WO1991004753A1 - Conjugates of antisense oligonucleotides and therapeutic uses thereof - Google Patents

Conjugates of antisense oligonucleotides and therapeutic uses thereof Download PDF

Info

Publication number
WO1991004753A1
WO1991004753A1 PCT/US1990/005272 US9005272W WO9104753A1 WO 1991004753 A1 WO1991004753 A1 WO 1991004753A1 US 9005272 W US9005272 W US 9005272W WO 9104753 A1 WO9104753 A1 WO 9104753A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
group
binding molecule
oligonucleotide
conjugate
Prior art date
Application number
PCT/US1990/005272
Other languages
French (fr)
Inventor
Bradford W. Baer
Eric S. Groves
Lou L. Houston
Corey H. Levenson
Original Assignee
Cetus Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cetus Corporation filed Critical Cetus Corporation
Publication of WO1991004753A1 publication Critical patent/WO1991004753A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6807Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide

Definitions

  • This invention relates generally to the inhibition and/or regulation of expression and replication of cellular or foreign nucleic acid in cells by means of antisense oligonucleotides conjugated to a ligand binding molecule that recognizes a cell surface molecule. More specifically, this invention relates to the inhibition of viral expression or replication in viral infected cells, and/or endogenous nucleotide expression or replication in cells.
  • compositions useful in AIDS, TNF induced diseases/symptoms, and cancer therapy comprising at least one antisense oligonucleotide (or analogue thereof) conjugated to an antibody against a cell surface antigen, a growth factor, an antibody to a growth factor, an antibody to a cell surface receptor, or an antibody which recognizes a complex of growth factor and receptor.
  • antisense oligonucleotide or analogue thereof conjugated to an antibody against a cell surface antigen, a growth factor, an antibody to a growth factor, an antibody to a cell surface receptor, or an antibody which recognizes a complex of growth factor and receptor.
  • Methods of making the compositions, and methods of using the compositions in therapy are also disclosed.
  • the present invention presents applications of antisense oligonucleotide conjugates for the treatment of diseases, and concerns antisense oligonucleotides, transferrin receptor antibody, interleukins, AIDS, TNF, and leukemia. Background information as to each of these is
  • the antisense oligonucleotide is a single-stranded nucleic acid, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA , or RNA-DNA duplex is formed. These nucleic acids are often termed "antisense" because they are complementary to the sense or coding strand of the gene. Recently, formation of a triple helix has proven possible where the oligonucleotide is bound to a DNA duplex. It was found that oligonucleotides could recognize sequences in the major groove of the DNA double helix. A triple helix was formed thereby. This suggests that it is possible to synthesize sequence-specific molecules which specifically bind double-stranded DNA via recognition of major groove hydrogen binding sites. Le Doan, T. ei al., 1987, Nh ileic Acid Res.. If 749.
  • the above oligonucleotides can inhibit the function of the target nucleic acid. This could, for example, be a result of blocking the transcription, processing, poly(A) addition, replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradations.
  • the antisense oligonucleotide can be used to selectively suppress certain cellular functions. For example, in oncogenic transformed cells, oligonucleotides complementary to the oncogene suppresses its expression.
  • An antisense oligonucleotide has been shown to inhibit c-myc protein expression in a human promyelocytic leukemia cell line, HL60, which over expresses the c-myc protoncogene.
  • the antisense oligonucleotide used was complementary to regions of the c-myc mRNA. Wickstrom E.L., & aL, 1988, PNAS (USA). j£: 1028-1032 "Human Promyelocytic Leukemia HL60 cell Proliferation and c-myc Protein Expression are Inhibited by an Antisense Pentadecadeoxynucleotide Targeted against c- myc mRNA".
  • Antisense oligonucleotide can also be used to inhibit replication and expression of nucleic acid foreign to the host cells.
  • Antisense oligonucleotides are prepared in the laboratory and then introduced into cells, for example, by microinjection, uptake from the cell culture medium into the cells, or expressed in cells after transfection with plasmids orretroviruses carrying an antisense gene.
  • Antisense oligonucleotides were first discovered to inhibit the following viral replication or expression in cell culture: Rous sarcoma virus, vesicular stomatitis virus, herpes simplex virus type 1, simian virus, and influenza virus.
  • oligonucleotides that were most effective were complementary to the poly(A) signal; also effective were those targeted at the 5' end of the RNA: the cap and 5' untranslated region, next to the primer binding site and at the primer binding site.
  • the cap, 5' untranslated region, and poly(A) signal lie within the sequence repeated at the ends of retrovirus RNA (R region) and the oligonucleotides complementary to these might bind twice to the RNA.
  • triple helix formation opens new possibilities to control gene expression at the transcriptional level.
  • myc gene transcription could be inhibited in vitro by a purine-rich DNA oligonucleotide recognizing a sequence upstream of the transcription initiation site, and this is thought to result from triple helix formation.
  • Transferrin is the major iron transport protein found in human blood. When transferrin binds to the transferrin receptor found on the cell surface, the transferrin is internalized. When transferrin receptor antibodies bind to the transferrin receptor, they are also internalized into the cell through a highly efficient coated pit pathway. Fitzgerald, D.J.P., £t al-, 1983, "Enhancement of Toxicity of Anti-Transferrin Receptor Antibody-Pseudomonas Exotoxin Conjugates by Adenovirus", Proc. Natl. Acad. Sci. (USAV ££4134-4138. Interleukin is produced by T-cells, and other cell types.
  • interleukin 2 T-cell growth factor
  • T-cell growth factor T-cell growth factor
  • IL 2 T-cell growth factor
  • Ruscetti F. W. sl l, 1981, Blood.42:379
  • Human T- Lymphocyte Growth Factor Regulation of Growth and Function of T-Lymphocytes
  • T-Cell Monoclonal Antibodies Leukemias Studied with T-Cell Monoclonal Antibodies", (submitted).
  • Activated T- cells for example, T-cells activated by lipopolysaccharide, have IL-2 receptors.
  • HTLV Human T-cell leukemia-lymphotropic virus
  • ATLL adult T-cell leukemia-lymphoma
  • HTLV-II HTLV-type II
  • HTLV-III HTLV-type III
  • HTLV-III is also known as lymphadenopathy-associated virus (LAV), AIDS related virus (ARV) and human immunodeficiency virus (HTV).
  • LAV lymphadenopathy-associated virus
  • ARV AIDS related virus
  • HTV human immunodeficiency virus
  • AIDS was first recognized in 1981 and since that time, the disease has come to be recognized as a new epidemic.
  • HIV infection is associated with the development of the clinical syndrome of AIDS.
  • helper T-cells T-lymphocytes or OKT4-bearing T- cells as they are sometimes known, and macrophage
  • monocytes monocytes
  • helper T-cells T-lymphocytes or OKT4-bearing T- cells as they are sometimes known, and macrophage
  • monocytes monocytes
  • helper T-cells HTV producers.
  • the helper T-cells are quickly destroyed and their number is depleted to such an extent that the body's B-cells and other T-cells normally stimulated by helper T-cells no longer function normally or produce sufficient lymphokines and antibodies to destroy the invading virus or other invading microbes, etc.
  • HTV virus does not necessarily cause death directly, it does in many cases cause the immune system to be so severely depressed that the infected individual is infected or afflicted with various other diseases, that are often life threatening, such as herpes, cytomegalovirus, Kaposi's sarcoma and Epstein-Barr virus related lymphomas.
  • body tissues and fluids e.g., blood, saliva
  • AZT 3' -Azido- 3' - deoxythymidine
  • LPS lipopolysaccharide
  • TNF is beneficial to the infected animal to combat infection. For example, it had been found that mice injected with TNF were more resistant to certain forms of malaria. Further, TNF had been shown to stimulate macrophages and other blood cells to kill the parasites that cause Chaga's disease and schistosomiasis. However, in another study, TNF appeared to mediate a lethal inflammation of the brain in mice infected with malaria. The mice could be protected by antibody that neutralizes the brain damaging effect of TNF. Further, human patients with severe meningococcal infections and relatively high levels of the TNF in their blood were more likely to die from sepsis than patients with no detectable levels of the polypeptide. Old, L.G., 1988, Scientific America. May:59-75. "Tumor Necrosis Factor".
  • TNF has been shown to be involved in initiating the expression of human immunodeficiency virus in human cells that carry latent virus. Folks, ⁇ l al-, 1989, PNAS OJSA1 £&2365. Therefore, it appears that the prevention of or inhibition of TNF production would serve as a valuable prophylactic for the treatment of AIDS patients by preventing the expression of virus that is latent in the patient.
  • TNF is helpful in the local control of injury and infection, but may also be toxic when released in large amounts or at particularly sensitive sites. Therefore, research has been conducted to block TNF's action where its effects becomes more detrimental than protective. To date, the research has centered around anti-TNF antibody Tracey, el al., 1987, Nature.220:662, and molecules with TNF inhibitory activity such as those present in the urine of febrile patients. Seckinger, £tal.» 1988, J. Exp. Med.. 167:1511. However, the particular non-antibody TNF inhibitor has not been purified and characterized to the point where it is clinical useful. The anti-TNF antibody involved non-human TNF and non-human TNF antibody tested so far posed the problem of immunologic rejection in humans.
  • CML chronic myeloid leukemia
  • ALL acute lymphocytic leukemia
  • the oligonucleotide, GCTGAAGGGCTT ⁇ TTGAACTCTGCTTA hybridizes to BCR exon 3/ABL and exon ⁇ junction sequences; and oligonucleotide GCTGAAGGGCTT ⁇ CTTCCTTATTGATG hybridizes to BCR exon 2- ABL and exon ⁇ fusions.
  • oligonucleotide GCTGAAGGGCTT ⁇ CTGCGTCTCCAT hybridizes to the junction of BCR/ABL.
  • the arrows denote the junction between BCR and ABL exons.
  • This invention relates generally to the inhibition and regulation of expression of foreign and cellular RNA or DNA in cells by means of antisense oligonucleotides conjugated to a ligand binding molecule that recognizes cell surface molecules.
  • the antisense oligonucleotide used in the conjugate of this patent application includes oligonucleotides, which bind to single stranded nucleic acid and those which bind a strand of a double stranded nucleic acid.
  • the double stranded nucleic acids include DNA DNA, a DNA RNA, and RNA/RNA.
  • These antisense oligonucleotides include unmodified and modified nucleic acids, discussed supra, in the "Background of the Invention" section.
  • the oligonucleotide can be either an oligoribonucleotide or a oligodeoxyribonucleotide.
  • this invention relates to the inhibition of viral expression or replication in viral infected cells, and endogenous nucleic acid function in cells.
  • compositions useful in AIDS, TNF induced diseases/symptoms and cancer therapy comprising antisense oligonucleotides conjugated to antibody against cell surface antigen, growth factors, antibody to growth factors, antibody to growth factor cell surface receptors, and antibody to a complex comprising growth factor and growth factor receptor. Also shown are methods of making the compositions, and methods of using the compositions in therapy.
  • Figure 1 presents the sequence of the oligonucleotides BB01, BB02, and BB03.
  • Figure 2 presents the sequence of the oligonucleotides BB04, BB05, and BB06.
  • Figure 3 graphically presents competitive binding data comparing the 454A12- oligonucleotide conjugates with 454A12-rRA immunotoxin.
  • Figure 4 presents the result of the first experiment testing the efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions.
  • Figure 5 presents the result of the second experiment testing the efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions.
  • FIG. 6 presents the location of the TNF sense sequences on HuTNF cDNA which can serve as the templates for antisense oligonucleotides in a conjugate with antibodies for inhibition or suppression of TNF induced diseases/symptoms, for example, sepsis.
  • the invention described herein presents conjugates comprising a ligand binding molecule and one or more antisense oligonucleotides bound to the ligand binding molecule. These conjugates present a more efficient means than found in the prior art, for the delivery of antisense oligonucleotides into cells, that is via attachment to a cell surface targeting molecule. Due to low cell permeation, the prior art shows that high levels of antisense oligonucleotides are required to be effective. Because oligonucleotides are expensive, the invention enables a more effective and less costly use for the oligonucleotides.
  • oligonucleotides are cell targeted, they spend less time exposed to extra-cellular nucleases, which may degrade the oligonucleotides.
  • extracellular nuclease Oncogene, Anti-sense Oligonucleotides Against Serum Nuclease Degradation Using Terminal Methylphosphonate Groups.
  • conjugates consisting of antisense oligonucleotide and ligand binding molecule have the advantage of being non-toxic to non-targeted cells. This is because the antisense oligonucleotide specifically suppresses or inhibits only the targeted complementary nucleic acid, leaving non-targeted nucleic acid and therefore the non-targeted cells unharmed.
  • the antisense oligonucleotide used in the conjugate of this patent application includes oligonucleotides, which bind to single stranded nucleic acid and those which bind to double stranded nucleic acid.
  • the double stranded nucleic acids include DNA/DNA, a DNA/RNA, and RNA/RNA.
  • These antisense oligonucleotides include unmodified and modified nucleic acids, discussed supra, in the "Background of the Invention" section.
  • the oligonucleotide can be either an oligoribonucleotide or a oligodeoxyribonucleotide.
  • the conjugate may be produced from its individual components as described below.
  • the invention described below draws on previously published work in molecular biology/biochemistry. By way of example, such work consists of scientific papers, patents or pending patent applications. All of these publications, those described previously as well as those described below are hereby incorporated by reference.
  • Oligonucleotides may be synthesized according to standard methods known in the art. For example, one method for the synthesis and characterization of the oligodeoxynucleotides is discussed in Goodchild, J., supra.
  • the oligonucleotides with reactive sulfhydryl groups can also be synthesized on an automated DNA synthesizer according to methods known in the art.
  • Several references teach methods of introducing a sulfhydryl group at the 5' terminus of synthetic oligonucleotides. For example, Connolly, 1985, Nuc. Acids Res.13(12 ⁇ :4485-4502.
  • the ligand binding molecule includes any cell surface recognizing molecule. It can include any molecule with a specific affinity for a cell surface component
  • the cell surface component can be those generally found on any cell type.
  • the cell surface component is specific to the cell type targeted.
  • the cell surface component also provides a pathway for entry into the cell, for the oligonucleotide- ligand binding molecule conjugate or the oligonucleotide attached thereto.
  • the conjugation of the oligonucleotide to the ligand molecule does not substantially interfere with the ability of the ligand binding molecule for binding to the cell surface molecule or for entry of the conjugate or oligonucleotide into the cell.
  • the ligand binding molecule is a growth factor, an antibody to a growth factor, or an antibody to a cell surface receptor.
  • the ligand binding molecule is an antibody which recognizes a complex of growth factor and receptor.
  • the ligand binding molecule is an antibody or antigen binding fragment derived therefrom.
  • Antibody either polyclonal, monoclonal, bispecific, etc., may be generated by methods well known in the ar
  • the more preferred embodiment antibody is transferrin receptor antibody.
  • the preferred transferrin receptor antibody is described in EPA 226,419, "Anti-human Ovarian Cancer Immunotoxins and Methods of Use Thereof, published June 24, 1987, applicants Bjom, M. J. £i al. and denoted 454A12, therein. (Samples of the hybridomas which produce the monoclonal antibody had been deposited with the Collections of In Vitro International under the accession number IVI 10075.
  • the 454A12 binds to transferrin receptors, but does not substantially inhibit binding of transferrin to the transferrin receptor. It is thus different from the transferrin monoclonal antibodies claimed in U.S. Patent No.4,434,156, which inhibit binding of transferrin to the transferrin receptor. Both types of transferrin antibody are suitable ligand binding molecules.
  • Oligonucleotides can be conjugated to the ligand binding molecule for example, through disulfide, amides, or thioethers bonds, or through peptide linker, or any other type of chemical bond that is sensitive to cleavage in lysosomes by either enzymes or the acidic environment
  • the preferred embodiment conjugate comprises ligand binding molecule and oligonucleotide bound by a disulfide bond. Exemplary of this approach is binding the preferred antibody 454A12 to oligonucleotides by a disulfide bond.
  • Oligodeoxynucleotides with the following sequences were used: CTGGTCTAACCAGAGAGACC (designated BB01); and GCAAGCTTTATTGAGGCTTA (designated BB02).
  • the control has the following sequence: CAGTCAGTCAGTCAGTCAGT (designated BB03).
  • BB01 was complementary to the cap or initiator codon and BB02 was complementary to the poly(A) signal of the HIV genomic RNA.
  • the cap and poly(A) signal lie within the sequence repeated at the ends of the HTV RNA (R region).
  • BB03 is a 20-mer not complementary to the HTV RNA, BB03 has been tested and shown to be inactive. Goodchild, J., supra.
  • Figure 1 presents the sequences of the oligonucleotides. i order to form a conjugate, oligonucleotides with a reactive sulfhydryl group were synthesized. In the preferred embodiment, the oligonucleotides with reactive sulfhydryl groups were designated BB04, BB05, and BB06, each with a sequence corresponding to BB01, BB02, and BB03 respectively.
  • Figure 2 presents the sequences and data on these oligonucleotides. The oligonucleotides had the following generalized structure (the sulfhydryl group was denoted as X in Figure 2):
  • the derivatized antibody was then covalently linked, in a disulfide exchange, to the sulfhydryl group on the oligonucleotide. This linkage was achieved by incubating the two components (454A12-IT-TNB at 4 nM and oligonucleotide at 100 nM, final concentration) overnight at 4 ⁇ C. The sample turned yellow, indicating that the TNB group was being released and the desired product was being formed.
  • the sample was then passed through a 2.5 x 24 cm column of Sephadex G-25 resin equilibrated with 40 mM sodium phosphate, pH 7.6, containing 0.2 M NaCl.
  • the separation profile of a standard mixture of proteins was compared to 454A12 which elutes at 20.3 minutes.
  • the reaction mixture containing the conjugate 454A12- BB06 was run on GF250 preparation HPLC in PBS, pH 7.6.
  • the peak eluting at 17.7 minutes was shown by SDS-PAGE analysr ⁇ contain protein with molecular sizes larger than the unconjugated antibody.
  • Reac ⁇ on mixtures containing 454A12- BB04 and 454A12-BB05 were also shown by SDS-PAGE analysis to contain protein with molecular sizes larger than the unconjugated antibody. Analysis of the Conjugates for Nucleic Acid Content
  • the conjugates each in 40 mM sodium phosphate, pH 7.6, containing 0.2 M NaCl presterilized by filtration was used. The result was as follows:
  • oligonucleotides were conjugated to one antibody. It is possible that higher number of oligonucleotides can be conjugated to each antibody. It should be noted that oligonucleotides of different sequences can be conjugated to a single ligand binding molecule. This is especially desirable for treatment of AIDS where different strains of the HIV virus exist in a single patient
  • the oligonucleotide conjugates were tested for the ability to protect cells against the effects of an immunotoxin consisting of 454A12 and recombinant ricin A chain. The result showed that the immunotoxin alone inhibited protein synthesis by 50% at a concentration 0.01 nM. When the same experiment was done in the presence of 30 nM BB04 and BB05 conjugates, 10 fold higher concentrations of immunotoxin were required to reach 50% inhibition (See Figure 4).
  • Monocytes infected with HTV virus were produced in the following manner. Monocytes treated with rCSF-1 and maintained in culture for at least 7 days were used for cocultivation experiments with freshly isolated PBMC from seropositive HTV-infected individuals. The detailed procedures for isolation and culture of peripheral blood monocytes and virus isolation by monocyte cocultivation are described in Gendelman, H.E., s al-, 1988, "Efficient Isolation and Propagation of Human Immunodeficiency Virus on Recombinant Colony-Stimulating Factor 1-Treated Monocytes", J. Exp. Med..1 ⁇ 7_: 1428- 1441.
  • Reverse transcriptase activity was assayed as an indicator of viral replication. Inhibition of viral replication was reflected in reduced reverse transcriptase activity.
  • Assays of virion-associated reverse transcriptase (RT) activity were performed with [32p] deoxythymidinetriphosphate in a protocol described in detail in Willey, R. L., 1988, J. Virol..£: 139-147, "In Vitro Mutagenesis Identifies a Region within the Envelope Gene of the Human Immunodeficiency Virus that is Critical for Lifectivity.”
  • the efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions was determined. ( Figures 5 and 6 present the results, respectively).
  • the experiments used uncconjugated oligonucleotides (without sulfhydryl group), mixtures of unconjugated oligonucleotides (without sulfhydryl group) plus 454A12, and conjugates comprising 454A12 and oligonucleotides bound by a disulfide bond.
  • the oligonucleotides were prevented from conjugating with the antibodies because the oligonucleotides lacked the sulfhydryl group necessary for linkage with the antibodies.
  • each sample was introduced at the same time the monocytes were infected with the HTV virus, and every three days thereafter along with a fresh change of media.
  • the monocytes were infected with HIV at 100 viral infective units (1 unit being the amount which results in 50% cell infection after 1 month in culture).
  • the reverse transcriptase levels (in count per minute per 0.01 ml) in the culture fluid were measured after twelve days of cocultivation.
  • the following samples were used:
  • Samples 1 to 6 contained 50 ⁇ g ml of oligonucleotides at IX concentration. (Based on a reading of 1.6 at OD 2 60 ; a reading of 32 at OD 2 6 0 being indicative of 1 mg/ml of oligonucleotide.) Samples 7 to 9 contained 19 ⁇ g ml of oligonucleotide at IX concentration (based on a reading of 0.6 at OD 6 0). As indicated in Figure 5, 1/100, 1/1000, and 1/10,000 concentrations of the samples were used, respectively.
  • the second experiment followed the same protocol as the first and tested some of the samples at 1/10,000 concentration.
  • the results of the second experiment indicated the oligonucleotide-antibody conjugate (Sample 7) was more effective in inhibiting viral expression than its counterpart, the unconjugated oligonucleotide (Sample 1). Further, the oligonucleotide-antibody conjugate (Sample 8) was more effective at inhibiting viral expression than the unconjugated oligonucleotide mixed with free antibody (Sample 5). This result showed that the increase in inhibition of viral expression was due to conjugation of the oligonucleotide with the antibody.
  • the oligonucleotide can be conjugated to the antibody using heterobifunctional crosslinkers.
  • the preferred crosslinkers are maleimide active esters, and encompass a family of crosslinkers that produce a thioether bond linking antibody and oligonucleotide consisting of an activated carboxylate, a spacer molecule that contains ether groups, and a maleimido group to which a thiol on the oligonucleotide can bind.
  • the linker will have a preferred length of up to about 34 angstroms; however, longer linkers are intended to come within the scope of the invention.
  • the conjugation consists of reacting antibody having a free amino group with a maleimide-active ester crosslinker in a suitably buffered solution.
  • the derivatized antibody is separated from the crosslinker.
  • the isolated derivatized antibody can then be reacted with the oligonucleotide having a sulfhydryl group.
  • the thioether bond that links the antibody and the oligonucleotide described herein result from heterobifunctional crosslinkers having two reactive groups, an active ester designed to react primarily with amino groups, preferably on the antibody molecule; and a maleimido group that reacts with sulfhydryl groups, preferably present on the oligonucleotide. It is important to note, however, that by suitable chemical modification of antibody or oligonucleotide that reaction of antibody can be made to occur with the maleimido group, and reaction of oligonucleotide with the active ester.
  • antibody or antibody fragments can be prepared having free sulfhydryl groups by techniques well known in the art Particularly useful is the procedure shown in Urnovitz, U.S. Patent 4,698,420, which is hereby incorporated by reference.
  • Certain classes of antibody, specifically IgM and IgA exist as aggregates such that antibody molecules are joined together by disulfide bonds. Reduction of the aggregates causes the formation of individual antibody molecules having free sulfhydiyl groups which can be reacted with the maleimido group of the instant heterobifunctional crosslinkers.
  • antibody fragments can be produced using suitab? •* enzymes, and reduced thereby rendering sulfhydryl groups available for reaction.
  • sulfhydryl group(s) can be introduced into these molecules by reactions described in U.S. Patent Nos. 4,350,626, 4,450,154, and 4,340,535, which are hereby incorporated by reference. Regardless of how the sulfhydryl group is realized, antibody, or antibody fragment, is reacted with the heterobifunctional crosslinker at pH's which favor sulfhydryl maleimide reaction, preferably about pH 6.
  • the heterobifunctional crosslinkers of the present invention consist of an activated carboxylate, a spacer containing ether groups, and a maleimido group.
  • the initial step in the synthesis of this type of crosslinker consists of employing an ether containing spacer group, preferably an ether diamine, having amino reactive groups on both ends of the spacer, with a reversible amino protective reactive group to block one of the amino groups.
  • the remaining amino group is reacted with a dicarboxylic anhydride; glutaric anhydride and succinic anhydride can be employed, among others.
  • the protecting group is then removed, preferably by exposure to acid, and the deprotected amino group reacted with an active ester of maleimido to introduce a maleimide functionality at this region of the spacer.
  • the spacer contains a maleimido group at one end, and a group capable of forming an active ester, that is to say, a carboxylic acid, at the other.
  • This molecule is then reacted with 1- hydroxy-2-nitrobenzene-4-sulfonic acid in the presence of a suitable condensing agent to yield the maleimide active ester.
  • spacers of various length can be employed to produce the instant crosslinkers.
  • the preferred spacer has a length of about 34A; however, additional spacers considerably shorter or longer in length can be used and are available from Texaco Chemical Company under the trade name Jeffamine.
  • the synthesis of the heterobifunctional crosslinkers involves initially reacting the diamino containing spacer with the protecting group, 2-tert- butoxycarbonyloxyimino-2-phenyl-acetonitrile, (BOC). Suitable chromatographic techniques permit the isolation of the mono-BOC-spacer-NH 2 molecule. The preferred dicarboxylic anhydride, glutaric anhydride, is reacted with the mono-BOC-spacer. Suitable chromatographic isolation of the reactants yields BOC-spacer-glutarate.
  • BOC 2-tert- butoxycarbonyloxyimino-2-phenyl-acetonitrile
  • the BOC group is removed, generally using trifluoroacetic acid, the acid removed and the product reacted with a suitable active maleimido ester, preferably maleimido-6- aminocaproyl-ester of l-hydroxy-2-nitrobenzene sulfonic acid, to yield maleimido-6- aminocaproyl-spacer-glutarate, that hereafter is abbreviated mal-sac-spacer-glutarate.
  • a suitable active maleimido ester preferably maleimido-6- aminocaproyl-ester of l-hydroxy-2-nitrobenzene sulfonic acid
  • mal-sac-spacer-glutarate maleimido-6- aminocaproyl-spacer-glutarate
  • the heterobifunctional crosslinker is produced by reacting l-hydroxyl-2- nitrobenzene-4-sulfonic acid with mal-sac-spacer-glut in the presence of a suitable condensing agent such as dicyclohexyl
  • the preferred heterobifunctional maleimide-active ester crosslinker is maleimido-6-aminocaproyl- spacer-glutarate ester of l-hydroxyl-2-nitrobenzene sulfonic acid, abbreviated as mal- sac-spacer-glut-HNSA.
  • heterobifunctional crosslinker was conducted as follows.
  • BOC- ON 2-(tert-butoxycarbonyloxyimino)-2-phenylacetonitrile
  • the latter is an amino group protective agent
  • the mixture was allowed to react overnight, and then concentrated by rotary evaporation, followed by purification on a silica gel column.
  • the mixture was added to the column, and the column first exposed to chloroform : methanol : acetic acid, 80 : 20 : 10.
  • This solvent removed the bis-BOC, or, 4,9-dioxa-l,12-dodecanediamine derivative, and the mono- BOC dodecanediamine derivative was eluted with chloroform : methanol : acetic acid, 70 : 30 : 5.
  • BOC-spacer-glut was treated with trifluoroacetic acid to remove the BOC group. This was carried out by dissolving 1.6 grams of BOC-spacer-glut-OH in 20 ml of 95% trifluoroacetic acid followed by stirring for 30 minutes at room temperature. Trifluoroacetic acid was removed by rotary evaporation, and the residual oil dried overnight in vacuo. The resulting deprotected, NH 2 -spacer-glut was dissolved in 2.0 ml of dimethylformamide.
  • maleimido-6-aminocaproyl-spacer-glutaryl ester of l-hydroxy-2- nitrobenzene sulfonic acid was formed by dissolving 0.2 grams of mal-sac-spacer-glut- OH in 4.0 ml of dimethylformamide, followed by adding 0.534 grams of l-hydroxy-2- nitrobenzene sulfonic acid and 0.305 grams of dicyclohexylcarbodiimide. The mixture was allowed to react overnight at room temperature, and the active ester product chromatographed over a LH-20 Sephadex column as described above.
  • the procedure for forming the oligonucleotide antibody conjugate consists of reacting antibody, either polyclonal or monoclonal, having a free amino group with a maleimide-active ester, produced as described above, in a suitably buffered solution.
  • a maleimide-active ester is present in about a two-fold molar excess over antibody, and the pH of the solution is slightly alkaline to maintain the antibody's amino group in an unprotonated state.
  • the reaction of antibody with the thioether crosslinker can be followed by monitoring the absorbance of the solution at a wavelength of about 406 nm. Aldwin & Nitecki, supra.
  • the reaction of antibody with the crosslinker is for a time sufficient to introduce about 0.5-3 crosslinker molecules per antibody molecule.
  • the derivatized antibody is separated from the crosslinker, using any number of standard biochemical separation techniques. Preferably the separation procedure will be accomplished using a gel filtration column, and more preferably Sephadex G-25 (Pharmacia Corp.) will be employed. The column is pre-equilibrated with a chromatographically compatible aqueous buffered solution. The isolated derivatized antibody can then be reacted with the oligonucleotide having a sulfhydryl group as described below.
  • Oligonucleotide having a free sulfhydryl group can be directly reacted with the derivatized antibody in an aqueous buffered solution compatible with the reaction.
  • the oligonucleotide and antibody concentrations, and the duration of the reaction may vary depending on the number of oligonucleotide molecules sought to be bound to antibody.
  • the reaction is preferably run at 4°C overnight
  • the synthesis of the more preferred oligonucleotide-antibody conjugate was carried out as follows.
  • the monoclonal antibody 454A12 was reacted with the heterobifunctional crosslinker, mal-sac-spacer-glut-HNSA as follows. 10 mg ml of 454A12 was reacted with a two-fold molar excess of the thioether crosslinker in 0.1 M sodium phosphate, pH 8, for about 25 minutes at room temperature. The progress of the reaction was followed by measuring the absorbance as described in Example I at 406 nm.
  • the derivatized antibody was separated from the reaction mixture by gel filtration using a Sephadex G-25 column (2.5 x 17 cm) in 40 mM sodium phosphate buffer, pH 6, containing 200 mM NaCl. This material was reacted, as described below, with the oligonucleotide having a reactive sulfhydryl group.
  • the oligonucleotide with reactive sulfhydryl group was combined with derivatized antibody in a 1 : 2 molar ratio ( antibody : oligonucleotide with sulfhydryl group).
  • the solution was concentrated using an Amicon stirred ultra-filtration device.
  • the buffer employed was 40 mM sodium phosphate, pH 7.6, containing 200 mM NaCl.
  • the reaction was allowed to proceed overnight at 4°C, and the sample was then chromatographed over GF 250 gel filtration column (PBS pH 7.6). The fractions collected were run on 6.5% SDS-PAGE and conjugates were observed having molecular weight greater than the unconjugated antibody, 150,000 kD, but less than 210,000 kD.
  • the oligonucleotide with reactive sulfydryl group is combined with derivatized antibody in a 1:25 molar ratio (antibody: oligonucleotides with sulfhydryl group).
  • the oligonucleotide and antibody concentrations may vary depending on the number of oligonucleotides bound to the antibody.
  • the sample can be chromatographed over a Sepharose S-300 column (2.2 x 80 cm) in 40 mM sodium phosphate, pH 6.5, containing 200 mM NaCl. This step removed any unreacted oligonucleotides with the sulfhydryl group.
  • oligonucleotide antibody conjugates can be identified using a suitable analytical technique, such as sodium dodecyl sulfate polyacrylamide gel electrophoresis.
  • a suitable analytical technique such as sodium dodecyl sulfate polyacrylamide gel electrophoresis.
  • the oligonucleotide antibody conjugates so isolated can, if desired, be concentrated by any suitable technique known in the art followed by sterilization. The latter is readily achieved by passing the oligonucleotide antibody conjugate through an 0.2 micron filter.
  • HTV was presented to illustrate the invention. It should not be construed as limiting the invention.
  • any antisense oligonucleotide that is complementary to the RNA of the retrovirus genomic HIV may be used in the conjugation described above. It has been demonstrated that oligodeoxynucleotides complementary to certain highly conserved regions of the HIV genome inhibit virus replication or gene expression in cultured HTV-transformed human lymphocytes.
  • Examples of the locations on the HIV genome which can serve as the templates for the antisense oligonucleotides are: the tRNAlys primer binding site; regions of the HTV genome vicinal in the 5' direction to the tRNAlys primer binding site; the tRNAlys primer binding site and regions of the HIV genome vicinal in the 5' direction to the t NAlys primer binding site; the mRNA donor splice sites; the mRNA acceptor splice sites; the initiator codon for the gag gene; the initiator codon for the env gene; the initiator codon for the tat gene; the initiator codon for the sor gene; the initiator codon for the 3' orf gene; the cap nucleotide of the HTV genome; the art gene or portions thereof; the region of the HTV genome encoding a frameshift; the poly (A) addition site; and equivalents thereof.
  • the specific antisense oligonucleotide sequences which can be used are: CTGCTAGAGATddT; TGCTAGAGATTTTCCACAC; TTCAAGTCCCTGTTCGGGCGCCAAA; GCGTACTCACCAGTCGCCGC; CTGCTAGAGATTAA; ACACCCAATTCTGAAAATGG; CTGGTCTAACCAGAGAGACC; GCAAGCTTTATTGAGGCTTA; and equivalents thereof.
  • the oligonucleotide can target HIV nucleotide sequences which code for protease necessary for proper viral assembly. Oligodeoxynucleotides blocked at the 3' end by ddT, the isourea group, or other chain terminators may prove to be more effective inhibitors.
  • any highly conserved region of the HTV genome which encodes information necessary for viral replication or gene expression is a potential target for complementary oligodeoxynucleotides.
  • the oligonucleotide can be complementary to the viral mRNA, one strand of an integrated or unintegrated proviral DNA, a DNA-RNA, or RNA-RNA duplexes.
  • the antisense oligonucleotide conjugate can be used to inhibit replication or expression of other viruses, for example, herpes viruses in the treatment of herpes.
  • the oligonucleotides can be complementary to the genomic DNA,
  • conjugates consisting of ligand binding molecule and oligonucleotides may be used to treat diseases other than viral infections, and preferably is applied to the treatment of sepsis, as described below.
  • antisense oligonucleotides that can be used for preventing or suppressing TNF induced diseases, for example sepsis, are those complementary to TNF DNA or TNF RNA.
  • oligonucleotides complementary to the following can be used: sequences around the 5' end of the TNF messenger RNA; sequences at the beginning of and within the mRNA region coding for the transmembrane domain of the TNF protein; sequence within the coding region of the 17kD molecule.
  • Examples of the specific oligonucleotide sequences complementary to the above mRNA regions are: 5TCTCCCTCTTAGCTGGTCCTCTGC3';
  • a third embodiment of the invention is to apply ligand binding molecule- oligonucleotide conjugates to the treatment of cancer, preferable for the treatment of leukemia.
  • oligodeoxynucleotide that can be used are complementary to the unique fusion sequence of BCR-ABL mRNAs. For example, GCTGAAGGGCTT ⁇ TTGAACTCTGCTTA, complementary to the BCR exon 3/ABL exon ⁇ junction sequence; and
  • the oligodeoxynucleotide that can be used is GCTGAAGGGCTT ⁇ CTGCGTCTCCAT, which is complementary to the BCR/ABL junction of the BCR-ABL mRNA.
  • the ligand binding molecules can be monoclonal antibodies against leukemia-associated antigens. Examples of these are: anti-CALLA (common acute lymphoblastic leukemia-associated antigen), J5, BA-3, RFB-1, BA-2, SJ-9A4 Du-ALL-1, anti-3-3, anti-3-40, SN1 and CALL2, described in Foon, K.A., £l al-, 1986, Blood. ⁇ £(l):l-31, "Review: Immunologic Classification of Leukemia and Lymphoma".
  • the ligand binding molecules can also be antibodies that identify myeloid cell surface antigens, or antibodies that are reactive with B or T lymphocytes, respectively.
  • antibodies are those which identify human myeloid cell surface antigens or those which are reactive with human B or T lymphocytes as described in Foon, K.A., I& Additional examples are antibodies B43, CD22 and CD 19 which are reactive with B lymphocytes can also be used. Miscellaneous
  • the oligonucleotide used in the conjugate for the treatment of the above diseases, and other applications can be either oligodeoxynucleotide or oligoribonucleotide.
  • the choice will be dependent on the ease of synthesis, the efficacy, and the relative stability and special advantages of the oligonucleotides in a particular system.
  • the oligonucleotides can be complementary to either DNA or RNA. It can also bind to either or both single stranded or double stranded nucleic acid.
  • the DNA or RNA can be indigenous (cellular) to the cell in question or they can be foreign nucleic acids found in the host cells.
  • the DNA can be cellular or foreign infectious DNA, e.g., those of virus, bacteria, yeast fungi and other parasites.
  • the RNA can be genomic RNA or messenger RNA, for example, retroviral genomic RNA, foreign or cellular mRNA.
  • the oligonucleotide is complementary to and bound to the genomic DNA or RNA, it inhibits or prevents the nucleic acid from being replicated. By interfering with or inhibiting the replication of the nucleic acid, the oligonucleotide interferes with or inhibits downstream expression of the DNA or RNA in protein synthesis. Where the oligonucleotide is complementary to the messenger RNA it interferes with or inhibits the mRNA from being expressed in protein synthesis.
  • the ligand binding molecule in the conjugate can be varied. Any ligand binding molecule which facilitates contact of the oligonucleotide with the target cell, or entry of the oligonucleotide into the cells that can be conjugated to the oligonucleotide may be used.
  • the ligand binding molecule are antibody or growth factor, preferably, interleukin, interleukin antibody and any cell surface recognizing ligand binding molecule and fragments thereof which retain the ability to recognize cell surface molecule.
  • the ligand binding molecule can be an antibody against a HTV antigen.
  • the conjugation procedure is essentially the same as that for the conjugation of the oligonucleotide with transferrin receptor antibody.
  • the conjugates can be used in treating a variety of diseases.
  • the conjugates are used in the treatment of AIDS, prevention and treatment of sepsis, and treatment and suppression of tumors, as described in detail below.
  • a method of administering the conjugates to a human to treat AIDS to inhibit the replication of the AIDS virus in infected human cells and/or to prevent AIDS from developing in humans infected with the AIDS virus.
  • the strategy used in treating a particular individual depends on the status of the individual and the objective of the treatment For example, an individual who has been found to be carrying the HTV virus but shows no symptoms of AIDS might be treated differently, in terms of both the type of conjugates administered and the dose given, than an individual who has ADDS.
  • treatment might well differ if its objective is to protect uninfected cells or to have an effect on cells which are already infected.
  • an individual known to be harboring the virus but yet manifesting no sign of AIDS could be given a long-term or lifetime maintenance dose of the conjugates whose inhibitory effects stop reverse transcription, e.g., by using conjugates with oligonucleotides complementary to the primer binding site and/or sequences close to the primer binding site in the 5' direction.
  • the ligand binding molecule is preferably human transferrin receptor antibody. In this way, the first step in viral life or replication is inhibited because viral DNA cannot be made and the virus is unable to proliferate.
  • cells are already infected and treatment must inhibit expression of viral genes already present in the infected cells.
  • conjugates comprising oligonucleotides complementary to, for example, initiator codons for genes encoding viral proteins, are required to prevent viral construction.
  • uninfected cells can also be protected by administration of conjugates comprising oligonucleotides capable of blocking reverse transcription.
  • the patient can be administered with conjugates comprising oligonucleotide complementary to the HTV nucleotide sequence which encodes the protease necessary for the viral assembly. By inhibiting the production of protease, the unassembled viral particles will still cause antigenic marker to be expressed on the host cell, but will not be infections to other cells.
  • Cells expressing such viral antigens then can be immunologically eliminated, either through the patient's own immune response or with other medical treatments. Clearly, such a treatment is viable only where the infected cells are relatively few, such that elimination of these cells will not adversely affect the patients.
  • the dosage varies with such factors as the size and age of the patient, stage of the disease, the concurrent treatments being given and the type of conjugates used, etc.
  • the desired dose may be presented as two, three, four or more subdoses administered as infusions at appropriate intervals throughout the day. Administration is by any suitable route including oral, rectal, nasal, topical (including buccal and sublingual), vaginal andparenteral (including subcutaneous, intramuscular, intravenous and intradermal). It will be appreciated that the preferred route may vary based on the factors discussed in the previous paragraph.
  • the administered ingredients may be used in therapy in conjunction with other medicaments such as suramin, ribavirin, antimoniotungstate (HPA-23), interferon, e.g., alpha-interferon, interleukin ⁇ , AZT, CD4, DDC (dideoxycytidine), DDA (dideoxyadenosine), DDI (dideoxyinosine), lymphokines, casteniosperamine, met- enkephalin, peptide T, dextran sulfate, Lnreg-l and Ampligen, and phosphonoformate (Foscamet).
  • medicaments such as suramin, ribavirin, antimoniotungstate (HPA-23), interferon, e.g., alpha-interferon, interleukin ⁇ , AZT, CD4, DDC (dideoxycytidine), DDA (dideoxyadenosine), DDI (dideoxyinosine), lymphokines,
  • the conjugates described herein may be used in combination with bone marrow or lymphocyte transplants or other medications such as levamisol or thymosin which would increase lymphocyte numbers and/or function as is appropriate.
  • one of the ingredients has side effects, it is given to patients on alternate weeks.
  • AZT causes toxic side effects, such as myelosuppression and severe anemia.
  • DDC is also toxic since it causes serious peripheral neuropathy. Since AZT and DDC exhibit different toxicities, they are given to patients on alternate weeks.
  • the administered ingredients may be administered alone, they may be presented as part of a pharmaceutical formulation.
  • the formulations of the present invention comprise at least one conjugate, together with one or more acceptable carriers thereof and optionally other therapeutic ingredients.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient.
  • the patient's condition is stable, he is re-treated at the same dosage daily and evaluated weekly. Provided the patient's condition is stable, the treatment may be continued. To avoid an unwanted immune response to the antibody part of the conjugation for long treatment periods, the preferred conjugate consist of human or humanized antibody coupled to the appropriate oligonucleotide(s). At the end of each period, the patient is again evaluated. Comparison of the pre-treatment and post- treatment T-cell counts indicates the efficacy of the combined treatments by showing whether the viral expression has been inhibited and whether the viral population has decreased. According to the efficacy of the combined treatments, and the patient's condition, the peptide or peptide-ligand binding molecule dosage, the chemotherapy may be increased or maintained constant for the duration of treatment. The patient's condition and the status of the viral expression is monitored periodically through physical exam, and laboratory tests. The starting dose of conjugate and chemotherapy is reduced for a patient who exhibits adverse reaction.
  • formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question.
  • the strategy used in treating a particular individual depends on the status of the sepsis and the objective of the treatment For example, treatments for prevention of sepsis differs from that of containment or reduction af er its onset
  • conjugates comprising oligonucleotides complementary to, for example, initiator codons for the gene encoding TNF can prevent TNF production.
  • the conjugates may comprise oligonucleotides complementary to the mRNA coding for TNF. By binding to the mRNA, the conjugates prevent translation of mRNA, therefore, production of TNF is inhibited or stopped.
  • the oligonucleotides that can be utilized in the conjugate are sequences complementary to the 5' end of the TNF messenger RNA; sequences at the beginning of and within the mRNA region coding for transmembrane domain of the TNF protein; and sequences within the coding region of the 17 kD molecule. ( Figure 10 shows the locations of these sequences on the HuTNF cDNA.)
  • the above conjugates can be administered by any number of routes, but preferably by intravenous injection whereby the desirable blood level may be maintained by a continuous infusion or intermittent infusion. The dosage varies with such factors as the size and age of the patient, stage of the disease, the concurrent treatments being given, and the type of conjugates used, etc.
  • the desired dose may be presented as two, three, four or more subdoses may be infused at appropriate intervals throughout the day.
  • Administration is by any suitable route including oral, rectal, nasal, topical (including buccal sublingual), vaginal andparenteral (including subcutaneous, intramuscular, intravenous and intradermal). It will be appreciated that the preferred route may vary based on the factors discussed in the previous paragraph.
  • an example of prophylactic use of the conjugate is as follows: 3-5 hours before surgery the patient is administered intravenous infusion of the conjugates in a physiologically acceptable media at a starting dose of 2.0-20 mg/m2. The intravenous infusion continues throughout the surgery and 1-10 days post surgery. During this period, the patient's reaction to the conjugate is monitored by means of physical examination, extensive laboratory testing and observation of the patient's subjective reactions. The tests include evaluation for the toxicity, and tests for the level of TNF produced by the patient According to the efficacy of the treatment and the patient's condition, the conjugate dosage may be increased, or maintained constant, or decreased for the duration of the treatment
  • the administered ingredients may be administered alone, they may be presented as part of a pharmaceutical formulation.
  • the formulations of the present invention comprise at least one administered conjugate together with one or more acceptable carriers thereof and optionally other therapeutic ingredients.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient
  • the conjugates can be used for inhibition or suppression of other endogenous gene expression or protein synthesis.
  • the conjugates may be used to suppress expression of oncogenes.
  • a method of administering the conjugate to a human to suppress leukemia cause by mutations in the Ph' chromosome is similar to those described in Examples I and II.
  • the modifications being clinical tests for improvement include white blood cells counts. All the above is by way of example, and does not preclude other conjugates, methods of making the conjugates and methods of treatment using the conjugates that are known by those skilled in the art, or that could be arrived at by those skilled in the art using the guidelines set forth in this specification.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • AIDS & HIV (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Conjugates consisting of one or more antisense oligonucleotide(s) bound to a ligand binding molecule which recognizes a cell surface molecule that are useful for treating diseases are disclosed. The conjugates are preferably used to treat viral infections, AIDS; the prevention or treatment of sepsis; and the treatment or suppression of cancer caused either by cellular oncogene or viral infections. Further disclosed are methods for making the conjugates.

Description

CONJUGATES OF ANTISENSE OLIGONUCLEOTIDES AND THERAPEUTIC USES THEREOF
This invention relates generally to the inhibition and/or regulation of expression and replication of cellular or foreign nucleic acid in cells by means of antisense oligonucleotides conjugated to a ligand binding molecule that recognizes a cell surface molecule. More specifically, this invention relates to the inhibition of viral expression or replication in viral infected cells, and/or endogenous nucleotide expression or replication in cells. Specific examples are compositions useful in AIDS, TNF induced diseases/symptoms, and cancer therapy comprising at least one antisense oligonucleotide (or analogue thereof) conjugated to an antibody against a cell surface antigen, a growth factor, an antibody to a growth factor, an antibody to a cell surface receptor, or an antibody which recognizes a complex of growth factor and receptor. Methods of making the compositions, and methods of using the compositions in therapy are also disclosed. The present invention presents applications of antisense oligonucleotide conjugates for the treatment of diseases, and concerns antisense oligonucleotides, transferrin receptor antibody, interleukins, AIDS, TNF, and leukemia. Background information as to each of these is presented below.
Antisense Oligonucleotide The antisense oligonucleotide is a single-stranded nucleic acid, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA , or RNA-DNA duplex is formed. These nucleic acids are often termed "antisense" because they are complementary to the sense or coding strand of the gene. Recently, formation of a triple helix has proven possible where the oligonucleotide is bound to a DNA duplex. It was found that oligonucleotides could recognize sequences in the major groove of the DNA double helix. A triple helix was formed thereby. This suggests that it is possible to synthesize sequence-specific molecules which specifically bind double-stranded DNA via recognition of major groove hydrogen binding sites. Le Doan, T. ei al., 1987, Nh ileic Acid Res.. If 749.
By binding to the target nucleic acid, the above oligonucleotides can inhibit the function of the target nucleic acid. This could, for example, be a result of blocking the transcription, processing, poly(A) addition, replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradations. The antisense oligonucleotide can be used to selectively suppress certain cellular functions. For example, in oncogenic transformed cells, oligonucleotides complementary to the oncogene suppresses its expression. An antisense oligonucleotide has been shown to inhibit c-myc protein expression in a human promyelocytic leukemia cell line, HL60, which over expresses the c-myc protoncogene. The antisense oligonucleotide used was complementary to regions of the c-myc mRNA. Wickstrom E.L., & aL, 1988, PNAS (USA). j£: 1028-1032 "Human Promyelocytic Leukemia HL60 cell Proliferation and c-myc Protein Expression are Inhibited by an Antisense Pentadecadeoxynucleotide Targeted Against c- myc mRNA". See also Harel-Bellan, A., &., 1988, Exp. Med.. 168:2309-2318 "Specific Inhibition of LymphoJάne Biosyntheses and Autocrin Growth Using Antisense Oligonucleotides in Thl and Th2 Helper T-cell clones".
Antisense oligonucleotide can also be used to inhibit replication and expression of nucleic acid foreign to the host cells. Antisense oligonucleotides are prepared in the laboratory and then introduced into cells, for example, by microinjection, uptake from the cell culture medium into the cells, or expressed in cells after transfection with plasmids orretroviruses carrying an antisense gene. Antisense oligonucleotides were first discovered to inhibit the following viral replication or expression in cell culture: Rous sarcoma virus, vesicular stomatitis virus, herpes simplex virus type 1, simian virus, and influenza virus. Since then, inhibition of mRNA translation by antisense oligonucleotides has been studied extensively in cell-free systems including rabbit reticulocyte lysates and wheat germ extracts. Inhibition of viral function by antisense oligonucleotides has been demonstrated in vitro using oligonucleotides which were complementary to the AIDS HIV retrovirus RNA. Goodchild, J., 1988, "Inhibition of Human Immunodeficiency Virus Replication by Antisense Oligodeoxynucleotides", Proc. Natl. Acad. Sci. (USA). £!Q5):5507-11. The Goodchild study showed that oligonucleotides that were most effective were complementary to the poly(A) signal; also effective were those targeted at the 5' end of the RNA: the cap and 5' untranslated region, next to the primer binding site and at the primer binding site. The cap, 5' untranslated region, and poly(A) signal lie within the sequence repeated at the ends of retrovirus RNA (R region) and the oligonucleotides complementary to these might bind twice to the RNA.
Toxicity studies in mice have shown that antisense oligodeoxynucleotides inhibit HIV only at high levels. Goodchild, J., M- This is due in part to limited cell permeation of some derivatives. Because the oligonucleotides arc expensive, the high dosage level necessarily increases the cost of treatment. As a result, research into modified oligonucleotides has been conducted. Examples of such modifications include: terminal blocking groups, internucleoside methylphosphonates or phosphorothioates, α-analogues, covalent addition of polylysine or other ligands, (e.g. attachment of iron EDTA or have analogs to the oligonucleotides), acridine or its derivatives, and other intercalating agents. See e.g. Stein, C. A. et al, 1988, Cancer Res., 4&: 2659-2668, "Oligonucleotides as Inhibitors of Gene Expression: A Review"; Helene, C, 1989, Br. J. Cancer. £Q: 157-160, "Artificial Control of Gene Expression by Oligodeoxynucleotides Covalendy Linked to Intercalating Agents." Also included are carbamate linked nucleic acid analogs, and antisense 2'-OMe RNA oligonucleotide. Stirchak, E.P., ≤ia 1989, Nuc. Acids Res..12(15):6129-6141, entitled "Uncharged Stereoregular Nucleic Acid Analogs: 2. Morpholino Nucleoside Oligomers with
Carbamate Internucleoside Linkages"; Lamond, A.I., ejt QL., 1989, Cell.5&383-390, "Probing the Structure and Function of U2 snRNP with Antisense Oligonucleotides made of2'-OMe RNA".
Sequence-specific suppression of viral expression in T-cells chronically infected with human immunodeficiency virus 1 (HIV-1) has been demonstrated using antisense phosphorothioate oligodeoxynucleotides. Matsukura, M., 1989, "Regulation of Viral Expression of Human Immunodeficiency Virus in Vitro by an Antisense Phosphorothioate Oligodeoxynucleotide Against Rev (art/trs) in Chronically Infected Cells", Proc. Natl Acad Sci. (USA). £6:4244-48. Oligodeoxynucleotide methylphosphonates have also been demonstrated to inhibit HTV expression. Sarin, P.S., 1988, "Inhibition of Acquired Immunodeficiency Syndrome Virus by Oligodeoxynucleotide Methylphosphonates", Proc. Natl. Acad. Sci. (USA.*. £5(20):7448-51.
Recently, there has been research into the formation of a triple helix consisting of oligonucleotide bound to a DNA double helix. See Helene. supra. Triple helix formation opens new possibilities to control gene expression at the transcriptional level. For example, it has been reported recently that myc gene transcription could be inhibited in vitro by a purine-rich DNA oligonucleotide recognizing a sequence upstream of the transcription initiation site, and this is thought to result from triple helix formation. Cooney, M. C. et al., 1988, Science.241:456-459. Cooney further postulated that it would be possible for a RNA to bind to a duplex DNA.
Anti-transferrin Receptor Antibody and Interleukin
Transferrin is the major iron transport protein found in human blood. When transferrin binds to the transferrin receptor found on the cell surface, the transferrin is internalized. When transferrin receptor antibodies bind to the transferrin receptor, they are also internalized into the cell through a highly efficient coated pit pathway. Fitzgerald, D.J.P., £t al-, 1983, "Enhancement of Toxicity of Anti-Transferrin Receptor Antibody-Pseudomonas Exotoxin Conjugates by Adenovirus", Proc. Natl. Acad. Sci. (USAV ££4134-4138. Interleukin is produced by T-cells, and other cell types. For example, interleukin 2 (IL 2, T-cell growth factor) is produced by T-lymphocytes after antigen- or mitogen-stimulation and is required for the proliferation of activated T-cells. IL 2 is an essential mediator of the immune response. Paetkau, V., 1981, Nature.224:689, "Lymphokines on the Move"; Ruscetti, F. W. sl l, 1981, Blood.42:379, "Human T- Lymphocyte Growth Factor: Regulation of Growth and Function of T-Lymphocytes". There is also preliminary evidence that it may be responsible for the abnormal cell proliferation in human lymphoblastic leukemias. Gillis, S. £i al., 1980, AACR. Abstract No.955:238, "Correlation of Elevated Terminal Transferase Activity (TdT) with Production of T-Cell Growth Factor (TCGF) in Human Leukemia Cells"; Venuta S. al-, "Production and Regulation of Interleukin-2 in Human Lymphoblastic
Leukemias Studied with T-Cell Monoclonal Antibodies", (submitted). Activated T- cells, for example, T-cells activated by lipopolysaccharide, have IL-2 receptors.
Human T-cell leukemia-lymphotropic virus (HTLV) refers to a family of T-cell tropic retroviruses. Such viruses, which have a role in causing certain T-cell neoplasms, are presently divided into three main types or subgroups: (1) HTLV-type I (HTLV-I), which appears to cause adult T-cell leukemia-lymphoma (ATLL); (2) HTLV- type II (HTLV-II), which has been isolated from an individual having a T-cell variant of hairy cell leukemia; and (3) HTLV-type III (HTLV-III), which has been identified as the etiologic agent of acquired immune deficiency syndrome (AIDS). HTLV-III is also known as lymphadenopathy-associated virus (LAV), AIDS related virus (ARV) and human immunodeficiency virus (HTV). (The HTLV-DI virus will hereinafter be referred to as HTV or AIDS virus.) Popovic, M., siaL 1984, Science.224:497-500: Gallo, R.C., st l., 1984, Science.224:500-503; Wong-Staal, F. and Gallo, R.C., 1985, Nature.212:395-403; and Curran, J.W., & L 1985, Science.229: 1352-1357. AIDS was first recognized in 1981 and since that time, the disease has come to be recognized as a new epidemic. RNA Tumor Viruses (2d edition), 2:437-443, Cold Spring Laboratory, 1985.
HIV infection is associated with the development of the clinical syndrome of AIDS. The following may be an explanation of the mechanism by which HIV operates. HIV appears to attack helper T-cells (T-lymphocytes or OKT4-bearing T- cells as they are sometimes known, and macrophage), monocytes, and possibly other human cells, e.g., certain cells within the brain. The invaded helper T-cells when activated become HTV producers. The helper T-cells are quickly destroyed and their number is depleted to such an extent that the body's B-cells and other T-cells normally stimulated by helper T-cells no longer function normally or produce sufficient lymphokines and antibodies to destroy the invading virus or other invading microbes, etc.
While the HTV virus does not necessarily cause death directly, it does in many cases cause the immune system to be so severely depressed that the infected individual is infected or afflicted with various other diseases, that are often life threatening, such as herpes, cytomegalovirus, Kaposi's sarcoma and Epstein-Barr virus related lymphomas. Thus, much effort is being put into developing methods of detecting the presence of HTV in body tissues and fluids (e.g., blood, saliva), developing vaccines, and prophylactics and therapeutics. So far, only one drug AZT (3' -Azido- 3' - deoxythymidine) has been approved by the United States Food and Drug
Administration to treat AIDS. AZT has serious side effects and limited efficiency. Therefore, there remains a need for a method for preventing the disease or for treating those who become infected with the virus. However, current efforts to develop a broad spectrum anti-HTV vaccine may be seriously compromised, in light of the variation in envelope proteins (which are the principal antigenic determinants of the virus) observed among various strains of HTV. Hahn, G.H., a 1985, PNAS (USA .. £2:4813- 4817; Benn, S., eial, 1985, Sciences.220:949-951. Other methods of blocking the effects of the virus are clearly needed.
TNF Induced Diseases/Svmptoms Endotoxin, a lipopolysaccharide (LPS) component of the cell wall of certain bacteria often causes the infected mammal to develop sepsis characterized by hypotension, disseminated intravascular coagulation, renal, hepatic, and cerebral injury, which eventually lead to the death of the mammal. The mechanism of action of LPS is unclear. It is widely believed that after its introduction, LPS stimulates macrophage cells to produce tumor necrosis factor (TNF) and other factors. Rec nt w implicates TNF as a cause of many negative effects associated with sepsis. Injection of TNF in mice and other animals mimics the effects of IPS and causes tissue injury, shock and death. However, other studies imply that at low doses, TNF is beneficial to the infected animal to combat infection. For example, it had been found that mice injected with TNF were more resistant to certain forms of malaria. Further, TNF had been shown to stimulate macrophages and other blood cells to kill the parasites that cause Chaga's disease and schistosomiasis. However, in another study, TNF appeared to mediate a lethal inflammation of the brain in mice infected with malaria. The mice could be protected by antibody that neutralizes the brain damaging effect of TNF. Further, human patients with severe meningococcal infections and relatively high levels of the TNF in their blood were more likely to die from sepsis than patients with no detectable levels of the polypeptide. Old, L.G., 1988, Scientific America. May:59-75. "Tumor Necrosis Factor".
Additionally, TNF has been shown to be involved in initiating the expression of human immunodeficiency virus in human cells that carry latent virus. Folks, ≤l al-, 1989, PNAS OJSA1 £&2365. Therefore, it appears that the prevention of or inhibition of TNF production would serve as a valuable prophylactic for the treatment of AIDS patients by preventing the expression of virus that is latent in the patient.
In summary, it appears that TNF is helpful in the local control of injury and infection, but may also be toxic when released in large amounts or at particularly sensitive sites. Therefore, research has been conducted to block TNF's action where its effects becomes more detrimental than protective. To date, the research has centered around anti-TNF antibody Tracey, el al., 1987, Nature.220:662, and molecules with TNF inhibitory activity such as those present in the urine of febrile patients. Seckinger, £tal.» 1988, J. Exp. Med.. 167:1511. However, the particular non-antibody TNF inhibitor has not been purified and characterized to the point where it is clinical useful. The anti-TNF antibody involved non-human TNF and non-human TNF antibody tested so far posed the problem of immunologic rejection in humans.
Myeloid and Acute Lvπφhocvtic Leukemias
A significant number of patients with chronic myeloid leukemia (CML) and acute lymphocytic leukemia (ALL) exhibit a cytogenetic abnormality known as
Philadelphia (Ph1) chromosome. Kawasaki, E.S., "Diagnosis of Chronic Myeloid and Acute Lymphocytic Leukemias by Detection of Leukemia-Specific mRNA Sequence Amplified In Vitro", 1988, PNAS OJSAl £5:5698-5702. The Philadelphia translocation fuses the BCR and ABL genes, resulting in the expression of leukemia- specific chimeric BCR-ABL messenger RNAs. Oligodeoxynucleotides complementary to this unique fusion sequence have been shown to hybridize to the BCR-ABL mRNA. The specific sequences of the oligonucleotides are as follows:
In the case of CML, the oligonucleotide, GCTGAAGGGCTTΛTTGAACTCTGCTTA hybridizes to BCR exon 3/ABL and exon π junction sequences; and oligonucleotide GCTGAAGGGCTTΛCTTCCTTATTGATG hybridizes to BCR exon 2- ABL and exon π fusions. In the case of ALL, oligonucleotide GCTGAAGGGCTTΛCTGCGTCTCCAT hybridizes to the junction of BCR/ABL. In the above sequences, the arrows denote the junction between BCR and ABL exons.
In summary, there is a need to identify and develop methods and compositions for treating diseases that have hitherto been intractable, particularly AIDS, sepsis, and certain forms of cancer. The instant invention describes a method applicable for the treatment of these diseases.
This invention relates generally to the inhibition and regulation of expression of foreign and cellular RNA or DNA in cells by means of antisense oligonucleotides conjugated to a ligand binding molecule that recognizes cell surface molecules. The antisense oligonucleotide used in the conjugate of this patent application includes oligonucleotides, which bind to single stranded nucleic acid and those which bind a strand of a double stranded nucleic acid. The double stranded nucleic acids include DNA DNA, a DNA RNA, and RNA/RNA. These antisense oligonucleotides include unmodified and modified nucleic acids, discussed supra, in the "Background of the Invention" section. Further, as used in this patent application, the oligonucleotide can be either an oligoribonucleotide or a oligodeoxyribonucleotide.
More specifically, this invention relates to the inhibition of viral expression or replication in viral infected cells, and endogenous nucleic acid function in cells. Specific examples are compositions useful in AIDS, TNF induced diseases/symptoms and cancer therapy comprising antisense oligonucleotides conjugated to antibody against cell surface antigen, growth factors, antibody to growth factors, antibody to growth factor cell surface receptors, and antibody to a complex comprising growth factor and growth factor receptor. Also shown are methods of making the compositions, and methods of using the compositions in therapy.
Figure 1 presents the sequence of the oligonucleotides BB01, BB02, and BB03.
Figure 2 presents the sequence of the oligonucleotides BB04, BB05, and BB06. Figure 3 graphically presents competitive binding data comparing the 454A12- oligonucleotide conjugates with 454A12-rRA immunotoxin.
Figure 4 presents the result of the first experiment testing the efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions.
Figure 5 presents the result of the second experiment testing the efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions.
Figure 6 presents the location of the TNF sense sequences on HuTNF cDNA which can serve as the templates for antisense oligonucleotides in a conjugate with antibodies for inhibition or suppression of TNF induced diseases/symptoms, for example, sepsis.
The invention described herein presents conjugates comprising a ligand binding molecule and one or more antisense oligonucleotides bound to the ligand binding molecule. These conjugates present a more efficient means than found in the prior art, for the delivery of antisense oligonucleotides into cells, that is via attachment to a cell surface targeting molecule. Due to low cell permeation, the prior art shows that high levels of antisense oligonucleotides are required to be effective. Because oligonucleotides are expensive, the invention enables a more effective and less costly use for the oligonucleotides. Additionally, because the oligonucleotides are cell targeted, they spend less time exposed to extra-cellular nucleases, which may degrade the oligonucleotides. For degradatory effect of extracellular nuclease on oligonucleotides, sss. Tidd, D.M., al, 1989, Br. J. Cancer. £Q:343-350, "Partial Protection of Oncogene, Anti-sense Oligonucleotides Against Serum Nuclease Degradation Using Terminal Methylphosphonate Groups".
Further, unlike other conjugates, for example immunotoxins, which are toxic if they permeate non-targeted cells, conjugates consisting of antisense oligonucleotide and ligand binding molecule have the advantage of being non-toxic to non-targeted cells. This is because the antisense oligonucleotide specifically suppresses or inhibits only the targeted complementary nucleic acid, leaving non-targeted nucleic acid and therefore the non-targeted cells unharmed. The antisense oligonucleotide used in the conjugate of this patent application includes oligonucleotides, which bind to single stranded nucleic acid and those which bind to double stranded nucleic acid. The double stranded nucleic acids include DNA/DNA, a DNA/RNA, and RNA/RNA. These antisense oligonucleotides include unmodified and modified nucleic acids, discussed supra, in the "Background of the Invention" section. Further, as used in this patent application, the oligonucleotide can be either an oligoribonucleotide or a oligodeoxyribonucleotide. The conjugate may be produced from its individual components as described below. The invention described below draws on previously published work in molecular biology/biochemistry. By way of example, such work consists of scientific papers, patents or pending patent applications. All of these publications, those described previously as well as those described below are hereby incorporated by reference.
Synthesis of the Oligonucleotides and Addition of Sulfhvdryl Group Thereto Oligonucleotides may be synthesized according to standard methods known in the art. For example, one method for the synthesis and characterization of the oligodeoxynucleotides is discussed in Goodchild, J., supra. The oligonucleotides with reactive sulfhydryl groups can also be synthesized on an automated DNA synthesizer according to methods known in the art. Several references teach methods of introducing a sulfhydryl group at the 5' terminus of synthetic oligonucleotides. For example, Connolly, 1985, Nuc. Acids Res.13(12^:4485-4502. describes a method of incorporating a sulfhydryl moiety into synthetic DNA using S-trityl-O-methoxy- morpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan-l-ol and 6- mercaptohexan-1-ol. Connolly further describes derivatization of the sulfhydryl- containing oligonucleotide with thiol-specific probes. Additionally, a new and improved procedure can be used and is described in detail in PCT patent application, PCT/US85/03212, Levenson, C, etal-, "Oligonucleotide Functionalizing Reagents and Methods", filed September 19, 1988.
Ligand Binding Molecules
The ligand binding molecule includes any cell surface recognizing molecule. It can include any molecule with a specific affinity for a cell surface component The cell surface component can be those generally found on any cell type. Preferably, the cell surface component is specific to the cell type targeted. More preferably, the cell surface component also provides a pathway for entry into the cell, for the oligonucleotide- ligand binding molecule conjugate or the oligonucleotide attached thereto. Preferably, the conjugation of the oligonucleotide to the ligand molecule does not substantially interfere with the ability of the ligand binding molecule for binding to the cell surface molecule or for entry of the conjugate or oligonucleotide into the cell. More preferably, the ligand binding molecule is a growth factor, an antibody to a growth factor, or an antibody to a cell surface receptor. Alternatively, the ligand binding molecule is an antibody which recognizes a complex of growth factor and receptor.
In the preferred embodiment, the ligand binding molecule is an antibody or antigen binding fragment derived therefrom. Antibody, either polyclonal, monoclonal, bispecific, etc., may be generated by methods well known in the ar The more preferred embodiment antibody is transferrin receptor antibody. The preferred transferrin receptor antibody is described in EPA 226,419, "Anti-human Ovarian Cancer Immunotoxins and Methods of Use Thereof, published June 24, 1987, applicants Bjom, M. J. £i al. and denoted 454A12, therein. (Samples of the hybridomas which produce the monoclonal antibody had been deposited with the Collections of In Vitro International under the accession number IVI 10075. This deposit was made under the Budapest Treaty and will be maintained and made accessible according to the provisions thereof.) The 454A12 binds to transferrin receptors, but does not substantially inhibit binding of transferrin to the transferrin receptor. It is thus different from the transferrin monoclonal antibodies claimed in U.S. Patent No.4,434,156, which inhibit binding of transferrin to the transferrin receptor. Both types of transferrin antibody are suitable ligand binding molecules.
Method for Conjugating the Oligonucleotides and Ligand Binding Molecule
Oligonucleotides can be conjugated to the ligand binding molecule for example, through disulfide, amides, or thioethers bonds, or through peptide linker, or any other type of chemical bond that is sensitive to cleavage in lysosomes by either enzymes or the acidic environment The preferred embodiment conjugate comprises ligand binding molecule and oligonucleotide bound by a disulfide bond. Exemplary of this approach is binding the preferred antibody 454A12 to oligonucleotides by a disulfide bond. Oligodeoxynucleotides with the following sequences were used: CTGGTCTAACCAGAGAGACC (designated BB01); and GCAAGCTTTATTGAGGCTTA (designated BB02). The control has the following sequence: CAGTCAGTCAGTCAGTCAGT (designated BB03). BB01 was complementary to the cap or initiator codon and BB02 was complementary to the poly(A) signal of the HIV genomic RNA. The cap and poly(A) signal lie within the sequence repeated at the ends of the HTV RNA (R region). BB03 is a 20-mer not complementary to the HTV RNA, BB03 has been tested and shown to be inactive. Goodchild, J., supra. All three oligonucleotides did not have a reactive sulfhydryl group. They, therefore, could not form a disulfide conjugate with the transferrin receptor antibodies. Figure 1 presents the sequences of the oligonucleotides. i order to form a conjugate, oligonucleotides with a reactive sulfhydryl group were synthesized. In the preferred embodiment, the oligonucleotides with reactive sulfhydryl groups were designated BB04, BB05, and BB06, each with a sequence corresponding to BB01, BB02, and BB03 respectively. Figure 2 presents the sequences and data on these oligonucleotides. The oligonucleotides had the following generalized structure (the sulfhydryl group was denoted as X in Figure 2):
Figure imgf000012_0001
At the same time, a sulfhydryl group was added to 454A12. The oligonucleotide was covalenύy linked to the 454A12 through a disulfide exchange reaction between the sulfhydryl groups of the two compounds. This reaction is described below. Addition of Sulfhvdrvi Group on the Antibody
The addition of a thiol group or an activated disulfide group to an immunoglobulin is known in relation to the synthesis of immunotoxins. U.S. Patent No. 4,340,535, Jul. 20, 1982, Voisin £laL "Cytotoxic Products Formed by Covalent Bonding of the A Chain of Ricin with an Antibody and the Process for Their Preparation and Use." The procedures disclosed therein regarding addition of the thiol group to the antibody is incorporated hereby. i our preferred example, EUman's reagent was added to a solution of 454A12 antibody in 40 mM phosphate buffer containing 1 mM EDTA (final concentration of 454A 12 was 3.2 mg ml, and that of Ellman's reagent was ImM. Final pH of the mixture was 8). The reaction was allowed to proceed for 30 minute at room temperature. At the end of 30 minutes, the reaction mixture was cooled in an ice bucket to 4βC and a ten fold excess of 2-iminothiolane reagent was added. The reaction mixture was allowed to continue at 4*C overnight. At the end of the reaction, the excess reagents were separated on a 1.5 x 15 cm column of Sephadex G-25 equilibrated with 40 mM sodium phosphate, pH 7.6, containing 0.2 M NaCl and ImM EDTA.
Disulfide Linkage of the Oligonucleotide with the Antibody
The derivatized antibody was then covalently linked, in a disulfide exchange, to the sulfhydryl group on the oligonucleotide. This linkage was achieved by incubating the two components (454A12-IT-TNB at 4 nM and oligonucleotide at 100 nM, final concentration) overnight at 4βC. The sample turned yellow, indicating that the TNB group was being released and the desired product was being formed.
The sample was then passed through a 2.5 x 24 cm column of Sephadex G-25 resin equilibrated with 40 mM sodium phosphate, pH 7.6, containing 0.2 M NaCl. The separation profile of a standard mixture of proteins was compared to 454A12 which elutes at 20.3 minutes. The reaction mixture containing the conjugate 454A12- BB06, was run on GF250 preparation HPLC in PBS, pH 7.6. The peak eluting at 17.7 minutes was shown by SDS-PAGE analysr Ό contain protein with molecular sizes larger than the unconjugated antibody. Reac^on mixtures containing 454A12- BB04 and 454A12-BB05 were also shown by SDS-PAGE analysis to contain protein with molecular sizes larger than the unconjugated antibody. Analysis of the Conjugates for Nucleic Acid Content
To determine the nucleic acid content of the conjugates, their absorbance at 260 and 280 nm were observed. For this purpose, the conjugates, each in 40 mM sodium phosphate, pH 7.6, containing 0.2 M NaCl presterilized by filtration was used. The result was as follows:
Figure imgf000014_0001
Based on the above data, it was calculated that about 4 to 8 oligonucleotides were conjugated to one antibody. It is possible that higher number of oligonucleotides can be conjugated to each antibody. It should be noted that oligonucleotides of different sequences can be conjugated to a single ligand binding molecule. This is especially desirable for treatment of AIDS where different strains of the HIV virus exist in a single patient
Binding Efficiency of the Conjugate to Transferrin Receptors
It is important that conjugation of the oligonucleotide to the ligand binding molecule not destroy the binding properties of the latter. To demonstrate that the conjugation did not destroy the ability of 454A12 to bind to the transferrin receptor on cell surfaces, the oligonucleotide conjugates were tested for the ability to protect cells against the effects of an immunotoxin consisting of 454A12 and recombinant ricin A chain. The result showed that the immunotoxin alone inhibited protein synthesis by 50% at a concentration 0.01 nM. When the same experiment was done in the presence of 30 nM BB04 and BB05 conjugates, 10 fold higher concentrations of immunotoxin were required to reach 50% inhibition (See Figure 4). The results showed that the conjugates compete with the immunotoxin for the transferrin binding sites. Therefore, conjugation of 454A12 to the oligonucleotides did not cause detectable damage to the antibody binding site. The immunotoxin 454A12-rRA was made as described in EP 226,419, published June 24, 1987, to Bjorn, M.J. el al-, entitled "Anti-human Ovarian Cancer Immunotoxins and Methods of Use Thereof. Efficacy of the Conjugates to Inhibit HTV Viral Expression
To test the efficacy of the above described conjugates in inhibiting HTV viral expression, the following procedures/experiments were carried out
1. Isolation and Culture of Peripheral Blood Monocvtes fPBMO and Virus Isolation bv Monocvte Cocultivation
To test the effect of the conjugates it was desirable to have a source of HTV infected monocytes. Monocytes infected with HTV virus were produced in the following manner. Monocytes treated with rCSF-1 and maintained in culture for at least 7 days were used for cocultivation experiments with freshly isolated PBMC from seropositive HTV-infected individuals. The detailed procedures for isolation and culture of peripheral blood monocytes and virus isolation by monocyte cocultivation are described in Gendelman, H.E., s al-, 1988, "Efficient Isolation and Propagation of Human Immunodeficiency Virus on Recombinant Colony-Stimulating Factor 1-Treated Monocytes", J. Exp. Med..1≤7_: 1428- 1441.
Effect of Conjugates on HIV
Reverse transcriptase activity was assayed as an indicator of viral replication. Inhibition of viral replication was reflected in reduced reverse transcriptase activity. Assays of virion-associated reverse transcriptase (RT) activity were performed with [32p] deoxythymidinetriphosphate in a protocol described in detail in Willey, R. L., 1988, J. Virol.. £2: 139-147, "In Vitro Mutagenesis Identifies a Region within the Envelope Gene of the Human Immunodeficiency Virus that is Critical for Lifectivity." The efficacy of the 454A12-oligonucleotides for inhibiting HTV viral functions was determined. (Figures 5 and 6 present the results, respectively). The experiments used uncconjugated oligonucleotides (without sulfhydryl group), mixtures of unconjugated oligonucleotides (without sulfhydryl group) plus 454A12, and conjugates comprising 454A12 and oligonucleotides bound by a disulfide bond. In the mixtures of unconjugated oligonucleotides with antibodies, the oligonucleotides were prevented from conjugating with the antibodies because the oligonucleotides lacked the sulfhydryl group necessary for linkage with the antibodies. In the experiments, each sample was introduced at the same time the monocytes were infected with the HTV virus, and every three days thereafter along with a fresh change of media. The monocytes were infected with HIV at 100 viral infective units (1 unit being the amount which results in 50% cell infection after 1 month in culture). The reverse transcriptase levels (in count per minute per 0.01 ml) in the culture fluid were measured after twelve days of cocultivation. In the first experiment, the following samples were used:
Sample Material
1 oligonucleotide without sulfhydryl group, BB01 2 oligonucleotide without sulfhydryl group, BB02
3 oligonucleotide without sulfhydryl group, BB03 (Control)
4 mixtures of unconjugated BB01 and antibody 454A12
5 mixtures of unconjugated BB02 and antibody 454A12
6 mixtures of unconjugated BB03 and antibody 454A12 7 conjugate comprising BB04 and antibody 454A12
8 conjugate comprising BB05 and antibody 454A12
9 conjugate comprising BB06 and antibody 454A12
10 buffer (as used in samples 1 to 9) Medium culture infected with HIV Background culture alone, without HTV, oligonucleotide nor antibody
Samples 1 to 6 contained 50 μg ml of oligonucleotides at IX concentration. (Based on a reading of 1.6 at OD260 ; a reading of 32 at OD260 being indicative of 1 mg/ml of oligonucleotide.) Samples 7 to 9 contained 19 μg ml of oligonucleotide at IX concentration (based on a reading of 0.6 at OD 60). As indicated in Figure 5, 1/100, 1/1000, and 1/10,000 concentrations of the samples were used, respectively.
The results showed that the unconjugated oligonucleotide BB01 of Sample 1 had some inhibitory activity, but the oligonucleotide-antibody conjugates of Samples 7 and 8 clearly inhibited the production of reverse transcriptase.
The second experiment followed the same protocol as the first and tested some of the samples at 1/10,000 concentration. The results of the second experiment indicated the oligonucleotide-antibody conjugate (Sample 7) was more effective in inhibiting viral expression than its counterpart, the unconjugated oligonucleotide (Sample 1). Further, the oligonucleotide-antibody conjugate (Sample 8) was more effective at inhibiting viral expression than the unconjugated oligonucleotide mixed with free antibody (Sample 5). This result showed that the increase in inhibition of viral expression was due to conjugation of the oligonucleotide with the antibody. The control, non-complementaiy oligonucleotide mixed with free antibody (Sample 6), showed a higher reading of reverse transcriptase than the conjugated non-control oligonucleotide antibody conjugates (Samples 7 & 8) (except for days 5, where the reading for Samples 7 and 6 were the same). These experiments establish that oligonucleotide antibody conjugates can be used to suppress HTV expression. Alternative Conjugation Method
Alternatively, the oligonucleotide can be conjugated to the antibody using heterobifunctional crosslinkers. The preferred crosslinkers are maleimide active esters, and encompass a family of crosslinkers that produce a thioether bond linking antibody and oligonucleotide consisting of an activated carboxylate, a spacer molecule that contains ether groups, and a maleimido group to which a thiol on the oligonucleotide can bind. The linker will have a preferred length of up to about 34 angstroms; however, longer linkers are intended to come within the scope of the invention. These linkers, referenced to as malsac HNSA glut are described in U.S. patent application, Serial No. 217,938, filed July 12, 1988, to L. Houston, ej al-, entitled "Thioether
Linked Immunotoxin Conjugates". The procedure is described herein. Using malsac HNSA glut, the conjugation consists of reacting antibody having a free amino group with a maleimide-active ester crosslinker in a suitably buffered solution. Next, the derivatized antibody is separated from the crosslinker. The isolated derivatized antibody can then be reacted with the oligonucleotide having a sulfhydryl group.
In more detail, the thioether bond that links the antibody and the oligonucleotide described herein result from heterobifunctional crosslinkers having two reactive groups, an active ester designed to react primarily with amino groups, preferably on the antibody molecule; and a maleimido group that reacts with sulfhydryl groups, preferably present on the oligonucleotide. It is important to note, however, that by suitable chemical modification of antibody or oligonucleotide that reaction of antibody can be made to occur with the maleimido group, and reaction of oligonucleotide with the active ester. For example, antibody or antibody fragments can be prepared having free sulfhydryl groups by techniques well known in the art Particularly useful is the procedure shown in Urnovitz, U.S. Patent 4,698,420, which is hereby incorporated by reference. Certain classes of antibody, specifically IgM and IgA, exist as aggregates such that antibody molecules are joined together by disulfide bonds. Reduction of the aggregates causes the formation of individual antibody molecules having free sulfhydiyl groups which can be reacted with the maleimido group of the instant heterobifunctional crosslinkers. Similarly, antibody fragments can be produced using suitab? •* enzymes, and reduced thereby rendering sulfhydryl groups available for reaction. Alternatively, in lieu of reducing antibody or antibody fragments to obtain a reactive sulfhydryl group, sulfhydryl group(s) can be introduced into these molecules by reactions described in U.S. Patent Nos. 4,350,626, 4,450,154, and 4,340,535, which are hereby incorporated by reference. Regardless of how the sulfhydryl group is realized, antibody, or antibody fragment, is reacted with the heterobifunctional crosslinker at pH's which favor sulfhydryl maleimide reaction, preferably about pH 6. Synthesis of Heterobifunctional Crosslinkers
The heterobifunctional crosslinkers of the present invention consist of an activated carboxylate, a spacer containing ether groups, and a maleimido group. The initial step in the synthesis of this type of crosslinker consists of employing an ether containing spacer group, preferably an ether diamine, having amino reactive groups on both ends of the spacer, with a reversible amino protective reactive group to block one of the amino groups. Next, the remaining amino group is reacted with a dicarboxylic anhydride; glutaric anhydride and succinic anhydride can be employed, among others. The protecting group is then removed, preferably by exposure to acid, and the deprotected amino group reacted with an active ester of maleimido to introduce a maleimide functionality at this region of the spacer. At this point in the synthesis the spacer contains a maleimido group at one end, and a group capable of forming an active ester, that is to say, a carboxylic acid, at the other. This molecule is then reacted with 1- hydroxy-2-nitrobenzene-4-sulfonic acid in the presence of a suitable condensing agent to yield the maleimide active ester. It will, of course, be understood by those skilled in the art that each of the reactions described above is followed by suitable purification procedures.
It is important to note that spacers of various length can be employed to produce the instant crosslinkers. The preferred spacer has a length of about 34A; however, additional spacers considerably shorter or longer in length can be used and are available from Texaco Chemical Company under the trade name Jeffamine.
The synthesis of the heterobifunctional crosslinkers involves initially reacting the diamino containing spacer with the protecting group, 2-tert- butoxycarbonyloxyimino-2-phenyl-acetonitrile, (BOC). Suitable chromatographic techniques permit the isolation of the mono-BOC-spacer-NH2 molecule. The preferred dicarboxylic anhydride, glutaric anhydride, is reacted with the mono-BOC-spacer. Suitable chromatographic isolation of the reactants yields BOC-spacer-glutarate. The BOC group is removed, generally using trifluoroacetic acid, the acid removed and the product reacted with a suitable active maleimido ester, preferably maleimido-6- aminocaproyl-ester of l-hydroxy-2-nitrobenzene sulfonic acid, to yield maleimido-6- aminocaproyl-spacer-glutarate, that hereafter is abbreviated mal-sac-spacer-glutarate. Finally, the heterobifunctional crosslinker is produced by reacting l-hydroxyl-2- nitrobenzene-4-sulfonic acid with mal-sac-spacer-glut in the presence of a suitable condensing agent such as dicyclohexylcarbodϋmide. Thus, the preferred heterobifunctional maleimide-active ester crosslinker is maleimido-6-aminocaproyl- spacer-glutarate ester of l-hydroxyl-2-nitrobenzene sulfonic acid, abbreviated as mal- sac-spacer-glut-HNSA.
Figure imgf000019_0001
Glutaryl Ester of l-Hvdroxyl-2-Nitrobenzene Sulfonic Acid
In more detail, the synthesis of the preferred embodiment heterobifunctional crosslinker was conducted as follows. A maleimido active ester crosslinker about 34 A in length, as measured from the two reactive functional groups of the spacer, was synthesized as follows. Approximately 61.4 grams of the ether diamine, 4,9-dioxa-l,12-dodecanediamine, was dissolved in 600 ml of anhydrous methanol. To this solution was added a slurry containing 81.2 grams of 2-(tert-butoxycarbonyloxyimino)-2-phenylacetonitrile (BOC- ON) in 150 ml methanol. The latter is an amino group protective agent The mixture was allowed to react overnight, and then concentrated by rotary evaporation, followed by purification on a silica gel column. The mixture was added to the column, and the column first exposed to chloroform : methanol : acetic acid, 80 : 20 : 10. This solvent removed the bis-BOC, or, 4,9-dioxa-l,12-dodecanediamine derivative, and the mono- BOC dodecanediamine derivative was eluted with chloroform : methanol : acetic acid, 70 : 30 : 5. Approximately 53.1 grams of a thick oil was produced, and thin layer chromatography using chloroform : acetic acid, 90 : 10 revealed the starting material, 4,9-dioxa-l,12-dodecanediamine to have a Rf value of about 0.08, which was visualized with iodine vapor or ninhydrin. The mono-BOC protected 4,9-dioxa-l,12 dodecanediamine had a Rf of about 0.72 and also was reactive with iodine vapor or ninhydrin. High voltage paper electrophoresis having a pH 1.85, and run at 500 volts for 20 minutes revealed that the diamine starting material had a migration distance of 8.8 centimeters and the mono-BOC derivative had a migration distance of about 4.7 centimeters. At a pH 3.5, the diamine starting material migrated 14.4 centimeters and the mono-BOC protected diamine had a migration distance of about 6.1 centimeter. The mono protected spacer (BOC-spacer-NH2) was derivatized to contain an acid reactive group by adding 4.1 grams of BOC-spacer-NH2 in 40 ml of pyridine, followed by the addition of a two fold molar excess, or 3.08 grams of glutaric anhydride. The reaction was allowed to proceed overnight, followed by removal of the pyridine in vacuo. The residue was taken up in chloroform and extracted three times with 0.5 M aqueous citric acid, followed by three further extractions with saturated, aqueous sodium chloride. The chloroform phase was dried over anhydrous magnesium sulfate and concentrated to a thick oil by rotary evaporation. This resulted in crude BOC-spacer-glutarate (BOC-spacer-glut), which was purified on a silicate gel column in a solvent system comprising chloroform: acetic acid, 90 : 10. About 1.48 grams of a thick oil was recovered, and thin layer chromatography using a developing solvent of methyl-t-butyl ether: chloroform: acetic acid, 6 : 3 : 1, revealed an iodine and ninhydrin positive species with an Rf of about 0.14, and a second species with an Rf of about 0.49, which also reacted with iodine, but did not react with ninhydrin. The iodine/ninhydrin reactivity profile indicated that the species with the Rf value of 0.14 is BOC-spacer-NH2, which would be expected to react with both reagents. Ninhydrin reacts with the free amino group. In contrast the absence of ninhydrin staining with the species having the Rf value of 0.49 is consistent with the formation of BOC-spacer- glut This was supported by the observation that when the protecting group, BOC, was removed with 6 NHC1, the resulting deprotected molecule was ninhydrin positive. Further characterization of the reaction protect revealed that in n-butanol:acetic acid:water, 120 : 30 : 50, BOC-spacer-NH2 had an Rf of about 0.73 and the BOC- spacer-glut an Rf of about 0,83.
BOC-spacer-glut was treated with trifluoroacetic acid to remove the BOC group. This was carried out by dissolving 1.6 grams of BOC-spacer-glut-OH in 20 ml of 95% trifluoroacetic acid followed by stirring for 30 minutes at room temperature. Trifluoroacetic acid was removed by rotary evaporation, and the residual oil dried overnight in vacuo. The resulting deprotected, NH2-spacer-glut was dissolved in 2.0 ml of dimethylformamide. This solution was neutralized with disopropylethylamine, followed by adding 2.68 grams of maleimido-6-aminocaproyl ester of l-hydroxy-2- nitrobenzene-4-sulfonic acid (sodium salt). The reaction was effected at room temperature with continuous stirring. The progress of the reaction was monitored by measuring the formation of the amount of l-hydroxy-2-nitrobenzene sulfonic acid dianion that results from the aminolysis of the active ester. This is readily achieved by diluting 1 microliter aliquots of the reaction mixture into 5 ml of 0,01 M phosphate buffer, pH 7.0 and reading the absorption of the solution at 406 nm in a spectrophotometer. A method for performing this procedure is described in Aldwin & Nitecki Analytical Biochemistry. 164:494 (1987).
After the reaction had gone to completion, generally within about thirty minutes, the mixture was chromatographically purified on a LH-20 Sephadex column (4.5 cm x 40 cm pre-equilibrated in dimethylformamide). Maleiaddo-6-aminocaproyl-spacer- glutarate (mal-sac-spacer-glut) eluted first from the column. Fractions containing this derivative were pooled, concentrated n vacuo and purified using preparative thin layer Chromatotron chromatography. Four mm thick silicate gel plates were employed with the solvent chloroform : methanol : acetic acid, 90 : 10 : 10. A further purification was achieved using high pressure liquid chromatography with a Waters DeltaPrep 3000
HPLC on a microBondapak C18 column and a gradient of acetonitrile in 0.1% aqueous trifluoroacetic acid. About 0.3 grams of product was obtained. Thin layer chromatography using chloroform, acetic acid, methanol, 90 : 10 : 10 revealed that mal- sac-spacer-glut had an Rf of about 0.66, whereas in the solvent system chloroform : methanol : acetic acid, 70 : 3 : 5 an Rf of about 0.92 was observed. Consistent with the formation of mal-sac-spacer-glut was the reaction of the product with iodine vapor, chlorox spray, which is indicative of amide bonds, and a reagent reactive with maleimides, Keller, O. and Rudinger, J., Helv. Chi . Acta. ≤£:531 (1975).
Lastiy, maleimido-6-aminocaproyl-spacer-glutaryl ester of l-hydroxy-2- nitrobenzene sulfonic acid was formed by dissolving 0.2 grams of mal-sac-spacer-glut- OH in 4.0 ml of dimethylformamide, followed by adding 0.534 grams of l-hydroxy-2- nitrobenzene sulfonic acid and 0.305 grams of dicyclohexylcarbodiimide. The mixture was allowed to react overnight at room temperature, and the active ester product chromatographed over a LH-20 Sephadex column as described above. The identification of fractions containing mal-sac-spacer-glut-HNSA was achieved by spotting a drop of a fraction on to a porcelain plate, followed by the addition of a drop of 5 N NaOH. The latter causes the hydrolysis of the ester, thereby producing a bright yellow color indicative of the HNSA anion. Fractions so identified as to contain mal- sac-spacer-glut-HNSA had the dimethylformamide removed jn vacuo. and purified on a silica gel Chromatotron 2 mm thick thin-layer-chromatographic plate, using a solvent system consisting of chloroform : methanol : acetic acid, 70 : 30 : 5. The ester containing fractions identified as described previously were pooled and concentrated by rotary evaporation. About 0.113 grams of a pale yellow solid product was obtained which contained 94.1% ester. The product was shown to have a Rf of about 0.25 in chloroform : acetic acid : methanol, 90 : 10 : 10, and an Rf value of about 0.75 in chloroform : methanol : acetic acid, 70 : 30 : 5. Spectral analysis revealed strong absorbance in the UV. Moreover, the product reacted positively with iodine, chlorox spray, and the maleimide reactive reagent These results indicate that the product is the desired heterobifunctional maleimide active ester crosslinker, maleimido-6- aminocaproyl-spacer-glutaryl ester of l-hydroxy-2-nitrobenzene sulfonic acid, which has the structure:
Figure imgf000021_0001
-<X>-σ -SO3 Na NO2 Synthesis of Oligonucleotide Antibody Conjugates Through Thioether Bonding
Li general, the procedure for forming the oligonucleotide antibody conjugate consists of reacting antibody, either polyclonal or monoclonal, having a free amino group with a maleimide-active ester, produced as described above, in a suitably buffered solution. Preferably, the maleimide-active ester is present in about a two-fold molar excess over antibody, and the pH of the solution is slightly alkaline to maintain the antibody's amino group in an unprotonated state. The reaction of antibody with the thioether crosslinker can be followed by monitoring the absorbance of the solution at a wavelength of about 406 nm. Aldwin & Nitecki, supra. An increase in absorbance at this wavelength is the result of the dianion leaving group, HNSA, and the reaction of antibody amines to form stable amide bonds. Because hydrolysis of the crosslinker's active ester is slow relative to aminolysis, most of the leaving groups absorbance is due to amide bond formation. The reaction of antibody with the crosslinker is for a time sufficient to introduce about 0.5-3 crosslinker molecules per antibody molecule. Next the derivatized antibody is separated from the crosslinker, using any number of standard biochemical separation techniques. Preferably the separation procedure will be accomplished using a gel filtration column, and more preferably Sephadex G-25 (Pharmacia Corp.) will be employed. The column is pre-equilibrated with a chromatographically compatible aqueous buffered solution. The isolated derivatized antibody can then be reacted with the oligonucleotide having a sulfhydryl group as described below.
Oligonucleotide having a free sulfhydryl group can be directly reacted with the derivatized antibody in an aqueous buffered solution compatible with the reaction. The oligonucleotide and antibody concentrations, and the duration of the reaction may vary depending on the number of oligonucleotide molecules sought to be bound to antibody. The reaction is preferably run at 4°C overnight
Synthesis of the Preferred Oligonucleotide-Antibodv Conjugates
More specifically, the synthesis of the more preferred oligonucleotide-antibody conjugate was carried out as follows. The monoclonal antibody 454A12 was reacted with the heterobifunctional crosslinker, mal-sac-spacer-glut-HNSA as follows. 10 mg ml of 454A12 was reacted with a two-fold molar excess of the thioether crosslinker in 0.1 M sodium phosphate, pH 8, for about 25 minutes at room temperature. The progress of the reaction was followed by measuring the absorbance as described in Example I at 406 nm. At the end of 25 minutes the absorbance had increased to 0.57, and the derivatized antibody was separated from the reaction mixture by gel filtration using a Sephadex G-25 column (2.5 x 17 cm) in 40 mM sodium phosphate buffer, pH 6, containing 200 mM NaCl. This material was reacted, as described below, with the oligonucleotide having a reactive sulfhydryl group.
The oligonucleotide with reactive sulfhydryl group was combined with derivatized antibody in a 1 : 2 molar ratio ( antibody : oligonucleotide with sulfhydryl group). The solution was concentrated using an Amicon stirred ultra-filtration device. The buffer employed was 40 mM sodium phosphate, pH 7.6, containing 200 mM NaCl. The reaction was allowed to proceed overnight at 4°C, and the sample was then chromatographed over GF 250 gel filtration column (PBS pH 7.6). The fractions collected were run on 6.5% SDS-PAGE and conjugates were observed having molecular weight greater than the unconjugated antibody, 150,000 kD, but less than 210,000 kD.
Alternatively, to maximize the conjugation, the oligonucleotide with reactive sulfydryl group is combined with derivatized antibody in a 1:25 molar ratio (antibody: oligonucleotides with sulfhydryl group). The oligonucleotide and antibody concentrations may vary depending on the number of oligonucleotides bound to the antibody. Additionally, after the reaction has proceeded overnight at 4*C, the sample can be chromatographed over a Sepharose S-300 column (2.2 x 80 cm) in 40 mM sodium phosphate, pH 6.5, containing 200 mM NaCl. This step removed any unreacted oligonucleotides with the sulfhydryl group.
Fractions containing either free antibody, if any, or oligonucleotide antibody conjugate can be identified using a suitable analytical technique, such as sodium dodecyl sulfate polyacrylamide gel electrophoresis. The oligonucleotide antibody conjugates so isolated can, if desired, be concentrated by any suitable technique known in the art followed by sterilization. The latter is readily achieved by passing the oligonucleotide antibody conjugate through an 0.2 micron filter.
The above conjugates would be as efficacious as conjugates formed by disulfide linkages, and the methods of use of both types of conjugates would be similar.
Alternative Conjugates The above specific description of an exemplary conjugate and testing against
HTV was presented to illustrate the invention. It should not be construed as limiting the invention. For example, it will be apparent to those skilled in the art that any antisense oligonucleotide that is complementary to the RNA of the retrovirus genomic HIV may be used in the conjugation described above. It has been demonstrated that oligodeoxynucleotides complementary to certain highly conserved regions of the HIV genome inhibit virus replication or gene expression in cultured HTV-transformed human lymphocytes. U. S. Patent No. 4,806,463, Goodchild sl al-, February 21, 1989, "Inhibition of HTLV-III by Exogenous Oligonucleotides." That is, oligodeoxynucleotides complementary to (1) sequences 5' to the primary tRNAlys binding site; (2) the primer binding site; (3) sequences of a mRNA donor splice site; or (4) sequences of a mRNA acceptor splice site have been shown to cause inhibition. Id. Examples of the locations on the HIV genome which can serve as the templates for the antisense oligonucleotides are: the tRNAlys primer binding site; regions of the HTV genome vicinal in the 5' direction to the tRNAlys primer binding site; the tRNAlys primer binding site and regions of the HIV genome vicinal in the 5' direction to the t NAlys primer binding site; the mRNA donor splice sites; the mRNA acceptor splice sites; the initiator codon for the gag gene; the initiator codon for the env gene; the initiator codon for the tat gene; the initiator codon for the sor gene; the initiator codon for the 3' orf gene; the cap nucleotide of the HTV genome; the art gene or portions thereof; the region of the HTV genome encoding a frameshift; the poly (A) addition site; and equivalents thereof. The specific antisense oligonucleotide sequences which can be used are: CTGCTAGAGATddT; TGCTAGAGATTTTCCACAC; TTCAAGTCCCTGTTCGGGCGCCAAA; GCGTACTCACCAGTCGCCGC; CTGCTAGAGATTAA; ACACCCAATTCTGAAAATGG; CTGGTCTAACCAGAGAGACC; GCAAGCTTTATTGAGGCTTA; and equivalents thereof. Alternatively, the oligonucleotide can target HIV nucleotide sequences which code for protease necessary for proper viral assembly. Oligodeoxynucleotides blocked at the 3' end by ddT, the isourea group, or other chain terminators may prove to be more effective inhibitors. In general, any highly conserved region of the HTV genome which encodes information necessary for viral replication or gene expression (e.g., protein synthesis) is a potential target for complementary oligodeoxynucleotides. Id. Further, the oligonucleotide can be complementary to the viral mRNA, one strand of an integrated or unintegrated proviral DNA, a DNA-RNA, or RNA-RNA duplexes.
Similarly, the antisense oligonucleotide conjugate can be used to inhibit replication or expression of other viruses, for example, herpes viruses in the treatment of herpes. Additonally, in the case of DNA viruses, the oligonucleotides can be complementary to the genomic DNA,
The foregoing general approach of forming conjugates consisting of ligand binding molecule and oligonucleotides may be used to treat diseases other than viral infections, and preferably is applied to the treatment of sepsis, as described below. TNF Induce . Diseases/Svmptoms
Examples of antisense oligonucleotides that can be used for preventing or suppressing TNF induced diseases, for example sepsis, are those complementary to TNF DNA or TNF RNA. For example, oligonucleotides complementary to the following can be used: sequences around the 5' end of the TNF messenger RNA; sequences at the beginning of and within the mRNA region coding for the transmembrane domain of the TNF protein; sequence within the coding region of the 17kD molecule. Examples of the specific oligonucleotide sequences complementary to the above mRNA regions are: 5TCTCCCTCTTAGCTGGTCCTCTGC3';
5'CATGCTTTCAGTGCTCATGGTGTCCTTTC3*; 5'GATCAGGAAGGAGAAGAGGCTGAGGAACAA3'; 5'CTCAGCTTGAGGGTTTGC3'; and 5"_rTCGTCCTCCTCACAGGGC3'.
Cancer A third embodiment of the invention is to apply ligand binding molecule- oligonucleotide conjugates to the treatment of cancer, preferable for the treatment of leukemia.
In the treatment of chronic myeloid leukemia (CML), oligodeoxynucleotide that can be used are complementary to the unique fusion sequence of BCR-ABL mRNAs. For example, GCTGAAGGGCTTΛTTGAACTCTGCTTA, complementary to the BCR exon 3/ABL exon π junction sequence; and
GCTGAAGGGCTTΛCTTCCTTATTGATG complementary to BCR exon 2- ABL exon II fusion sequence. As for the treatment of acute lymphocytic leukemia (ALL), the oligodeoxynucleotide that can be used is GCTGAAGGGCTTΛCTGCGTCTCCAT, which is complementary to the BCR/ABL junction of the BCR-ABL mRNA.
As applied to the treatment of CML or ALL, the ligand binding molecules can be monoclonal antibodies against leukemia-associated antigens. Examples of these are: anti-CALLA (common acute lymphoblastic leukemia-associated antigen), J5, BA-3, RFB-1, BA-2, SJ-9A4 Du-ALL-1, anti-3-3, anti-3-40, SN1 and CALL2, described in Foon, K.A., £l al-, 1986, Blood. β£(l):l-31, "Review: Immunologic Classification of Leukemia and Lymphoma". The ligand binding molecules can also be antibodies that identify myeloid cell surface antigens, or antibodies that are reactive with B or T lymphocytes, respectively. Examples of such antibodies are those which identify human myeloid cell surface antigens or those which are reactive with human B or T lymphocytes as described in Foon, K.A., I& Additional examples are antibodies B43, CD22 and CD 19 which are reactive with B lymphocytes can also be used. Miscellaneous
It will be apparent to those skilled in the art that the oligonucleotide used in the conjugate for the treatment of the above diseases, and other applications, can be either oligodeoxynucleotide or oligoribonucleotide. Among other factors, the choice will be dependent on the ease of synthesis, the efficacy, and the relative stability and special advantages of the oligonucleotides in a particular system. Further, the oligonucleotides can be complementary to either DNA or RNA. It can also bind to either or both single stranded or double stranded nucleic acid. The DNA or RNA can be indigenous (cellular) to the cell in question or they can be foreign nucleic acids found in the host cells. The DNA can be cellular or foreign infectious DNA, e.g., those of virus, bacteria, yeast fungi and other parasites. The RNA can be genomic RNA or messenger RNA, for example, retroviral genomic RNA, foreign or cellular mRNA. Where the oligonucleotide is complementary to and bound to the genomic DNA or RNA, it inhibits or prevents the nucleic acid from being replicated. By interfering with or inhibiting the replication of the nucleic acid, the oligonucleotide interferes with or inhibits downstream expression of the DNA or RNA in protein synthesis. Where the oligonucleotide is complementary to the messenger RNA it interferes with or inhibits the mRNA from being expressed in protein synthesis.
Further, the ligand binding molecule in the conjugate can be varied. Any ligand binding molecule which facilitates contact of the oligonucleotide with the target cell, or entry of the oligonucleotide into the cells that can be conjugated to the oligonucleotide may be used. Examples of the ligand binding molecule are antibody or growth factor, preferably, interleukin, interleukin antibody and any cell surface recognizing ligand binding molecule and fragments thereof which retain the ability to recognize cell surface molecule. Li the treatment of AIDS, the ligand binding molecule can be an antibody against a HTV antigen. In the case of interleukin, the conjugation procedure is essentially the same as that for the conjugation of the oligonucleotide with transferrin receptor antibody.
The conjugates can be used in treating a variety of diseases. Preferably, the conjugates are used in the treatment of AIDS, prevention and treatment of sepsis, and treatment and suppression of tumors, as described in detail below.
Methods for Using the Conjugates in Treatment of Human Viral Infections
As another feature of this invention, there is also disclosed a method of administering the conjugates to a human to treat AIDS, to inhibit the replication of the AIDS virus in infected human cells and/or to prevent AIDS from developing in humans infected with the AIDS virus. The strategy used in treating a particular individual depends on the status of the individual and the objective of the treatment For example, an individual who has been found to be carrying the HTV virus but shows no symptoms of AIDS might be treated differently, in terms of both the type of conjugates administered and the dose given, than an individual who has ADDS. In addition, treatment might well differ if its objective is to protect uninfected cells or to have an effect on cells which are already infected.
For example, an individual known to be harboring the virus but yet manifesting no sign of AIDS could be given a long-term or lifetime maintenance dose of the conjugates whose inhibitory effects stop reverse transcription, e.g., by using conjugates with oligonucleotides complementary to the primer binding site and/or sequences close to the primer binding site in the 5' direction. In this instance, to avoid immunologic rejection the ligand binding molecule is preferably human transferrin receptor antibody. In this way, the first step in viral life or replication is inhibited because viral DNA cannot be made and the virus is unable to proliferate. However, in an AIDS patient, cells are already infected and treatment must inhibit expression of viral genes already present in the infected cells. In this case, conjugates comprising oligonucleotides complementary to, for example, initiator codons for genes encoding viral proteins, are required to prevent viral construction. In an AIDS patient, uninfected cells can also be protected by administration of conjugates comprising oligonucleotides capable of blocking reverse transcription. Further, at the early stage of HIV infection, the patient can be administered with conjugates comprising oligonucleotide complementary to the HTV nucleotide sequence which encodes the protease necessary for the viral assembly. By inhibiting the production of protease, the unassembled viral particles will still cause antigenic marker to be expressed on the host cell, but will not be infections to other cells. Cells expressing such viral antigens then can be immunologically eliminated, either through the patient's own immune response or with other medical treatments. Clearly, such a treatment is viable only where the infected cells are relatively few, such that elimination of these cells will not adversely affect the patients.
Conjugates whose presence in cells can stop reverse transcription and conjugates whose presence in cells can inhibit protein synthesis .an be administered by a number of routes, however, intravenous injection is preferred whereby the desirable blood level may be maintained by a continuous infusion or intermittent infusions. The dosage varies with such factors as the size and age of the patient, stage of the disease, the concurrent treatments being given and the type of conjugates used, etc. For example, the desired dose may be presented as two, three, four or more subdoses administered as infusions at appropriate intervals throughout the day. Administration is by any suitable route including oral, rectal, nasal, topical (including buccal and sublingual), vaginal andparenteral (including subcutaneous, intramuscular, intravenous and intradermal). It will be appreciated that the preferred route may vary based on the factors discussed in the previous paragraph.
The administered ingredients may be used in therapy in conjunction with other medicaments such as suramin, ribavirin, antimoniotungstate (HPA-23), interferon, e.g., alpha-interferon, interleukin π, AZT, CD4, DDC (dideoxycytidine), DDA (dideoxyadenosine), DDI (dideoxyinosine), lymphokines, casteniosperamine, met- enkephalin, peptide T, dextran sulfate, Lnreg-l and Ampligen, and phosphonoformate (Foscamet). Further, the conjugates described herein may be used in combination with bone marrow or lymphocyte transplants or other medications such as levamisol or thymosin which would increase lymphocyte numbers and/or function as is appropriate. Where one of the ingredients has side effects, it is given to patients on alternate weeks. For example, AZT causes toxic side effects, such as myelosuppression and severe anemia. DDC is also toxic since it causes serious peripheral neuropathy. Since AZT and DDC exhibit different toxicities, they are given to patients on alternate weeks. While the administered ingredients may be administered alone, they may be presented as part of a pharmaceutical formulation. The formulations of the present invention comprise at least one conjugate, together with one or more acceptable carriers thereof and optionally other therapeutic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient. The following is an example of the procedure: the patient is administered intravenous infusion of the above conjugate in a physiologically acceptable carrier at a starting dose of 2.0-20 mg m2 daily for five days. By inhibiting viral expression, host cell decimation by the virus is decreased. The cells, still containing the virus, are treated with chemotherapy administered in conjunction with the conjugate treatment At the end of the five-day period, the patient is evaluated. The evaluation includes physical examination and extensive laboratory testing. The tests include evaluation for toxicity and specific tests directed to the determination of the T-cell counts. Subjective improvements of the patient are also monitored, e.g., improvement in appetite or strength. If the patient's condition is stable, he is re-treated at the same dosage daily and evaluated weekly. Provided the patient's condition is stable, the treatment may be continued. To avoid an unwanted immune response to the antibody part of the conjugation for long treatment periods, the preferred conjugate consist of human or humanized antibody coupled to the appropriate oligonucleotide(s). At the end of each period, the patient is again evaluated. Comparison of the pre-treatment and post- treatment T-cell counts indicates the efficacy of the combined treatments by showing whether the viral expression has been inhibited and whether the viral population has decreased. According to the efficacy of the combined treatments, and the patient's condition, the peptide or peptide-ligand binding molecule dosage, the chemotherapy may be increased or maintained constant for the duration of treatment. The patient's condition and the status of the viral expression is monitored periodically through physical exam, and laboratory tests. The starting dose of conjugate and chemotherapy is reduced for a patient who exhibits adverse reaction.
The formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question.
The above is by way of example, and does not preclude methods of treatment that are known by those skilled in the art. It also does not preclude use of the conjugates of treatment of other viral infection, with proper modification according to the specific virus involved.
Methods of Using the Conjugates in Treatment of TNF Induced Diseases/Svmptoms
As another feature of this invention, there is also disclosed a method of administering the conjugate to a human to inhibit TNF induced diseases/symptoms, for example, to prevent sepsis, or to inhibit and reduce sepsis after its onset
Again, the strategy used in treating a particular individual depends on the status of the sepsis and the objective of the treatment For example, treatments for prevention of sepsis differs from that of containment or reduction af er its onset
For example, an individual without sepsis could be given a maintenance dose of the conjugates to inhibit/stop transcription of the TNF genes. Conjugates comprising oligonucleotides complementary to, for example, initiator codons for the gene encoding TNF can prevent TNF production. Where there is already an onset of sepsis, the conjugates may comprise oligonucleotides complementary to the mRNA coding for TNF. By binding to the mRNA, the conjugates prevent translation of mRNA, therefore, production of TNF is inhibited or stopped. The oligonucleotides that can be utilized in the conjugate are sequences complementary to the 5' end of the TNF messenger RNA; sequences at the beginning of and within the mRNA region coding for transmembrane domain of the TNF protein; and sequences within the coding region of the 17 kD molecule. (Figure 10 shows the locations of these sequences on the HuTNF cDNA.) The above conjugates can be administered by any number of routes, but preferably by intravenous injection whereby the desirable blood level may be maintained by a continuous infusion or intermittent infusion. The dosage varies with such factors as the size and age of the patient, stage of the disease, the concurrent treatments being given, and the type of conjugates used, etc.
For example, the desired dose may be presented as two, three, four or more subdoses may be infused at appropriate intervals throughout the day. Administration is by any suitable route including oral, rectal, nasal, topical (including buccal sublingual), vaginal andparenteral (including subcutaneous, intramuscular, intravenous and intradermal). It will be appreciated that the preferred route may vary based on the factors discussed in the previous paragraph.
An example of prophylactic use of the conjugate is as follows: 3-5 hours before surgery the patient is administered intravenous infusion of the conjugates in a physiologically acceptable media at a starting dose of 2.0-20 mg/m2. The intravenous infusion continues throughout the surgery and 1-10 days post surgery. During this period, the patient's reaction to the conjugate is monitored by means of physical examination, extensive laboratory testing and observation of the patient's subjective reactions. The tests include evaluation for the toxicity, and tests for the level of TNF produced by the patient According to the efficacy of the treatment and the patient's condition, the conjugate dosage may be increased, or maintained constant, or decreased for the duration of the treatment
While the administered ingredients may be administered alone, they may be presented as part of a pharmaceutical formulation. The formulations of the present invention comprise at least one administered conjugate together with one or more acceptable carriers thereof and optionally other therapeutic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient
Method of Using the Conjugates of Treatment of Human Leukemia
The conjugates can be used for inhibition or suppression of other endogenous gene expression or protein synthesis. For example, the conjugates may be used to suppress expression of oncogenes.
As another feature of this invention, here is also disclosed a method of administering the conjugate to a human to suppress leukemia cause by mutations in the Ph' chromosome. The method is similar to those described in Examples I and II. The modifications being clinical tests for improvement include white blood cells counts. All the above is by way of example, and does not preclude other conjugates, methods of making the conjugates and methods of treatment using the conjugates that are known by those skilled in the art, or that could be arrived at by those skilled in the art using the guidelines set forth in this specification.

Claims

WE CLAIM:
1. A conjugate for treating or preventing disease comprising a cell surface ligand binding molecule conjugated to at least one antisense oligonucleotide, said antisense oligonucleotide being complementary to and capable of hybridizing with a segment of a nucleic acid, said hybridization interfering with or inhibiting the expression or replication of said nucleic acid.
2. A conjugate according to claim 1 , wherein the segment of the nucleic acid which is capable of hybridizing to said oligonucleotide is selected from the group consisting of a single stranded DNA, RNA, or a strand belonging to a duplex of DNA- DNA, RNA-RNA, orDNA-RNA.
3. A conjugate according to claim 2, wherein the antisense oligonucleotide(s) comprise oligodeoxynucleotides or oligoribonucleotides.
4. A conjugate according to claim 2, wherein the antisense oligonucleotide(s) further comprise modified oligodeoxynucleotides or oligoribonucleotides.
5. A conjugate according to claim 4, wherein said modified oligonucleotide(s) are selected from the group consisting of: methylphosphonate oligodeoxynucleotide, phosphorothioate oligodeoxynucleotide, 2'-OMe RNA oligonucleotide, α-ohgodeoxynucleotide, α-oligodeoxynucleotide covalently linked to intercalating agent(s), oligodeoxynucleotide covalently linked to intercalating agent(s), oligoribonucleotide modified with carbamate, or oligodeoxynucleotide modified with polylysine or iron EDTA or its analogues.
6. A conjugate according to claim 2, wherein the nucleic acid is selected from the group consisting of HTV viral genomic RNA, unintegrated and integrated proviral DNA, viral mRNA, and viral RNA-DNA duplex.
7. A conjugate according to claim 6, wherein said cell surface ligand binding molecule is selected from the group consisting of: growth factors, antibody to growth factors, antibody to growth factor cell surface receptors, and antibody to a complex comprising growth factor and growth factor receptor.
8. A conjugate according to claim 7, wherein said ligand binding molecule is selected from the group consisting of: transferrin, transferrin receptor antibody, interleukin, interleukin antibody, interleukin receptor antibody, and antibody against HTV antigen.
9. A conjugate according to claim 8, wherein said cell surface binding molecule is a transferrin receptor antibody, said transferrin receptor antibody being covalendy bound to the antisense oligonucleotide.
10. A conjugate according to claim 8, wherein said antisense oligonucleotide comprises a nucleic acid which is complementary to a region of the HIV genome selected from the group consisting of: a) the tRNAlys primer binding site; b) regions of the HIV genome vicinal in the 5' direction to the tRNAlys primer binding site; c) the tRNAlys primer binding site and regions of the HTV genome vicinal in the 5' direction to the tRNAlys primer binding site; d) the mRNA donor splice sites; e) the mRNA acceptor splice sites; f) the initiator codon for the gag gene; g) the initiator codon for the env gene; h) the initiator codon for the tat gene; i) the initiator codon for the sor gene; j) the initiator codon for the 3' orf gene; k) the cap nucleotide of the HIV genome; 1) the art gene or portions thereof; m) the region of the HIV genome encoding a frameshift; n) the poly (A) region; and o) equivalents thereof.
11. A conjugate according to claim 10, wherein said antisense oligonucleotide comprises an oligodeoxynucleotide selected from the group consisting of: a) CTGCTAGAGATddT; b) CTGCTAGAGATTTTCCACAC; c) TTCAAGTCCCTGTTCGGGCGCCAAA; d) GCGTACTCACCAGTCGCCGC; e) CTGCTAGAGATTAA; f) ACACCCAATTCTGAAAATGG; g) CTGGTCTAACCAGAGAGACC; h) GCAAGCTΓTATTGAGGCTTA; and g) equivalents thereof.
12. A method of inhibiting HTV replication, HTV gene expression or both in an individual, comprising administering to said individual an effective amount of a conjugate comprising a cell surface ligand binding molecule conjugated to at least one antisense oligonucleotide; said antisense oligonucleotide being complementary to and capable of hybridizng with a segment of a HTV nucleic acid selected from the group consisting of viral genomic RNA, unintegrated and integrated proviral DNA, viral mRNA, and viral RNA-DNA duplex.
13. A method according to claim 12, wherein said cell surface hgand binding molecule is selected from the group consisting of growth factor, antibody to growth factor, antibody to growth factor receptor, and antibody capable of recognizing a complex comprising growth factor and growth factor receptor.
14. A method according to claim 13, wherein said cell surface hgand binding molecule is selected from the group consisting of: transferrin, transferrin receptor antibody, interleukin, interleukin antibody, interleukin receptor antibody, and antibody to HTV antigen.
15. A method according to claim 14, wherein said antisense oligonucleotide comprises a nucleic acid which is complementary to a region of the HTV genome selected from the group consisting of: a) the tRNAlys primer binding site; b) regions of the HIV genome vicinal in the 5' direction to the tRNAlys primer binding site; c) the tRNAlys primer binding site and regions of the HTV genome vicinal in the 5' direction to the tRNAlys primer binding site; d) the mRNA donor splice sites; e) the mRNA acceptor splice sites; f) the initiator codon for the gag gene; g) the initiator codon for the env gene; h) the initiator codon for the tat gene; i) the initiator codon for the sor gene; j) the initiator codon for the 3' orf gene; k) the cap nucleotide of the HTV genome;
1) the art gene or portions thereof; m) the region of the HIV genome encoding a frameshift; n) the poly (A) region; and o) equivalents thereof.
16. A method according to claim 15, wherein the antisense ohgonucleotide comprises oligodeoxynucleotides selected from the group consisting of: a) CTGCTAGAGATddT; b) CTGCTAGAGATTTTCCACAC; c) TTCAAGTCCCTGTTCGGGCGCCAAA; d) GCGTACTCACCAGTCGCCGC; e) CTGCTAGAGATTAA; f) ACACCCAATTCTGAAAATGG; g) CTGGTCTAACCAGAGAGACC; h) GCAAGCTTTATTGAGGCTTA; and g) equivalents thereof.
17. A conjugate according to claim 2, wherein the antisense ohgonucleotide is complementary to segments of TNF DNA or TNF RNA.
18. A conjugate according to claim 17, wherein said antisense ohgonucleotide is selected from the group consisting of: a) 5TCTCCCTCTTAGCTGGTCCTCTGC3'; b) 5'CATGCTTTCAGTGCTCATGGTGTCCTTTC3'; c) 5'GATCAGGAAGGAGAAGAGGCTGAGGAACAA3'; d) 5'CTCAGCTTGAGGGTTTGC3'; and e) 5TTCGTCCTCCTCACAGGGC3'.
19. A conjugate according to claim 18, wherein said cell surface hgand binding molecule is selected from the group consiting of: growth factor, antibody to growth factor, antibody to cell surface receptor and antibody capable of recognizing complex comprising growth factor and growth factor receptor.
20. A method of preventing or suppressing TNF induced diseases or symptoms in an animal, comprising administering to said animal an effective amount of a conjugate comprising a cell surface hgand binding molecule conjugated to at least one antisense oligonucleotide; said antisense ohgonucleotide being complementary to and capable of hybridizng with a segment of a TNF RNA or TNF DNA.
21. A conjugate according to claim 2, wherein the antisense ohgonucleotide is complementary to BCR-ABL messenger RNA.
22. A conjugate according to claim 21 , wherein said antisense ohgonucleotide is selected from the group consisting of: a) GCTGAAGGGCTTΛTTGAACTCTGCTTA; b) GCΓGAAGGGCTTΛCTTCCTTATTGATG; c) GCTGAAGGGCTTΛCTGCGTCTCCAT; and d) equivalents thereof.
23. A conjugate according to claim 22, wherein said cell surface ligand binding molecule is selected from the group consisting of growth factor, antibody to growth factor, antibody to cell surface receptor, antibody capable of recognizing complex comprising growth factor and growth factor receptor, antibody to leukemia associated antigen.
24. A method for treating leukemia comprising administering an effective amount of a conjugate comprising cell surface hgand binding molecule conjugated to at least one antisense ohgonucleotide, said antisense ohgonucleotide being complementary to and capable of hybridizing with a segment of BCR-ABL mRNA.
25. A method according to claim 24, wherein said antisense oligonucleotides is selected from the group consisting of: a) GCTGAAGGGCTTΛTTGAACTCTGCTTA; b) GCTGAAGGGCTTΛCrTCCTTATTGATG; c) GCTGAAGGGCTTΛCTGCGTCTCCAT; and d) equivalents thereof.
26. A method of making a conjugate comprising at least one ohgonucleotide hnked to a ligand binding molecule by a disulfide linkage, comprising the steps of: a) adding a sulfhydryl group to the hgand binding molecule to form a sulfhydryl-ligand binding molecule complex; b) adding a sulfhydryl group to the ohgonucleotide to form a sulfhydryl- ohgonucleotide complex; c) reacting said sulfhydryl-ligand binding molecule complex with said sulfhydryl-oligonucleotide complex to form said conjugates; and d) isolating said conjugate.
27. A method of making a conjugate comprising at least one ohgonucleotide hnked to a hgand binding molecule by a thioether linkage, comprising the steps of: a) forming a hgand binding molecule complex comprising reacting said hgand molecule with a heterobifunctional crosslinker comprising an activated carboxylate group, a spacer molecule containing either groups, and a maleimide group, wherein an amino group on said Hgand binding molecule reacts with said activated carboxylate group; b) isolating said hgand binding molecule crosslinker complex; c) adding a sulfhydryl group to an ohgonucleotide to form a sulfhydryl- oligonucleotide complex; d) reacting said sulfhydryl oligonucleotide complex with said hgand binding molecule crosshnker complex to form said conjugates; and e) isolating said conjugate.
PCT/US1990/005272 1989-10-02 1990-09-17 Conjugates of antisense oligonucleotides and therapeutic uses thereof WO1991004753A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US41601789A 1989-10-02 1989-10-02
US416,017 1989-10-02

Publications (1)

Publication Number Publication Date
WO1991004753A1 true WO1991004753A1 (en) 1991-04-18

Family

ID=23648174

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/005272 WO1991004753A1 (en) 1989-10-02 1990-09-17 Conjugates of antisense oligonucleotides and therapeutic uses thereof

Country Status (1)

Country Link
WO (1) WO1991004753A1 (en)

Cited By (134)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992017210A1 (en) * 1991-03-29 1992-10-15 Boehringer Ingelheim International Gmbh Novel protein polycation conjugates
EP0529008A1 (en) * 1990-05-04 1993-03-03 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with rna secondary structure
EP0535576A1 (en) * 1991-09-30 1993-04-07 BOEHRINGER INGELHEIM INTERNATIONAL GmbH New conjugates to introduce nucleic acid into higher eucaryotic cells
WO1993009221A1 (en) * 1991-10-30 1993-05-13 Thera Gene Hb Targeted delivery of virus vector to mammalian cells
WO1993009813A1 (en) * 1991-11-12 1993-05-27 Imperial Cancer Research Technology Limited Therapeutic compounds
EP0544292A2 (en) * 1991-11-27 1993-06-02 Roche Diagnostics GmbH Method of introduction of nucleic acids in cells
WO1993010819A1 (en) * 1991-11-26 1993-06-10 Alkermes, Inc. Process for the preparation of transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
EP0551294A1 (en) * 1991-08-01 1993-07-21 City Of Hope Ribozyme inhibition of bcr-abl gene expression
WO1993019768A1 (en) * 1992-04-03 1993-10-14 The Regents Of The University Of California Self-assembling polynucleotide delivery system
DE4225094A1 (en) * 1992-04-28 1993-11-04 Frank Andreas Harald Meyer Compsn. for gene therapy, esp. of viral infections and tumours - comprises anti-sense DNA or RNA inserted into long terminal repeat or transposable element and e.g. virus envelope as carrier
EP0590090A1 (en) * 1991-06-18 1994-04-06 Temple University SELECTIVE INHIBITION OF LEUKEMIC CELL PROLIFERATION BY $i(BCR-ABL) ANTISENSE OLIGONUCLEOTIDES
WO1994008625A1 (en) * 1992-10-21 1994-04-28 Temple University - Of The Commonwealth System Of Higher Education Combination of antineoplastic agent and antisense oligonucleotides for treatment of cancer
WO1995007923A1 (en) * 1993-09-15 1995-03-23 Temple University Of The Commonwealth System Of Higher Education Multi-unit ribozyme inhibition of oncogene expression
WO1995019433A2 (en) * 1994-01-12 1995-07-20 Targetech, Inc. Anti-hepatitis b poly- and oligonucleotides
WO1996004294A1 (en) * 1994-08-01 1996-02-15 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Nucleic acid to initiate the activity of ribonuclease h or reverse transcriptase
US5527527A (en) * 1989-09-07 1996-06-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical agent conjugates
WO1997020069A1 (en) * 1995-11-28 1997-06-05 Boehringer Mannheim Gmbh Method of detecting telomerase activity
US5672683A (en) * 1989-09-07 1997-09-30 Alkermes, Inc. Transferrin neuropharmaceutical agent fusion protein
US5744460A (en) * 1996-03-07 1998-04-28 Novartis Corporation Combination for treatment of proliferative diseases
US5866698A (en) * 1990-05-04 1999-02-02 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with RNA secondary structure
US5955644A (en) * 1996-08-08 1999-09-21 M.D. Anderson Cancer Center Ku deficient cells and non-human transgenic animals
US5977307A (en) * 1989-09-07 1999-11-02 Alkermes, Inc. Transferrin receptor specific ligand-neuropharmaceutical agent fusion proteins
WO1999062526A2 (en) * 1998-06-05 1999-12-09 Mayo Foundation For Medical Education And Research Use of genetically engineered antibodies to cd38 to treat multiple myeloma
EP0971033A2 (en) 1991-01-21 2000-01-12 Imperial College Of Science, Technology & Medicine Test and model for Alzheimer's disease
US6015555A (en) * 1995-05-19 2000-01-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
US6030954A (en) * 1991-09-05 2000-02-29 University Of Connecticut Targeted delivery of poly- or oligonucleotides to cells
US6034233A (en) * 1990-05-04 2000-03-07 Isis Pharmaceuticals Inc. 2'-O-alkylated oligoribonucleotides and phosphorothioate analogs complementary to portions of the HIV genome
US6057489A (en) * 1996-09-12 2000-05-02 M.D. Anderson Cancer Center MmRad51-deficient cells and transgenic mice
US6080727A (en) * 1996-03-26 2000-06-27 Istituto Regina Elena Oligonucleotide treatments and compositions for human melanoma
US6180767B1 (en) 1996-01-11 2001-01-30 Thomas Jefferson University Peptide nucleic acid conjugates
WO2001029070A2 (en) 1999-10-20 2001-04-26 Genentech, Inc. Modulation of t cell differentiation for the treatment of t helper cell mediated diseases
US6329508B1 (en) 1989-09-07 2001-12-11 Alkermes, Inc. Transferrin receptor reactive chimeric antibodies
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
US6376248B1 (en) 1997-03-14 2002-04-23 Life Technologies, Inc. Peptide-enhanced transfections
EP1023052B1 (en) * 1997-10-17 2003-09-10 Dds Drug Delivery Service Gesellschaft Zur Förderung Der Forschung In Pharmazeutischer Technologie Und Biopharmazie Mbh Medicament excipient particles for tissue-specific application of a medicament
US6713280B1 (en) 1999-04-07 2004-03-30 Thomas Jefferson University Enhancement of peptide cellular uptake
US6776986B1 (en) 1996-06-06 2004-08-17 Novartis Ag Inhibition of HIV-1 replication by antisense RNA expression
WO2005118864A2 (en) 2004-05-28 2005-12-15 Agensys, Inc. Antibodies and related molecules that bind to psca proteins
EP1666591A1 (en) 1995-06-29 2006-06-07 Immunex Corporation Cytokine that induces apoptosis
US7173115B2 (en) 2000-01-13 2007-02-06 Genentech, Inc. Stra6 polypeptides
EP1757618A2 (en) 2000-03-22 2007-02-28 Curagen Corporation Angiogenesis-associated proteins, and nucleic acids encoding the same
WO2007038658A2 (en) 2005-09-26 2007-04-05 Medarex, Inc. Antibody-drug conjugates and methods of use
EP1772515A1 (en) 1999-05-12 2007-04-11 Immunex Corporation Immunoregulator from the family designated 'leukocyte immunoglobulin-like receptors' (LIR)
US7273932B1 (en) * 1999-05-28 2007-09-25 The University Of Cincinnati Antisense oligonucleotides for fertility and menstrual cycle regulation and for chemopreventive and chemotherapeutic use
EP1865061A2 (en) 1998-05-15 2007-12-12 Genentech, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
EP1944317A2 (en) 2000-09-01 2008-07-16 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP1953173A1 (en) 1999-06-15 2008-08-06 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
EP1992643A2 (en) 2001-06-20 2008-11-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1995321A2 (en) 2005-08-15 2008-11-26 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
EP2002714A1 (en) 2005-11-21 2008-12-17 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2011886A2 (en) 2002-04-16 2009-01-07 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2014669A2 (en) 2002-03-01 2009-01-14 Sagres Discovery, Inc. Compositions and methods for cancer
EP2014298A2 (en) 2000-08-24 2009-01-14 Genentech, Inc. Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders
EP2031076A1 (en) 2002-02-27 2009-03-04 Sagres Discovery, Inc. Novel compositions and methods for cancer
EP2034030A2 (en) 2001-12-26 2009-03-11 Sagres Discovery, Inc. Novel compositions and methods for cancer
EP2050763A2 (en) 2005-03-10 2009-04-22 Genentech, Inc. Methods and compositions for modulating vascular integrity
EP2050335A1 (en) 2006-02-17 2009-04-22 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
EP2058408A2 (en) 2003-02-14 2009-05-13 Sagres Discovery, Inc. Therapeutic GPCR targets in cancer
EP2062591A1 (en) 2005-04-07 2009-05-27 Novartis Vaccines and Diagnostics, Inc. CACNA1E in cancer diagnosis detection and treatment
EP2067472A1 (en) 2002-01-02 2009-06-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2075334A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. EG-VEGF nucleic acids and polypeptides and methods of use
EP2082645A1 (en) 2006-04-19 2009-07-29 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2083088A2 (en) 2005-04-07 2009-07-29 Novartis Vaccines and Diagnostics, Inc. Cancer-related genes
EP2093233A1 (en) 2002-03-21 2009-08-26 Sagres Discovery, Inc. Novel compositions and methods in cancer
EP2110434A1 (en) 2002-02-25 2009-10-21 Genentech, Inc. Type-1 cytokine receptor GLM-R
US7645441B2 (en) 2000-12-22 2010-01-12 Sagres Discovery Inc. Compositions and methods in cancer associated with altered expression of PRLR
EP2143438A1 (en) 2001-09-18 2010-01-13 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US7659375B2 (en) 1998-08-21 2010-02-09 Immunex Corporation Human IL-1 epsilon DNA and polypeptides
EP2161283A1 (en) 2003-11-17 2010-03-10 Genentech, Inc. Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin
EP2163625A1 (en) 1999-12-23 2010-03-17 Genentech, Inc. IL-17 and IL-17R homologous polypeptides and therapeutic uses thereof
US7700274B2 (en) 2000-12-22 2010-04-20 Sagres Discovery, Inc. Compositions and methods in cancer associated with altered expression of KCNJ9
US7705195B2 (en) 2002-06-07 2010-04-27 Genentech, Inc. Screening method
EP2186402A1 (en) 2005-06-06 2010-05-19 Genentech, Inc. Knock-out animal models for novel genes and methods of use
WO2010062995A2 (en) 2008-11-26 2010-06-03 Five Prime Therapeutics, Inc. Compositions and methods for regulating collagen and smooth muscle actin expression by serpine2
EP2204376A2 (en) 2004-07-20 2010-07-07 Sagres Discovery, Inc. Novel therapeutic targets in cancer
US7767387B2 (en) 2003-06-13 2010-08-03 Sagres Discovery, Inc. Therapeutic targets in cancer
EP2228446A1 (en) 1999-12-01 2010-09-15 Genentech, Inc. Secreted and transmembrane polypeptieds and nucleic acids encoding the same
US7816076B2 (en) 2003-02-14 2010-10-19 Sagres Discovery, Inc. Therapeutic targets in cancer
US7851169B2 (en) 2004-01-27 2010-12-14 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for inhibiting squamous cell carcinoma
EP2266986A1 (en) 2001-05-31 2010-12-29 Medarex, Inc. Cytotoxins, Prodrugs, Linkers and Stabilizers useful therefor
US7875277B2 (en) 2004-01-27 2011-01-25 The Dept. of Veterans Affairs Office of The General Counsel Compositions and methods for inhibiting squamous cell carcinoma
EP2277908A2 (en) 2003-07-08 2011-01-26 Genentech, Inc. IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof
WO2011028950A1 (en) 2009-09-02 2011-03-10 Genentech, Inc. Mutant smoothened and methods of using the same
EP2302041A1 (en) 2001-11-07 2011-03-30 Agensys, Inc. Nucleic acid and corresponding protein entitled 161P2F10B useful in treatment and detection of cancer
EP2301954A2 (en) 2002-08-16 2011-03-30 Agensys, Inc. Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
EP2305812A2 (en) * 2002-11-14 2011-04-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
WO2011050194A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
EP2319524A1 (en) 2003-05-30 2011-05-11 Agensys, Inc. Prostate stem cell antigen (PSCA) variants and subsequences thereof
WO2011066503A2 (en) 2009-11-30 2011-06-03 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2333069A2 (en) 1998-05-15 2011-06-15 Genentech, Inc. Therapeutic uses of IL-17 homologous polypeptides
EP2343315A2 (en) 2003-02-10 2011-07-13 Agensys, Inc. Nucleic acid and corresponding protein named 158P1D7 useful in the treatment and detection of bladder and other cancers
US7993672B2 (en) 1995-01-23 2011-08-09 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
WO2011106297A2 (en) 2010-02-23 2011-09-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2011139985A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
EP2444099A1 (en) 2005-03-31 2012-04-25 Agensys, Inc. Antibodies and related molecules that bind to 161P2F10B proteins
EP2450050A1 (en) 2006-11-29 2012-05-09 Genentech, Inc. IL-17A/F heterodimeric polypeptides and therapeutic uses thereof
US8263403B2 (en) 2007-04-23 2012-09-11 Stowers Institute For Medical Research Methods and compositions for stem cell self-renewal
US8461117B2 (en) 2006-12-28 2013-06-11 Medarex, Inc. Chemical linkers and cleavable substrates and conjugates thereof
EP2614839A2 (en) 2006-04-05 2013-07-17 Genentech, Inc. Method for using BOC/CDO to modulate hedgehog signaling
US8664407B2 (en) 2007-02-21 2014-03-04 Medarex, LLC Chemical linkers with single amino acids and conjugates thereof
US8815794B2 (en) 2008-08-28 2014-08-26 The Research Foundation For The State University Of New York Treatment of amyloidoses using myelin basic protein and fragments thereof
WO2015116902A1 (en) 2014-01-31 2015-08-06 Genentech, Inc. G-protein coupled receptors in hedgehog signaling
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
US9358300B2 (en) 1998-11-12 2016-06-07 Life Technologies Corporation Transfection reagents
WO2016126972A1 (en) 2015-02-04 2016-08-11 Genentech, Inc. Mutant smoothened and methods of using the same
EP3112468A1 (en) 1998-05-15 2017-01-04 Genentech, Inc. Il-17 homologous polypeptides and therapeutic uses thereof
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
EP3252068A2 (en) 2009-10-12 2017-12-06 Larry J. Smith Methods and compositions for modulating gene expression using oligonucleotide based drugs administered in vivo or in vitro
EP3255144A1 (en) 2007-08-10 2017-12-13 E. R. Squibb & Sons, L.L.C. Recombineering construct for preparing transgenic mice capable of producing human immunoglobulin
US10195280B2 (en) 2014-07-15 2019-02-05 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US11111309B2 (en) 2018-08-02 2021-09-07 Dyne Therapeutics, Inc. Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11246941B2 (en) 2017-12-06 2022-02-15 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11311627B1 (en) 2017-01-06 2022-04-26 Avidity Biosciences Llc Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11446387B2 (en) 2020-03-27 2022-09-20 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US11525137B2 (en) 2020-03-19 2022-12-13 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
WO2023034409A1 (en) 2021-09-01 2023-03-09 Biogen Ma Inc. Anti-transferrin receptor antibodies and uses thereof
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
US11648318B2 (en) 2021-07-09 2023-05-16 Dyne Therapeutics, Inc. Anti-transferrin receptor (TFR) antibody and uses thereof
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11795232B2 (en) 2017-02-17 2023-10-24 Denali Therapeutics Inc. Engineered transferrin receptor binding polypeptides
US11834510B2 (en) 2018-12-21 2023-12-05 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
US11833221B2 (en) 2021-09-01 2023-12-05 Ionis Pharmaceuticals, Inc. Oligomeric compounds for reducing DMPK expression
US11891603B2 (en) 2017-07-21 2024-02-06 The Governors Of The University Of Alberta Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11912779B2 (en) 2021-09-16 2024-02-27 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11981897B2 (en) 2013-08-09 2024-05-14 Ionis Pharmaceuticals, Inc. Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4545985A (en) * 1984-01-26 1985-10-08 The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services Pseudomonas exotoxin conjugate immunotoxins
EP0227351A2 (en) * 1985-12-04 1987-07-01 Shionogi & Co., Ltd. Immobilized C-peptide antibody, and the preparation and use thereof
EP0263740A1 (en) * 1986-09-26 1988-04-13 Centre National De La Recherche Scientifique (Cnrs) Coupling conjugates between RNA or DNA sequences and a protein, method for their preparation and their biological use
WO1988005077A1 (en) * 1986-12-29 1988-07-14 Battelle Memorial Institute A method of modifiying the metabolism of eukaryotic cells upon incorporation therein of foreign sequences of nucleic acids by means of an internalizing vector

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4545985A (en) * 1984-01-26 1985-10-08 The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services Pseudomonas exotoxin conjugate immunotoxins
EP0227351A2 (en) * 1985-12-04 1987-07-01 Shionogi & Co., Ltd. Immobilized C-peptide antibody, and the preparation and use thereof
EP0263740A1 (en) * 1986-09-26 1988-04-13 Centre National De La Recherche Scientifique (Cnrs) Coupling conjugates between RNA or DNA sequences and a protein, method for their preparation and their biological use
WO1988005077A1 (en) * 1986-12-29 1988-07-14 Battelle Memorial Institute A method of modifiying the metabolism of eukaryotic cells upon incorporation therein of foreign sequences of nucleic acids by means of an internalizing vector

Cited By (220)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5977307A (en) * 1989-09-07 1999-11-02 Alkermes, Inc. Transferrin receptor specific ligand-neuropharmaceutical agent fusion proteins
US5833988A (en) * 1989-09-07 1998-11-10 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
US6329508B1 (en) 1989-09-07 2001-12-11 Alkermes, Inc. Transferrin receptor reactive chimeric antibodies
US5672683A (en) * 1989-09-07 1997-09-30 Alkermes, Inc. Transferrin neuropharmaceutical agent fusion protein
US5527527A (en) * 1989-09-07 1996-06-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical agent conjugates
EP0529008A1 (en) * 1990-05-04 1993-03-03 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with rna secondary structure
US6034233A (en) * 1990-05-04 2000-03-07 Isis Pharmaceuticals Inc. 2'-O-alkylated oligoribonucleotides and phosphorothioate analogs complementary to portions of the HIV genome
EP0903406A1 (en) * 1990-05-04 1999-03-24 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with RNA secondary structure
US5866698A (en) * 1990-05-04 1999-02-02 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with RNA secondary structure
EP0529008A4 (en) * 1990-05-04 1993-06-16 Isis Pharmaceuticals, Inc. Modulation of gene expression through interference with rna secondary structure
EP0971033A2 (en) 1991-01-21 2000-01-12 Imperial College Of Science, Technology & Medicine Test and model for Alzheimer's disease
WO1992017210A1 (en) * 1991-03-29 1992-10-15 Boehringer Ingelheim International Gmbh Novel protein polycation conjugates
EP0590090A4 (en) * 1991-06-18 1995-04-12 Univ Temple SELECTIVE INHIBITION OF LEUKEMIC CELL PROLIFERATION BY -i(BCR-ABL) ANTISENSE OLIGONUCLEOTIDES.
EP0590090A1 (en) * 1991-06-18 1994-04-06 Temple University SELECTIVE INHIBITION OF LEUKEMIC CELL PROLIFERATION BY $i(BCR-ABL) ANTISENSE OLIGONUCLEOTIDES
US5652222A (en) * 1991-06-18 1997-07-29 Temple University-Of The Commonwealth System Of Higher Education Selective inhibition of leukemic cell proliferation by bcr-abl antisense oligonucleotides
EP0551294A4 (en) * 1991-08-01 1993-12-29 City Of Hope Ribozyme inhibition of bcr-abl gene expression
EP0551294A1 (en) * 1991-08-01 1993-07-21 City Of Hope Ribozyme inhibition of bcr-abl gene expression
US6030954A (en) * 1991-09-05 2000-02-29 University Of Connecticut Targeted delivery of poly- or oligonucleotides to cells
EP0535576A1 (en) * 1991-09-30 1993-04-07 BOEHRINGER INGELHEIM INTERNATIONAL GmbH New conjugates to introduce nucleic acid into higher eucaryotic cells
WO1993007282A1 (en) * 1991-09-30 1993-04-15 Boehringer Ingelheim International Gmbh New conjugates for the introduction of nucleic acid into higher eukaryotic cells
US5695991A (en) * 1991-10-30 1997-12-09 Got-A-Gene Ab Targeted delivery of virus vector to mammalian cells
WO1993009221A1 (en) * 1991-10-30 1993-05-13 Thera Gene Hb Targeted delivery of virus vector to mammalian cells
GB2275928A (en) * 1991-11-12 1994-09-14 Imp Cancer Res Tech Therapeutic compounds
WO1993009813A1 (en) * 1991-11-12 1993-05-27 Imperial Cancer Research Technology Limited Therapeutic compounds
GB2275928B (en) * 1991-11-12 1995-09-06 Imp Cancer Res Tech Compound comprising a nucleic acid and a radioactive moiety
WO1993010819A1 (en) * 1991-11-26 1993-06-10 Alkermes, Inc. Process for the preparation of transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
EP0544292A3 (en) * 1991-11-27 1993-09-15 Boehringer Mannheim Gmbh Method of introduction of nucleic acids in cells
EP0544292A2 (en) * 1991-11-27 1993-06-02 Roche Diagnostics GmbH Method of introduction of nucleic acids in cells
EP1236473A2 (en) * 1992-04-03 2002-09-04 The Regents Of The University Of California Self-assembling polynucleotide delivery system
AU682308B2 (en) * 1992-04-03 1997-10-02 Regents Of The University Of California, The Self-assembling polynucleotide delivery system
US6300317B1 (en) * 1992-04-03 2001-10-09 The Regents Of The University Of California Self-assembling polynucleotide delivery system
EP1236473A3 (en) * 1992-04-03 2003-01-15 The Regents Of The University Of California Self-assembling polynucleotide delivery system
AU682308C (en) * 1992-04-03 2006-08-17 Regents Of The University Of California, The Self-assembling polynucleotide delivery system
WO1993019768A1 (en) * 1992-04-03 1993-10-14 The Regents Of The University Of California Self-assembling polynucleotide delivery system
DE4225094A1 (en) * 1992-04-28 1993-11-04 Frank Andreas Harald Meyer Compsn. for gene therapy, esp. of viral infections and tumours - comprises anti-sense DNA or RNA inserted into long terminal repeat or transposable element and e.g. virus envelope as carrier
WO1994008625A1 (en) * 1992-10-21 1994-04-28 Temple University - Of The Commonwealth System Of Higher Education Combination of antineoplastic agent and antisense oligonucleotides for treatment of cancer
US5635385A (en) * 1993-09-15 1997-06-03 Temple University-Of The Commonwealth System Of Higher Education Multi-unit ribozyme inhibition of oncogene gene expression
WO1995007923A1 (en) * 1993-09-15 1995-03-23 Temple University Of The Commonwealth System Of Higher Education Multi-unit ribozyme inhibition of oncogene expression
WO1995019433A3 (en) * 1994-01-12 1995-10-19 Targetech Inc Anti-hepatitis b poly- and oligonucleotides
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
WO1995019433A2 (en) * 1994-01-12 1995-07-20 Targetech, Inc. Anti-hepatitis b poly- and oligonucleotides
WO1996004294A1 (en) * 1994-08-01 1996-02-15 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Nucleic acid to initiate the activity of ribonuclease h or reverse transcriptase
US8771728B2 (en) 1995-01-23 2014-07-08 University of Pittsburgh—of the Commonwealth System of Higher Education Stable lipid-comprising drug delivery complexes and methods for their production
US7993672B2 (en) 1995-01-23 2011-08-09 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
US6015555A (en) * 1995-05-19 2000-01-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
EP1666591A1 (en) 1995-06-29 2006-06-07 Immunex Corporation Cytokine that induces apoptosis
WO1997020069A1 (en) * 1995-11-28 1997-06-05 Boehringer Mannheim Gmbh Method of detecting telomerase activity
US6180767B1 (en) 1996-01-11 2001-01-30 Thomas Jefferson University Peptide nucleic acid conjugates
US5744460A (en) * 1996-03-07 1998-04-28 Novartis Corporation Combination for treatment of proliferative diseases
US6080727A (en) * 1996-03-26 2000-06-27 Istituto Regina Elena Oligonucleotide treatments and compositions for human melanoma
US6776986B1 (en) 1996-06-06 2004-08-17 Novartis Ag Inhibition of HIV-1 replication by antisense RNA expression
US5955644A (en) * 1996-08-08 1999-09-21 M.D. Anderson Cancer Center Ku deficient cells and non-human transgenic animals
US6057489A (en) * 1996-09-12 2000-05-02 M.D. Anderson Cancer Center MmRad51-deficient cells and transgenic mice
US6376248B1 (en) 1997-03-14 2002-04-23 Life Technologies, Inc. Peptide-enhanced transfections
EP1023052B1 (en) * 1997-10-17 2003-09-10 Dds Drug Delivery Service Gesellschaft Zur Förderung Der Forschung In Pharmazeutischer Technologie Und Biopharmazie Mbh Medicament excipient particles for tissue-specific application of a medicament
EP1865061A2 (en) 1998-05-15 2007-12-12 Genentech, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
EP3112468A1 (en) 1998-05-15 2017-01-04 Genentech, Inc. Il-17 homologous polypeptides and therapeutic uses thereof
EP2333069A2 (en) 1998-05-15 2011-06-15 Genentech, Inc. Therapeutic uses of IL-17 homologous polypeptides
AU770718B2 (en) * 1998-06-05 2004-02-26 Mayo Foundation For Medical Education And Research Use of genetically engineered antibodies to CD38 to treat multiple myeloma
WO1999062526A2 (en) * 1998-06-05 1999-12-09 Mayo Foundation For Medical Education And Research Use of genetically engineered antibodies to cd38 to treat multiple myeloma
WO1999062526A3 (en) * 1998-06-05 2000-02-10 Mayo Foundation Use of genetically engineered antibodies to cd38 to treat multiple myeloma
US7659375B2 (en) 1998-08-21 2010-02-09 Immunex Corporation Human IL-1 epsilon DNA and polypeptides
US9358300B2 (en) 1998-11-12 2016-06-07 Life Technologies Corporation Transfection reagents
US6713280B1 (en) 1999-04-07 2004-03-30 Thomas Jefferson University Enhancement of peptide cellular uptake
EP1772515A1 (en) 1999-05-12 2007-04-11 Immunex Corporation Immunoregulator from the family designated 'leukocyte immunoglobulin-like receptors' (LIR)
US7273932B1 (en) * 1999-05-28 2007-09-25 The University Of Cincinnati Antisense oligonucleotides for fertility and menstrual cycle regulation and for chemopreventive and chemotherapeutic use
EP1953173A1 (en) 1999-06-15 2008-08-06 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
EP1956030A1 (en) 1999-06-15 2008-08-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids endoding the same
WO2001029070A2 (en) 1999-10-20 2001-04-26 Genentech, Inc. Modulation of t cell differentiation for the treatment of t helper cell mediated diseases
EP2228446A1 (en) 1999-12-01 2010-09-15 Genentech, Inc. Secreted and transmembrane polypeptieds and nucleic acids encoding the same
EP2258848A1 (en) 1999-12-23 2010-12-08 Genentech, Inc. Il-17 homologous polypeptide and therapeutic uses thereof
EP2163625A1 (en) 1999-12-23 2010-03-17 Genentech, Inc. IL-17 and IL-17R homologous polypeptides and therapeutic uses thereof
EP2290081A2 (en) 1999-12-23 2011-03-02 Genentech, Inc. IL-17 homologous polypeptide and therapeutic uses thereof
US7939650B2 (en) 2000-01-13 2011-05-10 Genentech, Inc. Stra6 polypeptides
US7855278B2 (en) 2000-01-13 2010-12-21 Genentech, Inc. Antibodies to Stra6 polypeptides
US7741439B2 (en) 2000-01-13 2010-06-22 Genentech, Inc. Isolated stra6 polypeptides
US7173115B2 (en) 2000-01-13 2007-02-06 Genentech, Inc. Stra6 polypeptides
EP1757618A2 (en) 2000-03-22 2007-02-28 Curagen Corporation Angiogenesis-associated proteins, and nucleic acids encoding the same
EP2075334A1 (en) 2000-06-23 2009-07-01 Genentech, Inc. EG-VEGF nucleic acids and polypeptides and methods of use
EP2014298A2 (en) 2000-08-24 2009-01-14 Genentech, Inc. Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders
EP1944317A2 (en) 2000-09-01 2008-07-16 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US7892730B2 (en) 2000-12-22 2011-02-22 Sagres Discovery, Inc. Compositions and methods for cancer
US7820447B2 (en) 2000-12-22 2010-10-26 Sagres Discovery Inc. Compositions and methods for cancer
US7700274B2 (en) 2000-12-22 2010-04-20 Sagres Discovery, Inc. Compositions and methods in cancer associated with altered expression of KCNJ9
US7645441B2 (en) 2000-12-22 2010-01-12 Sagres Discovery Inc. Compositions and methods in cancer associated with altered expression of PRLR
EP2266986A1 (en) 2001-05-31 2010-12-29 Medarex, Inc. Cytotoxins, Prodrugs, Linkers and Stabilizers useful therefor
EP2000545A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1992643A2 (en) 2001-06-20 2008-11-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2000148A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of prostate cancer
EP2000482A1 (en) 2001-06-20 2008-12-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2143438A1 (en) 2001-09-18 2010-01-13 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2151244A1 (en) 2001-09-18 2010-02-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2153843A1 (en) 2001-09-18 2010-02-17 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2302041A1 (en) 2001-11-07 2011-03-30 Agensys, Inc. Nucleic acid and corresponding protein entitled 161P2F10B useful in treatment and detection of cancer
EP2034030A2 (en) 2001-12-26 2009-03-11 Sagres Discovery, Inc. Novel compositions and methods for cancer
EP2067472A1 (en) 2002-01-02 2009-06-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP2110434A1 (en) 2002-02-25 2009-10-21 Genentech, Inc. Type-1 cytokine receptor GLM-R
EP2031076A1 (en) 2002-02-27 2009-03-04 Sagres Discovery, Inc. Novel compositions and methods for cancer
EP2014669A2 (en) 2002-03-01 2009-01-14 Sagres Discovery, Inc. Compositions and methods for cancer
EP2253643A1 (en) 2002-03-20 2010-11-24 Sagres Discovery, Inc. Novel compositions and methods in cancer associated with altered expression of PRLR
EP2093233A1 (en) 2002-03-21 2009-08-26 Sagres Discovery, Inc. Novel compositions and methods in cancer
EP2011886A2 (en) 2002-04-16 2009-01-07 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US7705195B2 (en) 2002-06-07 2010-04-27 Genentech, Inc. Screening method
EP2301954A2 (en) 2002-08-16 2011-03-30 Agensys, Inc. Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
EP2332966A1 (en) 2002-08-16 2011-06-15 Agensys, Inc. Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
EP2305812A2 (en) * 2002-11-14 2011-04-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
EP2343315A2 (en) 2003-02-10 2011-07-13 Agensys, Inc. Nucleic acid and corresponding protein named 158P1D7 useful in the treatment and detection of bladder and other cancers
US7816076B2 (en) 2003-02-14 2010-10-19 Sagres Discovery, Inc. Therapeutic targets in cancer
EP2058408A2 (en) 2003-02-14 2009-05-13 Sagres Discovery, Inc. Therapeutic GPCR targets in cancer
EP2319524A1 (en) 2003-05-30 2011-05-11 Agensys, Inc. Prostate stem cell antigen (PSCA) variants and subsequences thereof
US7767387B2 (en) 2003-06-13 2010-08-03 Sagres Discovery, Inc. Therapeutic targets in cancer
EP2784084A1 (en) 2003-07-08 2014-10-01 Genentech, Inc. IL-17 A/F heterologous polypeptides and therapeutics uses thereof
EP2277908A2 (en) 2003-07-08 2011-01-26 Genentech, Inc. IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof
EP3594228A1 (en) 2003-07-08 2020-01-15 Genentech, Inc. Il-17a/f heterologous polypedtides and therapeutic uses thereof
EP2295073A1 (en) 2003-11-17 2011-03-16 Genentech, Inc. Antibody against CD22 for the treatment of tumour of hematopoietic origin
EP2161283A1 (en) 2003-11-17 2010-03-10 Genentech, Inc. Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin
EP2301568A1 (en) 2003-11-17 2011-03-30 Genentech, Inc. Antibody against IRTA2 for the treatment of tumour of hematopoietic origin
US7851169B2 (en) 2004-01-27 2010-12-14 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for inhibiting squamous cell carcinoma
US7875277B2 (en) 2004-01-27 2011-01-25 The Dept. of Veterans Affairs Office of The General Counsel Compositions and methods for inhibiting squamous cell carcinoma
EP2428522A1 (en) 2004-05-28 2012-03-14 Agensys, Inc. Antibodies that bind to PSCA proteins for diagnosis of cancer
WO2005118864A2 (en) 2004-05-28 2005-12-15 Agensys, Inc. Antibodies and related molecules that bind to psca proteins
EP2583981A2 (en) 2004-05-28 2013-04-24 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
EP2204376A2 (en) 2004-07-20 2010-07-07 Sagres Discovery, Inc. Novel therapeutic targets in cancer
EP2050763A2 (en) 2005-03-10 2009-04-22 Genentech, Inc. Methods and compositions for modulating vascular integrity
EP2444099A1 (en) 2005-03-31 2012-04-25 Agensys, Inc. Antibodies and related molecules that bind to 161P2F10B proteins
EP3300739A2 (en) 2005-03-31 2018-04-04 Agensys, Inc. Antibodies and related molecules that bind to 161p2f10b proteins
EP2083088A2 (en) 2005-04-07 2009-07-29 Novartis Vaccines and Diagnostics, Inc. Cancer-related genes
EP2062591A1 (en) 2005-04-07 2009-05-27 Novartis Vaccines and Diagnostics, Inc. CACNA1E in cancer diagnosis detection and treatment
EP2186402A1 (en) 2005-06-06 2010-05-19 Genentech, Inc. Knock-out animal models for novel genes and methods of use
EP1995321A2 (en) 2005-08-15 2008-11-26 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
WO2007038658A2 (en) 2005-09-26 2007-04-05 Medarex, Inc. Antibody-drug conjugates and methods of use
EP2354163A2 (en) 2005-09-26 2011-08-10 Medarex, Inc. Conjugates of duocarmycin and anti-CD70 or anti-PSMA antibodies
EP2002714A1 (en) 2005-11-21 2008-12-17 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP2050335A1 (en) 2006-02-17 2009-04-22 Genentech, Inc. Gene disruptions, compositions and methods relating thereto
EP2614839A2 (en) 2006-04-05 2013-07-17 Genentech, Inc. Method for using BOC/CDO to modulate hedgehog signaling
EP2082645A1 (en) 2006-04-19 2009-07-29 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
EP3181147A1 (en) 2006-11-29 2017-06-21 Genentech, Inc. Il-17a/f heterodimeric polypeptides and therapeutic thereof
EP2450050A1 (en) 2006-11-29 2012-05-09 Genentech, Inc. IL-17A/F heterodimeric polypeptides and therapeutic uses thereof
US8461117B2 (en) 2006-12-28 2013-06-11 Medarex, Inc. Chemical linkers and cleavable substrates and conjugates thereof
US8664407B2 (en) 2007-02-21 2014-03-04 Medarex, LLC Chemical linkers with single amino acids and conjugates thereof
EP2798956A1 (en) 2007-04-23 2014-11-05 Stowers Institute for Medical Research Methods and compositions for hematopoeitic stem cell self-renewal
US8476071B2 (en) 2007-04-23 2013-07-02 Stowers Institute For Medical Research Methods and compositions for stem cell self-renewal
US10787643B2 (en) 2007-04-23 2020-09-29 Stowers Institute For Medical Research Methods, kits, and compositions for stem cell self-renewal
US9771559B2 (en) 2007-04-23 2017-09-26 Stowers Institute For Medical Research Methods and compositions for stem cell self-renewal
US8263403B2 (en) 2007-04-23 2012-09-11 Stowers Institute For Medical Research Methods and compositions for stem cell self-renewal
EP3255144A1 (en) 2007-08-10 2017-12-13 E. R. Squibb & Sons, L.L.C. Recombineering construct for preparing transgenic mice capable of producing human immunoglobulin
US8815794B2 (en) 2008-08-28 2014-08-26 The Research Foundation For The State University Of New York Treatment of amyloidoses using myelin basic protein and fragments thereof
WO2010062995A2 (en) 2008-11-26 2010-06-03 Five Prime Therapeutics, Inc. Compositions and methods for regulating collagen and smooth muscle actin expression by serpine2
WO2011028950A1 (en) 2009-09-02 2011-03-10 Genentech, Inc. Mutant smoothened and methods of using the same
EP3252068A2 (en) 2009-10-12 2017-12-06 Larry J. Smith Methods and compositions for modulating gene expression using oligonucleotide based drugs administered in vivo or in vitro
EP4089169A1 (en) 2009-10-12 2022-11-16 Larry J. Smith Methods and compositions for modulating gene expression using oligonucleotide based drugs administered in vivo or in vitro
WO2011050194A1 (en) 2009-10-22 2011-04-28 Genentech, Inc. Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
WO2011066503A2 (en) 2009-11-30 2011-06-03 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP3002297A2 (en) 2009-11-30 2016-04-06 F. Hoffmann-La Roche AG Antibodies for treating and diagnosing tumors expressing slc34a2 (tat211)
WO2011106297A2 (en) 2010-02-23 2011-09-01 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2011139985A1 (en) 2010-05-03 2011-11-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2012047968A2 (en) 2010-10-05 2012-04-12 Genentech, Inc. Mutant smoothened and methods of using the same
US11981897B2 (en) 2013-08-09 2024-05-14 Ionis Pharmaceuticals, Inc. Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression
WO2015116902A1 (en) 2014-01-31 2015-08-06 Genentech, Inc. G-protein coupled receptors in hedgehog signaling
WO2015120075A2 (en) 2014-02-04 2015-08-13 Genentech, Inc. Mutant smoothened and methods of using the same
US10767181B2 (en) 2014-05-15 2020-09-08 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US10421967B2 (en) 2014-05-15 2019-09-24 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US11591598B2 (en) 2014-05-15 2023-02-28 Hoffmann-La Roche Inc. Oligomers and oligomer conjugates
US11872285B2 (en) 2014-07-15 2024-01-16 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
US10195280B2 (en) 2014-07-15 2019-02-05 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
US10792362B2 (en) 2014-07-15 2020-10-06 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
WO2016126972A1 (en) 2015-02-04 2016-08-11 Genentech, Inc. Mutant smoothened and methods of using the same
WO2017136558A1 (en) 2016-02-04 2017-08-10 Curis, Inc. Mutant smoothened and methods of using the same
US11400163B2 (en) 2017-01-06 2022-08-02 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US11311627B1 (en) 2017-01-06 2022-04-26 Avidity Biosciences Llc Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US11912778B2 (en) 2017-02-17 2024-02-27 Denali Therapeutics Inc. Methods of engineering transferrin receptor binding polypeptides
US11795232B2 (en) 2017-02-17 2023-10-24 Denali Therapeutics Inc. Engineered transferrin receptor binding polypeptides
US11891603B2 (en) 2017-07-21 2024-02-06 The Governors Of The University Of Alberta Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA
US11872287B2 (en) 2017-12-06 2024-01-16 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11712478B2 (en) 2017-12-06 2023-08-01 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11246941B2 (en) 2017-12-06 2022-02-15 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11497814B2 (en) 2017-12-06 2022-11-15 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11576980B2 (en) 2017-12-06 2023-02-14 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11583591B2 (en) 2017-12-06 2023-02-21 Avidity Biosciences Llc Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11554176B2 (en) 2017-12-06 2023-01-17 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11518816B2 (en) 2018-08-02 2022-12-06 Dyne Therapeutics, Inc. Methods of delivering an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy
US11795233B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11286305B2 (en) 2018-08-02 2022-03-29 Dyne Therapeutics, Inc. Complex comprising anti-transferrin receptor antibody covalently linked to an oligonucleotide that targets DUX4 RNA
US11497815B2 (en) 2018-08-02 2022-11-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11633496B2 (en) 2018-08-02 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11833217B2 (en) 2018-08-02 2023-12-05 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11111309B2 (en) 2018-08-02 2021-09-07 Dyne Therapeutics, Inc. Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4
US11248056B1 (en) 2018-08-02 2022-02-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11390682B2 (en) 2018-08-02 2022-07-19 Dyne Therapeutics, Inc. Methods of intravenouisly delivering anti-transferrin antibody/oligonucleotide complexes to subjects having muscular dystrophy
US11795234B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11834510B2 (en) 2018-12-21 2023-12-05 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
US11555190B2 (en) 2020-03-19 2023-01-17 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
US11999955B2 (en) 2020-03-19 2024-06-04 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11525137B2 (en) 2020-03-19 2022-12-13 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
US11446387B2 (en) 2020-03-27 2022-09-20 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US11707532B2 (en) 2020-03-27 2023-07-25 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11839660B2 (en) 2021-07-09 2023-12-12 Dyne Therapeutics, Inc. Anti-transferrin receptor antibody and uses thereof
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11844843B2 (en) 2021-07-09 2023-12-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11759525B1 (en) 2021-07-09 2023-09-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
US11648318B2 (en) 2021-07-09 2023-05-16 Dyne Therapeutics, Inc. Anti-transferrin receptor (TFR) antibody and uses thereof
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11672872B2 (en) 2021-07-09 2023-06-13 Dyne Therapeutics, Inc. Anti-transferrin receptor antibody and uses thereof
US11827702B2 (en) 2021-09-01 2023-11-28 Biogen Ma Inc. Anti-transferrin receptor antibodies and uses thereof
US11833221B2 (en) 2021-09-01 2023-12-05 Ionis Pharmaceuticals, Inc. Oligomeric compounds for reducing DMPK expression
WO2023034409A1 (en) 2021-09-01 2023-03-09 Biogen Ma Inc. Anti-transferrin receptor antibodies and uses thereof
US11912779B2 (en) 2021-09-16 2024-02-27 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy

Similar Documents

Publication Publication Date Title
WO1991004753A1 (en) Conjugates of antisense oligonucleotides and therapeutic uses thereof
CA1322723C (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
JP3121599B2 (en) Antisense oligonucleotide regulation of raf gene expression
Leonetti et al. Biological activity of oligonucleotide-poly (L-lysine) conjugates: mechanism of cell uptake
JP2937481B2 (en) Oligonucleotide preparation of multidrug resistance-related proteins
Stein et al. Dynamics of the internalization of phosphodiester oligodeoxynucleotides in HL60 cells
US6660255B1 (en) Inhibition of gene transcription by polyamide DNA-binding ligands
KR0178958B1 (en) Oligonucleotide modulation of cell adhesion
JPH10510435A (en) Antisense inhibition of hepatitis B virus replication
JP2023158214A (en) COMPOSITIONS AND METHODS FOR INHIBITING GENE EXPRESSION OF Hif2α
JPH10506536A (en) Stabilized external guide arrangement
US6495671B1 (en) Oligonucleotide and nucleotide amine analogs, methods of synthesis and use
WO2003008628A2 (en) Enzymatic nucleic acid peptide conjugates
EP0911400A1 (en) Antisense compounds to cd14
IL143995A (en) Anti-(retro)viral conjugates of saccharides and acetamidino or guanidino compounds and pharmaceutical compositions comprising them
MXPA01013114A (en) Conjugates and methods for the production thereof, and their use for transporting molecules via biological membranes.
Bonfils et al. Uptake by macrophages of a biotinylated oligo-. alpha.-deoxythymidylate by using mannosylated streptavidin
KR100199247B1 (en) Antisense oligonucleotide inhibition of the ras gene
IVERSEN et al. Binding of antisense phosphorothioate oligonucleotides to murine lymphocytes is lineage specific and inducible
JPH11292795A (en) Hiv cofactor inhibitor
SULLIVAN et al. Inhibition of human immunodeficiency virus-1 proliferation by liposome-encapsulated sense DNA to the 5′ TAT splice acceptor site
EP0613379B1 (en) Therapeutic compounds
US20010029035A1 (en) Oligonucleotide conjugates
CHOW et al. Specific targeting of antisense oligonucleotides to neutrophils
WO1995020404A1 (en) Triplex-forming paired-ion oligonucleotides and methods for preparing and using same

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE