Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
  • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
  • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
  • A61K47/6807—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/713—Double-stranded nucleic acids or oligonucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
  • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
  • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
  • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
  • C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
  • A61K9/51—Nanocapsules; Nanoparticles
  • A61K9/5107—Excipients; Inactive ingredients
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/35—Nature of the modification
  • C12N2310/351—Conjugate
  • C12N2310/3513—Protein; Peptide
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/35—Nature of the modification
  • C12N2310/351—Conjugate
  • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/31—Combination therapy
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

• RNA interference provides long lasting effect over multiple cell divisions. As such, RNAi represents a viable method useful for drug target validation, gene function analysis, pathway analysis, and disease therapeutics.
• polynucleic acid molecules and pharmaceutical compositions for modulating a gene associated with muscle atrophy are also described herein.
• methods of treating muscle atrophy with a polynucleic acid molecule or a polynucleic acid molecule conjugate disclosed herein.
• -B-X 2 -C (Formula I) wherein, A is a binding moiety; B is a polynucleotide that hybridizes to a target sequence of an atrogene; C is a polymer; and Xi and X 2 are each independently selected from a bond or a non polymeric linker; wherein the polynucleotide comprises at least one 2’ modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein A and C are not attached to B at the same terminus.
• the atrogene comprises a differentially regulated (e.g., an upregulated or downregulated) gene within the IGFl-Akt-FoxO pathway, the glucocorticoids-GR pathway, the PGCla-FoxO pathway, the TNFQ-NFKB pathway, or the myostatin- ActRIIb-Smad2/3 pathway.
• the atrogene encodes an E3 ligase.
• the atrogene encodes a Forkhead box transcription factor.
• the atrogene comprises atrogin-l gene ( FBX032 ), MuRFl gene ( TRIM63 ), FOXOl, FOX03, or MSTN.
• the atrogene comprises DMPK.
• B consists of a differentially regulated (e.g., an upregulated or downregulated) gene within the IGFl-Akt-FoxO pathway, the glucocorticoids-GR pathway, the PGCla-FoxO pathway, the TNFQ-NFKB pathway, or
• the at least one 2’ modified nucleotide comprises 2’-0-methyl, 2’-0- methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0- AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide.
• the at least one 2’ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
• the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
• the at least one inverted abasic moiety is at at least one terminus.
• the polynucleotide comprises a single strand which hybridizes to the target sequence of an atrogene.
• the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double -stranded polynucleic acid molecule, wherein either the first
• polynucleotide or the second polynucleotide also hybridizes to the target sequence of an atrogene.
• the second polynucleotide comprises at least one modification.
• the first polynucleotide and the second polynucleotide are RNA molecules.
• the polynucleotide hybridizes to at least 8 contiguous bases of the target sequence of an atrogene.
• the polynucleotide comprises a sequence that is at least 60%, 70%, 80%, 85%, 90%, 95%, or 99% complementary to a sequence as set forth in SEQ ID NOs: 28-141, 370-480, and 703-3406.
• the polynucleotide is between about 8 and about 50 nucleotides in length. In some embodiments, the polynucleotide is between about 10 and about 30 nucleotides in length.
• the first polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• the second polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407- 14222.
• Xi and X 2 are independently a Ci-C 6 alkyl group. In some embodiments, Xi and X 2 are independently a homobifuctional linker or a heterobifimctional linker, optionally conjugated to a Ci-C 6 alkyl group. In some embodiments, A is an antibody or binding fragment thereof.
• A comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
• A is an anti- transferrin receptor antibody or binding fragment thereof.
• C is polyethylene glycol.
• A-Xi is conjugated to the 5’ end of B and X 2 -C is conjugated to the 3’ end of B.
• X 2 -C is conjugated to the 5’ end of B and A-Xi is conjugated to the 3’ end of B.
• A is directly conjugated to Xi.
• C is directly conjugated to X 2 .
• B is directly conjugated to Xi and X 2 .
• the molecule further comprises D.
• D is conjugated to C or to A.
• D is an endosomolytic polymer.
• a polynucleic acid molecule conjugate comprising a binding moiety conjugated to a polynucleotide that hybridizes to a target sequence of an atrogene; wherein the polynucleotide optionally comprises at least one 2’ modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein the polynucleic acid molecule conjugate mediates RNA interference against the atrogene, thereby treating muscle atrophy in a subject.
• the atrogene comprises a differentially regulated (e.g., an upregulated or dow nrcgulatcdjgcnc within the IGFl-Akt-FoxO pathway, the glucocorticoids -GR pathway, the PGCla- FoxO pathway, the TNFQ-NFKB pathway, or the myostatin-ActRIIb-Smad2/3 pathway.
• the atrogene encodes an E3 ligase.
• the atrogene encodes a Forkhead box transcription factor.
• the atrogene comprises ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins.
• the atrogene comprises DMPK.
• the binding moiety is an antibody or binding fragment thereof.
• the binding moiety comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
• the binding moiety is an anti-transferrin receptor antibody or binding fragment thereof.
• the binding moiety is cholesterol.
• the polynucleotide comprises a single strand which hybridizes to the target sequence of an atrogene.
• the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double - stranded polynucleic acid molecule, wherein either the first polynucleotide or the second polynucleotide also hybridizes to the target sequence of an atrogene.
• the second polynucleotide comprises at least one modification.
• the first polynucleotide and the second polynucleotide are RNA molecules.
• the polynucleotide hybridizes to at least 8 contiguous bases of the target sequence of an atrogene.
• the polynucleotide comprises a sequence that is at least 60%, 70%, 80%, 85%, 90%, 95%, or 99% complementary to a sequence as set forth in SEQ ID NOs: 28-141, 370-480, and 703-3406. In some embodiments, the polynucleotide is between about 8 and about 50 nucleotides in length. In some embodiments, the polynucleotide is between about 10 and about 30 nucleotides in length.
• the first polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• the second polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• the polynucleic acid molecule conjugate optionally comprises a linker connecting the binding moiety to the polynucleotide. In some embodiments, the polynucleic acid molecule conjugate further comprises a polymer, optionally indirectly conjugated to the polynucleotide by an additional linker. In some embodiments, the linker and the additional linker are each independently a bond or a non-polymeric linker.
• the polynucleic acid molecule conjugate comprises a molecule of Formula (I): A-X I -B-X 2 -C (Formula I) wherein, A is a binding moiety; B is a polynucleotide that hybridizes to a target sequence of an atrogene; C is a polymer; and Xi and X 2 are each independently selected from a bond or a non-polymeric linker; wherein the polynucleotide comprises at least one 2’ modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein A and C are not attached to B at the same terminus.
• A is a binding moiety
• B is a polynucleotide that hybridizes to a target sequence of an atrogene
• C is a polymer
• Xi and X 2 are each independently selected from a bond or a non-polymeric linker
• the at least one 2’ modified nucleotide comprises 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'- deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N- methylacetamido (2'-0-NMA) modified nucleotide.
• the at least one 2’ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
• the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a
• the muscle atrophy is a diabetes-associated muscle atrophy. In some embodiments, the muscle atrophy is a cancer cachexia-associated muscle atrophy. In some embodiments, the muscle atrophy is associated with insulin deficiency. In some embodiments, the muscle atrophy is associated with chronic renal failure. In some embodiments, the muscle atrophy is associated with congestive heart failure. In some embodiments, the muscle atrophy is associated with chronic respiratory disease. In some embodiments, the muscle atrophy is associated with a chronic infection. In some embodiments, the muscle atrophy is associated with fasting. In some embodiments, the muscle atrophy is associated with denervation.
• the muscle atrophy is associated with sarcopenia, glucocorticoid treatment, stroke, and/or heart attack.
• myotonic dystrophy type 1 (DM1) is associated with an expansion of CTG repeats in the 3’ UTR of the DMPK gene.
• a pharmaceutical composition comprising: a molecule described above or a polynucleic acid molecule conjugate described above; and a
• the pharmaceutical composition is formulated as a nanoparticle formulation. In some embodiments, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration.
• a method of treating muscle atrophy or myotonic dystrophy in a subject in need thereof comprising: administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate comprising a binding moiety conjugated to a polynucleotide that hybridizes to a target sequence of an atrogene; wherein the polynucleotide optionally comprises at least one 2’ modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein the polynucleic acid molecule conjugate mediates RNA interference against the atrogene, thereby treating muscle atrophy or myotonic dystrophy in the subject.
• the muscle atrophy is a diabetes-associated muscle atrophy. In some embodiments, the muscle atrophy is a diabetes-associated muscle atrophy.
• the muscle atrophy is a cancer cachexia-associated muscle atrophy. In some embodiments, the muscle atrophy is associated with insulin deficiency. In some embodiments, the muscle atrophy is associated with chronic renal failure. In some embodiments, the muscle atrophy is associated with congestive heart failure. In some embodiments, the muscle atrophy is associated with chronic respiratory disease. In some embodiments, the muscle atrophy is associated with a chronic infection. In some embodiments, the muscle atrophy is associated with fasting. In some embodiments, the muscle atrophy is associated with denervation. In some embodiments, the muscle atrophy is associated with sarcopenia. In some embodiments, the myotonic dystrophy is DM1.
• the atrogene comprises a differently regulated (e.g., an upregulated or downregulated) gene within the IGFl-Akt-FoxO pathway, the glucocorticoids -GR pathway, the PGCla-FoxO pathway, the TNFa-NFi ⁇ B pathway, or the myostatin- ActRIIb-Smad2/3 pathway.
• the atrogene encodes an E3 ligase.
• the atrogene encodes a Forkhead box transcription factor.
• the atrogene comprises atrogin-l gene ( FBX032 ), MuRFl gene ( TRIM63 ), FOXOl, F0X03, or MSTN.
• the atrogene comprises DMPK.
• the polynucleic acid molecule conjugate comprises a molecule of Formula (I): A-X r B-X 2 -C (Formula I) wherein, A is a binding moiety; B is a polynucleotide that hybridizes to the target sequence of an atrogene; C is a polymer; and Xi and X 2 are each independently selected from a bond or a non-polymeric linker; wherein the polynucleotide comprises at least one 2’ modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein A and C are not attached to B at the same terminus.
• B consists of a polynucleotide that hybridizes to the target sequence of an atrogene.
• C consists of a polymer.
• the at least one 2’ modified nucleotide comprises 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'- deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N- methylacetamido (2'-0-NMA) modified nucleotide.
• the at least one 2’ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
• the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a
• the polynucleotide comprises a single strand which hybridizes to the target sequence of an atrogene. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double- stranded polynucleic acid molecule, wherein either the first polynucleotide or the second polynucleotide also hybridizes to the target sequence of an atrogene. In some embodiments, the second polynucleotide comprises at least one modification.
• the first polynucleotide and the second polynucleotide are RNA molecules.
• the polynucleotide hybridizes to at least 8 contiguous bases of the target sequence of an atrogene.
• the polynucleotide comprises a sequence that is at least 60%, 70%, 80%, 85%, 90%, 95%, or 99% complementary to a sequence as set forth in SEQ ID NOs: 28-141, 370-480, and 703-3406.
• the polynucleotide is between about 8 and about 50 nucleotides in length. In some embodiments, the polynucleotide is between about 10 and about 30 nucleotides in length.
• the first polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• the second polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• Xi and X 2 are independently a Ci-C 6 alkyl group. In some embodiments, Xi and X 2 are independently a
• A is an antibody or binding fragment thereof.
• A comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
• A is an anti -transferrin receptor antibody or binding fragment thereof.
• C is polyethylene glycol.
• A-Xi is conjugated to the 5’ end of B and X 2 -C is conjugated to the 3’ end of B. In some embodiments, X 2 -C is conjugated to the 5’ end of B and A-Xi is conjugated to the 3’ end of B. In some embodiments, A is directly conjugated to Xi. In some embodiments, C is directly conjugated to X 2 . In some embodiments, B is directly conjugated to Xi and X 2 . In some embodiments, the method further comprises D. In some embodiments, D is conjugated to C or to A. In some embodiments, D is an endosomolytic polymer. In some embodiments, the polynucleic acid molecule conjugate is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration. In some embodiments, the subject is a human.
• kits comprising a molecule described above or a polynucleic acid molecule conjugate described above.
• Fig. 1 illustrates an exemplary structure of cholesterol-myostatin siRNA conjugate.
• Fig. 2 illustrates SAX HPFC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1.
• Fig. 3 illustrates SEC HPFC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1.
• Fig. 4 illustrates an overlay of DAR1 and DAR2 SAX HPFC chromatograms of TfRlmAb- Cys-BisMal-siRNA conjugates.
• Fig. 5 illustrates an overlay of DAR1 and DAR2 SEC HPFC chromatograms of TfRlmAb- Cys-BisMal-siRNA conjugates.
• Fig. 6 illustrates SEC chromatogram of CD71 Fab-Cys-HPRT-PEG5.
• Fig. 7 illustrates SAX chromatogram of CD71 Fab-Cys-HPRT-PEG5.
• Fig. 8 illustrates relative expression levels of Murfl and atrogin-l in C2C12 myoblasts and myotubes
• C2C12 myoblasts and myotubes were generated as described in Example 4.
• mRNA levels were determined as described in Example 4.
• Fig. 9A illustrates in vivo study design to assess the ability of exemplary conjugates for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle.
• MSTN myostatin
• Fig. 9B shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) muscle.
• Fig. 10A illustrates in vivo study design to assess the ability of exemplary conjugates for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle.
• MSTN myostatin
• Fig. 10B shows tissue concentration-time profiles out to 1008 h post-dose of an exemplary molecule of Formula (I).
• Fig. 10C shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) muscle.
• Fig. 10D shows plasma MSTN protein reduction after siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) muscle.
• Fig. 10E shows changes in muscle size after siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) muscle.
• Fig. 10F shows Welch’s two-tailed unpaired t-test of Fig. 10E.
• Fig. 11A illustrates an exemplary in vivo study design.
• Fig. 11B shows tissue accumulation of siRNA in mouse gastrocnemius (gastroc) muscle after a single i.v. administration of an exemplary molecule of Formula (I) at the doses indicated.
• Fig. 11C shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) muscle.
• Fig. 12A illustrates an exemplary in vivo study design.
• Fig. 12B shows accumulation of siRNA in various muscle tissue.
• Fig. 12C shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc) and heart muscle.
• Fig. 12D shows RISC loading of the MSTN guide strand in mouse gastrocnemius (gastroc) muscle.
• Fig. 13A illustrates an exemplary in vivo study design.
• Fig. 13B shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastrocnemius (gastroc), quadriceps, triceps, and heart.
• Fig. 13C illustrates plasma myostatin levels.
• Fig. 13D illustrates siRNA accumulation in different tissue types: gastrocnemius, triceps, quadriceps, and heart tissues.
• Fig. 13E shows RISC loading of the MSTN guide strand in mouse gastrocnemius (gastroc) muscle.
• Fig. 13F shows change in muscle area.
• Fig. 13G shows Welch’s two-tailed unpaired t-test of Fig. 13F.
• Fig. 14A illustrates an exemplary in vivo study design.
• Fig. 14B shows HPRT mRNA expression of gastrocnemius muscle by exemplary conjugates described herein.
• Fig. 14C shows SSB mRNA expression of gastrocnemius muscle by exemplary conjugates described herein.
• FIG. 14D shows HPRT mRNA expression of heart tissue by exemplary conjugates described herein.
• Fig. 14E shows SSB mRNA expression of heart tissue by exemplary conjugates described herein.
• Fig. 14F shows accumulation of siRNA in gastrocnemius muscle.
• Fig. 15A illustrates an exemplary in vivo study design.
• Fig. 15B shows Atrogin-l downregulation in gastrocnemius (gastroc) muscle.
• Fig. 15C shows Atrogin-l downregulation in heart tissue.
• Fig. 16A illustrates an exemplary in vivo study design.
• Fig. 16B shows MuRF-l downregulation in gastrocnemius muscle.
• Fig. 16C shows MuRF-l downregulation in heart tissue.
• Fig. 17 illustrates siRNAs that were transfected into mouse C2C12 myoblasts in vitro.
• the dotted lines are three-parameter curves fit by non-linear regression.
• Fig. l8A-Fig. 18F show in vivo results demonstrating robust dose-responses for DMPK mRNA knockdown 7 days after a single i.v. administration of DMPK siRNA-antibody conjugates.
• Fig. 18A gastrocnemius
• Fig. 18B Tibialis anterior
• Fig. 18C quadriceps
• Fig. 18D diaphragm
• Fig. 18E heart
• Fig. 18F liver.
• Fig. l9A-Fig. 19L show exemplary antibody-nucleic acid conjugates described herein.
• Fig. 19M presents an antibody cartoon utilized in Fig. l9A-Fig. 19L.
• Fig. 20A-Fig. 20B illustrate an exemplary 2lmer duplex utilized in Example 20.
• Fig. 20A shows a representative structure of siRNA passenger strand with C6-NH 2 conjugation handle at the 5’ end and C6-S-NEM at 3’ end.
• Fig. 20B shows a representative structure of a 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs.
• Fig. 2lA-Fig. 21B illustrate a second exemplary 21 mer duplex utilized in Example 20.
• Fig. 21A shows a representative struture of siRNA passenger strand with a 5’ conjugation handle.
• Fig. 21B shows a representative structure of a blunt ended duplex with 19 bases of complementarity and one 3’ dinucleotide overhang.
• Fig. 22 shows an illustrative in vivo study design.
• Fig. 23 illustrates a time course of Atrogin-l mRNA downregulation in gastroc muscle mediated by a TfRl antibody siRNA conjugate after IV delivery at a dose of a single dose of 3 mg/kg.
• Fig. 24 illustrates a time course of Atrogin-l mRNA downregulation in heart muscle mediate by a TfRl antibody siRNA conjugate after IV delivery at a dose of a single dose of 3 mg/kg.
• Fig. 25 shows an illustrative in vivo study design.
• Fig. 26 shows MuRFl mRNA downregulation at 96 hours in gastroc muscle mediated by a TfRl antibody siRNA conjugate after IV delivery at the doses indicated.
• Fig. 27 shows MuRFl mRNA downregulation at 96 hours in heart muscle mediated by a TfRl antibody siRNA conjugate after IV delivery at the doses indicated.
• Fig. 28 shows atime course of MuRFl and Atrogin-l mRNA downregulation in gastroc muscle mediated by a TfRl antibody siRNA conjugate (IV delivery at 3 mg/kg siRNA), in the absence and presence of dexamethasone induce muscle atrophy.
• Fig. 29 shows atime course of MuRFl and Agtroginl mRNA downregulation in heart muscle mediated by a TfRl antibody siRNA conjugate (IV delivery at 3 mg/kg siRNA), in the absence and presence of dexamethasone induce muscle atrophy.
• Fig. 30 shows a time course of gastroc weight changes mediated by a TfRl antibody siRNA conjugate (IV delivery at 3 mg/kg siRNA), in the absence and presence of muscle atrophy.
• Fig. 31 shows a time course of siRNA tissue concentrations in gastroc and heart muscle mediated by a TfRl antibody siRNA conjugate (IV delivery at 3 mg/kg siRNA), in the absence and presence of muscle atrophy.
• Fig. 32 shows an illustrative in vivo study design.
• Fig. 33 shows Atrogin-l mRNA downregulation in gastroc muscle, 10 days after TfRl antibody siRNA conjugate, in the absence a presence of dexamethasone induced atrophy (initiated at day 7), relative to the measure concentration of siRNA in the tissue.
• Fig. 34 shows relative Atrogin-l mRNA levels in gastroc muscle for the scrambled control groups in the absence (groups 10&13, and groups 11&14)) and presence of dexamethasone induced atrophy (groups 12&15).
• Fig. 35 shows relative RISC loading of the Atrogin-l guide strand in mouse gastroc muscle after TfRl-mAb conjugate delivery in the absence and presence of dexamethasone induced atrophy.
• Fig. 36 shows atime course of MSTN mRNA downregulation in gastroc muscle after TfRl antibody siRNA conjugate delivery, in the absence (solid lines) and presence (dotted lines) of dexamethasone induced atrophy (initiated at day 7), relative to the PBS control.
• Fig. 37 shows leg muscle growth rate in gastroc muscle, after TfRl-mAb conjugate delivery in the absence and presence of dexamethasone induced atrophy.
• Fig. 38 shows an illustrative in vivo study design.
• Fig. 39A shows a single treatment of 4.5 mg/kg (siRNA) of either Atrogin-l siRNA or MuRFl siRNA or a single dose of both siRNAs combined resulted in up to 75% downregulation of each target in the gastrocnemius.
• Fig. 39B shows mRNA knockdown of both targets in gastrocnemius is maintained at 75% in the intact leg out to 37 days post ASC dose.
• Fig. 39C shows changes in muscle area.
• Fig. 39D shows changes in gastrocnemius weight.
• Fig. 39E shows treatment-induced percentage sparing of muscle wasting in term of leg muscle area.
• the statistical analysis compared the treatment groups to the scramble siRNA control group using a Welch’s TTest.
• Fig. 39F shows the treatment-induced percentage sparing of muscle wasting in term of gastrocnemius weight.
• Muscle atrophy is the loss of muscle mass or the progressive weakening and degeneration of muscles, such as skeletal or voluntary muscles that controls movement, cardiac muscles, and smooth muscles.
• Various pathophysiological conditions including disuse, starvation, cancer, diabetes, and renal failure, or treatment with glucocorticoids result in muscle atrophy and loss of strength.
• the phenotypical effects of muscle atrophy are induced by various molecular events, including inhibition of muscle protein synthesis, enhanced turnover of muscle proteins, abnormal regulation of satellite cells differentiation, and abnormal conversion of muscle fibers types.
• muscle atrophy is an active process controlled by specific signaling pathways and transcriptional programs.
• exemplary pathways involved in this process include, but are not limited to, IGFl-Akt-FoxO, glucocorticoids-GR, PGCla-FoxO, TNFQ-NFKB. and myostatin - ActRIIb-Smad2/3.
• Atrophy -related genes named atrogenes (Sacheck et al.,“Rapid disuse and denervation atrophy involve transcriptional changes similar to those of muscle wasting during systemic diseases”, The FASEB Journal, 21(7): 140- 155, 2007), that are commonly up- or downregulated in atrophying muscle.
• atrogenes Sacheck et al.,“Rapid disuse and denervation atrophy involve transcriptional changes similar to those of muscle wasting during systemic diseases”, The FASEB Journal, 21(7): 140- 155, 2007
• genes that are strongly upregulated under atrophy conditions are muscle -specific ubiquitin-protein (E3) ligases (e.g. atrogin-l, MuRFl), Forkhead box transcription factors, and proteins mediating stress responses. In some cases, many of these effector proteins are difficult to regulate using traditional drugs.
• Nucleic acid (e.g., RNAi) therapy is a targeted therapy with high selectivity and specificity.
• nucleic acid therapy is also hindered by poor intracellular uptake, limited blood stability and non-specific immune stimulation.
• various modifications of the nucleic acid composition are explored, such as for example, novel linkers for better stabilizing and/or lower toxicity, optimization of binding moiety for increased target specificity and/or target delivery, and nucleic acid polymer modifications for increased stability and/or reduced off-target effect.
• the arrangement or order of the different components that make-up the nucleic acid composition further effects intracellular uptake, stability, toxicity, efficacy, and/or non specific immune stimulation.
• the nucleic acid component includes a binding moiety, a polymer, and a polynucleic acid molecule (or polynucleotide)
• the order or arrangement of the binding moiety, the polymer, and/or the polynucleic acid molecule (or polynucleotide) e.g., binding moiety - polynucleic acid molecule-polymer, binding moiety-polymer-polynucleic acid molecule, or polymer binding moiety-polynucleic acid molecule
• polynucleic acid molecules and polynucleic acid molecule conjugates for the treatment of muscle atrophy or myotonic dystrophy.
• the polynucleic acid molecule conjugates described herein enhance intracellular uptake, stability, and/or efficacy.
• the polynucleic acid molecule conjugates comprise a molecule of Formula (I): A-X I -B-X 2 -C.
• Additional embodiments described herein include methods of treating muscle atrophy or myotonic dystrophy, comprising administering to a subject a polynucleic acid molecule or a polynucleic acid molecule conjugate described herein.
• Atrogenes are genes that are upregulated or downregulated in atrophying muscle.
• upregulated atrogenes include genes that encode ubiquitin ligases, Forkhead box transcription factors, growth factors, deubiquitinating enzymes, or proteins that are involved in glucocorticoid-induced atrophy.
• an atrogene described herein encodes an E3 ubiquitin ligase.
• E3 ubiquitin ligases include, but are not limited to, Atrogin-l/MAFbx, muscle RING finger 1 (MuRFl), TNF receptor adaptor protein 6 (TRAF6), F-Box protein 30 (Fbxo30), F-Box protein 40 (Fbxo40), neural precursor cell expressed developmentally down -regulated protein 4 (Nedd4-l), and tripartite motif- containing protein 32 (Trim32).
• Exemplary mitochondrial ubiquitin ligases include, but are not limited to, Mitochondrial E3 ubiquitin protein ligase 1 (Mull) and Carboxy terminus of Hsc70 interacting protein (CHIP).
• an atrogene described herein encodes Atrogin-l, also named Muscle Atrophy F-box (MAFbx), a member of the F-box protein family.
• Atrogin-l /MAFbx is one of the four subunits of the ubiquitin ligase complex SKPl-cullin-F-box (SCF) that promotes degradation of MyoD, a muscle transcription factor, and eukaryotic translation initiation factor 3 subunit F (eIF3-f).
• SCF ubiquitin ligase complex SKPl-cullin-F-box
• eIF3-f eukaryotic translation initiation factor 3 subunit F
• an atrogene described herein encodes muscle RING finger 1 (MuRFl).
• MuRFl is a member of the muscle-specific RING finger proteins and along with family members MuRF2 and MuRF3 are found at the M-line and Z-line lattices of myofibrils. Further, several studies have shown that MuRF 1 interacts with and/or modulates the half-life of muscle structural proteins such as troponin I, myosin heavy chains, actin, myosin binding protein C, and myosin light chains 1 and 2. MuRFl is encoded by TRIM63.
• an atrogene described herein encodes TNF receptor adaptor protein 6 (TRAF6) (also known as interleukin-l signal transducer, RING finger protein 85, or RNF85).
• TRAF6 is a member of the E3 ligase that mediates conjugation of Lys63 -linked polyubiquitin chains to target proteins.
• the Lys63 -linked polyubiquitin chains signal autophagy-dependent cargo recognition by scaffold protein p62 (SQSTM1).
• TRAF6 is encoded by the TRAF6 gene.
• an atrogene described herein encodes F-Box protein 30 (Fbxo30) (also known as F-Box only protein, helicase, 18; muscle ubiquitin ligase of SCF complex in atrophy-l; or MUSA1).
• Fbxo30 is a member of the SCF complex family of E3 ubiquitin ligases.
• Fbox30 is proposed to be inhibited by the bone morphogenetic protein (BMP) pathway and upon atrophy- inducing conditions, are upregulated and subsequently undergoes autoubiquitination.
• BMP bone morphogenetic protein
• Fbxo30 is encoded by the FBXO30 gene.
• an atrogene described herein encodes F-Box protein 40 (Fbxo40) (also known as F-Box only protein 40 or muscle disease-related protein).
• Fbxo40 A second member of the SCF complex family of E3 ubiquitin ligases, Fbxo40 regulates anabolic signals.
• Fbxo40 is encoded by the FBXO40 gene.
• an atrogene described herein encodes neural precursor cell expressed developmentally down-regulated protein 4 (Nedd4-l), a HECT domain E3 ubiquitin ligase which has been shown to be upregulated in muscle cells during disuse.
• Nedd4-l is encoded by the NEDD4 gene.
• an atrogene described herein encodes tripartite motif-containing protein 32 (Trim32).
• Trim32 is a member of the E3 ubiquitin ligase that is involved in degradation of thin filaments such as actin, tropomyosin, and troponins; a-actinin; and desmin. Trim32 is encoded by the
• an atrogene described herein encodes Mitochondrial E3 ubiquitin protein ligase 1 (Mull) (also known as mitochondrial-anchored protein ligase, RING finger protein 218, RNF218, MAPL, MULAN, and GIDE).
• Mull mitochondrial-anchored protein ligase
• RING finger protein 218, RNF218, MAPL, MULAN, and GIDE mitochondrial-anchored protein ligase
• Mull is involved in the mitochondrial network remodeling and is up-regulated by the FoxO family of transcription factors under catabolic conditions, such as for example, denervation or fasting, and subsequently causes mitochondrial fragmentation and removal via autophagy (mitophagy).
• Mull ubiquitinates the mitochondrial pro-fusion protein mitofusin 2, a GTPase that is involved in mitochondrial fusion, leading to the degradation of mitofusin 2.
• Mull is encoded by the MUL1 gene.
• an atrogene described herein encodes Carboxy terminus of Hsc70 interacting protein (CHIP) (also known as STIP1 homology and U-Box containing protein 1, STUB1, CFF-associated antigen KW-8, antigen NY-CO-7, SCAR16, SDCCAG7, or UBOX1).
• CHIP is a mitochondrial ubiquitin ligase that regulates ubiquitination and lysosomal -ependent degradation of filamin C, a muscle protein found in the Z-line.
• Z-line or Z-disc is the structure formed between adjacent sarcomeres, and sarcomere is the basic unit of muscle. Alterations of filamin structure triggers binding of the co-chaperone BAG3, a complex that comprises chaperones Hsc70 and HspB8 with CHIP.
• CHIP is encoded by the STUB1 gene.
• an atrogene described herein encodes a Forkhead box transcription factor.
• Exemplary Forkhead box transcription factors include, but are not limited to, isoforms Forkhead box protein 01 (FoxOl) and Forkhead box protein 03 (Fox03).
• an atrogene described herein encodes Forkhead box protein 01 (FoxOl) (also known as Forkhead homolog in Rhabdomyoscarcoma, FKHR, or FKH1). FoxOl is involved in regulation of gluconeogenesis and glycogenolysis by insulin signaling, and the initiation of adipogenesis by preadipocytes. FoxOl is encoded by the FOXOl gene.
• FoxOl is encodes forkhead box protein 01 (FoxOl) (also known as Forkhead homolog in Rhabdomyoscarcoma, FKHR, or FKH1).
• FoxOl is involved in regulation of gluconeogenesis and glycogenolysis by insulin signaling, and the initiation of adipogenesis by preadipocytes. FoxOl is encoded by the FOXOl gene.
• an atrogene described herein encodes Forkhead box protein 03 (Fox03) (also known as Forkhead in Rhabdomyosarcoma-like 1, FKHRF1, or FOX03A). Fox03 is activated by AMP -activated protein kinase AMPK, which in term induces expression of atrogin-l and MuRFl. Fox03 is encoded by the FOXO 3 gene.
• Fox03 Forkhead box protein 03
• FOX03A Fox03
• Fox03 is activated by AMP -activated protein kinase AMPK, which in term induces expression of atrogin-l and MuRFl.
• Fox03 is encoded by the FOXO 3 gene.
• an atrogene described herein encodes a growth factor.
• An exemplary growth factor includes myostatin.
• an atrogene described herein encodes myostatin (Mstn), also known as growth/differentiation factor 8 (GDF-8).
• Myostatin is intracellularly converted into an activator, and stimulates muscle degradation and suppresses muscle synthesis by inhibiting Akt through the phosphorylation/activation of Smad (small mothers against decapentaplegic).
• myostatin has been found to be regulated by the Akt-FoxO signaling pathway.
• myostatin has been shown to suppress differentiation of satellite cells, stimulate muscle degradation through the inhibition of the Akt pathway, and suppress muscle synthesis via the mTOR pathway.
• an atrogene described herein encodes a deubiquitinating enzyme.
• exemplary deubiquitinating enzymes include, but are not limited to, Ubiquitin specific peptidase 14 (USP14) and Ubiquitin specific peptidase 19 (USP19).
• an atrogene described herein encodes USP14 (also known as deubiquitinating enzyme 14 or TGT).
• an atrogene described herein encodes USP19 (also known as zinc finger MYND domain-containing protein 9, deubiquitinating enzyme 19, or ZMYND9).
• USP14 is encoded by the USE 14 gene.
• USP19 is encoded by the USP19 gene.
• an atrogene described herein encodes regulated in development and DNA damage response 1 (Reddl), also known as DNA-damage-inducible transcript 4 (DDIT4) and HIF- 1 responsive protein RTP801.
• Reddl represses mTOR function by sequestering 14-3-3 and increases TSC1/2 activity. Furthermore, Reddl decreases phosphorylation of 4E-BP1 and S6K1, which are involved in muscle protein synthesis. Reddl is encoded by the DDIT4 gene.
• an atrogene described herein encodes cathepsin L2, also known as cathepsin V.
• Cathepsin L2 is a lysosomal cysteine proteinase. It is encoded by the CTSL2 gene.
• an atrogene described herein encodes TG interacting factor, or homeobox protein TGIF 1.
• TG interacting factor is a transcription factor which regulates signaling pathways involved in embryonic development. This protein is encoded by the TGIF gene.
• an atrogene described herein encodes myogenin, also known as myogenic factor 4.
• Myogenin is a member of the MyoD family of muscle-specific basic-helix-loop-helix (bHLH) transcription factor involved in the coordination of skeletal muscle development and repair.
• Myogenin is encoded by the MYOG gene.
• an atrogene described herein encodes myotonin-protein kinase (MT- PK), also known as myotonic dystrophy protein kinase (MDPK) or dystrophia myotonica protein kinase (DMK).
• MT-PK is a Serine/Threonine kinase and further interacts with members of the Rho family of GTPases.
• DMPK dystrophia myotonica protein kinase
• an atrogene described herein encodes histone deacetylase 2, a member of the histone deacetylase family.
• Histone deacetylase 2 is encoded by the HDAC2 gene.
• an atrogene described herein encodes histone deacetylase 3, another member of the histone deacetylase family. Histone deacetylase 3 is encoded by the HDAC3 gene.
• an atrogene described herein encodes metallothionein 1L, a member of the metallothionein family.
• Metallothioneins (MT) are cysteine-rish, low molecular weight proteins that is capable of binding heavy metals, thereby providing protection against metal toxicity and/or oxidative stress.
• Metallothionein 1L is encoded by the MT1L gene.
• an atrogene described herein encodes metallothionein 1B, a second member of the metallothionein family.
• Metallothionein 1B is encoded by the MT1B gene.
• an atrogene described herein is an atrogene listed in Table 14.
• a polynucleic acid molecule hybridizes to a target sequence of an atrophy -related gene (also referred to as an atrogene).
• a polynucleic acid molecule described herein hybridizes to a target sequence of an ubiquitin ligase (e.g., an E3 ubiquitin ligase or a mitochondrial ubiquitin ligase).
• a polynucleic acid molecule described herein hybridizes to a target sequence of a Forkhead box transcription factor.
• a polynucleic acid molecule described herein hybridizes to a target sequence of a growth factor.
• a polynucleic acid molecule described herein hybridizes to a target sequence of a deubiquitinating enzyme.
• a polynucleic acid molecule described herein hybridizes to a target sequence of FBX032, TRIM63, TRAF6, FBXO30, FBXO40, NEDD4, TRIM32, MUL1, STUB1, FOXOl, FOX03, MSTN, USP14, USP19, DDIT4, CTSL2, TGIF, MYOG, HDAC2, HDAC3, MT1L, MT1B, or DMPK.
• a polynucleic acid molecule described herein hybridizes to a target sequence of FBX032, TR1M63. FOXOl , FOX03, or MSTN.
• a polynucleic acid molecule described herein hybridizes to a target sequence of FBX032. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of TRJM63. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of TRAF6. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of FBXO30. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of FBXO40. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of NEDD4.
• a polynucleic acid molecule described herein hybridizes to a target sequence of TRJM32. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence oiMULl. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of STUB1. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of FOXOl. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of FOX03. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of MSTN.
• a polynucleic acid molecule described herein hybridizes to a target sequence of USP14. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of USP19. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of DDIT4. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of CTSL2. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of TGIF. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of MYOG.
• a polynucleic acid molecule described herein hybridizes to a target sequence of HDAC2. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of HDAC3. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of MT1L. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of MT1B. In some cases, a polynucleic acid molecule described herein hybridizes to a target sequence of of DMPK.
• the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480.
• the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480.
• the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480.
• the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to atarget sequence as set forth in SEQ ID NOs: 28-141 and 370-480.
• the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the polynucleic acid molecule consists of a target sequence as set forth in SEQ ID NOs: 28-141 and 370-480.
• the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to atarget sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406.
• the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406.
• the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406.
• the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to a target sequence as set forth in SEQ ID NOs: 703-3406. In some embodiments, the polynucleic acid molecule consists of a target sequence as set forth in SEQ ID NOs: 703-3406.
• the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide.
• the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to atarget sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407- 14222.
• the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target sequence as set forth in SEQ ID NOs: 142-255, 256-369, 481-591, 592-702, and 3407-14222.
• the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target sequence as set forth in SEQ ID NOs: 142-255, 481-591, 3407-6110, and 8815-11518, and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target sequence as set forth in SEQ ID NOs: 256-369, 592-702, 6111-8814, and 11519-14222.
• the polynucleic acid molecule comprises a sense strand (e.g., a passenger strand) and an antisense strand (e.g., a guide strand).
• the sense strand e.g., the passenger strand
• the sense strand comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to atarget sequence as set forth in SEQ ID NOs: 142-255, 481-591, 3407-6110, and 8815-11518.
• the antisense strand (e.g., the guide strand) comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a target sequence as set forth in SEQ ID NOs: 256-369, 592-702, 6111-8814, and 11519-14222.
• the polynucleic acid molecule described herein comprises RNA or DNA.
• the polynucleic acid molecule comprises RNA.
• RNA comprises short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), double - stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heterogeneous nuclear RNA (hnRNA).
• RNA comprises shRNA.
• RNA comprises miRNA.
• RNA comprises dsRNA.
• RNA comprises tRNA.
• RNA comprises rRNA.
• RNA comprises hnRNA.
• the RNA comprises siRNA.
• the polynucleic acid molecule comprises siRNA.
• the polynucleic acid molecule is from about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, form about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.
• the polynucleic acid molecule is about 50 nucleotides in length. In some instances, the polynucleic acid molecule is about 45 nucleotides in length. In some instances, the polynucleic acid molecule is about 40 nucleotides in length. In some instances, the polynucleic acid molecule is about 35 nucleotides in length. In some instances, the polynucleic acid molecule is about 30 nucleotides in length. In some instances, the polynucleic acid molecule is about 25 nucleotides in length. In some instances, the polynucleic acid molecule is about 20 nucleotides in length.
• the polynucleic acid molecule is about 19 nucleotides in length. In some instances, the polynucleic acid molecule is about 18 nucleotides in length. In some instances, the polynucleic acid molecule is about 17 nucleotides in length. In some instances, the polynucleic acid molecule is about 16 nucleotides in length. In some instances, the polynucleic acid molecule is about 15 nucleotides in length. In some instances, the polynucleic acid molecule is about 14 nucleotides in length. In some instances, the polynucleic acid molecule is about 13 nucleotides in length. In some instances, the polynucleic acid molecule is about 12 nucleotides in length.
• the polynucleic acid molecule is about 11 nucleotides in length. In some instances, the polynucleic acid molecule is about 10 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 50 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 45 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 40 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 35 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 30 nucleotides in length.
• the polynucleic acid molecule is between about 10 and about 25 nucleotides in length. In some instances, the polynucleic acid molecule is between about 10 and about 20 nucleotides in length. In some instances, the polynucleic acid molecule is between about 15 and about 25 nucleotides in length. In some instances, the polynucleic acid molecule is between about 15 and about 30 nucleotides in length. In some instances, the polynucleic acid molecule is between about 12 and about 30 nucleotides in length. [0126] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide.
• the polynucleic acid molecule comprises a second polynucleotide. In some instances, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide is a sense strand or passenger strand. In some instances, the second polynucleotide is an antisense strand or guide strand.
• the polynucleic acid molecule is a first polynucleotide.
• the first polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, form about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.
• the first polynucleotide is about 50 nucleotides in length. In some instances, the first polynucleotide is about 45 nucleotides in length. In some instances, the first polynucleotide is about 40 nucleotides in length. In some instances, the first polynucleotide is about 35 nucleotides in length. In some instances, the first polynucleotide is about 30 nucleotides in length. In some instances, the first polynucleotide is about 25 nucleotides in length. In some instances, the first polynucleotide is about 20 nucleotides in length.
• the first polynucleotide is about 19 nucleotides in length. In some instances, the first polynucleotide is about 18 nucleotides in length. In some instances, the first polynucleotide is about 17 nucleotides in length. In some instances, the first polynucleotide is about 16 nucleotides in length. In some instances, the first polynucleotide is about 15 nucleotides in length. In some instances, the first polynucleotide is about 14 nucleotides in length. In some instances, the first polynucleotide is about 13 nucleotides in length. In some instances, the first polynucleotide is about 12 nucleotides in length.
• the first polynucleotide is about 11 nucleotides in length. In some instances, the first polynucleotide is about 10 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 50 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 45 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 40 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 35 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 30 nucleotides in length.
• the first polynucleotide is between about 10 and about 25 nucleotides in length. In some instances, the first polynucleotide is between about 10 and about 20 nucleotides in length. In some instances, the first polynucleotide is between about 15 and about 25 nucleotides in length. In some instances, the first polynucleotide is between about 15 and about 30 nucleotides in length. In some instances, the first polynucleotide is between about 12 and about 30 nucleotides in length.
• the polynucleic acid molecule is a second polynucleotide.
• the second polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, form about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length. [0130] In some instances, the second polynucleotide is about 50 nucleotides in length. In some instances, the second polynucleotide is about 45 nucleotides in length.
• the second polynucleotide is about 40 nucleotides in length. In some instances, the second polynucleotide is about 35 nucleotides in length. In some instances, the second polynucleotide is about 30 nucleotides in length. In some instances, the second polynucleotide is about 25 nucleotides in length. In some instances, the second polynucleotide is about 20 nucleotides in length. In some instances, the second polynucleotide is about 19 nucleotides in length. In some instances, the second polynucleotide is about 18 nucleotides in length. In some instances, the second polynucleotide is about 17 nucleotides in length.
• the second polynucleotide is about 16 nucleotides in length. In some instances, the second polynucleotide is about 15 nucleotides in length. In some instances, the second polynucleotide is about 14 nucleotides in length. In some instances, the second polynucleotide is about 13 nucleotides in length. In some instances, the second polynucleotide is about 12 nucleotides in length. In some instances, the second polynucleotide is about 11 nucleotides in length. In some instances, the second polynucleotide is about 10 nucleotides in length.
• the second polynucleotide is between about 10 and about 50 nucleotides in length. In some instances, the second polynucleotide is between about 10 and about 45 nucleotides in length. In some instances, the second polynucleotide is between about 10 and about 40 nucleotides in length. In some instances, the second polynucleotide is between about 10 and about 35 nucleotides in length. In some instances, the second polynucleotide is between about 10 and about 30 nucleotides in length. In some instances, the second polynucleotide is between about 10 and about 25 nucleotides in length.
• the second polynucleotide is between about 10 and about 20 nucleotides in length. In some instances, the second polynucleotide is between about 15 and about 25 nucleotides in length. In some instances, the second polynucleotide is between about 15 and about 30 nucleotides in length. In some instances, the second polynucleotide is between about 12 and about 30 nucleotides in length.
• the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide.
• the polynucleic acid molecule further comprises a blunt terminus, an overhang, or a combination thereof.
• the blunt terminus is a 5’ blunt terminus, a 3’ blunt terminus, or both.
• the overhang is a 5’ overhang, 3’ overhang, or both.
• the overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base pairing nucleotides.
• the overhang comprises 1, 2, 3, 4, 5, or 6 non-base pairing nucleotides.
• the overhang comprises 1, 2, 3, or 4 non-base pairing nucleotides. In some cases, the overhang comprises 1 non-base pairing nucleotide. In some cases, the overhang comprises 2 non-base pairing nucleotides. In some cases, the overhang comprises 3 non-base pairing nucleotides. In some cases, the overhang comprises 4 non-base pairing nucleotides.
• the sequence of the polynucleic acid molecule is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 50% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 60% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 70% complementary to a target sequence described herein.
• the sequence of the polynucleic acid molecule is at least 80% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 90% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 95%
• sequence of the polynucleic acid molecule is at least 99% complementary to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule is 100% complementary to a target sequence described herein.
• the sequence of the polynucleic acid molecule has 5 or less mismatches to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has 4 or less mismatches to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule has 3 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule has 2 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule has 1 or less mismatches to a target sequence described herein.
• the specificity of the polynucleic acid molecule that hybridizes to a target sequence described herein is a 95%, 98%, 99%, 99.5% or 100% sequence complementarity of the polynucleic acid molecule to a target sequence.
• the hybridization is a high stringent hybridization condition.
• the polynucleic acid molecule has reduced off-target effect.
• “off-target” or“off-target effects” refer to any instance in which a polynucleic acid polymer directed against a given target causes an unintended effect by interacting either directly or indirectly with another mRNA sequence, a DNA sequence or a cellular protein or other moiety.
• an “off-target effect” occurs when there is a simultaneous degradation of other transcripts due to partial homology or complementarity between that other transcript and the sense and/or antisense strand of the polynucleic acid molecule.
• the polynucleic acid molecule comprises natural or synthetic or artificial nucleotide analogues or bases. In some cases, the polynucleic acid molecule comprises combinations of DNA, RNA and/or nucleotide analogues. In some instances, the synthetic or artificial nucleotide analogues or bases comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.
• nucleotide analogues or artificial nucleotide base comprise a nucleic acid with a modification at a 2’ hydroxyl group of the ribose moiety.
• the modification includes an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety.
• Exemplary alkyl moiety includes, but is not limited to, halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols and oxygen.
• the alkyl moiety further comprises a modification.
• the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso, group, a nitrile group, a heterocycle (e.g., imidazole, hydrazino or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur containing group (e.g., sulfoxide, sulfone, sulfide, and disulfide).
• the alkyl moiety further comprises a hetero substitution.
• the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur.
• the heterocyclic substitution includes but is not limited to, morpholino, imidazole, and pyrrolidino.
• the modification at the 2’ hydroxyl group is a 2’-0-methyl modification or a 2’-0-methoxyethyl (2’-0-M0E) modification.
• the 2’-0-methyl modification adds a methyl group to the 2’ hydroxyl group of the ribose moiety whereas the 2O-methoxyethyl modification adds a methoxyethyl group to the 2’ hydroxyl group of the ribose moiety.
• Exemplary chemical structures of a 2’-0-methyl modification of an adenosine molecule and 2 ⁇ -methoxyethyl modification of an uridine are illustrated below.
• the modification at the 2’ hydroxyl group is a 2’-0-aminopropyl modification in which an extended amine group comprising a propyl linker binds the amine group to the 2’ oxygen.
• this modification neutralizes the phosphate derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and thereby improves cellular uptake properties due to its zwitterionic properties.
• An exemplary chemical structure of a 2’-0-aminopropyl nucleoside phosphoramidite is illustrated below.
• the modification at the 2’ hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA) in which the oxygen molecule bound at the 2’ carbon is linked to the 4’ carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene-linked bicyclic ribonucleotide monomer.
• LNA locked nucleic acid
• Exemplary representations of the chemical structure of LNA are illustrated below. The representation shown to the left highlights the chemical connectivities of an LNA monomer. The representation shown to the right highlights the locked 3'-endo (3 ⁇ 4) conformation of the furanose ring of an LNA monomer.
• the modification at the 2’ hydroxyl group comprises ethylene nucleic acids (ENA) such as for example 2’-4’-ethylene-bridged nucleic acid, which locks the sugar conformation into a C 3 ’-endo sugar puckering conformation.
• ENA ethylene nucleic acids
• the bridged nucleic acids class of modified nucleic acids that also comprises LNA. Exemplary chemical structures of the ENA and bridged nucleic acids are illustrated below.
• additional modifications at the 2’ hydroxyl group include 2'-deoxy, T- deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N- methylacetamido (2'-0-NMA).
• nucleotide analogues comprise modified bases such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6- methyladenine, 6-methylguanine, N, N, -dimethyladenine, 2-propyladenine, 2propylguanine, 2-aminoadenine, 1 -methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5- (2- amino) propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1 - methyladenosine, 2-methyladenosine, 3- methylcytidine, 6-methyluridine, 2- methylguanosine, 7-methylguanosine, 2, 2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleot
• Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl.
• the sugar moieties in some cases are or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4'-thioribose, and other sugars, heterocycles, or carbocycles.
• the term nucleotide also includes what are known in the art as universal bases.
• universal bases include but are not limited to 3-nitropyrrole, 5-nitroindole, or nebularine.
• nucleotide analogues further comprise morpholinos, peptide nucleic acids (PNAs), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N3-P5’- phosphoramidites, G, 5’- anhydrohexitol nucleic acids (HNAs), or a combination thereof.
• Morpholino or phosphorodiamidate morpholino oligo (PMO) comprises synthetic molecules whose structure mimics natural nucleic acid structure by deviates from the normal sugar and phosphate structures.
• the five member ribose ring is substituted with a six member morpholino ring containing four carbons, one nitrogen and one oxygen.
• the ribose monomers are linked by a
• the backbone alterations remove all positive and negative charges making morpholinos neutral molecules capable of crossing cellular membranes without the aid of cellular delivery agents such as those used by charged oligonucleotides.
• peptide nucleic acid does not contain sugar ring or phosphate linkage and the bases are attached and appropriately spaced by oligoglycine-like molecules, therefore, eliminating a backbone charge.
• modified intemucleotide linkage include, but is not limited to,
• PS ASO Phosphorothioate antisene oligonucleotides
• the modification is a methyl or thiol modification such as
• thiolphosphonate nucleotide left
• methylphosphonate nucleotide right
• a modified nucleotide includes, but is not limited to, 2’-fluoro N3-P5’- phosphoramidites illustrated as:
• a modified nucleotide includes, but is not limited to, hexitol nucleic acid (or G, 5’- anhydrohexitol nucleic acids (HNA)) illustrated as:
• one or more modifications further optionally include modifications of the ribose moiety, phosphate backbone and the nucleoside, or modifications of the nucleotide analogues at the 3’ or the 5’ terminus.
• the 3’ terminus optionally include a 3’ cationic group, or by inverting the nucleoside at the 3’-terminus with a 3’ -3’ linkage.
• the 3’ -terminus is optionally conjugated with an aminoalkyl group, e.g., a 3’ C5-aminoalkyl dT.
• the 3’ -terminus is optionally conjugated with an abasic site, e.g.
• the 5’ -terminus is conjugated with an aminoalkyl group, e.g., a 5’-0-alkylamino substituent hi some cases, the 5’ -terminus is conjugated with an abasic site, e.g., with an apurinic or apyrimidinic site.
• the polynucleic acid molecule comprises one or more of the artificial nucleotide analogues described herein. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues described herein.
• the artificial nucleotide analogues include 2’-0-methyl, 2’-0- methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modified,
• LNA LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’- fluoro N3-P5’-phosphoramidites, or a combination thereof.
• the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues selected from 2’-0-methyl, 2’-0-methoxyethyl (2’-0-MOE), 2’-0- aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0- DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0- DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N
• the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of 2’-0-methyl modified nucleotides. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
• the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of thiolphosphonate nucleotides.
• the polynucleic acid molecule comprises at least one of: from about 5% to about 100% modification, from about 10% to about 100% modification, from about 20% to about 100% modification, from about 30% to about 100% modification, from about 40% to about 100% modification, from about 50% to about 100% modification, from about 60% to about 100% modification, from about 70% to about 100% modification, from about 80% to about 100% modification, and from about 90% to about 100% modification.
• the polynucleic acid molecule comprises at least one of: from about 10% to about 90% modification, from about 20% to about 90% modification, from about 30% to about 90% modification, from about 40% to about 90% modification, from about 50% to about 90% modification, from about 60% to about 90% modification, from about 70% to about 90% modification, and from about 80% to about 100% modification.
• the polynucleic acid molecule comprises at least one of: from about 10% to about 80% modification, from about 20% to about 80% modification, from about 30% to about 80% modification, from about 40% to about 80% modification, from about 50% to about 80% modification, from about 60% to about 80% modification, and from about 70% to about 80% modification.
• the polynucleic acid molecule comprises at least one of: from about 10% to about 70% modification, from about 20% to about 70% modification, from about 30% to about 70% modification, from about 40% to about 70% modification, from about 50% to about 70% modification, and from about 60% to about 70% modification. [0156] In some instances, the polynucleic acid molecule comprises at least one of: from about 10% to about 60% modification, from about 20% to about 60% modification, from about 30% to about 60% modification, from about 40% to about 60% modification, and from about 50% to about 60%
• the polynucleic acid molecule comprises at least one of: from about 10% to about 50% modification, from about 20% to about 50% modification, from about 30% to about 50% modification, and from about 40% to about 50% modification.
• the polynucleic acid molecule comprises at least one of: from about 10% to about 40% modification, from about 20% to about 40% modification, and from about 30% to about 40% modification.
• the polynucleic acid molecule comprises at least one of: from about 10% to about 30% modification, and from about 20% to about 30% modification.
• the polynucleic acid molecule comprises from about 10% to about 20%
• the polynucleic acid molecule comprises from about 15% to about 90%, from about 20% to about 80%, from about 30% to about 70%, or from about 40% to about 60% modifications.
• the polynucleic acid molecule comprises at least about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% modification.
• the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more modifications.
• the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more modified nucleotides.
• polynucleic acid molecule from about 5 to about 100% of the polynucleic acid molecule comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the polynucleic acid molecule comprise the artificial nucleotide analogues described herein. In some instances, about 5% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 10% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• about 15% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 20% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 25% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 30% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 35% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• about 40% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 45% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 50% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 55% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 60% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• about 65% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 70% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 75% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 80% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 85% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• about 90% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 95% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 96% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 97% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 98% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 100% of the polynucleic acid molecule comprises the artificial nucleotide analogues described herein.
• the artificial nucleotide analogues include 2’-0-methyl, 2’-0-methoxyethyl (2’-0-MOE), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0- DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N3-P5’-phosphoramidites, or a combination thereof.
• the polynucleic acid molecule comprises from about 1 to about 25 modifications in which the modification comprises an artificial nucleotide analogues described herein. In some embodiments, the polynucleic acid molecule comprises about 1 modification in which the modification comprises an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 2 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 3 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• the polynucleic acid molecule comprises about 4 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 5 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 6 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 7 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 8 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• the polynucleic acid molecule comprises about 9 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 10 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 11 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 12 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 13 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• the polynucleic acid molecule comprises about 14 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 15 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 16 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 17 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 18 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• the polynucleic acid molecule comprises about 19 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 20 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 21 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 22 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 23 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• the polynucleic acid molecule comprises about 24 modifications in which the modifications comprise an artificial nucleotide analogue described herein. In some embodiments, the polynucleic acid molecule comprises about 25 modifications in which the modifications comprise an artificial nucleotide analogue described herein.
• a polynucleic acid molecule is assembled from two separate polynucleotides wherein one polynucleotide comprises the sense strand and the second polynucleotide comprises the antisense strand of the polynucleic acid molecule.
• the sense strand is connected to the antisense strand via a linker molecule, which in some instances is a polynucleotide linker or a non-nucleotide linker.
• a polynucleic acid molecule comprises a sense strand and antisense strand, wherein pyrimidine nucleotides in the sense strand comprises 2'-0-methylpyrimidine nucleotides and purine nucleotides in the sense strand comprise 2'-deoxy purine nucleotides.
• a polynucleic acid molecule comprises a sense strand and antisense strand, wherein pyrimidine nucleotides present in the sense strand comprise 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine nucleotides present in the sense strand comprise 2'-deoxy purine nucleotides.
• a polynucleic acid molecule comprises a sense strand and antisense strand, wherein the pyrimidine nucleotides when present in said antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and the purine nucleotides when present in said antisense strand are 2'-0-methyl purine nucleotides.
• a polynucleic acid molecule comprises a sense strand and antisense strand, wherein the pyrimidine nucleotides when present in said antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein the purine nucleotides when present in said antisense strand comprise 2'-deoxy-purine nucleotides.
• a polynucleic acid molecule comprises a sense strand and antisense strand, wherein the sense strand includes a terminal cap moiety at the 5 '-end, the 3 '-end, or both of the 5' and 3' ends of the sense strand.
• the terminal cap moiety is an inverted deoxy abasic moiety.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises a phosphate backbone modification at the 3' end of the antisense strand.
• the phosphate backbone modification is a phosphorothioate.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises a glyceryl modification at the 3' end of the antisense strand.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, in which the sense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
• phosphorothioate intemucleotide linkages and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-0-methyl, 2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and in which the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2,
• one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense strand are chemically- modified with 2'-deoxy, 2'-0-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, in which the sense strand comprises about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) 2'-deoxy, 2'-0-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 -end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and in which the antisense strand comprises about 1 to about 25 or more, for example about 1, 2,
• pyrimidine nucleotides of the sense and/or antisense strand are chemically- modified with 2'-deoxy, 2'-0-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 25 or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, in which the antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9,
• phosphorothioate intemucleotide linkages and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-0-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3,
• pyrimidine nucleotides of the sense and/or antisense strand are chemically-modified with 2'-deoxy, 2'-0-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3' and 5 '-ends, being present in the same or different strand.
• a polynucleic acid molecule comprises a sense strand and an antisense strand, in which the antisense strand comprises about 1 to about 25 or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-0-methyl, 2'-deoxy-2'- fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 25 or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
• one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense strand are chemically-modified with 2'-deoxy, 2'-0-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
• a polynucleic acid molecule described herein is a chemically -modified short interfering nucleic acid molecule having about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7,
• a polynucleic acid molecule described herein comprises 2' -5' intemucleotide linkages.
• the 2'-5' intemucleotide linkage(s) is at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of one or both sequence strands.
• the 2'-5' intemucleotide linkage(s) is present at various other positions within one or both sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every intemucleotide linkage of a pyrimidine nucleotide in one or both strands of the polynucleic acid molecule comprise a 2'-5' intemucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every intemucleotide linkage of a purine nucleotide in one or both strands of the polynucleic acid molecule comprise a 2'-5' intemucleotide linkage.
• a polynucleic acid molecule is a single stranded polynucleic acid molecule that mediates R Ai activity in a cell or reconstituted in vitro system, wherein the polynucleic acid molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the polynucleic acid are 2'- deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the polynucleic acid are 2'-deoxy purine nucleotides (e.g., wherein all pyrim
• one or more of the artificial nucleotide analogues described herein are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease when compared to natural polynucleic acid molecules.
• nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease when compared to natural polynucleic acid molecules.
• artificial nucleotide analogues comprising 2’-0-methyl, 2’-0- methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modified,
• LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’- fluoro N3-P5’-phosphoramidites, or combinations thereof are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease.
• nucleases such as for example ribonuclease such as RNase H, deoxyribonuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease.
• 2’-O-methyl modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2O-methoxyethyl (2’-0-M0E) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2’-0- aminopropyl modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2'-deoxy modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• T-deoxy-2'-fluoro modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2'-0-aminopropyl (2'-0-AP) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2'-0-dimethylaminoethyl (2'-0-DMA0E) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2'-0-dimethylaminopropyl (2'-0- DMAP) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• T-O- dimethylaminoethyloxyethyl (2'- O-DMAEOE) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• 2'-0-N-methylacetamido (2'-0-NMA) modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• LNA modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• ENA modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• HNA modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• morpholinos is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• PNA modified polynucleic acid molecule is resistant to nucleases (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• methylphosphonate nucleotides modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• thiolphosphonate nucleotides modified polynucleic acid molecule is nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).
• polynucleic acid molecule comprising 2’-fluoro N3-P5’-phosphoramidites is nuclease resistance (e.g., RNase H, DNase,
• the 5’ conjugates described herein inhibit 5’-3’ exonucieoiytic cleavage in some instances, the 3’ conjugates described herein inhibit 3’-5’ exonuc!eo!ytic cleavage.
• one or more of the artificial nucleotide analogues described herein have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• the one or more of the artificial nucleotide analogues comprising 2’-0-methyl, 2’-0- methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modified,
• LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2’-fluoro N3-P5’-phosphoramidites have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2’ -O-methyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2’-0-methoxyethyl (2’-0-M0E) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2’-0-aminopropyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2'-deoxy modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• T-deoxy-2'-fluoro modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2'-0- aminopropyl (2'-0-AP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2'-0- dimethylaminoethyl (2'-0-DMA0E) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2'-0-dimethylaminopropyl (2'-0-DMAP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• 2'-0-N-methylacetamido (2'-0-NMA) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• LNA modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• ENA modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• PNA modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• HNA modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• morpholino modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• methylphosphonate nucleotides modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• thiolphosphonate nucleotides modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• polynucleic acid molecule comprising 2’-fluoro N3-P5’-phosphoramidites has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
• the increased affinity is illustrated with a lower Kd, a higher melt temperature (Tm), or a combination thereof.
• a polynucleic acid molecule described herein is a chirally pure (or stereo pure) polynucleic acid molecule, or a polynucleic acid molecule comprising a single enantiomer.
• the polynucleic acid molecule comprises L-nucleotide. In some instances, the polynucleic acid molecule comprises D -nucleotides. In some instance, a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of its mirror enantiomer. In some cases, a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of a racemic mixture. In some instances, the polynucleic acid molecule is a polynucleic acid molecule described in: U.S. Patent Publication Nos: 2014/194610 and 2015/211006; and PCT Publication No.: WO2015107425.
• a polynucleic acid molecule described herein is further modified to include an aptamer conjugating moiety.
• the aptamer conjugating moiety is a DNA aptamer conjugating moiety.
• the aptamer conjugating moiety is Alphamer (Centauri Therapeutics), which comprises an aptamer portion that recognizes a specific cell-surface target and a portion that presents a specific epitopes for attaching to circulating antibodies.
• a polynucleic acid molecule described herein is further modified to include an aptamer conjugating moiety as described in: U.S. Patent Nos: 8,604,184, 8,591,910, and 7,850,975.
• a polynucleic acid molecule described herein is modified to increase its stability.
• the polynucleic acid molecule is RNA (e.g., siRNA).
• the polynucleic acid molecule is modified by one or more of the modifications described above to increase its stability.
• the polynucleic acid molecule is modified at the 2’ hydroxyl position, such as by 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T- deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N- methylacetamido (2'-0-NMA) modification or by a locked or bridged ribose conformation (e.g., LNA or ENA).
• a locked or bridged ribose conformation e.g., LNA or ENA
• the polynucleic acid molecule is modified by 2’-0-methyl and/or 2’-0- methoxyethyl ribose. In some cases, the polynucleic acid molecule also includes morpholinos, PNAs, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, and/or 2’-fluoro N3-P5’- phosphoramidites to increase its stability. In some instances, the polynucleic acid molecule is a chirally pure (or stereo pure) polynucleic acid molecule. In some instances, the chirally pure (or stereo pure) polynucleic acid molecule is modified to increase its stability. Suitable modifications to the RNA to increase stability for delivery will be apparent to the skilled person.
• the polynucleic acid molecule is a double -stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
• the polynucleic acid molecule is assembled from two separate polynucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (e.g., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 19, 20, 21, 22, 23, or more base pairs); the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
• each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double
• the polynucleic acid molecule is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the polynucleic acid molecule are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
• the polynucleic acid molecule is a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
• the polynucleic acid molecule is a circular single -stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide is processed either in vivo or in vitro to generate an active polynucleic acid molecule capable of mediating RNAi.
• the polynucleic acid molecule also comprises a single- stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such polynucleic acid molecule does not require the presence within the polynucleic acid molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide further comprises a terminal phosphate group, such as a 5'-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568), or 5 ',3 '-diphosphate.
• a terminal phosphate group such as a 5'-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-5
• an asymmetric hairpin is a linear polynucleic acid molecule comprising an antisense region, a loop portion that comprises nucleotides or non-nucleotides, and a sense region that comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complimentary nucleotides to base pair with the antisense region and form a duplex with loop.
• an asymmetric hairpin polynucleic acid molecule comprises an antisense region having length sufficient to mediate RNAi in a cell or in vitro system (e.g.
• the asymmetric hairpin polynucleic acid molecule also comprises a 5 '-terminal phosphate group that is chemically modified.
• the loop portion of the asymmetric hairpin polynucleic acid molecule comprises nucleotides, non-nucleotides, linker molecules, or conjugate molecules.
• an asymmetric duplex is a polynucleic acid molecule having two separate strands comprising a sense region and an antisense region, wherein the sense region comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complimentary nucleotides to base pair with the antisense region and form a duplex.
• an asymmetric duplex polynucleic acid molecule comprises an antisense region having length sufficient to mediate RNAi in a cell or in vitro system (e.g. about 19 to about 22 nucleotides) and a sense region having about 3 to about 18 nucleotides that are complementary to the antisense region.
• a universal base refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them.
• Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole
• nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6- nitroindole as known in the art (see for example Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
• a polynucleic acid molecule described herein is constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art.
• a polynucleic acid molecule is chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleic acid molecule and target nucleic acids.
• Exemplary methods include those described in: U.S. Patent Nos. 5,142,047; 5,185,444; 5,889,136;
• the polynucleic acid molecule is produced biologically using an expression vector into which a polynucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleic acid molecule will be of an antisense orientation to a target polynucleic acid molecule of interest).
• an antisense orientation i.e., RNA transcribed from the inserted polynucleic acid molecule will be of an antisense orientation to a target polynucleic acid molecule of interest.
• a polynucleic acid molecule is synthesized via a tandem synthesis methodology, wherein both strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate fragments or strands that hybridize and permit purification of the duplex.
• a polynucleic acid molecule is also assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the molecule.
• Additional modification methods for incorporating, for example, sugar, base and phosphate modifications include: Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci., 1992, 17, 334-339; Usman et al. International Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International PCT publication No.
• intemucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5'-methylphosphonate linkages improves stability, excessive modifications sometimes cause toxicity or decreased activity.
• the amount of these intemucleotide linkages in some cases is minimized. In such cases, the reduction in the concentration of these linkages lowers toxicity, increases efficacy and higher specificity of these molecules.
• a polynucleic acid molecule is further conjugated to a polypeptide A for delivery to a site of interest.
• a polynucleic acid molecule is conjugated to a polypeptide A and optionally a polymeric moiety.
• At least one polypeptide A is conjugated to at least one B. In some instances, the at least one polypeptide A is conjugated to the at least one B to form an A-B conjugate. In some embodiments, at least one A is conjugated to the 5’ terminus of B, the 3’ terminus of B, an internal site on B, or in any combinations thereof. In some instances, the at least one polypeptide A is conjugated to at least two B. In some instances, the at least one polypeptide A is conjugated to at least 2, 3, 4, 5, 6,
• At least one polypeptide A is conjugated at one terminus of at least one B while at least one C is conjugated at the opposite terminus of the at least one B to form an A-B-C conjugate.
• at least one polypeptide A is conjugated at one terminus of the at least one B while at least one of C is conjugated at an internal site on the at least one B.
• at least one polypeptide A is conjugated directly to the at least one C.
• the at least one B is conjugated indirectly to the at least one polypeptide A via the at least one C to form an A-C-B conjugate.
• At least one B and/or at least one C, and optionally at least one D are conjugated to at least one polypeptide A.
• the at least one B is conjugated at a terminus (e.g., a 5’ terminus or a 3’ terminus) to the at least one polypeptide A or are conjugated via an internal site to the at least one polypeptide A.
• the at least one C is conjugated either directly to the at least one polypeptide A or indirectly via the at least one B. If indirectly via the at least one B, the at least one C is conjugated either at the same terminus as the at least one polypeptide A on B, at opposing terminus from the at least one polypeptide A, or independently at an internal site.
• at least one additional polypeptide A is further conjugated to the at least one polypeptide A, to B, or to C.
• the at least one D is optionally conjugated either directly or indirectly to the at least one polypeptide A, to the at least one B, or to the at least one C. If directly to the at least one polypeptide A, the at least one D is also optionally conjugated to the at least one B to form an A-D-B conjugate or is optionally conjugated to the at least one B and the at least one C to form an A-D-B-C conjugate. In some instances, the at least one D is directly conjugated to the at least one polypeptide A and indirectly to the at least one B and the at least one C to form a D-A-B-C conjugate.
• the at least one D is also optionally conjugated to the at least one B to form an A-B-D conjugate or is optionally conjugated to the at least one B and the at least one C to form an A-B-D-C conjugate. In some instances, at least one additional D is further conjugated to the at least one polypeptide A, to B, or to C.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19A.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19B.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19C.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19D.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19E.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19F.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19G.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19H.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 191.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19J.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19K.
• a polynucleic acid molecule conjugate comprises a construct as illustrated in Fig. 19L
• the antibody cartoon as illustrated in Fig. 19M is for representation purposes only and encompasses a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
• the binding moiety A is a polypeptide.
• the polypeptide is an antibody or its fragment thereof.
• the fragment is a binding fragment.
• the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab 2 , F(ab)' 3 fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) 2 , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein (dsFv), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
• A is an antibody or binding fragment thereof.
• A is a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab’, divalent Fab 2 , F(ab)' 3 fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) 2 , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein ("dsFv”), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
• dsFv single-domain antibody
• sdAb single-domain antibody
• Ig NAR camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
• A is a humanized antibody or binding fragment thereof. In some instances, A is a murine antibody or binding fragment thereof. In some instances, A is a chimeric antibody or binding fragment thereof. In some instances, A is a monoclonal antibody or binding fragment thereof. In some instances, A is a monovalent Fab’ . In some instances, A is a diavalent Fab 2 . In some instances, A is a single-chain variable fragment (scFv).
• the binding moiety A is a bispecific antibody or binding fragment thereof.
• the bispecific antibody is a trifunctional antibody or a bispecific mini antibody.
• the bispecific antibody is a trifunctional antibody.
• the trifunctional antibody is a full length monoclonal antibody comprising binding sites for two different antigens.
• the bispecific antibody is a bispecific mini -antibody.
• the bispecific mini-antibody comprises divalent Fab 2 , F(ab)' 3 fragments, bis-scFv, (scFv) 2 , diabody, minibody, triabody, tetrabody or a bi-specific T-cell engager (BiTE).
• the bi- specific T-cell engager is a fusion protein that contains two single -chain variable fragments (scFvs) in which the two scFvs target epitopes of two different antigens.
• the binding moiety A is a bispecific mini -antibody.
• A is a bispecific Fab 2 .
• A is a bispecific F(ab)' 3 fragment.
• A is a bispecific bis-scFv.
• A is a bispecific (scFv) 2 .
• A is a bispecific diabody.
• A is a bispecific minibody.
• A is a bispecific triabody.
• A is a bispecific tetrabody.
• A is a bi-specific T- cell engager (BiTE).
• the binding moiety A is a trispecific antibody.
• the trispecific antibody comprises F(ab)' 3 fragments or a triabody.
• A is a trispecific F(ab)' 3 fragment.
• A is a triabody.
• A is a trispecific antibody as described in Dimas, et al.,“Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells,” Mol. Pharmaceutics, 12(9): 3490-3501 (2015).
• the binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein.
• the binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein on a muscle cell.
• the binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein on a skeletal muscle cell.
• exemplary antibodies include, but are not limited to, an anti-myosin antibody, an anti -transferrin antibody, and an antibody that recognizes Muscle-Specific kinase (MuSK).
• McSK Muscle-Specific kinase
• the antibody is an anti-transferrin (anti-CD7l) antibody.
• the binding moiety A is conjugated to a polynucleic acid molecule (B) non-specifically. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue or a cysteine residue, in a non-site specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue in a non -site specific manner. In some cases, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a cysteine residue in a non-site specific manner.
• the binding moiety A is conjugated to a polynucleic acid molecule (B) in a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue, a cysteine residue, at the 5’-terminus, at the 3’-terminus, an unnatural amino acid, or an enzyme -modified or enzyme-catalyzed residue, via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue via a site-specific manner.
• the binding moiety A is conjugated to a polynucleic acid molecule (B) through a cysteine residue via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 5’-terminus via a site-specific manner.
• the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 3’- terminus via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through an unnatural amino acid via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through an enzyme - modified or enzyme -catalyzed residue via a site-specific manner.
• one or more polynucleic acid molecule (B) is conjugated to a binding moiety A.
• about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more polynucleic acid molecules are conjugated to one binding moiety A.
• about 1 polynucleic acid molecule is conjugated to one binding moiety A.
• about 2 polynucleic acid molecules are conjugated to one binding moiety A.
• about 3 polynucleic acid molecules are conjugated to one binding moiety A.
• about 4 polynucleic acid molecules are conjugated to one binding moiety A.
• about 5 polynucleic acid molecules are conjugated to one binding moiety A.
• about 6 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 7 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 8 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 11 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 13 polynucleic acid molecules are conjugated to one binding moiety A.
• polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 15 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, the one or more polynucleic acid molecules are the same. In other cases, the one or more polynucleic acid molecules are different.
• the number of polynucleic acid molecule (B) conjugated to a binding moiety A forms a ratio.
• the ratio is referred to as a DAR (drug-to-antibody) ratio, in which the drug as referred to herein is the polynucleic acid molecule (B).
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or greater.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 or greater.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7 or greater.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12 or greater.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 13. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 14. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 15. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 16.
• the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 4. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 12.
• a conjugate comprising polynucleic acid molecule (B) and binding moiety A has improved activity as compared to a conjugate comprising polynucleic acid molecule (B) without a binding moiety A.
• improved activity results in enhanced biologically relevant functions, e.g., improved stability, affinity, binding, functional activity, and efficacy in treatment or prevention of a disease state.
• the disease state is a result of one or more mutated exons of a gene.
• the conjugate comprising polynucleic acid molecule (B) and binding moiety A results in increased exon skipping of the one or more mutated exons as compared to the conjugate comprising polynucleic acid molecule (B) without a binding moiety A.
• exon skipping is increased by at least or about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% in the conjugate comprising polynucleic acid molecule (B) and binding moiety A as compared to the conjugate comprising polynucleic acid molecule (B) without a binding moiety A.
• an antibody or its binding fragment is further modified using conventional techniques known in the art, for example, by using amino acid deletion, insertion, substitution, addition, and/or by recombination and/or any other modification (e.g. posttranslational and chemical modifications, such as glycosylation and phosphorylation) known in the art either alone or in combination.
• the modification further comprises a modification for modulating interaction with Fc receptors.
• the one or more modifications include those described in, for example, International Publication No. W097/34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor.
• an antibody binding fragment further encompasses its derivatives and includes polypeptide sequences containing at least one CDR.
• the term“single -chain” as used herein means that the first and second domains of a bi-specific single chain construct are covalently linked, preferably in the form of a co-linear amino acid sequence encodable by a single nucleic acid molecule.
• a bispecific single chain antibody construct relates to a construct comprising two antibody derived binding domains.
• bi-specific single chain antibody construct is tandem bi-scFv or diabody.
• a scFv contains a VH and VL domain connected by a linker peptide.
• linkers are of a length and sequence sufficient to ensure that each of the first and second domains can, independently from one another, retain their differential binding specificities.
• binding to or interacting with as used herein defines a
• antigen-interaction-site defines a motif of a polypeptide that shows the capacity of specific interaction with a specific antigen or a specific group of antigens.
• the binding/interaction is also understood to define a specific recognition.
• specific recognition refers to that the antibody or its binding fragment is capable of specifically interacting with and/or binding to at least two amino acids of each of a target molecule.
• specific recognition relates to the specificity of the antibody molecule, or to its ability to discriminate between the specific regions of a target molecule.
• the specific interaction of the antigen-interaction-site with its specific antigen results in an initiation of a signal, e.g. due to the induction of a change of the conformation of the antigen, an oligomerization of the antigen, etc.
• the binding is exemplified by the specificity of a "key -lock -principle".
• specific motifs in the amino acid sequence of the antigen-interaction-site and the antigen bind to each other as a result of their primary, secondary or tertiary structure as well as the result of secondary modifications of said structure.
• the specific interaction of the antigen-interaction-site with its specific antigen results as well in a simple binding of the site to the antigen.
• specific interaction further refers to a reduced cross-reactivity of the antibody or its binding fragment or a reduced off-target effect.
• the antibody or its binding fragment that bind to the polypeptide/protein of interest but do not or do not essentially bind to any of the other polypeptides are considered as specific for the polypeptide/protein of interest.
• Examples for the specific interaction of an antigen-interaction-site with a specific antigen comprise the specificity of a ligand for its receptor, for example, the interaction of an antigenic determinant (epitope) with the antigenic binding site of an antibody.
• the binding moiety is a plasma protein.
• the plasma protein comprises albumin.
• the binding moiety A is albumin.
• albumin is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule.
• albumin is conjugated by native ligation chemistry to a polynucleic acid molecule.
• albumin is conjugated by lysine conjugation to a polynucleic acid molecule.
• the binding moiety is a steroid.
• steroids include cholesterol, phospholipids, di-and triacylglycerols, fatty acids, hydrocarbons that are saturated, unsaturated, comprise substitutions, or combinations thereof.
• the steroid is cholesterol.
• the binding moiety is cholesterol.
• cholesterol is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule.
• cholesterol is conjugated by native ligation chemistry to a polynucleic acid molecule.
• cholesterol is conjugated by lysine conjugation to a polynucleic acid molecule.
• the binding moiety is a polymer, including but not limited to polynucleic acid molecule aptamers that bind to specific surface markers on cells.
• the binding moiety is a polynucleic acid that does not hybridize to a target gene or mR A, but instead is capable of selectively binding to a cell surface marker similarly to an antibody binding to its specific epitope of a cell surface marker.
• the binding moiety is a peptide.
• the peptide comprises between about 1 and about 3 kDa. In some cases, the peptide comprises between about 1.2 and about 2.8 kDa, about 1.5 and about 2.5 kDa, or about 1.5 and about 2 kDa.
• the peptide is a bicyclic peptide. In some cases, the bicyclic peptide is a constrained bicyclic peptide. In some instances, the binding moiety is a bicyclic peptide (e.g., bicycles from Bicycle Therapeutics).
• the binding moiety is a small molecule.
• the small molecule is an antibody-recruiting small molecule.
• the antibody-recruiting small molecule comprises a target-binding terminus and an antibody -binding terminus, in which the target binding terminus is capable of recognizing and interacting with a cell surface receptor.
• the target-binding terminus comprising a glutamate urea compound enables interaction with PSMA, thereby, enhances an antibody interaction with a cell that expresses PSMA.
• a binding moiety is a small molecule described in Zhang et ah,“A remote arene -binding site on prostate specific membrane antigen revealed by antibody-recruiting small molecules,” J Am Chem Soc. 132(36): 12711-12716 (2010); or McEnaney, et ah,“Antibody-recruiting molecules: an emerging paradigm for engaging immune function in treating human disease,” ACS Chem Biol. 7(7): 1139-1151 (2012).
• polypeptides described herein are produced using any method known in the art to be useful for the synthesis of polypeptides (e.g., antibodies), in particular, by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression techniques.
• an antibody or its binding fragment thereof is expressed recombinantly, and the nucleic acid encoding the antibody or its binding fragment is assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
• chemically synthesized oligonucleotides e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242
• a nucleic acid molecule encoding an antibody is optionally generated from a suitable source (e.g., an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the immunoglobulin) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence.
• a suitable source e.g., an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the immunoglobulin
• an antibody or its binding is optionally generated by immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, by generating monoclonal antibodies, e.g., as described by Kohler and Milstein (1975, Nature 256:495-497) or, as described by Kozbor et al. (1983, Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
• a clone encoding at least the Fab portion of the antibody is optionally obtained by screening Fab expression libraries (e.g., as described in Huse et al, 1989, Science 246: 1275-1281) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (See, e.g., Clackson et al., 1991, Nature 352:624; Plane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).
• chimeric antibodies techniques developed for the production of“chimeric antibodies” (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity are used.
• a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region, e.g., humanized antibodies.
• single chain antibodies are adapted to produce single chain antibodies.
• Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
• Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988, Science 242: 1038-1041).
• an expression vector comprising the nucleotide sequence of an antibody or the nucleotide sequence of an antibody is transferred to a host cell by conventional techniques (e.g., electroporation, liposomal transfection, and calcium phosphate precipitation), and the transfected cells are then cultured by conventional techniques to produce the antibody.
• the expression of the antibody is regulated by a constitutive, an inducible or a tissue, specific promoter.
• a variety of host-expression vector systems is utilized to express an antibody or its binding fragment described herein.
• Such host-expression systems represent vehicles by which the coding sequences of the antibody is produced and subsequently purified, but also represent cells that are, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody or its binding fragment in situ.
• These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B.
• subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing an antibody or its binding fragment coding sequences; yeast (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing an antibody or its binding fragment coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing an antibody or its binding fragment coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing an antibody or its binding fragment coding sequences; or mammalian cell systems (e.g., COS, CHO, BH, 293, 293T, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the
• cell lines that stably express an antibody are optionally engineered.
• host cells are transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
• appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
• engineered cells are then allowed to grow for 1 -2 days in an enriched media, and then are switched to a selective media.
• the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn are cloned and expanded into cell lines.
• This method can advantageously be used to engineer cell lines which express the antibody or its binding fragments.
• a number of selection systems are used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et ah, 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et ah, 1980, Cell 22:817) genes are employed in tk-, hgprt- or aprt- cells, respectively.
• antimetabolite resistance are used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et ah, 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et ah, 1981, Proc. Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci.
• the expression levels of an antibody are increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)).
• vector amplification for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)).
• a marker in the vector system expressing an antibody is amplifiable
• an increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the nucleotide sequence of the antibody, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell Biol. 3:257).
• any method known in the art for purification or analysis of an antibody or antibody conjugates is used, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
• chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
• centrifugation e.g., centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
• Exemplary chromatography methods included, but are not limited to, strong anion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, and fast protein liquid chromatography.
• a polynucleic acid molecule B is conjugated to a binding moiety.
• the binding moiety comprises amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as analogs or derivatives of all of these classes of substances.
• binding moiety also include steroids, such as cholesterol, phospholipids, di-and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or contains substitutions), enzyme substrates, biotin, digoxigenin, and polysaccharides.
• the binding moiety is an antibody or binding fragment thereof.
• the polynucleic acid molecule is further conjugated to a polymer, and optionally an endosomolytic moiety.
• the polynucleic acid molecule is conjugated to the binding moiety by a chemical ligation process. In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a native ligation. In some instances, the conjugation is as described in: Dawson, et al.
• the polynucleic acid molecule is conjugated to the binding moiety either site-specifically or non -specifically via native ligation chemistry.
• the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing a“traceless” coupling technology (Philochem).
• the “traceless” coupling technology utilizes an N-terminal l,2-aminothiol group on the binding moiety which is then conjugate with a polynucleic acid molecule containing an aldehyde group (see Casi el al,“Site- specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery,” JACS 134(13): 5887-5892 (2012))
• the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing an unnatural amino acid incorporated into the binding moiety.
• the unnatural amino acid comprises /; -ace t y 1 p h e n y 1 al an i n e (pAcPhe).
• the keto group of pAcPhe is selectively coupled to an alkoxy-amine derivatived conjugating moiety to form an oxime bond.
• the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing an enzyme -catalyzed process.
• the site-directed method utilizes SMARTagTM technology (Catalent, Inc.).
• the SMARTagTM technology comprises generation of a formylglycine (FGly) residue from cysteine by formylglycine -generating enzyme (FGE) through an oxidation process under the presence of an aldehyde tag and the subsequent conjugation of FGly to an alkylhydraine -functionalized polynucleic acid molecule via hydrazino-Pictet- Spengler (HIPS) ligation
• FGE formylglycine
• HIPS hydrazino-Pictet- Spengler
• the enzyme -catalyzed process comprises microbial transglutaminase (mTG).
• mTG microbial transglutaminase
• the polynucleic acid molecule is conjugated to the binding moiety utilizing a microbial transglutaminase-catalyzed process.
• mTG catalyzes the formation of a covalent bond between the amide side chain of a glutamine within the recognition sequence and a primary amine of a functionalized polynucleic acid molecule.
• mTG is produced from Streptomyces mobarensis . (see Strop et al,“Location matters: site of conjugation modulates stability and
• the polynucleic acid molecule is conjugated to the binding moiety by a method as described in PCT Publication No. W02014/140317, which utilizes a sequence -specific transpeptidase.
• the polynucleic acid molecule is conjugated to the binding moiety by a method as described in U.S. Patent Publication Nos. 2015/0105539 and 2015/0105540.
• Polymer Conjugating Moiety is described in U.S. Patent Publication Nos. 2015/0105539 and 2015/0105540.
• a polymer moiety C is further conjugated to a polynucleic acid molecule described herein, a binding moiety described herein, or in combinations thereof. In some instances, a polymer moiety C is conjugated a polynucleic acid molecule. In some cases, a polymer moiety C is conjugated to a binding moiety. In other cases, a polymer moiety C is conjugated to a polynucleic acid molecule-binding moiety molecule. In additional cases, a polymer moiety C is conjugated, as illustrated supra.
• the polymer moiety C is a natural or synthetic polymer, consisting of long chains of branched or unbranched monomers, and/or cross-linked network of monomers in two or three dimensions.
• the polymer moiety C includes a polysaccharide, lignin, rubber, or polyalkylen oxide (e.g., polyethylene glycol).
• the at least one polymer moiety C includes, but is not limited to, alpha-, omega-dihydroxylpolyethyleneglycol, biodegradable lactone -based polymer, e.g.
• polyacrylic acid polylactide acid (PLA), poly(glycolic acid) (PGA), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, polyimide, polyethylene terephthalate (also known as poly(ethylene terephthalate), PET, PETG, or PETE), polytetramethylene glycol (PTG), or polyurethane as well as mixtures thereof.
• PPA polylactide acid
• PGA poly(glycolic acid)
• polypropylene polystyrene
• polyolefin polyamide
• polycyanoacrylate polyimide
• polyethylene terephthalate also known as poly(ethylene terephthalate)
• PET PETG
• PETE polytetramethylene glycol
• polyurethane polyurethane as well as mixtures thereof.
• a mixture refers to the use of different polymers within the same compound as well as in reference to block copolymers.
• block copolymers are poly
• the polymer moiety C comprises polyalkylene oxide. In some instances, the polymer moiety C comprises PEG. In some instances, the polymer moiety C comprises polyethylene imide (PEI) or hydroxy ethyl starch (HES).
• PEI polyethylene imide
• HES hydroxy ethyl starch
• C is a PEG moiety.
• the PEG moiety is conjugated at the 5’ terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 3’ terminus of the polynucleic acid molecule.
• the PEG moiety is conjugated at the 3’ terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 5’ terminus of the polynucleic acid molecule.
• the PEG moiety is conjugated to an internal site of the polynucleic acid molecule.
• the PEG moiety, the binding moiety, or a combination thereof are conjugated to an internal site of the polynucleic acid molecule.
• the conjugation is a direct conjugation. In some instances, the conjugation is via native ligation.
• the polyalkylene oxide (e.g., PEG) is a polydisperse or monodisperse compound.
• polydisperse material comprises disperse distribution of different molecular weight of the material, characterized by mean weight (weight average) size and dispersity.
• the monodisperse PEG comprises one size of molecules.
• C is poly- or monodispersed polyalkylene oxide (e.g., PEG) and the indicated molecular weight represents an average of the molecular weight of the polyalkylene oxide, e.g., PEG, molecules.
• the molecular weight of the polyalkylene oxide is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000,
• the polyalkylene oxide e.g., PEG
• C is polyalkylene oxide (e.g., PEG) and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.
• PEG polyalkylene oxide
• C is PEG and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some instances, the molecular weight of C is about 200 Da.
• the molecular weight of C is about 300 Da. In some instances, the molecular weight of C is about 400 Da. In some instances, the molecular weight of C is about 500 Da. In some instances, the molecular weight of C is about 600 Da. In some instances, the molecular weight of C is about 700 Da. In some instances, the molecular weight of C is about 800 Da. In some instances, the molecular weight of C is about 900 Da. In some instances, the molecular weight of C is about 1000 Da. In some instances, the molecular weight of C is about 1100 Da. In some instances, the molecular weight of C is about 1200 Da. In some instances, the molecular weight of C is about 1300 Da.
• the molecular weight of C is about 1400 Da. In some instances, the molecular weight of C is about 1450 Da. In some instances, the molecular weight of C is about 1500 Da. In some instances, the molecular weight of C is about 1600 Da. In some instances, the molecular weight of C is about 1700 Da. In some instances, the molecular weight of C is about 1800 Da. In some instances, the molecular weight of C is about 1900 Da. In some instances, the molecular weight of C is about 2000 Da. In some instances, the molecular weight of C is about 2100 Da. In some instances, the molecular weight of C is about 2200 Da. In some instances, the molecular weight of C is about 2300 Da.
• the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2500 Da. In some instances, the molecular weight of C is about 2600 Da. In some instances, the molecular weight of C is about 2700 Da. In some instances, the molecular weight of C is about 2800 Da. In some instances, the molecular weight of C is about 2900 Da. In some instances, the molecular weight of C is about 3000 Da. In some instances, the molecular weight of C is about 3250 Da. In some instances, the molecular weight of C is about 3350 Da. In some instances, the molecular weight of C is about 3500 Da. In some instances, the molecular weight of C is about 3750 Da.
• the molecular weight of C is about 4000 Da. In some instances, the molecular weight of C is about 4250 Da. In some instances, the molecular weight of C is about 4500 Da. In some instances, the molecular weight of C is about 4600 Da. In some instances, the molecular weight of C is about 4750 Da. In some instances, the molecular weight of C is about 5000 Da. In some instances, the molecular weight of C is about 5500 Da. In some instances, the molecular weight of C is about 6000 Da. In some instances, the molecular weight of C is about 6500 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7500 Da.
• the molecular weight of C is about 8000 Da. In some instances, the molecular weight of C is about 10,000 Da. In some instances, the molecular weight of C is about 12,000 Da. In some instances, the molecular weight of C is about 20,000 Da. In some instances, the molecular weight of C is about 35,000 Da. In some instances, the molecular weight of C is about 40,000 Da. In some instances, the molecular weight of C is about 50,000 Da. In some instances, the molecular weight of C is about 60,000 Da. In some instances, the molecular weight of C is about 100,000 Da.
• the polyalkylene oxide (e.g., PEG) comprises discrete ethylene oxide units (e.g., four to about 48 ethylene oxide units).
• the polyalkylene oxide comprising the discrete ethylene oxide units is a linear chain. In other cases, the polyalkylene oxide comprising the discrete ethylene oxide units is a branched chain.
• the polymer moiety C is a polyalkylene oxide (e.g., PEG) comprising discrete ethylene oxide units. In some cases, the polymer moiety C comprises between about 4 and about 48 ethylene oxide units. In some cases, the polymer moiety C comprises about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, or about 48 ethylene oxide units.
• PEG polyalkylene oxide
• the polymer moiety C comprises between about 4 and about 48 ethylene oxide units. In some cases, the polymer moiety C comprises about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about
• the polymer moiety C is a discrete PEG comprising, e.g., between about 4 and about 48 ethylene oxide units.
• the polymer moiety C is a discrete PEG comprising, e.g., about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, or about 48 ethylene oxide units.
• the polymer moiety C is a discrete PEG comprising, e.g., about 4 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 5 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 6 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 7 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 8 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 9 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 10 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 11 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 12 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 13 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 14 ethylene oxide units.
• the polymer moiety C is a discrete
• the polymer moiety C is a discrete PEG comprising, e.g., about 16 ethylene oxide units. In some cases, the polymer moiety C is a discrete
• PEG comprising, e.g., about 17 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 18 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 19 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 20 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 21 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 22 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 23 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 24 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 25 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 26 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 27 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 28 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 29 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 30 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 31 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 32 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 33 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 34 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 35 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 36 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 37 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 38 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 39 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 40 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 41 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 42 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 43 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 44 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 45 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 46 ethylene oxide units.
• the polymer moiety C is a discrete
• polymer moiety C comprising, e.g., about 47 ethylene oxide units.
• the polymer moiety C is a discrete
• PEG comprising, e.g., about 48 ethylene oxide units.
• the polymer moiety C is dPEG® (Quanta Biodesign Ltd).
• the polymer moiety C comprises a cationic mucic acid-based polymer (cMAP).
• cMAP comprises one or more subunit of at least one repeating subunit, and the subunit structure is represented as Formula (V):
• n is independently at each occurrence 1, 2, 3, 4, or 5.
• m and n are, for example, about 10.
• cMAP is further conjugated to a PEG moiety, generating a cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer.
• the PEG moiety is in a range of from about 500 Da to about 50,000 Da.
• the PEG moiety is in a range of from about 500 Da to about 1000 Da, greater than 1000 Da to about 5000 Da, greater than 5000 Da to about 10,000 Da, greater than 10,000 to about 25,000 Da, greater than 25,000 Da to about 50,000 Da, or any combination of two or more of these ranges.
• the polymer moiety C is cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some cases, the polymer moiety C is cMAP-PEG copolymer. In other cases, the polymer moiety C is an mPEG-cMAP-PEGm triblock polymer. In additional cases, the polymer moiety C is a cMAP-PEG-cMAP triblock polymer.
• the polymer moiety C is conjugated to the polynucleic acid molecule, the binding moiety, and optionally to the endosomolytic moiety as illustrated supra.
• a molecule of Formula (I): A-X I -B-X 2 -C further comprises an additional conjugating moiety.
• the additional conjugating moiety is an endosomolytic moiety.
• the endosomolytic moiety is a cellular compartmental release component, such as a compound capable of releasing from any of the cellular compartments known in the art, such as the endosome, lysosome, endoplasmic reticulum (ER), golgi apparatus, microtubule, peroxisome, or other vesicular bodies with the cell.
• the endosomolytic moiety comprises an endosomolytic polypeptide, an endosomolytic polymer, an endosomolytic lipid, or an endosomolytic small molecule. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide. In other cases, the endosomolytic moiety comprises an endosomolytic polymer.
• a molecule of Formula (I): A-X I -B-X 2 -C is further conjugated with an endosomolytic polypeptide.
• the endosomolytic polypeptide is a pH-dependent membrane active peptide.
• the endosomolytic polypeptide is an amphipathic polypeptide.
• the endosomolytic polypeptide is a peptidomimetic. In some instances, the
• endosomolytic polypeptide comprises INF, melittin, meucin, or their respective derivatives thereof. In some instances, the endosomolytic polypeptide comprises INF or its derivatives thereof. In other cases, the endosomolytic polypeptide comprises melittin or its derivatives thereof. In additional cases, the endosomolytic polypeptide comprises meucin or its derivatives thereof.
• INF7 is a 24 residue polypeptide those sequence comprises
• INF7 or its derivatives comprise a sequence of:
• GLFEAIEGFIENGWEGMIWDY GSGSCG SEQ ID NO: 3
• GLFEAIEGFIENGWEGMIDG WYG- (PEG)6-NH2 SEQ ID NO: 4
• GLFEAIEGFIENGWEGMIWDYG-SGSC-K(GalNAc)2 SEQ ID NO: 3
• melittin is a 26 residue polypeptide those sequence comprises
• melittin comprises a polypeptide sequence as described in U.S. Patent No. 8,501,930.
• meucin is an antimicrobial peptide (AMP) derived from the venom gland of the scorpion Mesobuthus eupeus.
• meucin comprises of meucin- 13 those sequence comprises IFGAIAGLLKNIF-NFf (SEQ ID NO: 8) and meucin-l8 those sequence comprises
• the endosomolytic polypeptide comprises a polypeptide in which its sequence is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence identity to INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof.
• the endosomolytic moiety comprises INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof.
• the endosomolytic moiety is INF7 or its derivatives thereof.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1-5.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2-5.
• the endosomolytic moiety comprises SEQ ID NO: 1.
• the endosomolytic moiety comprises SEQ ID NO: 2-5.
• the endosomolytic moiety consists of SEQ ID NO: 1.
• the endosomolytic moiety consists of SEQ ID NO: 2-5.
• the endosomolytic moiety is melittin or its derivatives thereof.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 6 or 7.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 6.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 7.
• the endosomolytic moiety comprises SEQ ID NO: 6.
• the endosomolytic moiety comprises SEQ ID NO: 7.
• the endosomolytic moiety consists of SEQ ID NO: 6.
• the endosomolytic moiety consists of SEQ ID NO: 7.
• the endosomolytic moiety is meucin or its derivatives thereof.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 8 or 9.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 8.
• the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 9.
• the endosomolytic moiety comprises SEQ ID NO: 8.
• the endosomolytic moiety comprises SEQ ID NO: 9.
• the endosomolytic moiety consists of SEQ ID NO: 8.
• the endosomolytic moiety consists of SEQ ID NO: 9.
• the endosomolytic moiety comprises a sequence as illustrated in Table 1.
• the endosomolytic moiety comprises a Bak BH3 polypeptide which induces apoptosis through antagonization of suppressor targets such as Bcl-2 and/or Bcl-x L .
• the endosomolytic moiety comprises a Bak BH3 polypeptide described in Albarran, et al.,“Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier,” Reactive & Functional Polymers 71: 261-265 (2011).
• the endosomolytic moiety comprises a polypeptide (e.g., a cell -penetrating polypeptide) as described in PCT Publication Nos. WO2013/166155 or WO2015/069587.
• the endosomolytic moiety is a lipid (e.g., a fusogenic lipid).
• a molecule of Formula (I): A-Xi-B- X 2 -C is further conjugated with an endosomolytic lipid (e.g., fusogenic lipid).
• fusogenic lipids include l,2-dileoyl-sn-3-phosphoethanolamine (DOPE), phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC),
• an endosomolytic moiety is a lipid (e.g., a fusogenic lipid) described in PCT Publication No. WO09/l26,933.
• the endosomolytic moiety is a small molecule.
• a molecule of Formula (I): A-X r B- X 2 -C is further conjugated with an endosomolytic small molecule.
• Exemplary small molecules suitable as endosomolytic moieties include, but are not limited to, quinine, chloroquine, hydroxychloroquines, amodiaquins (camoquines), amopyroquines, primaquines, mefloquines, nivaquines, halofantrines, quinone imines, or a combination thereof.
• quinoline endosomolytic moieties include, but are not limited to, 7-chloro-4-(4-diethylamino-l- methylbutyl-amino)quinoline (chloroquine); 7 -chloro-4-(4-ethyl-(2-hydroxyethyl)-amino- 1 -methylbutyl- amino)quinoline (hydroxychloroquine); 7 -fluoro-4-(4-diethylamino- 1 -methylbutyl-amino)quinoline; 4- (4-diethylamino-l-methylbutylamino) quinoline; 7-hydroxy-4-(4-diethyl -amino- 1- methylbutylamino)quinoline; 7-chloro-4-(4-diethylamino-l-butylamino)quinoline
• a linker described herein is a cleavable linker or a non-cleavable linker. In some instances, the linker is a cleavable linker. In other instances, the linker is a non-cleavable linker.
• the linker is a non-polymeric linker.
• a non-polymeric linker refers to a linker that does not contain a repeating unit of monomers generated by a polymerization process.
• Exemplary non-polymeric linkers include, but are not limited to, Ci-C 6 alkyl group (e.g., a C 5 , C 4 , C 3 , C 2 , or Ci alkyl group), homobifunctional cross linkers, heterobifunctional cross linkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof.
• the non- polymeric linker comprises a Ci-C 6 alkyl group (e.g., a C 5 , C 4 , C 3 , C 2 , or C
• the non- polymeric linker does not comprise more than two of the same type of linkers, e.g., more than two homobifunctional cross linkers, or more than two peptide linkers.
• the non-polymeric linker optionally comprises one or more reactive functional groups.
• the non-polymeric linker does not encompass a polymer that is described above. In some instances, the non-polymeric linker does not encompass a polymer encompassed by the polymer moiety C. In some cases, the non-polymeric linker does not encompass a polyalkylene oxide (e.g., PEG). In some cases, the non-polymeric linker does not encompass a PEG.
• a polyalkylene oxide e.g., PEG
• the non-polymeric linker does not encompass a PEG.
• the linker comprises a homobifunctional linker.
• homobifunctional linkers include, but are not limited to, Lomanf s reagent dithiobis
• DSP succinimidylpropionate
• DTSSP disuccinimidyl suberate
• DSS bis(sulfosuccinimidyl)suberate
• DST disuccinimidyl tartrate
• Sulfo DST ethylene glycobis(succinimidylsuccinate)
• EGS disuccinimidyl glutarate
• DSC N,N'-disuccinimidyl carbonate
• DMA dimethyl adipimidate
• DMP dimethyl pimelimidate
• DMS dimethyl suberimidate
• DTBP dimethyl-3, 3'-dithiobispropionimidate
• DTBP dimethyl-3, 3'-dithiobispropionimidate
• BASED formaldehyde, glutaraldehyde, l,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, a,a'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).
• the linker comprises a heterobifunctional linker.
• exemplary heterobifunctional linker include, but are not limited to, amine-reactive and sulfhydryl cross-linkers such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long -chain N-succinimidyl 3-(2- pyridyldithio)propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-a-methyl-a-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[a-methyl-a-(2-pyridyldithio)toluamido]hexanoate (sulf
• the linker comprises a reactive functional group.
• the reactive functional group comprises a nucleophilic group that is reactive to an electrophilic group present on a binding moiety.
• electrophilic groups include carbonyl groups— such as aldehyde, ketone, carboxylic acid, ester, amide, enone, acyl halide or acid anhydride.
• the reactive functional group is aldehyde.
• nucleophilic groups include hydrazide, oxime, amino, hydrazine, thiosemicarbazone, hydrazine carboxylate, and arylhydrazide.
• the linker comprises a maleimide group.
• the maleimide group is also referred to as a maleimide spacer.
• the maleimide group further encompasses a caproic acid, forming maleimidocaproyl (me).
• the linker comprises maleimidocaproyl (me).
• the linker is maleimidocaproyl (me).
• the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sMCC) or sulfosuccinimidyl-4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sulfo-sMCC) described above.
• a maleimidomethyl group such as succinimidyl-4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sMCC) or sulfosuccinimidyl-4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sulfo-sMCC) described above.
• the maleimide group is a self-stabilizing maleimide.
• the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide to provide intramolecular catalysis of tiosuccinimide ring hydrolysis, thereby eliminating maleimide from undergoing an elimination reaction through a retro-Michael reaction.
• the self-stabilizing maleimide is a maleimide group described in Lyon, et al,“Self hydrolyzing maleimides improve the stability and pharmacological properties of antibody -drug conjugates,” Nat. Biotechnol. 32(10): 1059-1062 (2014).
• the linker comprises a self- stabilizing maleimide.
• the linker is a self-stabilizing maleimide.
• the linker comprises a peptide moiety.
• the peptide moiety comprises at least 2, 3, 4, 5, or 6 more amino acid residues.
• the peptide moiety comprises at most 2, 3, 4, 5, 6, 7, or 8 amino acid residues.
• the peptide moiety comprises about 2, about 3, about 4, about 5, or about 6 amino acid residues.
• the peptide moiety is a cleavable peptide moiety (e.g., either enzymatically or chemically).
• the peptide moiety is a non-cleavable peptide moiety.
• the peptide moiety comprises Val-Cit (valine -citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 14223), Phe-Lys, Val-Lys, Gly- Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu- Ala-Leu (SEQ ID NO: 14224), or Gly-Phe-Leu-Gly (SEQ ID NO: 14225).
• the linker comprises a peptide moiety such as: Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 14223), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 14224), or Gly-Phe-Leu-Gly (SEQ ID NO: 14225).
• the linker comprises Val-Cit.
• the linker is Val-Cit.
• the linker comprises a benzoic acid group, or its derivatives thereof.
• the benzoic acid group or its derivatives thereof comprise paraaminobenzoic acid (PABA).
• the benzoic acid group or its derivatives thereof comprise gamma- aminobutyric acid (GABA).
• the linker comprises one or more of a maleimide group, a peptide moiety, and/or a benzoic acid group, in any combination. In some embodiments, the linker comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group. In some instances, the maleimide group is maleimidocaproyl (me). In some instances, the peptide group is val-cit. In some instances, the benzoic acid group is PABA. In some instances, the linker comprises a me -val-cit group.
• the linker comprises a val-cit-PABA group. In additional cases, the linker comprises a mc- val-cit-PABA group.
• the linker is a self-immolative linker or a self-elimination linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-elimination linker (e.g., a cyclization self-elimination linker). In some instances, the linker comprises a linker described in U.S. Patent No. 9,089,614 or PCT Publication No. WO2015038426.
• the linker is a dendritic type linker.
• the dendritic type linker comprises a branching, multifunctional linker moiety.
• the dendritic type linker is used to increase the molar ratio of polynucleotide B to the binding moiety A.
• the dendritic type linker comprises PAMAM dendrimers.
• the linker is a traceless linker or a linker in which after cleavage does not leave behind a linker moiety (e.g., an atom or a linker group) to a binding moiety A, a polynucleotide B, a polymer C, or an endosomolytic moiety D.
• a linker moiety e.g., an atom or a linker group
• Exemplary traceless linkers include, but are not limited to, germanium linkers, silicium linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linker.
• the linker is a traceless aryl-triazene linker as described in Hejesen, et al.,“A traceless aryl-triazene linker for DNA- directed chemistry,” Org Biomol Chem 11(15): 2493-2497 (2013).
• the linker is a traceless linker described in Blaney, et al.,“Traceless solid-phase organic synthesis,” Chem. Rev. 102: 2607-2024 (2002).
• a linker is a traceless linker as described in U.S. Patent No.
• the linker is a linker described in U.S. Patent Nos. 6,884,869; 7,498,298; 8,288,352; 8,609,105; or 8,697,688; U.S. Patent Publication Nos. 2014/0127239; 2013/028919;
• Xi and X 2 are each independently a bond or a non-polymeric linker. In some instances, Xi and X 2 are each independently a bond. In some cases, Xi and X 2 are each
• Xi is a bond or a non-polymeric linker. In some instances, Xi is a bond. In some instances, Xi is a non-polymeric linker. In some instances, the linker is a Ci-C 6 alkyl group. In some cases, Xi is a Ci-C 6 alkyl group, such as for example, a C 5 , C 4 , C 3 , C 2 , or Ci alkyl group. In some cases, the Ci-C 6 alkyl group is an unsubstituted Ci-C 6 alkyl group.
• alkyl means a saturated straight or branched hydrocarbon radical containing up to six carbon atoms.
• Xi includes a homobifunctional linker or a heterobifunctional linker described supra.
• Xi includes a heterobifunctional linker.
• Xi includes sMCC.
• Xi includes a heterobifunctional linker optionally conjugated to a Ci-C 6 alkyl group.
• Xi includes sMCC optionally conjugated to a (%- C 6 alkyl group.
• Xi does not include a homobifunctional linker or a
• X 2 is a bond or a linker. In some instances, X 2 is a bond. In other cases, X 2 is a linker. In additional cases, X 2 is a non-polymeric linker. In some embodiments, X 2 is a Ci-C 6 alkyl group. In some instances, X 2 is a homobifunctional linker or a heterobifunctional linker described supra. In some instances, X 2 is a homobifunctional linker described supra. In some instances, X 2 is a heterobifunctional linker described supra. In some instances, X 2 comprises a maleimide group, such as maleimidocaproyl (me) or a self-stabilizing maleimide group described above.
• a maleimide group such as maleimidocaproyl (me) or a self-stabilizing maleimide group described above.
• X 2 comprises a peptide moiety, such as Val-Cit.
• X 2 comprises a benzoic acid group, such as PABA.
• X 2 comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group.
• X 2 comprises a me group.
• X 2 comprises a mc-val-cit group.
• X 2 comprises a val-cit-PABA group.
• X 2 comprises a mc-val-cit-PABA group.
• Muscle atrophy refers to a loss of muscle mass and/or to a progressive weakening and degeneration of muscles.
• the loss of muscle mass and/or the progressive weakening and degeneration of muscles occurs due to a high rate of protein degradation, a low rate of protein synthesis, or a combination of both.
• a high rate of muscle protein degradation is due to muscle protein catabolism (i.e., the breakdown of muscle protein in order to use amino acids as substrates for gluconeogenesis).
• muscle atrophy refers to a significant loss in muscle strength.
• significant loss in muscle strength is meant a reduction of strength in diseased, injured, or unused muscle tissue in a subject relative to the same muscle tissue in a control subject.
• a significant loss in muscle strength is a reduction in strength of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more relative to the same muscle tissue in a control subject.
• by significant loss in muscle strength is meant a reduction of strength in unused muscle tissue relative to the muscle strength of the same muscle tissue in the same subject prior to a period of nonuse.
• a significant loss in muscle strength is a reduction of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least
• muscle atrophy refers to a significant loss in muscle mass.
• significant loss in muscle mass is meant a reduction of muscle volume in diseased, injured, or unused muscle tissue in a subject relative to the same muscle tissue in a control subject.
• a significant loss of muscle volume is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more relative to the same muscle tissue in a control subject.
• by significant loss in muscle mass is meant a reduction of muscle volume in unused muscle tissue relative to the muscle volume of the same muscle tissue in the same subject prior to a period of nonuse.
• a significant loss in muscle tissue is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more relative to the muscle volume of the same muscle tissue in the same subject prior to a period of nonuse.
• Muscle volume is optionally measured by evaluating the cross-section area of a muscle such as by Magnetic Resonance Imaging (e.g., by a muscle volume/cross-section area (CSA) MRI method).
• Magnetic Resonance Imaging e.g., by a muscle volume/cross-section area (CSA) MRI method.
• Myotonic dystrophy is a multisystemic neuromuscular disease comprising two main types: myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2).
• DM1 is caused by a dominantly inherited“CTG” repeat expansion in the gene DM protein kinase (DMPK ), which when transcribed into mRNA, forms hairpins that bind with high affinity to the Muscleblind-like (MBNL) family of proteins.
• DMPK DM protein kinase
• MBNL proteins are involved in post-transcriptional splicing and polyadenylatin site regulation and loss of the MBNL protein functions lead to downstream accumulation of nuclear foci and increase in mis-splicing events and subsequently to myotonia and other clinical symptoms.
• described herein is a method of treating muscle atrophy or myotonic dystrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein.
• the muscle atrophy is associated and/or induced by cachexia (e.g., cancer cachexia), denervation, myopathy, motor neuron diseases, diabetes, chronic obstructive pulmonary disease, liver disease, congestive heart failure, chronic renal failure, chronic infection, sepsis, fasting, sarcopenia, glucocorticoid-induced atrophy, disuse, or space flight.
• myotonic dystrophy is DM1.
• Cachexia is an acquired, accelerated loss of muscle caused by an underlying disease.
• cachexia refers to a loss of body mass that cannot be reversed nutritionally, and is generally associated with an underlying disease, such as cancer, COPD, AIDS, heart failure, and the like.
• cancer cachexia affects the majority of patients with advanced cancer and is associated with a reduction in treatment tolerance, response to therapy, quality of life and duration of survival. It some instances, cancer cachexia is defined as a multifactorial syndrome characterized by an ongoing loss of skeletal muscle mass, with or without loss of fat mass, which cannot be fully reversed by conventional nutritional support and leads to progressive functional impairment.
• cancer cachexia skeletal muscle loss appears to be the most significant event in cancer cachexia.
• diagnostic criteria takes into account not only that weight loss is a signal event of the cachectic process but that the initial reserve of the patient should also be considered, such as low BMI or low level of muscularity.
• described herein is a method of treating cachexia-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein.
• described herein is a method of treating cancer cachexia-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein.
• Denervation is an injury to the peripheral motoneurons with a partial or complete interruption of the nerve fibers between an organ and the central nervous system, resulting in an interruption of nerve conduction and motoneuron firing which, in turn, prevents the contractability of skeletal muscles.
• This loss of nerve function is either localized or generalized due to the loss of an entire motor neuron unit. The resulting inability of skeletal muscles to contract leads to muscle atrophy.
• denervation is associated with or as a result of degenerative, metabolic, or inflammatory neuropathy (e.g., Guillain- Barre syndrome, peripheral neuropathy, or exposure to environmental toxins or drugs).
• denervation is associated with a physical injury, e.g., a surgical procedure.
• described herein is a method of treating muscle atrophy associated with or induced by denervation in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating muscle atrophy associated with or induced by denervation in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Myopathy is an umbrella term that describes a disease of the muscle.
• myopathy includes myotonia; congenital myopathy such as nemaline myopathy, multi/minicore myopathy and myotubular (centronuclear) myopathy; mitochondrial myopathy; familial periodic paralysis; inflammatory myopathy; metabolic myopathy, for example, caused by a glycogen or lipid storage disease; dermatomyositis; polymyositis; inclusion body myositis; myositis ossificans;
• myopathy is caused by a muscular dystrophy syndrome, such as Duchenne, Becker, myotonic, fascioscapulohumeral, Emery-Dreifuss, oculopharyngeal, scapulohumeral, limb girdle, Fukuyama, a congenital muscular dystrophy, or hereditary distal myopathy.
• myopathy is caused by myotonic dystrophy (e.g., myotonic dystrophy type 1 or DM1). In some instances, myopathy is caused by DM1.
• described herein is a method of treating muscle atrophy associated with or induced by myopathy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating muscle atrophy associated with or induced by myopathy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Motor neuron disease encompasses a neurological disorder that affects motor neurons, cells that control voluntary muscles of the body.
• Exemplary motor neuron diseases include, but are not limited to, adult motor neuron diseases, infantile spinal muscular atrophy, amyotrophic lateral sclerosis, juvenile spinal muscular atrophy, autoimmune motor neuropathy with multifocal conductor block, paralysis due to stroke or spinal cord injury, or skeletal immobilization due to trauma.
• described herein is a method of treating muscle atrophy associated with or induced by a motor neuron disease in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating muscle atrophy associated with or induced by a motor neuron disease in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Diabetes comprises type 1 diabetes, type 2 diabetes, type 3 diabetes, type 4 diabetes, double diabetes, latent autoimmune diabetes (LAD), gestational diabetes, neonatal diabetes mellitus (NDM), maturity onset diabetes of the young (MODY), Wolfram syndrome, Alstrom syndrome, prediabetes, or diabetes insipidus.
• Type 2 diabetes also called non-insulin dependent diabetes, is the most common type of diabetes accounting for 95% of all diabetes cases.
• type 2 diabetes is caused by a combination of factors, including insulin resistance due to pancreatic beta cell dysfunction, which in turn leads to high blood glucose levels.
• increased glucagon levels stimulate the liver to produce an abnormal amount of unneeded glucose, which contributes to high blood glucose levels.
• Type 1 diabetes also called insulin-dependent diabetes, comprises about 5% to 10% of all diabetes cases.
• Type 1 diabetes is an autoimmune disease where T cells attack and destroy insulin- producing beta cells in the pancreas. In some embodiments, Type 1 diabetes is caused by genetic and environmental factors.
• Type 4 diabetes is a recently discovered type of diabetes affecting about 20% of diabetic patients age 65 and over. In some embodiments, type 4 diabetes is characterized by age -associated insulin resistance.
• type 3 diabetes is used as a term for Alzheimer’s disease resulting in insulin resistance in the brain.
• described herein is a method of treating diabetes-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein.
• described herein is a method of treating cancer diabetes-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein or a polynucleic acid molecule conjugate described herein.
• Chronic obstructive pulmonary disease is a type of obstructive lung disease characterized by long-term breathing problems and poor airflow.
• Chronic bronchitis and emphysema are two different types of COPD.
• described herein is a method of treating muscle atrophy associated with or induced by COPD (e.g., chronic bronchitis or emphysema) in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by COPD (e.g., chronic bronchitis or emphysema) in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• COPD chronic bronchitis or emphysema
• Liver disease comprises fibrosis, cirrhosis, hepatitis, alcoholic liver disease, hepatic steatosis, a hereditary disease, or primary liver cancer.
• described herein is a method of treating muscle atrophy associated with or induced by a liver disease in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by a liver disease in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Congestive heart failure is a condition in which the heart is unable to pump enough blood and oxygen to the body’s tissues.
• described herein is a method of treating muscle atrophy associated with or induced by congestive heart failure in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by congestive heart failure in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Chronic renal failure or chronic kidney disease is a condition characterized by a gradual loss of kidney function over time.
• described herein is a method of treating muscle atrophy associated with or induced by a chronic renal failure in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by a chronic renal failure in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• chronic infection such as AIDS further leads to muscle atrophy.
• described herein is a method of treating muscle atrophy associated with or induced by a chronic infection (e.g., AIDS) in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by a chronic infection (e.g., AIDS) in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Sepsis is an immune response to an infection leading to tissue damage, organ failure, and/or death.
• described herein is a method of treating muscle atrophy associated with or induced by sepsis in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by sepsis in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Fasting is a willing abstinence or reduction from some or all food, drinks, or both, for a period of time.
• described herein is a method of treating muscle atrophy associated with or induced by fasting in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein.
• described herein is a method of treating muscle atrophy associated with or induced by fasting in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• Sarcopenia is the continuous process of muscle atrophy in the course of regular aging that is characterized by a gradual loss of muscle mass and muscle strength over a span of months and years.
• a regular aging process means herein an aging process that is not influenced or accelerated by the presence of disorders and diseases which promote skeletomuscular neurodegeneration.
• described herein is a method of treating muscle atrophy associated with or induced by sarcopenia in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating muscle atrophy associated with or induced by sarcopenia in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• treatment with a glucocorticoid further results in muscle atrophy.
• glucocorticoids include, but are not limited to, cortisol, dexamethasone, betamethasone, prednisone, methylprednisolone, and prednisolone.
• described herein is a method of treating glucocorticoid-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating glucocorticoid-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• a limb is immobilized (e.g., due to a limb or joint fracture or an orthopedic surgery such as a hip or knee replacement surgery).
• immobilization or“immobilized” refers to the partial or complete restriction of movement of limbs, muscles, bones, tendons, joints, or any other body parts for an extended period of time (e.g., for 2 days, 3 days, 4 days, 5 days, 6 days, a week, two weeks, or more).
• a period of immobilization includes short periods or instances of unrestrained movement, such as to bathe, to replace an external device, or to adjust an external device.
• Limb immobilization is optionally carried out by any variety of external devices including, but are not limited to, braces, slings, casts, bandages, and splints (any of which is optionally composed of hard or soft material including but not limited to cloth, gauze, fiberglass, plastic, plaster, or metal), as well as any variety of internal devices including surgically implanted splints, plates, braces, and the like.
• external devices including, but are not limited to, braces, slings, casts, bandages, and splints (any of which is optionally composed of hard or soft material including but not limited to cloth, gauze, fiberglass, plastic, plaster, or metal), as well as any variety of internal devices including surgically implanted splints, plates, braces, and the like.
• the restriction of movement involves a single joint or multiple joints (e.g., simple joints such as the shoulder joint or hip joint, compound joints such as the radiocarpal joint, and complex joints such as the knee joint, including but not limited to one or more of the following: articulations of the hand, shoulder joints, elbow joints, wrist joints, auxiliary articulations, sternoclavicular joints, vertebral articulations, temporomandibular joints, sacroiliac joints, hip joints, knee joints, and articulations of the foot), a single tendon or ligament or multiple tendons or ligaments (e.g., including but not limited to one or more of the following: the anterior cruciate ligament, the posterior cruciate ligament, rotator cuff tendons, medial collateral ligaments of the elbow and knee, flexor tendons of the hand, lateral ligaments of the ankle, and tendons and ligaments of the jaw or temporomandibular joint), a single bone or multiple bones (e.g., including but
• described herein is a method of treating disuse-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, described herein is a method of treating disuse-associated muscle atrophy in a subject, which comprises administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein.
• the pharmaceutical formulations described herein are administered to a subject by multiple administration routes, including but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal administration routes.
• parenteral e.g., intravenous, subcutaneous, intramuscular, intra-arterial, intraperitoneal, intrathecal, intracerebral, intracerebroventricular, or intracranial
• the pharmaceutical composition describe herein is formulated for oral administration.
• the pharmaceutical composition describe herein is formulated for intranasal administration.
• the pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
• aqueous liquid dispersions self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
• the pharmaceutical formulation includes multiparticulate formulations.
• the pharmaceutical formulation includes nanoparticle formulations.
• nanoparticles comprise cMAP, cyclodextrin, or lipids.
• nanoparticles comprise solid lipid nanoparticles, polymeric nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or micellar solutions.
• Additional exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohoms, nano onions, nanorods, nanoropes and quantum dots.
• a nanoparticle is a metal nanoparticle, e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys or oxides thereof.
• a metal nanoparticle e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel
• a nanoparticle includes a core or a core and a shell, as in a core-shell nanoparticle.
• a nanoparticle is further coated with molecules for attachment of functional elements (e.g., with one or more of a polynucleic acid molecule or binding moiety described herein).
• a coating comprises chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carragheenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acids, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, a-chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin or dextrin or
• a nanoparticle has at least one dimension of less than about 500nm, 400nm, 300nm, 200nm, or lOOnm.
• the nanoparticle formulation comprises paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohoms, nano-onions, nanorods, nanoropes or quantum dots.
• a polynucleic acid molecule or a binding moiety described herein is conjugated either directly or indirectly to the nanoparticle. In some instances, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more polynucleic acid molecules or binding moieties described herein are conjugated either directly or indirectly to a nanoparticle.
• the pharmaceutical formulation comprises a delivery vector, e.g., a recombinant vector, the delivery of the polynucleic acid molecule into cells.
• a delivery vector e.g., a recombinant vector
• the recombinant vector is DNA plasmid.
• the recombinant vector is a viral vector.
• Exemplary viral vectors include vectors derived from adeno-associated vims, retrovims, adenovirus, or alphavims.
• the recombinant vectors capable of expressing the polynucleic acid molecules provide stable expression in target cells.
• viral vectors are used that provide for transient expression of polynucleic acid molecules.
• the pharmaceutical formulation includes a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form.
• exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like.
• Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman,
• the pharmaceutical formulation further includes pH adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
• acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids
• bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane
• buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
• acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
• the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range.
• salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
• the pharmaceutical formulation further includes diluent which are used to stabilize compounds because they provide a more stable environment.
• Salts dissolved in buffered solutions are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution.
• diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling.
• Such compounds include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel ® ; dibasic calcium phosphate, dicalcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugar, such as Di- Pac ® (Amstar); mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner’s sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.
• the pharmaceutical formulation includes disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance.
• disintegration agents include a starch, e.g., a natural starch such as com starch or potato starch, a pregelatinized starch such as National 1551 or Amijel ® , or sodium starch glycolate such as Promogel ® or Explotab ® , a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel ® , Avicel ® PH101, Avicel ® PHl02, Avicel ® PH105, Elcema ® P100, Emcocel ® , Vivacel ® , Ming Tia ® , and Solka-Floc ® , methylcellulose, croscarmellose, or a cross-linked cellulose, such
• carboxymethylcellulose (Ac -Di-Sol ® ), cross-linked carboxymethylcellulose, or cross-linked
• croscarmellose a cross-linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross-linked polyvinylpyrrolidone, alginate such as alginic acid or a salt of alginic acid such as sodium alginate, a clay such as Veegum ® HV (magnesium aluminum silicate), a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, a natural sponge, a surfactant, a resin such as a cation-exchange resin, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination starch, and the like.
• a cross-linked starch such as sodium starch glycolate
• a cross-linked polymer such as crospovidone
• a cross-linked polyvinylpyrrolidone alginate such as
• the pharmaceutical formulation includes filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
• agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
• Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein for preventing, reducing or inhibiting adhesion or friction of materials.
• Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex ® ), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet ® , boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a
• methoxypolyethylene glycol such as CarbowaxTM, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as SyloidTM, Cab-O-Sil ® , a starch such as com starch, silicone oil, a surfactant, and the like.
• Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers also function as dispersing agents or wetting agents.
• Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N- hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide and the like.
• Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like.
• Suspending agents include compounds such as polyvinylpyrrolidone, e.g.,
• polyvinylpyrrolidone K12 polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or
• polyvinylpyrrolidone K30 vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol has a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose,
• hydroxyethylcellulose sodium alginate
• gums such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone and the like.
• Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic ® (BASF), and the like.
• compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic ® (BASF), and the like.
• Pluronic ® Pluronic ®
• Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. Sometimes, surfactants is included to enhance physical stability or for other purposes.
• Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.
• Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium doccusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.
• the pharmaceutical compositions described herein are administered for therapeutic applications.
• the pharmaceutical composition is administered once per day, twice per day, three times per day or more.
• the pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more.
• composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.
• one or more pharmaceutical compositions are administered
• one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In additional cases, one or more
• compositions are administered at an interval period of time (e.g., the first administration of a first pharmaceutical composition is on day one followed by an interval of at least 1, 2, 3, 4, 5, or more days prior to the administration of at least a second pharmaceutical composition).
• two or more different pharmaceutical compositions are coadministered. In some instances, the two or more different pharmaceutical compositions are coadministered simultaneously. In some cases, the two or more different pharmaceutical compositions are
• the two or more different pharmaceutical compositions are coadministered sequentially without a gap of time between administrations.
• the two or more different pharmaceutical compositions are coadministered sequentially with a gap of about 0.5 hour, 1 hour, 2 hour, 3 hour, 12 hours, 1 day, 2 days, or more between administrations.
• the administration of the composition is given continuously; alternatively, the dose of the composition being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a“drug holiday”).
• the length of the drug holiday varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days.
• the dose reduction during a drug holiday is from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
• the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated.
• the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.
• toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
• the dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50.
• Compounds exhibiting high therapeutic indices are preferred.
• the data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human.
• the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity.
• the dosage varies within this range depending upon the dosage form employed and the route of administration utilized.
• kits and articles of manufacture for use with one or more of the compositions and methods described herein.
• Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
• Suitable containers include, for example, bottles, vials, syringes, and test tubes.
• the containers are formed from a variety of materials such as glass or plastic.
• the articles of manufacture provided herein contain packaging materials.
• packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
• the container(s) include target nucleic acid molecule described herein.
• Such kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.
• a kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.
• a label is on or associated with the container.
• a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
• a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
• the pharmaceutical compositions are presented in a pack or dispenser device which contains one or more unit dosage forms containing a compound provided herein.
• the pack for example, contains metal or plastic foil, such as a blister pack.
• the pack or dispenser device is accompanied by instructions for administration.
• the pack or dispenser is also accompanied with a notice associated with the container in form prescribed by a govemmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, is the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert.
• compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
• ranges and amounts can be expressed as“about” a particular value or range. About also includes the exact amount. Hence“about 5 pL” means“about 5 pL” and also“5 pL.” Generally, the term“about” includes an amount that would be expected to be within experimental error.
• the terms“individual(s)”,“subject(s)” and“patient(s)” mean any mammal.
• the mammal is a human.
• the mammal is a non-human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly or a hospice worker).
• a health care worker e.g. a doctor, a registered nurse, a nurse practitioner, a physician’s assistant, an orderly or a hospice worker.
• the term“therapeutically effective amount” relates to an amount of a polynucleic acid molecule conjugate that is sufficient to provide a desired therapeutic effect in a mammalian subject.
• the amount is single or multiple dose administration to a patient (such as a human) for treating, preventing, preventing the onset of, curing, delaying, reducing the severity of, ameliorating at least one symptom of a disorder or recurring disorder, or prolonging the survival of the patient beyond that expected in the absence of such treatment.
• dosage levels of the particular polynucleic acid molecule conjugate employed to provide a therapeutically effective amount vary in dependence of the type of injury, the age, the weight, the gender, the medical condition of the subject, the severity of the condition, the route of administration, and the particular inhibitor employed.
• therapeutically effective amounts of polynucleic acid molecule conjugate, as described herein is estimated initially from cell culture and animal models. For example, IC 50 values determined in cell culture methods optionally serve as a starting point in animal models, while IC 50 values determined in animal models are optionally used to find a therapeutically effective dose in humans.
• Skeletal muscle or voluntary muscle, is generally anchored by tendons to bone and is generally used to effect skeletal movement such as locomotion or in maintaining posture. Although some control of skeletal muscle is generally maintained as an unconscious reflex (e.g., postural muscles or the diaphragm), skeletal muscles react to conscious control. Smooth muscle, or involuntary muscle, is found within the walls of organs and structures such as the esophagus, stomach, intestines, uterus, urethra, and blood vessels.
• Type I muscle fibers are dense with capillaries and are rich in mitochondria and myoglobin, which gives Type I muscle tissue a characteristic red color. In some cases, Type I muscle fibers carries more oxygen and sustain aerobic activity using fats or carbohydrates for fuel. Type I muscle fibers contract for long periods of time but with little force. Type II muscle fibers are further subdivided into three major subtypes (Ila, IIx, and lib) that vary in both contractile speed and force generated. Type II muscle fibers contract quickly and powerfully but fatigue very rapidly, and therefore produce only short, anaerobic bursts of activity before muscle contraction becomes painful.
• Ila, IIx, and lib major subtypes
• Cardiac muscle is also an involuntary muscle but more closely resembles skeletal muscle in structure and is found only in the heart. Cardiac and skeletal muscles are striated in that they contain sarcomeres that are packed into highly regular arrangements of bundles. By contrast, the myofibrils of smooth muscle cells are not arranged in sarcomeres and therefore are not striated.
• Muscle cells encompass any cells that contribute to muscle tissue.
• Exemplary muscle cells include myoblasts, satellite cells, myotubes, and myofibril tissues.
• muscle force is proportional to the cross-sectional area (CSA), and muscle velocity is proportional to muscle fiber length.
• CSA cross-sectional area
• muscle velocity is proportional to muscle fiber length.
• siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. All the siRNA passenger strand contains conjugation handles in different formats, C6-NH 2 and/or C6-SH, one at each end of the strand. The conjugation handle or handles were connected to siRNA passenger strand via inverted abasic phosphodiester or phosphorothioate. Below are representative structures of the formats used in the in vivo experiments.
• the sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 1169 for the mouse mRNA transcript for MSTN (UUAUUAUUUGUUCUUUGCCUU; SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained a 5’ cholesterol which was conjugated as described below in Fig. 1.
• mice were obtained from either Charles River Laboratories or Harlan Laboratories.
• Wild type CD-l mice (4-6 week old) were dosed via intravenous (iv) injection with the indicated ASCs (or antibody-nucleic acid conjugate) and doses.
• Anti-transferrin receptor antibody or CD71 mAb is a rat IgG2a subclass monoclonal antibody that binds mouse CD71 or mouse transferrin receptor 1 (mTfRl). The antibody was produced by BioXcell and it is commercially available (Catalog # BE0175).
• Rat IgG2a isotype control antibody was purchased from BioXcell (Clone 2A3, Catalog # BE0089) and this antibody is specific to trinitrophenol and does not have any known antigens in mouse.
• Anti-EGFR antibody is a fully human IgGlK monoclonal antibody directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese Hamster Ovary cell line DJT33, which has been derived from the CHO cell line CHO-K1SV by transfection with a GS vector carrying the antibody genes derived from a human anti-EGFR antibody producing hybridoma cell line (2F8). Standard mammalian cell culture and purification technologies are employed in the manufacturing of anti-EGFR antibody.
• the theoretical molecular weight (MW) of anti-EGFR antibody without glycans is 146.6 kDa.
• the experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry.
• SDS-PAGE under reducing conditions the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain to be approximately 50 kDa.
• the heavy chains are connected to each other by two inter-chain disulfide bonds, and one light chain is attached to each heavy chain by a single inter-chain disulfide bond.
• the light chain has two intra-chain disulfide bonds and the heavy chain has four intra-chain disulfide bonds.
• the antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose and galactose.
• the predominant glycans present are fiicosylated bi-antennary structures containing zero or one terminal galactose residue.
• the charged isoform pattern of the IgGlK antibody has been investigated using imaged capillary IEF, agarose IEF and analytical cation exchange HPLC. Multiple charged isoforms are found, with the main isoform having an isoelectric point of approximately 8.7.
• anti-EGFR antibody The major mechanism of action of anti-EGFR antibody is a concentration dependent inhibition of EGF -induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody- dependent cell-mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in pre- clinical cellular in vitro studies.
• ADCC antibody- dependent cell-mediated cytotoxicity
• C2C12 myoblasts were grown in DMEM supplemented with 10% v/v FBS. For transfection, cells were plated at a density of 10.000 cells/well in 24-well plates, and transfected within 24 hours. C2C12 myotubes were generated by incubating confluent C2C12 myoblast cultures in DMEM supplemented with 2% v/v horse serum for 3-4 days. During and after differentiation the medium was changed daily. Pre-differentiated primary human skeletal muscle cells were obtained from ThermoFisher and plated in DMEM with 2% v/v horse serum according to recommendations by the manufacturer.
• Human SJCRH30 rhabdomyosarcoma myoblasts were grown in DMEM supplemented with 10% v/v heat-inactivated fetal calf serum, 4.5 mg/mL glucose, 4 mM L-glutamine, 10 mM HEPES, and 1 mM sodium pyruvate.
• For transfections cells were plated in a density of 10.000-20.000 cells/well in 24- well plates and transfected within 24 hours. All cells were transfected with various concentrations of the siRNAs (0.0001-100 nM; lO-fold dilutions) using RNAiMax (ThermoFisher) according to the recommendation by the manufacturer.
• Myostatin protein in plasma was quantified using the GDF-8 (Myostatin) Quantikine EFISA Immunoassay (part# DGDF80) from R&D Systems according to the manufacturer’s instructions.
• Architecture- 1 Antibody-Cys-SMCC-5’ -passenger strand. This conjugate was generated by antibody inter-chain cysteine conjugation to maleimide (SMCC) at the 5’ end of passenger strand.
• SMCC maleimide
• Architecture-2 Antibody-Cys-SMCC-3’ -Passenger strand. This conjugate was generated by antibody inter-chain cysteine conjugation to maleimide (SMCC) at the 3’ end of passenger strand.
• SMCC maleimide
• ASC Architecture-3 Antibody-Cys-bisMal-3’ -Passenger strand. This conjugate was generated by antibody inter-chain cysteine conjugation to bismaleimide (bisMal)linker at the 3’ end of passenger strand.
• ASC Architecture-4 A model structure of the Fab-Cys-bisMal-3’ -Passenger strand. This conjugate was generated by Fab inter-chain cysteine conjugation to bismaleimide (bisMal) linker at the 3’ end of passenger strand.
• ASC Architecture-5 A model structure of the antibody siR A conjugate with two different siR As attached to one antibody molecule. This conjugate was generated by conjugating a mixture of SSB and HPRT siRNAs to the reduced mAb inter-chain cysteines to bismaleimide (bisMal) linker at the 3’ end of passenger strand of each siRNA.
• ASC Architecture-6 A model structure of the antibody siRNA conjugate with two different siRNAs attached. This conjugate was generated by conjugating a mixture of SSB and HPRT siRNAs to the reduced mAb inter-chain cysteines to maleimide (SMCC) linker at the 3’ end of passenger strand of each siRNA.
• SMCC maleimide
• Step 1 Antibody interchain disulfide reduction with TCEP
• conjugates were characterized by SEC, SAX chromatography and SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange
• Isolated DAR1 conjugates are typically eluted at 9.0 ⁇ 0.3 min on analytical SAX method and are greater than 90% pure.
• the typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3.
• Fig. 2 illustrates SAX HPLC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1.
• Fig. 3 illustrates SEC HPLC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1.
• Step 1 Antibody reduction with TCEP
• Antibody was buffer exchanged with borax buffer (pH 8) and made up to 5mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of BisMal -C6-siRNA-C6-S-NEM (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and kept at 4 °C overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.
• Step 2 Purification [0431] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-l. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.
• the isolated conjugates were characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or 3 as well as size exclusion chromatography method- 1.
• Fig. 4 illustrates an overlay of DAR1 and DAR2 SAX HPLC chromatograms of TfRlmAb- Cys-BisMal-siRNA conjugates.
• Fig. 5 illustrates an overlay of DAR1 and DAR2 SEC HPLC chromatograms of TfRlmAb- Cys-BisMal-siRNA conjugates.
• Step 1 Antibody digestion with pepsin
• Antibody was buffer exchanged with pH 4.0, 20 mM sodium acetate/acetic acid buffer and made up to 5mg/ml concentration. Immobilized pepsin (Thermo Scientific, Prod#20343) was added and incubated for 3 hours at 37 °C. The reaction mixture was filtered using 30 kDa MWCO Amicon spin filters and pH 7.4 PBS. The retentate was collected and purified using size exclusion chromatography to isolate F(ab’)2. The collected F(ab’)2 was then reduced by 10 equivalents of TCEP and conjugated with SMCC-C6-siRNA-PEG5 at room temperature in pH 7.4 PBS. Analysis of reaction mixture on SAX chromatography showed Fab-siRNA conjugate along with unreacted Fab and siRNA-PEG.
• Step 2 Purification [0440] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-l . Fractions containing DAR1 and DAR2 Fab-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.
• Fig. 6 illustrates SEC chromatogram of CD71 Fab-Cys-HPRT-PEG5.
• Fig. 7 illustrates SAX chromatogram of CD71 Fab-Cys-HPRT-PEG5.
• Solvent A 20 mM TRIS buffer, pH 8.0
• Solvent B 20 mM TRIS, 1.5 M NaCl, pH 8.0;
• Solvent A 80% 10 mM TRIS pH 8, 20% ethanol
• Solvent B 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl
• Flow Rate 0.75 ml/min
• Solvent A 80% 10 mM TRIS pH 8, 20% ethanol
• Solvent B 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl
• a bioinformatics screen conducted identified 56 siRNAs (l9mers) that bind specifically to mouse atrogin-l (Fbxo32; NM_026346.3). In addition, 6 siRNAs were identified that target mouse atrogin-l and human atrogin-l (FBX032; NM_058229.3). A screen for siRNAs (l9mers) targeting specifically human/NHP atrogin-l (FBX032; NM_058229.3) yielded 52 candidates (Table 2A-Table 2B). All selected siRNA target sites do not harbor SNPs (pos. 2-18).
• Tables 2A and 2B illustrate identified siRNA candidates for the regulation of mouse and human/NHP atrogin-l.
• siRNAs targeting mouse atrogin-l and 52 targeting human atrogin-l 30 and 20 siRNAs were selected for synthesis and functional analysis, respectively. The activity of these siRNAs was analyzed in transfected mouse C2C12 myoblasts, mouse C2C12 myotubes, pre
• siRNAs targeting mouse atrogin-l showed significant activity in mouse C2C12 myotubes (at 10 nM), however 3 siRNAs downregulated mouse atrogin-l mRNA by >75% in C2C12 myoblasts (Table 3).
• siRNAs targeting Murfl which is exclusively expressed in C2C12 myotubes (Fig. 8) were active in C2C12 myotubes, demonstrating that siRNAs can be transfected into C2C12 myotubes.
• Atrogin-l might be alternatively spliced in C2C12 myoblasts and myotubes
• various positions in the atrogin-l mRNA were probed by RT-qPCR, but yielded similar results.
• siRNAs targeting human atrogin-l only four yielded >75% KD.
• active siRNAs localized either within or close to the coding region .
• One of the siRNAs targeting mouse atrogin-l (1179) was strongly cross-reactive with human atrogin-l. While this siRNA failed to show significant activity in mouse C2C12 myotubes, it effectively downregulated human atrogin-l in myotubes of primary human skeletal muscle cells. All efficacious siRNAs downregulated their respective targets with subnanomolar potency.
• Table 3 illustrates activity of selected atrogin-l siRNAs in transfected mouse C2C12 myoblasts, mouse C2C12 myotubes, pre -differentiated myotubes of primary human skeletal muscle cells, and human SJCRH30 rhabdomyosarcoma myoblasts.
• Example 2 For experimental procedures see Example 2.
• siRNAs (l9mers) that bind specifically to mouse Murfl sequences that show >3 sequence derivations from mouse Murf2 (Trim55; NM_00l039048.2) or Murf3 (Trim54).
• 9 siRNAs were identified that target mouse Murfl and human MuRFl (TRIM63; NM_032588.3).
• a screen for siRNAs (l9mers) targeting specifically human and NHP MuRFl (NM_032588.3) yielded 52 candidates (Table 4A-Table 4B). All selected siRNA target sites do not harbor SNPs (pos. 2-18).
• Tables 4A and 4B illustrate identified siRNA candidates for the regulation of mouse and human/NHP MuRF 1.
• siRNAs targeting mouse Murfl and 25 siRNAs targeting human MuRFl 35 and 25 siRNAs were selected for synthesis, respectively.
• the activity of these siRNAs was analyzed in transfected mouse C2C12 myotubes and pre -differentiated primary human skeletal muscle cells (Table 5).
• siRNAs targeting mouse MurFl 14 displayed >70% knock down of Murfl, but ⁇ 20% knock down of Murf2 and Murf3 in C2C12 myotubes. At least 6 of these 14 siRNAs were cross reactive with human MuRFl.
• siRNAs targeting human MuRFl 8 displayed >70% knock down of MuRFl, but ⁇ 20% knock down of MuRF2 and MuRF3 in pre -differentiated myotubes of primary human skeletal muscle cells. Only 1 of these 8 siRNAs showed significant cross - reactivity with mouse Mufl. All efficacious siRNAs downregulated their respective targets with subnanomolar potency.
• Table 5 illustrates activity of selected MuRFl siRNAs in transfected mouse C2C12 myotubes and pre-differentiated myotubes of primary human skeletal muscle cells. Cells were grown and transfected and RNAs isolated and analyzed as described in Example 5.
• MSTN A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker.
• HPRT A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker.
• CD71 mAb-siRNA DAR1 conjugates were made, purified and characterized as described in Example 3. All conjugates were made through cysteine conjugation, a SMCC linker and the PEG was attached at the thiol using architecture 1 for MSTN and the scrambled siRNA and architecture 2 for the HPRT siRNA, see Example 3. Conjugates were characterized chromatographically as described in Table 6
• the conjugates were assessed for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see Fig. 9A.
• gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• an ASC is able to downregulate a muscle specific gene.
• the ASC was made with an anti -transferrin antibody conjugated to an siRNA designed to down regulate MSTN mRNA.
• Mouse gastroc muscle expresses the transferrin receptor and the conjugate has a mouse specific anti -transferrin antibody to target the siRNA, resulting in accumulation of the conjugates in gastroc muscle.
• Receptor mediate uptake resulted in siRNA mediated knockdown of the MSTN mRNA.
• MSTN A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3”) of the guide/antisense strand was
• UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• CD71 mAb-siRNA DAR1 conjugates were made and characterized as described in Example 3. All conjugates were made through cysteine conjugation, a SMCC linker and the thiol was end capped with NEM using architecture 1. Conjugates were characterized chromatographically as described in Table 7.
• the conjugates were assessed for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 10A.
• Plasma and tissue samples were also taken as indicated in Fig. 10A.
• Muscle tissues were harvested and snap- frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• Quantitation of tissue siRNA concentrations was determined using a stem- loop qPCR assay as described in the methods section.
• the antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem-loop RT primer.
• Plasma myostatin levels were determined using an ELISA, see Example 2 for full experimental details. Changes in leg muscle area were determined: The leg-to-be-measured were shaved and a line was drawn using indelible ink to mark region of measurement. Mice were restrained in a cone restraint and the right leg was held by hand. Digital calipers were used to take one measurement on the sagittal plane and another on the coronal plane. The procedure was repeated twice per week.
• siRNA mediated MSTN mRNA downregulation was observed.
• Mouse gastroc muscle expresses transferrin receptor and the conjugate has a mouse specific anti -transferrin antibody to target the siRNA, resulting in accumulation of the conjugates in gastroc muscle.
• Receptor mediate uptake resulted in siRNA mediated knockdown of the MSTN gene.
• Example 8 2017-PK-299-WT - MSTN Zalu vs TfR, mAb vs Fab, DARI vs DAR2 siRNA design and synthesis
• MSTN A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• MSTN* MSTN: A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN.
• the sequence (5’ to 3’) of the guide/antisense strand was UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained one conjugation handle, a C6-NH 2 at the 5’ end, which was connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker.
• ASC synthesis and characterization [0487] The CD71 mAb-siRNA DAR1 and DAR2 conjugates were made and characterized as described in Example 3. Groups 1-8 and 17-20 were made through cysteine conjugation and a BisMal linker using architecture 3. Groups 9-16 were made through cysteine conjugation, a SMCC linker and the free thiol was end capped with NEM PEG using architecture 1. Conjugates were characterized chromatographically as described in Table 8.
• the conjugates were assessed for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 11A.
• Plasma and tissue samples were also taken as indicated in Fig. 11A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.
• siRNA mediated MSTN mRNA downregulation with DAR1 and DAR2 antibody conjugates were observed, in addition to the DAR1 Fab conjugate.
• Mouse gastroc muscle expresses transferrin receptor and the conjugate has a mouse specific anti -transferrin antibody or Fab to target the siRNA, resulting in accumulation of the conjugates in gastroc muscle.
• Receptor mediate uptake resulted in siRNA mediated knockdown of the MSTN gene.
• MSTN A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• MSTN* MSTN: A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN.
• the sequence (5’ to 3’) of the guide/antisense strand was UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained one conjugation handle, a C6-NH 2 at the 5’ end, which was connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• CD71 mAb-siRNA DAR1 and DAR2 conjugates were made and characterized as described in Example 3. Groups 5-12 made through cysteine conjugation, a BisMal linker using architecture 3. Groups 13-16 were made through cysteine conjugation, a SMCC linker, the free thiol was end capped with NEM using architecture 1. Groups 17-20 were made through cysteine conjugation, a BisMal linker, the free thiol was end capped with NEM using architecture 3. Conjugates were characterized chromatographically as described Table 9.
• the conjugates were assessed for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 12A.
• Tissue samples were also taken as indicated in Fig. 12A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.
• Intracellular RISC loading was determined as described in Example 2.
• siRNA mediated MSTN mRNA downregulation with the DAR1 anti-transferrin antibody or Fab conjugates was observed.
• Mouse gastroc muscle expresses transferrin receptor and the conjugate have a mouse specific anti -transferrin antibody or Fab to target the payload, resulting in accumulation of the conjugates in gastroc muscle and loading into the RISC complex.
• Receptor mediate uptake resulted in siRNA mediated MSTN mRNA downregulation.
• Example 10 2017-PK-304-WT - PK with MSTN phenotype mAb vs Choi siRNA design and synthesis
• MSTN A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 14226).
• Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity.
• All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• CD71 mAb-siRNA DAR1 and DAR2 conjugates were made and characterized as described in example 3.
• Groups 5-12 were made through cysteine conjugation, a SMCC linker, the free thiol was end capped with NEM using architecture 1.
• Groups 13-16 were made through cysteine conjugation, a BisMal linker, the free thiol was end capped with NEM using architecture 3.
• Conjugates were characterized chromatographically as described in Table 10.
• the conjugates were assessed for their ability to mediate mRNA downregulation of myostatin (MSTN) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 13A.
• Tissue samples were also taken as indicated in Fig. 13A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.
• Intracellular RISC loading was determined as described in Example 2.
• Plasma MSTN protein levels were measured by EFISA as described in Example 2.
• siRNA mediated MSTN mRNA downregulation with the DAR1 and DAR2 anti-transferrin antibody conjugates was observed.
• mRNA downregulation correlated with a reduced level of plasma MSTN protein and RISC loading of the siRNA guide strand.
• All three muscle tissues expressed transferrin receptor and the conjugate has a mouse specific anti-transferrin antibody to target the siRNA, resulting in accumulation of the conjugates in muscle.
• Receptor mediate uptake resulted in siRNA mediated knockdown of the MSTN gene.
• HPRT A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• SSB A 2lmer duplex with 19 bases of complementarity and 3’ dinucleotide overhangs was designed against mouse MSTN. The sequence (5’ to 3’) of the guide/antisense strand was
• CD71 mAb-siRNA conjugates were made and characterized as described in Example 3.
• Groups 1-4 and 5-8 were made through cysteine conjugation, a BisMal linker, no 3’ conjugation handle on the passenger strand using architecture 3.
• Groups 13-16 were made through cysteine conjugation, a BisMal linker, no 3’ conjugation handle on the passenger strand, but were DAR2 conjugates made with a mixture of HPRT and SSB siRNAs using architecture 4. Conjugates were characterized chromatographically as described in Table 11.
• the conjugates were assessed for their ability to mediate mRNA downregulation of two house keeper genes (HPRT and SSB) in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 14A.
• Tissue samples were also taken as indicated in Fig. 14A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.
• Example 12 2017-PK-380-WT Activity of Atrogin-1 siRNAs in vivo (dose response) siRNA design and synthesis
• Atrogin-l siRNAs 4 different 2 lmer duplexes with 19 bases of complementarity and 3’ dinucleotide overhangs were designed against Atrogin-l, see Example 4 for details of the sequence.
• RNAi base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. The same design was used for all four siRNAs. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate- inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• CD71 mAb-siRNA conjugates were made and characterized as described in Example 3.
• Groups 1 -16 were made through cysteine conjugation, a BisMal linker, the free thiol was end capped with NEM using architecture 3. Conjugates were characterized chromatographically as described Table 12.
• the conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-l in skeletal muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 15 A.
• Tissue samples were taken as indicated in Fig. 15 A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap-frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• antibody siRNA conjugates differentially downregulate Atrogin- 1 in muscle and heart.
• Example 13 2017-PK-383-WT Activity of MuRFl siRNA in vivo (dose response) siRNA design and synthesis
• MuRFl siRNAs 4 different 2 lmer duplexes with 19 bases of complementarity and 3’ dinucleotide overhangs were designed against Atrogin-l, see Example 5 for details of the sequence.
• RNAi base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. The same design was used for all four siRNAs. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.
• the passenger strand contained two conjugation handles, a C6-NH 2 at the 5’ end and a C6-SH at the 3’ end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate- inverted abasic-phosphorothioate linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.
• CD71 mAb-siRNA conjugates were made and characterized as described in Example 3.
• Groups 1 -16 were made through cysteine conjugation, a BisMal linker, the free thiol was end capped with NEM using architecture 3. Conjugates were characterized chromatographically as described Table 13.
• the conjugates were assessed for their ability to mediate mRNA downregulation of MuRF-l in skeletal and heart muscle in vivo in wild type CD-l mice.
• Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs at the doses indicated in Fig. 16A.
• Tissue samples were taken as indicated in Fig. 16A.
• Gastrocnemius (gastroc) muscle tissues were harvested and snap- frozen in liquid nitrogen.
• mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes.
• MuRFl mRNA in gastroc muscle was downregulated to up to 70% and up to 50% in heart tissue, see Fig. 16B and Fig. 16C.
• antibody siRNA conjugates differentially downregulate MuRFl in muscle and heart.
• Table 14 illustrates exemplary siRNA (or atrogene) targets to regulate muscle atrophy.
• a polynucleic acid molecule hybridizes to a target region of an atrogene described in Table 14.
• 23-mer target sequences within one DMPK transcript variant are assigned with SEQ ID NOs: 703-3406.
• the set of 23-mer target sequences for this transcript variant was generated by walking down the length of the transcript one base at a time, and a similar set of target sequences could be generated for the other DMPK transcript variants using the same procedure.
• One common siRNA structure that can be used to target these sites in the DMPK transcript is a l9-mer fully complimentary duplex with 2 overhanging (not base-paired) nucleotides on the 3’ end of each strand.
• adding the l9-mer with both of the 2 nucleotide overhangs results in a total of 23 bases for the target site.
• the overhangs can be comprised of a sequence reflecting that of the target transcript or other nucleotides (for example a non-related dinucleotide sequence such as“UU”), the l9-mer fully complimentary sequence can be used to describe the siRNA for each 23-mer target site.
• l9-mer sense and antisense sequences for siRNA duplexes targeting each site within the DMPK transcript are assigned with SEQ ID NOs: 3407-8814 (with the first sense and antisense pairing as SEQ ID NO: 3407 and SEQ ID NO: 6111).
• SEQ ID NOs: 3407-6110 illustrate the sense strand.
• SEQ ID NOs: 6111-8814 illustrate the antisense strand.
• the DMPK transcript variant NM_00l288766 has been used for illustration but a similar set of siRNA duplexes can be generated by walking through the other DMPK transcript variants.
• the first base associates within the Ago2 binding pocket while the other bases (starting at position 2 of the antisense strand) are displayed for complimentary mRNA binding. Since“U” is the thermodynamically preferred first base for binding to Ago2 and does not bind the target mRNA, all of the antisense sequences can have“U” substituted into the first base without affecting the target complementarity and specificity.
• the last base of the sense strand l9-mer (position 19) is switched to“A” to ensure base pairing with the“U” at the first position of the antisense strand.
• SEQ ID NOs: 8815-11518 are similar to SEQ ID NOs: 3407-6110 except the last position of the l9-mer sense strand substituted with base“A”.
• SEQ ID NOs: 11519-14222 are similar to SEQ ID NOs: 6111-8814 except the first position of the l9-mer antisense strand substituted with base“U”.
• SEQ ID NO: 8815 and SEQ ID NO: 11519 for the first respective sense and antisense pairing.
• Example 16 Initial screening of a selected set of DMPK siRNAs for in vitro activity
• the initial set of DMPK siRNAs from SEQ ID NOs: 8815-14222 was narrowed down to a list of 81 siRNA sequences using a bioinformatic analysis aimed at selecting the sequences with the highest probability of on-target activity and the lowest probability of off-target activity.
• the bioinformatic methods for selecting active and specific siRNAs are well described in the field of RNAi and a person skilled in the arts would be able to generate a similar list of DMPK siRNA sequences against any of the other DMPK transcript variants.
• the DMPK siRNAs in the set of 81 sequences were synthesized on small scale using standard solid phase synthesis methods that are described in the oligonucleotide synthesis literature.
• DMPK siRNA sequences were synthesized using base, sugar and phosphate modifications that are described in the field of RNAi to optimize the potency of the duplex and reduce immunogenicity.
• Two human cell lines were used to assess the in vitro activity of the DMPK siRNAs: first, SJCRH30 human rhabdomyosarcoma cell line (ATCC® CRL-2061TM); and second, Myotonic Dystrophy Type 1 (DM1) patient-derived immortalized human skeletal myoblasts.
• each DMPK siRNA was transfected into SJCRH30 cells at 1 nM and 0.01 nM final concentration, as well as into DM1 myoblasts at 10 nM and 1 nM final concentration.
• the siRNAs were formulated with transfection reagent Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s“forward transfection” instructions. Cells were plated 24 h prior to transfection in triplicate on 96-well tissue culture plates, with 8500 cells per well for SJCRH30 and 4000 cells per well for DM1 myoblasts.
• 3DMl myoblasts 1 nM; % DMPK mRNA
• Example 17 In vitro dose response curves for a selected set of DMPK siRNAs

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Epidemiology (AREA)
• Biochemistry (AREA)
• Immunology (AREA)
• Biomedical Technology (AREA)
• General Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• General Chemical & Material Sciences (AREA)
• Cell Biology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Neurology (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Physical Education & Sports Medicine (AREA)
• Mycology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Nanotechnology (AREA)
• Optics & Photonics (AREA)
• Virology (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (36)

Applications Claiming Priority (4)

Related Child Applications (1)

Publications (1)

Family

ID=66751772

Family Applications (1)

Country Status (12)

Cited By (39)

Families Citing this family (27)