that can amplify the regions outside the homologous recombination upstream region and downstream region into which the gene is inserted, respectively, and CA04-8352 It was named as.
- the strain CA04-8352 was internationally deposited with the Korea Microbial Conservation Center (KCCM), an international depository organization under the Budapest Treaty, on February 2, 2018, and was given a deposit number as KCCM12218P.
- KCCM Korea Microbial Conservation Center
- Example 10 Production of tryptophan by microorganisms of the genus Corynebacterium into which genes derived from Herbaspirium rizospere and E. coli were introduced
- Example 7 a gene derived from Herbaspirium rizospere, which showed excellent activity at a minimum low concentration of tryptophan analogue (analogue), was introduced into CA04-8352, a tryptophan-producing strain prepared in Reference Example 1.
- the vector pDZTn-PgapA-Hrh for gene introduction derived from Herbaspirium rizospere prepared in Example 2 was transformed into a tryptophan-producing strain CA04-8352 by electroporation, and the same as in Example 2 Through the process, a strain in which a gene derived from Herbaspirium rizospere was inserted between the transposon genes was obtained. This was named CA04-8405.
- E. coli-derived genes were introduced into tryptophan-producing strain CA04-8352 as a control.
- the E. coli-derived gene introduction vector pDZTn-PgapA-Eco prepared in Example 6 was transformed into a tryptophan-producing strain CA04-8352 by electroporation, and through the same process as in Example 6, between the transposon genes.
- One copy of the E. coli-derived release gene was inserted to obtain a strain. This was named CA04-8406.
- CA04-8405 and CA04-8406 produced through the above process were cultured in the following manner to confirm the tryptophan production amount as a control for CA04-8352 produced in Reference Example 1.
- Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and cultured with shaking at 30° C. for 20 hours and 200 rpm.
- 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 24 hours and 200 rpm.
- the production amount of L-tryptophan was measured by HPLC.
- Glucose 30g (NH 4 ) 2 SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 1 g, yeast extract 5 g, biotin 900 ⁇ g, thiamine hydrochloride 4500 ⁇ g, calcium-pantothenic acid 4500 ⁇ g, CaCO 3 30 g (based on 1 liter of distilled water).
- Corynebacterium glutamicum L-tryptophan producing strain (CA04-8352), Herbaspirium rizospere-derived gene-inserted production strain (CA04-8405), E. coli-derived gene-inserted production strain (CA04-8406) ) L-tryptophan production OD562 Tryptophan production (g/L) Tryptophan yield (g/g glc, %) CA04-8352 56.5 0.25 0.83 CA04-8405 52.3 1.52 5.07 CA04-8406 56.1 0.24 0.80
- results for L-tryptophan production in the medium for CA04-8352, CA04-8405, and CA04-8406 are shown in Table 4 above.
- the CA04-8405 strain into which the gene derived from Herbaspirium rizospere was introduced produced a final 1.52 g/L of L-tryptophan in flask culture, which is about 5 times higher than that of the control CA04-8352 strain. This means that the gene derived from Herbaspirium rizospere significantly enhances L-tryptophan production in the Corynebacterium glutamicum strain.
- the tryptophan production of the CA04-8406 strain into which the E is the tryptophan production of the CA04-8406 strain into which the E.
- KCCM12099P As of August 21, it was deposited with the Korea Microbiological Conservation Center (KCCM), an international depository under the Budapest Treaty, and was given a deposit number as KCCM12099P (CA04-8405).
- KCCM Korea Microbiological Conservation Center
- Example 11 Analysis of intracellular tryptophan metabolites in Corynebacterium glutamicum into which a gene derived from Herbaspirium rizospere was introduced
- Intracellular metabolite analysis method was performed according to the method described in Nakamura J et al., Appl. Environ. Microbiol. 73(14): 4491-4498, 2007.
- Corynebacterium glutamicum mutant strains CA04-8352 and CA04-8405 were inoculated into 250 ml corner-baffle flasks containing 25 ml of species medium, and cultured with shaking at 30° C. for 20 hours and 200 rpm. I did. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium and cultured with shaking at 30°C at 200 rpm.
- the intracellular tryptophan concentration was confirmed in a total of 3 steps depending on the amount of sugar consumed, and the cultured cells in each step were separated from the culture medium through rapid vacuum filtration (Durapore HV, 0.45 m; Millipore, Billerica, MA). .
- the filter to which the cells were adsorbed was washed twice with 10 ml of purified water, and then immersed in methanol containing 5 uM morpholine ethanesulfonic acid and 5 uM methionine sulfone for 10 minutes.
- the concentration of tryptophan in the cell was reduced to a level of 33 to 41% in CA04-8405 compared to the parent strain CA04-8352. It is judged that the intracellular tryptophan concentration of the CA04-8405 strain decreased as the tryptophan generated in the cells of the Corynebacterium glutamicum strain was smoothly excreted to the outside by the expression of the gene derived from Herbaspirium rizospere. . From this, it can be confirmed that the gene derived from Herbaspirium rizospere is a gene encoding a membrane protein having a specific excretion ability for tryptophan.
- the strain producing L-tryptophan of the genus Escherichia was developed from the wild-type E. coli W3110.
- a strain designed to produce L-tryptophan was used as a parent strain.
- the expression of L-tryptophan biosynthesis genes ( trpEDCBA ) involved in L-tryptophan production from Chorismate is suppressed by TrpR. Accordingly, the trpR gene encoding it was removed.
- proline amino acid 21 from the N-terminus of TrpE
- serine amino acid 21 from the N-terminus of TrpE
- Mtr membrane protein plays a role in introducing L-tryptophan from outside the cell into the cell, and TnaA protein breaks down L-tryptophan and water molecules in the cell into indole, pyruvate, and ammonia (NH 3 ). Do it. Therefore, mtr and tnaA genes that inhibit and degrade L-tryptophan production were removed.
- lambda red recombination ( ⁇ -red recombination, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci USA. 2000 Jun6;97(12) ):6640-5) method was used.
- the pKD4 vector is used as a template and the FRT-kanamycin-FRT cassette and the homologous 50 bp base pairs on both sides of the mtr gene where homologous recombination occurs on the chromosome are combined using primers of SEQ ID NO: 64 and SEQ ID NO: 65
- the resulting gene fragment (1580 bp) was obtained through PCR.
- the kanamycin antibiotic marker of the pKD4 vector was used to remove the target gene and confirm the insertion of the antibiotic gene, and the FRT region serves to remove the antibiotic marker after the target gene is removed.
- Solg TM Pfu-X DNA polymerase As the polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were after denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute after 27 times. , Polymerization was performed at 72° C. for 5 minutes.
- the pKD46 vector expressing lambda red recombinase (gam, bet, exo) was transformed into E. coli W3110 strain by electroporation and plated on LB solid medium containing 50 mg/L of kanamycin.
- the FRT-kanamycin-FRT cassette obtained in the above process and the linear gene fragment in which the homologous 50 bp base pairs on both sides of the mtr gene were bound were transformed through electroporation.
- Colonies grown in LB solid medium containing 25 mg/L kanamycin were subjected to colony PCR using SEQ ID NO: 66 and SEQ ID NO: 67, and colonies from which 782 bp gene fragments are produced were selected.
- the strain from which the mtr gene was removed due to homologous recombination was prepared as a conformant cell for removal of the kanamycin antibiotic marker, and then transformed with pCP20 vector by electroporation.
- the pCP20 vector expresses the FLP protein to recognize the FRT region on both sides of the kanamycin antibiotic and binds onto the chromosome, thereby removing the antibiotic marker between the FRT regions.
- the pCP20 vector transformed strain grown in LB solid medium containing 100 mg/L of Ampicillin and 25 mg/L of Chloramphenicol was incubated for 1 hour in LB medium at 30° C. and then added at 42° C. for 15 hours. Cultured and plated on LB solid medium.
- the grown colonies are LB solid medium containing 100 mg/L of Ampicillin and 25 mg/L of chloramphenicol, LB solid medium containing 12.5 mg/L of kanamycin, and LB solid without antibiotics. Cultured in the medium, colonies grown only in LB solid medium without antibiotics were selected. The mtr gene removal was finally confirmed through genomic sequencing, and this was named CA04-9300.
- Solg TM Pfu-X DNA polymerase As the polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were after denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute after 27 times. , Polymerization was performed at 72° C. for 5 minutes.
- Transformation of the pKD46 vector was confirmed, and the CA04-9300 strain, in which the recombinant enzymes were expressed through the addition of 10 mM L-arabinose, was electroporated to obtain the FRT-kanamycin-FRT cassette and the tnaA gene
- the linear gene fragment to which the homologous 50 bp base pair was bound was transformed.
- Colonies grown in LB solid medium containing 25 mg/L kanamycin were subjected to colony PCR using SEQ ID NO: 66 and SEQ ID NO: 70, and colonies from which 787 bp gene fragments are produced were selected.
- the strain from which the tnaA gene was removed due to homologous recombination was prepared as a conformant cell for removal of the kanamycin antibiotic marker, and then the pCP20 vector was transformed, and a strain from which the kanamycin antagonist marker was removed was produced by expression of the FLP protein.
- the tnaA gene removal was finally confirmed through genomic sequencing, and this was named CA04-9301.
- the pKD4 vector is used as a template, and the FRT-kanamycin-FRT cassette and the homologous 50 bp base pairs on both sides of the trpR gene where homologous recombination occurs on the chromosome are combined using the primers of SEQ ID NO: 71 and SEQ ID NO: 72.
- the resulting gene fragment (1580 bp) was obtained through PCR.
- Transformation of the pKD46 vector was confirmed, and the CA04-9301 strain, in which the recombinant enzymes were expressed through the addition of 10 mM L-arabinose, was electroporated to obtain the FRT-kanamycin-FRT cassette and both sides of the trpR gene.
- the linear gene fragment to which the homologous 50 bp base pair was bound was transformed.
- Colonies grown in LB solid medium containing 25 mg/L kanamycin were subjected to colony PCR using primers of SEQ ID NO: 66 and SEQ ID NO: 73, and colonies from which 838 bp gene fragments are produced were selected.
- the strain from which the trpR gene was removed due to homologous recombination was prepared as a conformant cell for removal of the kanamycin antibiotic marker, and then the pCP20 vector was transformed, and a strain from which the kanamycin antagonist marker was removed was produced by expression of the FLP protein. The removal of the trpR gene was finally confirmed through genomic sequencing, which was named CA04-9307.
- trpE gene fragment containing the EcoRI sequence 1575 bp Obtained through PCR.
- the polymerase Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were after denaturation at 95°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 62°C for 1 minute, polymerization at 72°C for 1 minute, and repeating 27 times. , Polymerization was performed at 72° C. for 5 minutes.
- the trpE gene and pSG76-C plasmid obtained by the above method were respectively treated with EcoRI restriction enzymes and cloned.
- the cloned plasmid was transformed into E. coli DH5 ⁇ by electroporation, and the transformed E. coli DH5 ⁇ was selected from an LB plate containing 25 ⁇ g/ml of chlororamphenocol to obtain pSG76-C-trpE plasmid.
- pSG76-C-trpE (P21S) was prepared using the primers of SEQ ID NO: 76 and SEQ ID NO: 77 by a site directed mutagenesis (Stratagene, USA) method.
- CA04-9307 strain was transformed with the pSG76-C-trpE (P21S) plasmid and cultured in LB-Cm (Yeast extract 10g/L, NaCl 5g/L, Tryptone 10g/L, Chlororamphenicol 25ug/L) medium. Colonies with chloramphenicol resistance were selected.
- the selected transformant is a strain in which the pSG76-C-trpE (P21S) plasmid is first inserted into the trpE portion of the genome. PAScep(JOURNAL OF BACTERIOLOGY, July 1997, p.
- Example 12 Production of L-tryptophan by microorganisms of the genus Escherichia into which a gene derived from Herbaspirium rizospere was introduced
- the pCL1920-PyccA-Hrh prepared in Example 8 was introduced into CA04-4303 prepared in Reference Example 2 to prepare CA04-4306, a transformant in which a gene derived from Herbaspirium rizospere was overexpressed.
- the pCL1920 vector was transformed into CA04-4303.
- the two strains CA04-4303/pCL1920 and CA04-4306 were cultured in LB liquid medium containing 50 mg/L spectinomycin for 12 hours to confirm the production of L-tryptophan.
- Glucose 70g (NH 4 ) 2 SO 4 20 g, MgSO 4 7H 2 O 1 g, KH 2 PO 4 2 g, yeast extract 2.5 g, Na-citrate 5 g, NaCl 1 g, CaCO 3 40 g (distilled water 1 Liters).
- the gene derived from Herbaspirium rizospere showed superior resistance while being specific to L-tryptophan and its analog, and in the results of Examples 10 and 12, Herba The gene derived from Philium rizospere improved L-tryptophan production in both the Corynebacterium glutamicum strain and the E. coli strain.
- the gene derived from Herbaspirium rizospere substantially excreted tryptophan to the outside of the cell. Accordingly, the gene derived from Herbaspirium rizospere was named as Tryptophan ( W ) ex porter, wex).
- error-prone PCR was performed to apply a random mutagenesis to the wild-type wex gene, and diversify PCR random mutagenesis kit (US CLONTECH) was used when performing error-prone PCR.
- error-producing PCR was performed using the pCL1920-PyccA-wex prepared in Example 8 as a template using SEQ ID NOs: 78 and 79.
- error-prone PCR was performed with two compositions according to the concentration of MnSO 4 as follows.
- Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, with pCL1920 digested with error-prone PCR products and SmaI restriction enzymes performed under the conditions of [Table 6] and [Table 7].
- NEBuilder HiFi DNA Assembly Master Mix was used to obtain a recombinant mutant plasmid library.
- the mutant library obtained by the above method, pCL1920-PyccA-Hrh and pCL1920 were transformed into Escherichia coli W3110 cells, and cultured in LB plate medium containing 50 ⁇ g/L spectinomycin. Sequencing was performed to select the colonies of 50 mutation libraries to determine the mutation rate and the presence or absence of mutations at various locations.
- positions 79 to 83 of the Wex membrane protein amino acid sequence were the key regions for introducing mutations to improve L-tryptophan excretion, and the amino acids in the sequence were various hydrophobic amino acids and aliphatic amino acids. Alternatively, it was attempted to improve its activity by replacing it with a relatively small L-amino acid.
- Example 14 Substitution of amino acid No. 79 of the Wex sequence and a hydrophobic amino acid of Leucine in a microorganism of the genus Corynebacterium.
- leucine which is the 79th amino acid sequence of the Wex membrane protein, with another hydrophobic amino acid.
- Site-Directed Mutagenesis was performed using pDZTn-PgapA-Hrh prepared in Example 2 as a template in order to make mutations to three other amino acids other than leucine. Site-Directed mutagenesis was performed in the following way.
- the pDZTn-PgapA-wex L79A, pDZTn-PgapA-wex L79V, pDZTn-PgapA-wex L79I vectors prepared as in [Table 11] were transformed to CA04-8352 prepared in Reference Example 1 by electroporation, respectively.
- Three strains were obtained in which the mutant wex gene was inserted on the chromosome through a second crossover process.
- the genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the transformed strains thus obtained were named CA04-8352 (wex L79A), CA04-8352 (wex L79V), and CA04-8352 (wex L79I), respectively.
- CA04-8352, CA04-8405, CA04-8352 (wex L79A), CA04-8352 (wex L79V), CA04-8352 (wex L79I) strains were cultured in the same manner as in Example 10 to confirm tryptophan production. After completion of the culture, the production amount of L-tryptophan was measured using HPLC.
- Example 15 Substitution of the 80th amino acid of the Wex sequence, serine, with a hydrophobic amino acid in the microorganism of the genus Corynebacterium.
- serine 80 of the Wex amino acid sequence was used as a hydrophobic amino acid, alanine (A) (SEQ ID NO: 89, SEQ ID NO: 134), valine (V) (SEQ ID NO: 90, SEQ ID NO: 135), leucine (L) (SEQ ID NO: 91, sequence Number 136), isoleucine (I) (SEQ ID NO: 92, SEQ ID NO: 137) was carried out in the same manner as in Example 14, the mutagenic primer set used to secure the pDZTn-PgapA-wex variant plasmid and The variant form is the same as in [Table 13].
- Base sequence pDZTn-PgapA-wex S80A 93 GTCCTACGAACTCTGCCTG GCA CTCTCCATCGGTTATGCC 94
- pDZTn-PgapA-wex S80L 97 GTCCTACGAACTCTGCCTG CTG CTCTCCATCGGTTATGCC 98
- the pDZTn-PgapA-wex S80A, pDZTn-PgapA-wex S80V, pDZTn-PgapA-wex S80L, pDZTn-PgapA-wex S80I vectors prepared as in [Table 13] were transformed into CA04-8352 by electroporation, respectively. , Four strains were obtained in which the mutant wex gene was inserted on the chromosome through a second crossover process.
- the genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the transformed strains thus obtained were named CA04-8352 (wex S80A), CA04-8352 (wex S80V), CA04-8352 (wex S80L), and CA04-8352 (wex S80I), respectively.
- CA04-8352, CA04-8405, CA04-8352 (wex S80A), CA04-8352 (wex S80V), CA04-8352 (wex S80L), CA04-8352 (wex S80I) strains were used in Example 10 to confirm tryptophan production. It was cultured in the same way. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- Example 16 Substitution of amino acid 81 of the Wex sequence and a hydrophobic amino acid of Leucine in a microorganism of the genus Corynebacterium.
- leucine 81 the 81st amino acid of the amino acid sequence of the Wex membrane protein (hereinafter referred to as leucine 81) with another hydrophobic amino acid.
- Site-Directed Mutagenesis was performed using pDZTn-PgapA-wex as a template in the same manner as in Example 14 in order to mutate into three other hydrophobic amino acids other than leucine.
- leucine 81 of the Wex amino acid sequence was used as a hydrophobic amino acid, alanine (A) (SEQ ID NO: 101, SEQ ID NO: 138), valine (V) (SEQ ID NO: 102, SEQ ID NO: 139), isoleucine (I) (SEQ ID NO: 103, sequence 140) was performed in the same manner as in Example 14, and the mutagenic primer set and mutant form used to secure the pDZTn-PgapA-wex mutant plasmid are the same as in [Table 15].
- A alanine
- V valine
- I isoleucine
- Base sequence pDZTn-PgapA-wex L81A CCTACGAACTCTGCCTGTCG GCA TCCATCGGTTATGCCAATAC 105 GTATTGGCATAACCGATGGA TGC CGACAGGCAGAGTTCGTAGG pDZTn-PgapA-wex L81V
- CCTACGAACTCTGCCTGTCG GTG TCCATCGGTTATGCCAATAC 107 GTATTGGCATAACCGATGGA CAC CGACAGGCAGAGTTCGTAGG pDZTn-PgapA-wex L81I CCTACGAACTCTGCCTGTCG ATC TCCATCGGTTATGCCAATAC 109 GTATTGGCATAACCGATGGA G,
- the pDZTn-PgapA-wex L81A, pDZTn-PgapA-wex L81V, and pDZTn-PgapA-wex L81I vectors prepared as in [Table 15] were transformed into CA04-8352 by electroporation, respectively, and then subjected to a second crossover process. Three strains were obtained in which the variant wex gene was inserted on the chromosome. The genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the transformed strains thus obtained were named CA04-8352 (wex L81A), CA04-8352 (wex L81V), and CA04-8352 (wex L81I), respectively.
- CA04-8352, CA04-8405, CA04-8352 (wex L81A), CA04-8352 (wex L81V), CA04-8352 (wex L81I) strains were cultured in the same manner as in Example 10 to confirm tryptophan production. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- Example 17 Substitution of the 82nd amino acid of the Wex sequence, Serine with a hydrophobic amino acid in a microorganism of the genus Corynebacterium.
- Serine 82 which is the 82nd amino acid in the amino acid sequence of the Wex membrane protein, with a hydrophobic amino acid.
- Site-Directed Mutagenesis was performed using pDZTn-PgapA-wex as a template in the same manner as in Example 14 in order to mutate into four different hydrophobic amino acids.
- serine 82 of the Wex amino acid sequence is hydrophobic amino acids alanine (A) (SEQ ID NO: 110, SEQ ID NO: 141), valine (V) (SEQ ID NO: 111, SEQ ID NO: 142), leucine (L) (SEQ ID NO: 112, sequence Number 143), isoleucine (I) (SEQ ID NO: 113, SEQ ID NO: 144) was carried out in the same manner as in Example 14, the mutagenic primer set used to secure the pDZTn-PgapA-wex variant plasmid and The variant form is the same as [Table 17].
- Base sequence pDZTn-PgapA-wex S82A 114 CGAACTCTGCCTGTCGCTC GCA ATCGGTTATGCCAATACAG 115 CTGTATTGGCATAACCGAT TGC GAGCGACAGGCAGAGTTCG pDZTn-PgapA-wex S82V 116 CGAACTCTGCCTGTCGCTC GTG ATCGGTTATGCCAATACAG 117 CTGTATTGGCATAACCGAT CAC GAGCGACAGGCAGAGTTCG pDZTn-PgapA-wex S82L 118 CGAACTCTGCCTGTCGCTC CTG ATCGGTTATGCCAATACAG 119 CTGTATTGGCATAACCGAT CAG GAGCGACAGGCAGAGTTCG p
- the pDZTn-PgapA-wex S82A, pDZTn-PgapA-wex S82V, pDZTn-PgapA-wex S82L, pDZTn-PgapA-wex S82I vectors prepared as in [Table 17] were transformed into CA04-8352 by electroporation, respectively. , Four strains were obtained in which the mutant wex gene was inserted on the chromosome through a second crossover process.
- the genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the transformed strains thus obtained were named CA04-8352 (wex S82A), CA04-8352 (wex S82V), CA04-8352 (wex S82L), CA04-8352 (wex S82I), respectively.
- CA04-8352, CA04-8405, CA04-8352 (wex S82A), CA04-8352 (wex S82V), CA04-8352 (wex S82L), CA04-8352 (wex S82I) strains were used in Example 10 to confirm tryptophan production. It was cultured in the same way. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- Corynebacterium glutamicum L-tryptophan-producing strain (CA04-8352) and L-tryptophan-releasing gene (Wex) inserted strain (CA04-8405), and amino acid variant 82 of the Wex amino acid sequence (CA04-8352 ( Wex S82A), CA04-8352 (wex S82V), CA04-8352 (wex S82L), CA04-8352 (wex S82I)) of L-tryptophan production.
- Example 18 Substitution of amino acid 83 of the Wex sequence and isoleucine with a hydrophobic amino acid in a microorganism of the genus Corynebacterium.
- isoleucine which is the 83rd amino acid of the Wex membrane protein, with another hydrophobic amino acid.
- Site-Directed Mutagenesis was performed using pDZTn-PgapA-wex as a template in the same manner as in Example 14 in order to mutate to three other hydrophobic amino acids other than isoleucine.
- isoleucine at No. 83 of the Wex amino acid sequence is used as a hydrophobic amino acid
- alanine (A) (SEQ ID NO: 122, SEQ ID NO: 145), valine (V) (SEQ ID NO: 123, SEQ ID NO: 146), leucine (L) (SEQ ID NO: 124, sequence Number 147) was carried out in the same manner as in Example 14, and the mutagenic primer set and variant form used to secure the pDZTn-PgapA-wex mutant plasmid are the same as in [Table 19].
- a mutagenic primer set for the production of amino acid variant 83 plasmid of Wex amino acid sequence for introduction of microorganisms in Corynebacterium genus Variant Wex Plasmid SEQ ID ## Base sequence pDZTn-PgapA-wex I83A 125 GAACTCTGCCTGTCGCTCTCC GCA GGTTATGCCAATACAGGCAGG 126 CCTGCCTGTATTGGCATAACC TGC GGAGAGCGACAGGCAGAGTTC pDZTn-PgapA-wex I83V 127 GAACTCTGCCTGTCGCTCTCC GTG GGTTATGCCAATACAGGCAGG 128 CCTGCCTGTATTGGCATAACC CAC GGAGAGCGACAGGCAGAGTTC pDZTn-PgapA-wex I83L 129 GAACTCTGCCTGTCGCTCTCC CTG GGTTATGCCAATACAGGCAGG 130 CCTGCCTGTATTGGCATAACC CAG GGAGAG
- the pDZTn-PgapA-wex I83A, pDZTn-PgapA-wex I83V, and pDZTn-PgapA-wex I83L vectors prepared as in [Table 19] were transformed into CA04-8352 by electroporation, respectively, and then subjected to a second crossover process. Three strains were obtained in which the variant wex gene was inserted on the chromosome. The genetic manipulation was confirmed by PCR method and genome sequencing using primers of SEQ ID NO: 7 and SEQ ID NO: 8, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
- the transformed strains thus obtained were named CA04-8352 (wex I83A), CA04-8352 (wex I83V), and CA04-8352 (wex I83L), respectively.
- CA04-8352, CA04-8405, CA04-8352 (wex I83A), CA04-8352 (wex I83V), CA04-8352 (wex I83L) strains were cultured in the same manner as in Example 10 to confirm the tryptophan production. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- the strain CA04-8352 (wex L79I), CA04-8352 (wex S80V), CA04-8352 (wex L81V), CA04-8352 (wex S82V), CA04-8352 (wex I83L) of the present application was introduced They were named CM05-9022, CM05-9023, CM05-9024, CM05-9025, CM05-9026, respectively, and as of March 29, 2019, KCCM12475P was internationally deposited with the Korea Microbial Conservation Center (KCCM), an international depository organization under the Budapest Treaty. , KCCM12476P, KCCM12477P, KCCM12478P, KCCM12479P.
- KCCM Korea Microbial Conservation Center
- Example 19 Substitution of amino acid No. 79 of the Wex sequence and a hydrophobic amino acid of Leucine in a microorganism of the genus Escherichia.
- Leucine No. 79 of the Wex amino acid sequence is another hydrophobic amino acid, alanine (A) (SEQ ID NO: 80, SEQ ID NO: 131), valine (V) (SEQ ID NO: 81, SEQ ID NO: 132), isoleucine (I) (SEQ ID NO: 82, sequence In order to substitute number 133), a PCR mixture as shown in [Table 21] was prepared using each mutagenic primer set indicated in [Table 23], and PCR was performed in the cycle of [Table 22]. After PCR was completed, 1 ⁇ l of DpnI restriction enzyme was added, followed by treatment at 37°C for 1 hour.
- A alanine
- V valine
- I isoleucine
- DpnI-treated DNA 3 ⁇ l DH5a competent cells were transformed to obtain pCL1920-PgapA-wex mutant plasmids, and it was confirmed that they were replaced with each of the mutations indicated in [Table 23] through sequencing.
- a mutagenic primer set for the preparation of amino acid variant 79 of the Wex amino acid sequence for expression in Escherichia microorganisms Variant Wex Plasmid SEQ ID ## Base sequence pCL1920-PyccA-wex L79A 83 GTGTCCTACGAACTCTGC GCA TCGCTCTCCATCGGTTATG 84 CATAACCGATGGAGAGCGA TGC GCAGAGTTCGTAGGACAC pCL1920-PyccA-wex L79V 85 GTGTCCTACGAACTCTGC GTG TCGCTCTCCATCGGTTATG 86 CATAACCGATGGAGAGCGA CAC GCAGAGTTCGTAGGACAC pCL1920-PyccA-wex L79I 87 GTGTCCTACGAACTCTGC ATC TCGCTCCATCGGTTATG 88 CATAACCGATGGAGCGA GAT GCAGAGTTCGTAGGACAC
- the pCL1920-PyccA-wex L79A, pCL1920-PyccA-wex L79V, and pCL1920-PyccA-wex L79I vectors prepared as shown in [Table 23] were transformed into CA04-4303 by electroporation, respectively, and different amino acids wex 79 Three strains into which the mutant gene was each introduced were obtained.
- the transformed strains thus obtained were named CA04-4303 (wex L79A), CA04-4303 (wex L79V), and CA04-4303 (wex L79I), respectively.
- L-tryptophan of CA04-4303 (wex L79A), CA04-4303 (wex L79V), CA04-4303 (wex L79I) strains using CA04-4303 (pCL1920) and CA04-4306 prepared in Example 12 as controls
- E. coli L-tryptophan-producing strain (CA04-4303 (pCL1920)) and L-tryptophan-releasing gene (Wex)-expressing strain (CA04-4306), amino acid mutation 79 of the Wex amino acid sequence (CA04-4303 (wex L79A)) , CA04-4303 (wex L79V), CA04-4303 (wex L79I)) L-tryptophan production check Strain name Tryptophan production (g/L) Tryptophan yield (g/g glc, %) Improved yield compared to wild type Wex ( ⁇ ,%p) CA04-4303 (pCL1920) 1.4 2.0 - CA04-4306 2.1 3.0 - CA04-4303 (wex L79A) 3.2 4.5 1.5 CA04-4303 (wex L79V) 2.5 3.6 0.6 CA04-4303 (wex L79I) 2.7 3.9 0.9
- Substitution of is meant to significantly improve the activity of Wex's L-tryptophan excretion capacity not only in the microorganisms of the genus Corynebacterium, but also in the microorganisms of the genus Escherichia.
- Example 20 Substitution of amino acid No. 80 of the Wex sequence and a hydrophobic amino acid of serine in a microorganism of the genus Escherichia.
- serine 80 of the Wex amino acid sequence was used as a hydrophobic amino acid, alanine (A) (SEQ ID NO: 89, SEQ ID NO: 134), valine (V) (SEQ ID NO: 90, SEQ ID NO: 135), leucine (L) (SEQ ID NO: 91, sequence Number 136), isoleucine (I) (SEQ ID NO: 92, SEQ ID NO: 137) was carried out in the same manner as in Example 19, the mutagenic primer set used to secure the pCL1920-PyccA-wex variant plasmid and The variant form is the same as in [Table 25].
- a mutagenic primer set for the production of amino acid variant 80 of the Wex amino acid sequence for expression in Escherichia microorganisms Variant Wex Plasmid SEQ ID ## Base sequence pCL1920-PyccA-wex S80A 93 GTCCTACGAACTCTGCCTG GCA CTCTCCATCGGTTATGCC 94 GGCATAACCGATGGAGAG TGC CAGGCAGAGTTCGTAGGAC pCL1920-PyccA-wex S80V 95 GTCCTACGAACTCTGCCTG GTG CTCCATCGGTTATGCC 96 GGCATAACCGATGGAGAG CAC CAGGCAGAGTTCGTAGGAC pCL1920-PyccA-wex S80L 97 GTCCTACGAACTCTGCCTG CTG CTCTCCATCGGTTATGCC 98 GGCATAACCGATGGAG CAG CAGGCAGAGTTCGTAGGAC pCL1920-PyccA-wex S80I 99 GTCCTAC
- the pCL1920-PyccA-wex S80A, pCL1920-PyccA-wex S80V, pCL1920-PyccA-wex S80L, pCL1920-PyccA-wex S80I vectors prepared as in [Table 25] were transformed into CA04-4303 by electroporation, respectively. , Four different strains were obtained in which different wex 80 amino acid variant genes were introduced, respectively. The transformed strains thus obtained were named CA04-4303 (wex S80A), CA04-4303 (wex S80V), CA04-4303 (wex S80L), and CA04-4303 (wex S80I), respectively.
- E. coli L-tryptophan-producing strain (CA04-4303 (pCL1920)) and L-tryptophan-releasing gene (Wex)-expressing strain (CA04-4306), and amino acid mutation strain 80 of the Wex amino acid sequence (CA04-4303 (wex S80A)) , CA04-4303 (wex S80V), CA04-4303 (wex S80L), CA04-4303 (wex S80I)) L-tryptophan production check Strain name Tryptophan production (g/L) Tryptophan yield (g/g glc, %) Improved yield compared to wild type Wex ( ⁇ ,%p) CA04-4303 (pCL1920) 1.4 2.0 - CA04-4306 2.1 3.0 - CA04-4303 (wex S80A) 2.7 3.9 0.9 CA04-4303 (wex S80V) 2.9 4.2 1.2 CA04-4303 (wex S80L) 2.6 3.7 0.7 CA04-4303 (wex S80I) 2.3
- Example 21 Substitution of amino acid 81 of the Wex sequence and a hydrophobic amino acid of Leucine in a microorganism of the genus Escherichia.
- leucine 81 of the Wex amino acid sequence was used as a hydrophobic amino acid, alanine (A) (SEQ ID NO: 101, SEQ ID NO: 138), valine (V) (SEQ ID NO: 102, SEQ ID NO: 139), isoleucine (I) (SEQ ID NO: 103, sequence No. 140) was carried out in the same manner as in Example 19, and the mutagenic primer set and variant form used to secure the pCL1920-PyccA-wex mutant plasmid are the same as in [Table 27].
- a set of mutagenic primers for the production of amino acid variant 81 of the Wex amino acid sequence for expression in Escherichia microorganisms Variant Wex Plasmid SEQ ID ## Base sequence pCL1920-PyccA-wex L81A 104 CCTACGAACTCTGCCTGTCG GCA TCCATCGGTTATGCCAATAC 105 GTATTGGCATAACCGATGGA TGC CGACAGGCAGAGTTCGTAGG pCL1920-PyccA-wex L81V 106 CCTACGAACTCTGCCTGTCG GTG TCCATCGGTTATGCCAATAC 107 GTATTGGCATAACCGATGGA CAC CGACAGGCAGAGTTCGTAGG pCL1920-PyccA-wex L81I 108 CCTACGAACTCTGCCTGTCG ATC TCCATCGGTTATGCCAATAC 109 GTATTGGCATAACCGATGGA GAT CGACAGGCAGAGTTCGTAGG
- the pCL1920-PyccA-wex L81A, pCL1920-PyccA-wex L81V, and pCL1920-PyccA-wex L81I vectors prepared as shown in [Table 27] were transformed into CA04-4303 by electroporation, respectively, and different amino acids wex 81 Three strains into which the mutant gene was each introduced were obtained. The transformed strains thus obtained were named CA04-4303 (wex L81A), CA04-4303 (wex L81V), and CA04-4303 (wex L81I), respectively.
- CA04-4303 (pCL1920), CA04-4306, CA04-4303 (wex L81A), CA04-4303 (wex L81V), CA04-4303 (wex L81I) to determine the L-tryptophan production of strains in the same manner as in Example 12 Cultured. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- E. coli L-tryptophan-producing strain (CA04-4303 (pCL1920)) and L-tryptophan-releasing gene (Wex)-expressing strain (CA04-4306), and amino acid mutation 81 of the Wex amino acid sequence (CA04-4303 (wex L81A)) , CA04-4303 (wex L81V), CA04-4303 (wex L81I)) L-tryptophan production check Strain name Tryptophan production (g/L) Tryptophan yield (g/g glc, %) Improved yield compared to wild type Wex ( ⁇ ,%p) CA04-4303 (pCL1920) 1.4 2.0 - CA04-4306 2.1 3.0 - CA04-4303 (wex L81A) 3.4 4.8 1.8 CA04-4303 (wex L81V) 2.9 4.1 1.1 CA04-4303 (wex L81I) 2.8 4.0 1.0
- Substitution of is meant to significantly improve the activity of Wex's L-tryptophan excretion capacity not only in the microorganisms of the genus Corynebacterium, but also in the microorganisms of the genus Escherichia.
- Example 22 Substitution of amino acid 82 and serine to hydrophobic amino acid of Wex sequence in microorganisms of the genus Escherichia.
- serine 82 of the Wex amino acid sequence is hydrophobic amino acids alanine (A) (SEQ ID NO: 110, SEQ ID NO: 141), valine (V) (SEQ ID NO: 111, SEQ ID NO: 142), leucine (L) (SEQ ID NO: 112, sequence Number 143) and isoleucine (I) (SEQ ID NO: 113, SEQ ID NO: 144) was carried out in the same manner as in Example 19, and the mutagenic primer set used to secure the pCL1920-PyccA-wex variant plasmid and The variant form is the same as in [Table 29].
- a mutagenic primer set for the production of amino acid variant 82 of the Wex amino acid sequence for expression in Escherichia microorganisms Variant Wex Plasmid SEQ ID ##
- Base sequence pCL1920-PyccA-wex S82A 114 CGAACTCTGCCTGTCGCTC GCA ATCGGTTATGCCAATACAG 115 CTGTATTGGCATAACCGAT TGC GAGCGACAGGCAGAGTTCG pCL1920-PyccA-wex S82V 116 CGAACTCTGCCTGTCGCTC GTG ATCGGTTATGCCAATACAG 117 CTGTATTGGCATAACCGAT CAC GAGCGACAGGCAGAGTTCG pCL1920-PyccA-wex S82L 118 CGAACTCTGCCTGTCGCTC CTG ATCGGTTATGCCAATACAG 119 CTGTATTGGCATAACCGAT CAG GAGCGACAGGCAGAGTTCG pCL1920-PyccA-wex
- the pCL1920-PyccA-wex S82A, pCL1920-PyccA-wex S82V, pCL1920-PyccA-wex S82L, pCL1920-PyccA-wex S82I vectors prepared as in [Table 29] were transformed into CA04-4303 by electroporation, respectively.
- Four different strains were obtained in which different wex 82 amino acid variant genes were introduced, respectively.
- the transformed strains thus obtained were named CA04-4303 (wex S82A), CA04-4303 (wex S82V), CA04-4303 (wex S82L), and CA04-4303 (wex S82I), respectively.
- E. coli L-tryptophan-producing strain (CA04-4303 (pCL1920)) and L-tryptophan-releasing gene (Wex)-expressing strain (CA04-4306), amino acid mutant strain of the Wex amino acid sequence at amino acid 82 (CA04-4303 (wex S82A)) , Confirmation of L-tryptophan production of CA04-4303(wex S82V), CA04-4303(wex S82L), CA04-4303(wex S82I)) Strain name Tryptophan production (g/L) Tryptophan yield (g/g glc, %) Improved yield compared to wild type Wex ( ⁇ ,%p) CA04-4303 (pCL1920) 1.4 2.0 - CA04-4306 2.1 3.0 - CA04-4303 (wex S82A) 2.9 4.2 1.2 CA04-4303 (wex S82V) 3.1 4.4 1.4 CA04-4303 (wex S82L) 2.4 3.4 0.4 CA04-4303 (w
- Example 23 Substitution of amino acid 83 of the Wex sequence, isoleucine with a hydrophobic amino acid in a microorganism of the genus Escherichia.
- isoleucine at No. 83 of the Wex amino acid sequence is used as a hydrophobic amino acid
- alanine (A) (SEQ ID NO: 122, SEQ ID NO: 145), valine (V) (SEQ ID NO: 123, SEQ ID NO: 146), leucine (L) (SEQ ID NO: 124, sequence Number 147) was carried out in the same manner as in Example 19, and the mutagenic primer set and variant form used to secure the pCL1920-PyccA-wex mutant plasmid are the same as in [Table 31].
- a mutagenic primer set for the production of amino acid variant 83 plasmid of the Wex amino acid sequence for expression in Escherichia microorganisms Variant Wex Plasmid SEQ ID ## Base sequence pCL1920-PyccA-wex I83A 125 GAACTCTGCCTGTCGCTCTCC GCA GGTTATGCCAATACAGGCAGG 126 CCTGCCTGTATTGGCATAACC TGC GGAGAGCGACAGGCAGAGTTC pCL1920-PyccA-wex I83V 127 GAACTCTGCCTGTCGCTCTCC GTG GGTTATGCCAATACAGGCAGG 128 CCTGCCTGTATTGGCATAACC CAC GGAGAGCGACAGGCAGAGTTC pCL1920-PyccA-wex I83L 129 GAACTCTGCCTGTCGCTCTCC CTG GGTTATGCCAATACAGGCAGG 130 CCTGCCTGTATTGGCATAACC CAG GGAGAGCGACAGGCAGAGTTC
- the pCL1920-PyccA-wex I83A, pCL1920-PyccA-wex I83V, and pCL1920-PyccA-wex I83L vectors prepared as shown in [Table 31] were transformed into CA04-4303 by electroporation, respectively, and different amino acids wex 83 Three strains into which the mutant gene was each introduced were obtained. The transformed strains thus obtained were named CA04-4303 (wex I83A), CA04-4303 (wex I83V), and CA04-4303 (wex I83L), respectively.
- CA04-4303 (pCL1920), CA04-4306, CA04-4303 (wex I83A), CA04-4303 (wex I83V), CA04-4303 (wex I83L) to determine the L-tryptophan production of strains in the same manner as in Example 12 Cultured. After completion of the culture, the production amount of L-tryptophan was measured by HPLC.
- E. coli L-tryptophan-producing strain (CA04-4303 (pCL1920)) and L-tryptophan-releasing gene (Wex)-expressing strain (CA04-4306), and the 83rd amino acid mutation strain of the Wex amino acid sequence (CA04-4303 (wex I83A)) , CA04-4303 (wex I83V), CA04-4303 (wex I83L)) L-tryptophan production check Strain name Tryptophan production (g/L) Tryptophan yield (g/g glc, %) Improved yield compared to wild type Wex ( ⁇ ,%p) CA04-4303 (pCL1920) 1.4 2.0 - CA04-4306 2.1 3.0 - CA04-4303 (wex I83A) 2.2 3.2 0.2 CA04-4303 (wex I83V) 2.3 3.3 0.3 CA04-4303 (wex I83L) 2.6 3.7 0.7
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112021000765-2A BR112021000765B1 (pt) | 2019-04-05 | 2020-03-20 | Variante de proteína de exportação de l-triptofano e seu uso, polinucleotídeo que codifica a dita variante, vetor, microrganismo que produz l-triptofano e método para produzir l- triptofano |
| RU2020139396A RU2763603C1 (ru) | 2019-04-05 | 2020-03-20 | Новый вариант белка-экспортера l-триптофана и способ получения l-триптофана с его применением |
| CN202080004146.7A CN112823165B (zh) | 2019-04-05 | 2020-03-20 | 新型l-色氨酸输出蛋白变体及使用其生产l-色氨酸的方法 |
| CA3105666A CA3105666C (en) | 2019-04-05 | 2020-03-20 | Novel l-tryptophan-exporting protein variant and method for producing l-tryptophan using the same |
| EP20784578.5A EP3789398A4 (en) | 2019-04-05 | 2020-03-20 | Novel L-TRYPTOPHANE EXPORT PROTEIN VARIANT AND METHOD FOR MANUFACTURING L-TRYPTOPHANE USING THEREOF |
| MX2021000685A MX2021000685A (es) | 2019-04-05 | 2020-03-20 | Novedosa variante de proteina exportadora de l-triptofano y procedimiento para producir l-triptofano utilizando el mismo. |
| JP2021517540A JP7539871B2 (ja) | 2019-04-05 | 2020-03-20 | 新規l-トリプトファン排出タンパク質変異体及びそれを用いてl-トリプトファンを生産する方法 |
| US17/268,691 US11524981B2 (en) | 2019-04-05 | 2020-03-20 | L-tryptophan-exporting protein variant and method for producing L-tryptophan using the same |
| JP2022155934A JP2022185040A (ja) | 2019-04-05 | 2022-09-29 | 新規l-トリプトファン排出タンパク質変異体及びそれを用いてl-トリプトファンを生産する方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020190040397A KR102205717B1 (ko) | 2019-04-05 | 2019-04-05 | 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법 |
| KR10-2019-0040397 | 2019-04-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020204427A1 true WO2020204427A1 (ko) | 2020-10-08 |
Family
ID=72666413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/003855 Ceased WO2020204427A1 (ko) | 2019-04-05 | 2020-03-20 | 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법 |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US11524981B2 (https=) |
| EP (1) | EP3789398A4 (https=) |
| JP (2) | JP7539871B2 (https=) |
| KR (1) | KR102205717B1 (https=) |
| CN (1) | CN112823165B (https=) |
| BR (1) | BR112021000765B1 (https=) |
| CA (1) | CA3105666C (https=) |
| MX (1) | MX2021000685A (https=) |
| RU (1) | RU2763603C1 (https=) |
| WO (1) | WO2020204427A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4060037A4 (en) * | 2021-01-25 | 2023-01-25 | CJ Cheiljedang Corporation | NEW TAUTOMERASE PPTA VARIANT AND METHOD FOR PRODUCTION OF L-TRYPTOPHAN THEREOF |
| US20230272441A1 (en) * | 2020-05-27 | 2023-08-31 | Cj Cheiljedang Corporation | Novel l-tyrosine-exporting protein variant and method for producing l-tyrosine using the same |
| JP2023550754A (ja) * | 2020-12-09 | 2023-12-05 | シージェイ チェルジェダン コーポレイション | シュワネラ・オネイデンシス由来蛋白質を発現する微生物、およびこれを利用したl-アミノ酸の生産方法 |
| WO2024090885A1 (ko) * | 2022-10-24 | 2024-05-02 | 대상 주식회사 | Dna-결합 전사 제어인자 malt 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법 |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102284728B1 (ko) * | 2021-01-25 | 2021-08-02 | 씨제이제일제당 주식회사 | 신규한 H(+)/Cl(-) 익스체인지 트랜스포터 변이체 및 이를 이용한 L-트립토판 생산 방법 |
| KR102284725B1 (ko) * | 2021-01-25 | 2021-08-02 | 씨제이제일제당 주식회사 | 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법 |
| KR102284727B1 (ko) * | 2021-01-25 | 2021-08-02 | 씨제이제일제당 주식회사 | 신규한 단백질 HtrL 변이체 및 이를 이용한 L-트립토판 생산 방법 |
| KR102284729B1 (ko) * | 2021-01-29 | 2021-08-02 | 씨제이제일제당 주식회사 | 신규한 시아네이트 트랜스포터 패밀리 단백질변이체 및 이를 이용한 l-트립토판 생산 방법 |
| KR102688095B1 (ko) * | 2021-04-28 | 2024-07-24 | 씨제이제일제당 주식회사 | 변이형 SpoT 단백질 및 이를 이용한 L-아미노산을 생산하는 방법 |
| KR102771797B1 (ko) * | 2022-10-24 | 2025-02-25 | 대상 주식회사 | GlpM 패밀리 단백질 신규 변이체 및 이를 이용한 L-방향족 아미노산의 생산 방법 |
| WO2024090884A1 (ko) * | 2022-10-24 | 2024-05-02 | 대상 주식회사 | 페닐알라닌:h+ 동시수송체 phep 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법 |
| KR102877975B1 (ko) * | 2022-12-28 | 2025-10-31 | 씨제이제일제당 주식회사 | 외래 글루타민 신테타제가 도입된 미생물 및 이를 이용한 l-트립토판의 생산 방법 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101023925B1 (ko) * | 2001-11-23 | 2011-03-22 | 아지노모토 가부시키가이샤 | 에세리키아속 세균을 사용한 l-아미노산의 제조방법 |
| KR101142885B1 (ko) * | 2003-12-15 | 2012-05-10 | 씨제이제일제당 (주) | 트립토판 생합성 관련 변이유전자를 함유한 대장균 변이주및 이를 이용한 트립토판 제조방법 |
| KR20180089329A (ko) * | 2018-02-23 | 2018-08-08 | 씨제이제일제당 (주) | L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법 |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19548222A1 (de) | 1995-12-22 | 1997-06-26 | Forschungszentrum Juelich Gmbh | Verfahren zur mikrobiellen Herstellung von Aminosäuren durch gesteigerte Aktivität von Exportcarriern |
| RU2148642C1 (ru) | 1998-12-23 | 2000-05-10 | ЗАО "Научно-исследовательский институт АДЖИНОМОТО-Генетика" (ЗАО "АГРИ") | Фрагмент днк rhtc, кодирующий синтез белка rhtc, придающего повышенную устойчивость к l-треонину бактериям escherichia coli, и способ получения l-аминокислоты |
| RU2175351C2 (ru) | 1998-12-30 | 2001-10-27 | Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО "АГРИ") | Фрагмент днк из escherichia coli, определяющий повышенную продукцию l-аминокислот (варианты), и способ получения l-аминокислот |
| DE102004037572A1 (de) * | 2004-08-03 | 2006-02-23 | Degussa Ag | Verfahren zur Herstellung von L-Aminosäuren unter Verwendung von Stämmen der Familie Enterobacteriaceae |
| EP1930432A4 (en) | 2005-09-01 | 2010-04-14 | Suntory Holdings Ltd | TRYPTOPHANTRANSPORTER GEN AND USE THEREOF |
| CN101273138A (zh) * | 2005-09-27 | 2008-09-24 | 味之素株式会社 | 产生l-氨基酸的细菌和用于产生l-氨基酸的方法 |
| EP1979486B1 (en) * | 2006-01-30 | 2013-04-17 | Ajinomoto Co., Inc. | L-amino acid producing bacterium and method of producing l-amino acid |
| JP2009165355A (ja) * | 2006-04-28 | 2009-07-30 | Ajinomoto Co Inc | L−アミノ酸を生産する微生物及びl−アミノ酸の製造法 |
| DE102006032634A1 (de) * | 2006-07-13 | 2008-01-17 | Evonik Degussa Gmbh | Verfahren zur Herstellung von L-Aminosäuren |
| JP6449653B2 (ja) | 2012-01-10 | 2019-01-09 | シージェイ チェイルジェダン コーポレーションCj Cheiljedang Corporation | L−トリプトファン産生能が強化されたエシェリキア属微生物及びこれを用いてl−トリプトファンを産生する方法 |
| CN107002074B (zh) * | 2015-06-10 | 2021-08-10 | 公立大学法人富山县立大学 | 活性型突变酶的制造方法及活性型突变酶、以及可溶性化突变蛋白的制造方法 |
| JP6895992B2 (ja) | 2016-12-22 | 2021-06-30 | 昭和電工株式会社 | 接着剤、これを用いた積層体、電池外装材、並びに電池ケース及びその製造方法 |
| KR101968317B1 (ko) * | 2018-02-23 | 2019-04-11 | 씨제이제일제당 주식회사 | 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법 |
-
2019
- 2019-04-05 KR KR1020190040397A patent/KR102205717B1/ko active Active
-
2020
- 2020-03-20 JP JP2021517540A patent/JP7539871B2/ja active Active
- 2020-03-20 WO PCT/KR2020/003855 patent/WO2020204427A1/ko not_active Ceased
- 2020-03-20 US US17/268,691 patent/US11524981B2/en active Active
- 2020-03-20 MX MX2021000685A patent/MX2021000685A/es unknown
- 2020-03-20 BR BR112021000765-2A patent/BR112021000765B1/pt active IP Right Grant
- 2020-03-20 EP EP20784578.5A patent/EP3789398A4/en active Pending
- 2020-03-20 CN CN202080004146.7A patent/CN112823165B/zh active Active
- 2020-03-20 CA CA3105666A patent/CA3105666C/en active Active
- 2020-03-20 RU RU2020139396A patent/RU2763603C1/ru active
-
2022
- 2022-09-29 JP JP2022155934A patent/JP2022185040A/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101023925B1 (ko) * | 2001-11-23 | 2011-03-22 | 아지노모토 가부시키가이샤 | 에세리키아속 세균을 사용한 l-아미노산의 제조방법 |
| KR101142885B1 (ko) * | 2003-12-15 | 2012-05-10 | 씨제이제일제당 (주) | 트립토판 생합성 관련 변이유전자를 함유한 대장균 변이주및 이를 이용한 트립토판 제조방법 |
| KR20180089329A (ko) * | 2018-02-23 | 2018-08-08 | 씨제이제일제당 (주) | L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법 |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE Protein 16 October 2017 (2017-10-16), "drug/metabolite DMT transporter permease [Herbaspirillum rhizosphaerae]", XP055746643, retrieved from NCBI Database accession no. WP_050478745.1 * |
| WANG, JIAN ET AL.: "Genetic engineering of Escherichia coli to enhance production of L-tryptophan", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 97, no. 17, 2013, pages 7587 - 7596, XP035328764, DOI: 10.1007/s00253-013-5026-3 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230272441A1 (en) * | 2020-05-27 | 2023-08-31 | Cj Cheiljedang Corporation | Novel l-tyrosine-exporting protein variant and method for producing l-tyrosine using the same |
| US12545939B2 (en) * | 2020-05-27 | 2026-02-10 | Cj Cheiljedang Corporation | L-tyrosine-exporting protein variant and method for producing l-tyrosine using the same |
| JP2023550754A (ja) * | 2020-12-09 | 2023-12-05 | シージェイ チェルジェダン コーポレイション | シュワネラ・オネイデンシス由来蛋白質を発現する微生物、およびこれを利用したl-アミノ酸の生産方法 |
| JP7774625B2 (ja) | 2020-12-09 | 2025-11-21 | シージェイ チェイルジェダン コーポレーション | シュワネラ・オネイデンシス由来蛋白質を発現する微生物、およびこれを利用したl-アミノ酸の生産方法 |
| EP4060037A4 (en) * | 2021-01-25 | 2023-01-25 | CJ Cheiljedang Corporation | NEW TAUTOMERASE PPTA VARIANT AND METHOD FOR PRODUCTION OF L-TRYPTOPHAN THEREOF |
| WO2024090885A1 (ko) * | 2022-10-24 | 2024-05-02 | 대상 주식회사 | Dna-결합 전사 제어인자 malt 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20200118334A (ko) | 2020-10-15 |
| BR112021000765A2 (pt) | 2021-04-13 |
| US11524981B2 (en) | 2022-12-13 |
| CN112823165B (zh) | 2024-03-26 |
| MX2021000685A (es) | 2021-03-25 |
| CN112823165A (zh) | 2021-05-18 |
| JP7539871B2 (ja) | 2024-08-26 |
| RU2763603C1 (ru) | 2021-12-30 |
| EP3789398A4 (en) | 2021-08-25 |
| JP2021525108A (ja) | 2021-09-24 |
| CA3105666A1 (en) | 2020-10-08 |
| EP3789398A1 (en) | 2021-03-10 |
| JP2022185040A (ja) | 2022-12-13 |
| US20220009973A1 (en) | 2022-01-13 |
| BR112021000765B1 (pt) | 2022-05-10 |
| KR102205717B1 (ko) | 2021-01-22 |
| CA3105666C (en) | 2023-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2020204427A1 (ko) | 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법 | |
| WO2019164348A1 (ko) | 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법 | |
| WO2021049866A1 (ko) | L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법 | |
| WO2021261733A1 (ko) | L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법 | |
| WO2021125896A1 (ko) | 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법 | |
| WO2021150029A1 (ko) | Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 l-아미노산을 생산하는 방법 | |
| WO2017069578A1 (ko) | L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법 | |
| WO2020226341A1 (ko) | L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법 | |
| WO2019017706A2 (ko) | 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법 | |
| WO2022163951A1 (ko) | 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법 | |
| WO2022244932A1 (ko) | 신규 프로모터 및 이의 용도 | |
| WO2022124708A1 (ko) | 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법 | |
| WO2022231036A1 (ko) | 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법 | |
| WO2023054881A1 (ko) | 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법 | |
| WO2022164118A1 (ko) | 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법 | |
| WO2021060701A1 (ko) | 메조 디아미노피멜레이트 디하이드로게네이즈 변이형 폴리펩타이드 및 이를 이용한 l-쓰레오닌 생산방법 | |
| WO2022225075A1 (ko) | 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법 | |
| WO2024215141A1 (ko) | 피루브산 탈수소효소 복합체 디히드로리포일리신-잔기 아세틸트랜스퍼라제의 활성이 증가된 미생물 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2025226086A1 (ko) | 플라빈 함유 모노옥시게네이즈 변이체 및 이를 이용한 인디고 생산 방법 | |
| WO2024123109A1 (ko) | 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 | |
| WO2021153866A1 (ko) | 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2023054882A1 (ko) | 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법 | |
| WO2023191263A1 (ko) | O-아세틸 호모세린 생산 미생물 및 이를 이용한 o-아세틸 호모세린 또는 l-메치오닌 생산 방법 | |
| WO2022124786A1 (ko) | 신규한 감마-아미노부티르산 퍼미에이즈 변이체 및 이를 이용한 이소류신 생산 방법 | |
| WO2021242032A1 (ko) | 신규 l-타이로신 배출 단백질 변이체 및 이를 이용한 l-타이로신을 생산하는 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20784578 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2021517540 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20784578.5 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2020784578 Country of ref document: EP Effective date: 20201203 |
|
| ENP | Entry into the national phase |
Ref document number: 3105666 Country of ref document: CA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021000765 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112021000765 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210115 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWG | Wipo information: grant in national office |
Ref document number: MX/A/2021/000685 Country of ref document: MX |