WO2019107917A1 - 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법 - Google Patents

실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법 Download PDF

Info

Publication number
WO2019107917A1
WO2019107917A1 PCT/KR2018/014825 KR2018014825W WO2019107917A1 WO 2019107917 A1 WO2019107917 A1 WO 2019107917A1 KR 2018014825 W KR2018014825 W KR 2018014825W WO 2019107917 A1 WO2019107917 A1 WO 2019107917A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
gsh
glutathione
formula
Prior art date
Application number
PCT/KR2018/014825
Other languages
English (en)
French (fr)
Inventor
강흔수
김혜미
송지은
양광모
신지웅
강혜원
김용환
김명진
Original Assignee
주식회사 셀투인
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 셀투인 filed Critical 주식회사 셀투인
Priority to JP2020546265A priority Critical patent/JP7262126B2/ja
Priority to CN201880077236.1A priority patent/CN111492248B/zh
Priority to EP18884812.1A priority patent/EP3719501B1/en
Priority to US16/768,014 priority patent/US11499978B2/en
Publication of WO2019107917A1 publication Critical patent/WO2019107917A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06—Tripeptides
    • A61K38/063—Glutathione
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5076—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving cell organelles, e.g. Golgi complex, endoplasmic reticulum
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6806—Determination of free amino acids
    • G01N33/6812—Assays for specific amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6806—Determination of free amino acids
    • G01N33/6812—Assays for specific amino acids
    • G01N33/6815—Assays for specific amino acids containing sulfur, e.g. cysteine, cystine, methionine, homocysteine
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G01N2021/6439—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/7004—Stress
    • G01N2800/7009—Oxidative stress

Definitions

  • the present invention relates to a method for measuring cell quality through real-time glutathione measurement.
  • ROS Active oxygen species
  • stem cells it is defined by the expression of self-renewal capacity and specific markers.
  • the identity of the desired cell population should be defined.
  • Current hESC cell lines have been shown to contain a range of standardized metrics, such as expression of surface antigens, specific enzyme activities (such as alkaline phosphatase), gene expression, epigenetic markers, genomic stability assessments, cytology and morphology Is characterized by the absence of measurable microbiological infection using in vitro (embryonic body formation) and in vivo differentiation potential (teratoma-like xenografts formation) (Japanese Patent No. 5185443) .
  • the procedure used to evaluate these stem cell characteristics requires skilled personnel, but the information content is relatively small, time consuming and costly. In addition, it does not provide conclusive information about the safety profile and / or the suitability of the cells produced therefrom.
  • the provision of information on the quality and consistency of the stem cell line at the induction stage under continuous subculture in culture, including expansion of the cell population under conditions that support the undifferentiated cell proliferation, and accurate cell quality measurement and quality Improvement is necessary.
  • the term " Fluorescent Real-time SH group-Tracer " or " FreSH” means a compound comprising a compound represented by the following formula A or salt thereof, And is used as a fluorescent material for unlimited thiol detection.
  • the FreSH-tracer includes both compounds that are specific for and are not limited to organelles.
  • R 1 and R 2 are each independently hydrogen or C 1-4 straight chain or branched chain alkyl or heterocycloalkyl or heterocycloalkenyl wherein R 1 , R 2 and X taken together form a pentagonal or hexagonal ring;
  • R 3 is hydrogen or C 1-4 straight or branched chain alkyl;
  • R 4 and R 5 are each independently hydrogen, C 1-5 linear or branched alkyl, - (CH 2 ) m -COO-C 1-5 straight chain or branched alkyl (wherein m is an integer of 1-5)
  • R 4 , R 5 and Y together are C 3-7 heterocycloalkyl, wherein said heterocycloalkyl is unsubstituted or substituted heterocycloalkyl by R 6 ;
  • R 6 is -COO (CH 2 ) n -OCO-C 1-5 straight or branched alkyl (wherein n is an integer of 1-5), - (CONH) - (CH 2 )
  • the compound of formula B-8 is used as a GolgiFreSH-tracer and the compound of formula B-4 is used as a MitoFreSH-tracer.
  • R < 1 > is heterocycloalkyl which is a 3-7 membered ring containing one or more N.
  • ratiometric means that the output is directly proportional to the input.
  • ratio quantitative means that the composition of the present invention is directly proportional to the amount of thiol input, so that the ratio of fluorescence intensity or fluorescence intensity increases or decreases.
  • detection means measuring the presence or amount of a chemical species or biological material in a sample.
  • reversible means a state in which a mixture of reactants and products in a chemical reaction is capable of producing an equilibrium mixture.
  • thiol means an organic compound comprising a sulfhydryl group bonded to a carbon, and a sulfhydryl group or thiol group is used in combination.
  • the mitochondria of the invention are contained within a living cell.
  • the composition of the present invention is characterized not only in the mitochondria isolated from cells but also in measuring the level of thiol in the mitochondria contained in the cells in measuring the level of thiol in the mitochondria.
  • thiol levels in living mitochondria can be specifically detected.
  • the GolgiFreSH-tracer refers to a compound represented by the formula (B) as a coumarin derivative having a cyanoacrylamide electrophile, and as a fluorescent substance for detecting thiol in a Golgi apparatus in the present invention Is used.
  • the present inventors have developed a GolgiFreSH-tracer, which is a biosensor capable of quantitatively or qualitatively detecting the amount of thiol in the intracellular Golgi in real time.
  • the Golgi fluorescence real-time SH group-Tracer of the present invention represented by the formula (B-5) of the present invention showed continuous fluorescence intensities according to the amount of thiol in the intracellular Golgi, , And it has been proved that it can be usefully used as a biosensor having a remarkable sensitivity to quantitatively or qualitatively detecting the amount of thiol in the intracellular Golgi in real time.
  • the present invention provides highly sensitive and sophisticated means of determining the ability of a cell or cell line (e.g., a cell population of a cell culture) to conform to a set of predetermined criteria and to enhance the characteristics of the cell to match.
  • a cell or cell line e.g., a cell population of a cell culture
  • Traditionally in order to determine cell quality characteristics, one has to establish a microRNA profile of a cell known to the skilled person as meeting a set of pre-determined safety and / or quality standards, and compare the microRNA comparison To meet the predetermined quality and / or characteristics.
  • BSO glutathione sulfoximine
  • stem cell in the present invention means an undifferentiated cell having self-replicating ability and differentiation-promoting ability.
  • Stem cells include subpopulations such as pluripotent stem cells, multipotent stem cells, and unipotent stem cells, depending on the differentiation ability.
  • the pluripotent stem cell refers to a cell capable of differentiating into all tissues or cells constituting a living body.
  • pluripotent stem cells are not all kinds but pluripotent cells or cells having the ability to differentiate into cells.
  • the term “pluripotent stem cell” refers to a cell having an ability to differentiate into a specific tissue or cell.
  • pluripotent stem cells include embryonic stem cells (ES cells), undifferentiated germline cells (EG cells), and degenerated stem cells (iPS cells).
  • pluripotent stem cells include adult stem cells such as mesenchymal stem cells (derived from fat, bone marrow, umbilical cord or umbilical cord), hematopoietic stem cells (derived from bone marrow or peripheral blood), neural stem cells and reproductive stem cells .
  • stem cell stem cell refers to a stem cell that normally exists only in a state of low ability to divide and that only the hepatocytes are produced by the vigorous division after activation.
  • the mesenchymal stem cells (MSCs) of the present invention include human embryonic stem cell-derived mesenchymal stroma cells (hES-MSC), bone marrow mesenchymal stem cells (BM-MSC), umbilical cord mesenchymal stem cells And ADSC (Adipose Derived Stem Cell-Condensed Medium), but are not limited thereto.
  • hES-MSC human embryonic stem cell-derived mesenchymal stroma cells
  • BM-MSC bone marrow mesenchymal stem cells
  • ADSC Adipose Derived Stem Cell-Condensed Medium
  • embryonic stem cell in the present invention means a cell in which the inner cell mass of the blastocyst immediately before embryo implantation is isolated and cultured in vitro , And has pluripotency that can differentiate into cells of all tissues of an individual. Broadly, embryonic stem cells derived from embryonic stem cells are included.
  • embryonic body or embryoid body (EB) in the present invention means a chunk of spherical stem cells produced in suspension culture, potentially capable of differentiating into endoderm, mesoderm and ectoderm And is used as a precursor in the induction of most differentiation to secure tissue-specific differentiated cells.
  • the term " extract " in the present invention means a preparation which is prepared by squeezing a herbal medicine with an appropriate extract solution and evaporating the extract solution.
  • the extraction method include, but are not limited to, hot water extraction, hot water extraction, cold extraction, reflux cooling extraction, or ultrasonic extraction.
  • the extract can be prepared by extracting with an extraction solvent or extracting with an extraction solvent and fractionating the extract with a fraction solvent.
  • the organic solvent may be an alcohol having 1 to 4 carbon atoms, a polar solvent such as ethyl acetate or acetone, a solvent such as hexane or dichloromethane
  • Non-polar solvents or mixed solvents thereof may be used.
  • the amount of GSH can be measured by glutathione probe depending on the whole cell or organelle.
  • the FreSHracer of the present invention is a newly synthesized fluorescent dye capable of quickly and easily measuring the amount of live intracellular glutathione (GSH).
  • GSH glutathione
  • FreSHtracer is a small molecule probe that can be easily inserted into cells and organelles and works by binding to the thiol (-SH) group of GSH (see FIG. 1).
  • -SH thiol
  • When FreSHtrace binds to GSH it exhibits fluorescence in the wavelength range of 510 nm (F510).
  • F580 When it does not bind to GSH, it shows fluorescence in the wavelength range of 580 nm (F580).
  • the fluorescence value of F510 / F580 thus measured can be used to measure the intracellular GSH level.
  • the reaction between FreSHtracer and GSH is reversible and does not consume intracellular GSH to measure.
  • &quot Glutathione Mean Level (GM) " in the present invention refers to the average value or median value of GSH in the cultured cells using the method for measuring glutathione, to be.
  • Glutathione Heterogeneity (GH) &quot is a parameter capable of measuring the antioxidative capacity of cells by measuring the distribution pattern of GSH in the cultured cells using the method for measuring glutathione.
  • the scattering coefficient is a coefficient of variation or a robust coefficient of variation, and a method of obtaining the coefficient of variation is shown in FIG.
  • the term " Glutathione Regeneration Capacity (GRC) " in the present invention refers to the ability of GSH to be reduced to GSSG by treatment with diamide and to measure the GSH concentration of the cells in real time, It is a parameter that can objectively analyze the antioxidant capacity of cells. That is, a value obtained by monitoring the FR or F510 in real time after oxidizing agent treatment in living cells, the area under the curve (AUC) of the first oxidant-treated group, the second curve of the second oxidant-treated group, Subtracted from the third curve underline of the untreated control group minus the second curve underline of the second oxidant treatment group, and then multiplied by 100.
  • AUC area under the curve
  • the term "reversible oxidizing agent" or "first oxidizing agent” includes hydroperoxide including H 2 O 2 and tert-butyl peroxide; Thiol oxidizing agents including diamide, oxidized GSH, 5,5'-dithiobis (2-nitrobenzoic acid), maleimide, N-ethylmaleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid and iodoacetamide ; Glutathione reductase inhibitors including bis-chloroethyl nitrosoformamide; Thioredoxin inhibitors including PX-12; Mitochondrial transmembrane delivery inhibitors including antimycin A, rotenone, oligomycin and carbonyl cyanide m-chlorophenyl hydrazone; NADPH oxidase activator including phorbol 12-myristate 13-acetate; 1S, 3R-RAS-selective lethal 3 (1S,
  • the term " irreversible thiol oxidant ", " irreversible oxidant " or " second oxidant " in the present invention is a preparation that can be used to assure that any unreacted group (e.g. This can help prevent dimerization of cytotoxic agents, particularly cytotoxic agents with unreacted thiol groups (such as DM1). That is, the irreversible thiol oxidizing agent is a material for making a blank group to completely eliminate GSH.
  • maleic anhydride such as maleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid, ethylmaleimide, N-ethylmaleimide, iodoacetamide, 5,5'-dithiobis (2-nitrobenzoic acid) Aminopropionic acid, but is not limited thereto, and ethylmaleimide is preferable.
  • the quality of the stem cells can be determined by a range of GM, GH, and GRC reference values, which can be determined by comparing the values of GM, GH, and GRC of the target cells with the values of standard stem cells of the target cells.
  • " oxidizing agent " in the present invention encompasses a treatment that induces oxidative stress on cells, in addition to substances that are normally oxidized.
  • it comprises a first oxidizing agent or a second oxidizing agent.
  • " Oxidative Stress Resistance Capacity (ORC) " in the present invention refers to a value obtained by quantifying GSH level after treatment with a first oxidant in living cells.
  • GSH level is measured by a control group without oxidant treatment or a control group before oxidant treatment
  • GSH expression was calculated as the amount of fluctuated cells.
  • mGSH mitochondrial glutathione
  • the quality of the stem cells may be determined by an ORC value of 10% to 100%, preferably 30% to 90%, more preferably 40% to 90%.
  • " oxidative stress " in ORC means adding a first oxidizing agent to the cell.
  • the present invention relates to a method for screening a target cell, Measuring the level of glutathione in the separated cells; And determining the cell quality according to the level of glutathione, wherein the step of determining the cell quality according to the level of glutathione is at least one of the following evaluation parameters: i) Glutathione Mean or Median (Glutathione Mean Level, GM); ii) Glutathione Heterogeneity of cells (GH); iii) Glutathione Regeneration Capacity (GRC) of cells; And iv) Oxidative Stress Resistance Capacity (ORC), wherein GM is calculated as the mean or median value of cell FR (FreSHtracer Ratio) or F510, and GH is the coefficient of variation of cell FR or F510 Coefficient of variation or robust coefficient of variation.
  • Glutathione Mean or Median Glutathione Mean Level, GM
  • GH Glutathione Heterogeneity of cells
  • GRC Gluta
  • GRC is a value obtained by monitoring FR or F510 in real time after oxidative treatment of living cells.
  • the first curve of the first oxidant treatment group the value obtained by subtracting the second curve lower limit of the second oxidant treatment group from the third curve lower limit of the untreated control group was subtracted from the second curve lower limit of the second oxidant treatment group and then multiplied by 100
  • ORC is a value obtained by quantifying GSH level after first oxidizing agent treatment in living cells. GSH level is compared with control cell not treated with first oxidizing agent or before treatment with first oxidizing agent Wherein the GSH expression is calculated as a fluctuating amount of cells.
  • the level of glutathione is measured by adding the following formula A or B to measure the level of glutathione:
  • R 1 and R 2 are each independently hydrogen or C 1-4 straight chain or branched chain alkyl or heterocycloalkyl or heterocycloalkenyl wherein R 1 , R 2 and X taken together form a pentagonal or hexagonal ring;
  • R 3 is hydrogen or C 1-4 straight or branched chain alkyl;
  • R 4 and R 5 are each independently hydrogen, C 1-5 linear or branched alkyl, - (CH 2 ) m -COO-C 1-5 straight chain or branched alkyl (wherein m is an integer of 1-5)
  • R 4 , R 5 and Y together are C 3-7 heterocycloalkyl, wherein said heterocycloalkyl is unsubstituted or substituted heterocycloalkyl by R 6 ;
  • R 6 is -COO (CH 2 ) n -OCO-C 1-5 straight or branched alkyl (wherein n is an integer of 1-5), - (CONH) - (CH 2 )
  • R < 1 &gt is heterocycloalkyl which is a 3-7 membered ring containing one or more N.
  • the formula (A) or (B) is any one of the following formulas A-2 to A-6, B-2 to B-8.
  • the FR is the ratio of fluorescence intensity (F510) at 430-550 nm and fluorescence intensity (F580) at 550-680 nm.
  • the higher the average or median glutathione concentrations of the cells before or after the treatment of oxidative stress the better the quality.
  • the quality of the glutathione distribution (Glutathione Heterogeneity, GH) of the cells before or after treatment with oxidative stress is of the highest quality.
  • the Oxidative Stress Resistance Capacity is such that the amount of GSH measured in the oxidant treatment is reduced compared to the amount of GSH in the control cells without oxidant treatment or control cells before the oxidant treatment.
  • the higher the number of cells the higher the amount of GSH or the amount of GSH of the control cells before the treatment with the oxidizing agent or the control cells before the treatment with the oxidizing agent, the better the quality.
  • the first oxidant is selected from the group consisting of hydroperoxide including H 2 O 2 , and tert-butyl peroxide;
  • Thiol oxidizing agents including diamide, oxidized GSH, 5,5'-dithiobis (2-nitrobenzoic acid), maleimide, N-ethylmaleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid and iodoacetamide ;
  • Glutathione reductase inhibitors including bis-chloroethyl nitrosoformamide;
  • Thioredoxin inhibitors including PX-12;
  • Mitochondrial transmembrane delivery inhibitors including antimycin A, rotenone, oligomycin and carbonyl cyanide m-chlorophenyl hydrazone;
  • NADPH oxidase activator including phorbol 12-myristate 13-acetate; 1S, 3R-RAS-selective lethal 3 (1S
  • the second oxidant is selected from the group consisting of maleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid, ethylmaleimide, N- ethylmaleimide, iodoacetamide, 5,5'-dithiobis 2-nitrobenzoic acid), or iodoacetamidopropionic acid.
  • the target cell is any one selected from the group consisting of adult stem cells, embryonic stem cells, and induced pluripotent stem cells; (T cells), T cells (natural killer T cells), T cells (natural killer cells, T cells), dendritic cells, natural killer cells, T cells, B cells, regulatory T cells cells, innate lymphoid cells, macrophages, granulocytes, chimeric antigen receptor-T cells (CAR-T), lymphocytic active kill cells LAK: Lymphokine-activated killer Cell) and cytokine-induced killer cell (CIK: Cytokine Induced Killer Cell);
  • the present invention relates to a method for the treatment of fibroblast, chondrocyte, synovial cell, keratinocyte, adipocyte, osteoblast, osteoclast and peripheral blood mononuclear cells (peripheral a blood mononuclear cell (Somatic cell);
  • a cell line used for production of a protein preparation selected from the group consisting of CHO cells,
  • the FreSHtracer and evaluation parameters according to the present invention are used to monitor the intracellular GSH level of living stem cells in real time and to differentiate cells according to the level of GSH, to measure the quality of the cell therapeutic agent, To a novel method.
  • FIG. 1 shows the results of a reversible reaction of FreSH-tracer reversibly reacting with glutathione (GSH) (FIG. 1A), a reversal reaction of FreSH-tracer by UV visible light absorption spectrum (FIG. 1B) 1C) monitoring the fluorescence emission spectrum of the FreSH-tracer generated by excitation in each of them at 510 nm (F510) and 580 nm (F580), and graphically showing the results of FIG. 1C ) And F510 / F580 (FR), and shows the emission ratio (Fig. 1e) adjusted to the increased concentration of GSH.
  • GSH glutathione
  • FIG. 2 is a graph showing a step of FACS sorting hBM-MSC with F510 / F580 (FR).
  • FIG. 3 is a graph showing that the FreSH-Tracer is removable from the cells.
  • the cells stained with FreSH-Tracer were washed and cultured in a new culture medium, and then subjected to FACS analysis (FIG. 3A) ).
  • FIG. 4 shows CFU-F (FIG. 4A) and migration activity (FIG. 4B) of SDF-1alpha and PDGF-AA of hBM-MSC isolated from FASC based on FreSH-tracer.
  • Figures 5A-5F show the anti-aging activity of fibroblasts isolated by FreSH-tracers.
  • Figure 6 shows the activity of dendritic cells isolated by FreSH-tracers.
  • Figure 7 shows the activity of Treg cells in T cells isolated by FreSH-Tracer.
  • Figure 8 schematically shows four glutathione parameters, derivation equations, and the resulting results for therapeutic cell quality assessment.
  • FIG. 9 shows CFU-F analysis (FIG. 9a) and migration ability to SDF-1alpha and PDGF-AA (FIG. 9b) according to the passage culture of hBM-MSC.
  • Figures 10a-c show the results of analysis of FreSH-tracer, GolgiFreSH-tracer, and MitoFreSH-tracer based GM and GH according to subculture of hBM-MSC.
  • Figure 11 shows the results of analysis of FreSH-tracer, GolgiFreSH-tracer and MitoFreSH-tracer based GRC according to the passage culture of hBM-MSC.
  • FIG. 12 shows the results of analysis of GM and GH based on MitoFreSH-tracer after separating rat bone marrow cells according to the lineage.
  • Figure 13 shows the results of treatment of BSO or GSH-EE with either FACS-separated hES-MSC (Figure 13a) or hES-MSC ( Figure 13b) cultured without isolation using FreSH- -AA (Fig. 13B).
  • 14A to 14C show results of analysis of GRC based on FreSH-tracer after hUC-MSC was subcultured three times into culture containing AA2G.
  • FIGS. 15A and 15B are results of analyzing FreSH-tracer-based ORC after subculturing hUC-MSC three times in culture medium containing AA2G.
  • FIG. 16A is a photograph showing the result of CFU-F assay performed by treating hUC-MSC with 125 ⁇ g / mL of AA2G (left image) or 250 ⁇ g / mL (right image) for 3 days.
  • 17A is a photograph showing the migration ability of hUC-MSC by PDGF-AA treated with 125 ⁇ g / mL or 250 ⁇ g / mL of AA2G for 3 days.
  • GGC gamma-glutamylcysteine
  • STI571 was used as a PDGFR kinase inhibitor.
  • STI571 was used as a PDGFR kinase inhibitor.
  • STI571 was used as a PDGFR kinase inhibitor.
  • FIG. 21 is a graphical representation of an experimental step of screening for a substance that modulates GSH of cells through analysis of GM, GH, and ORC.
  • Figures 22A-22B show the results of ORC analysis of lipoclostatin-1 in hUC-MSC.
  • Figures 23A-23C show the results of analysis of GM, GH, and ORC of vitamin D3 in hUC-MSC.
  • 25A to 25E are the results of analyzing GM, GH, and ORC of flavonoids in hUC-MSC.
  • Figure 25A shows the results of GM, GH, and ORC analysis of bicalin in hUC-MSC.
  • Figure 25B shows the results of GM, GH, and ORC analysis of Baikal lane in hUC-MSC.
  • Figure 25C shows the results of GM, GH, and ORC analysis of rheuorin in hUC-MSC.
  • Figure 25D shows the results of GM, GH, and ORC analysis of quercetin in hUC-MSC.
  • Figure 25E shows the results of GM, GH, and ORC analysis of butane in hUC-MSC.
  • 26A to 26E show the results of analysis of GM, GH, and ORC of plant extracts in hUC-MSC.
  • FIG. 26A shows the results of GM, GH, and ORC analysis of chrysanthemum flower extracts in hUC-MSC.
  • Figure 26B shows the results of GM, GH, and ORC analysis of leather tree leaf extract in hUC-MSC.
  • Figure 26C shows the results of GM, GH, and ORC analysis of the evening primrose extract in hUC-MSC.
  • FIG. 26 (d) shows the results of GM, GH, and ORC analysis of the hunter extract in hUC-MSC.
  • Figure 26E shows the GM, GH, and ORC analysis of sweet potato leaf extract in hUC-MSC.
  • Figure 26f shows the GM, GH, and ORC analysis of tomato extract (LYCOBEADS®) in hUC-MSC.
  • 29 is a histogram of flow cytometry analysis of mGSH expression levels for cells corresponding to subculture 4, 7, 15.
  • Figure 30 is a histogram of Confocal imaging histogram of mGSH expression levels for cells in subculture 4, 7, and 15.
  • FIG. 31 shows the distribution profile of mGSH high cell and low cell according to the number of stem cell cultures and RSL3 concentration.
  • FIG. 32 shows the results of confirming the lipid oxide dependency of the effect of RSL3 treatment on mesenchymal stem cells through ferrostatin-1 treatment.
  • FIG. 33 shows the results of CD196 surface expression of mGSH High and Low cells after RLS3 treatment.
  • FIG. 34 shows the distribution patterns of mGSH high cell and low cell according to the degree of passage of fibroblasts.
  • the FreSHtracer and evaluation parameters according to the present invention can be used to monitor the intracellular GSH level of living stem cells in real time and to differentiate cells according to the level of GSH and to measure the quality of the cell therapeutic agent and to evaluate its quality .
  • R 1 and R 2 are each independently hydrogen or C 1-4 straight chain or branched chain alkyl or heterocycloalkyl or heterocycloalkenyl wherein R 1 , R 2 and X together form a pentagonal or hexagonal ring ego;
  • R 3 is hydrogen or C 1-4 straight or branched chain alkyl;
  • R 4 and R 5 are each independently hydrogen, C 1-5 linear or branched alkyl, - (CH 2 ) m -COO-C 1-5 straight chain or branched alkyl (wherein m is an integer of 1-5)
  • R 4 , R 5 and Y together are C 3-7 heterocycloalkyl, wherein said heterocycloalkyl is unsubstituted or substituted heterocycloalkyl by R 6 ;
  • R 6 is -COO (CH 2 ) n -OCO-C 1-5 straight or branched alkyl (wherein n is an integer of 1-5), - (CONH) - (CH 2
  • the compound of formula (A) is a compound selected from the group consisting of compounds of formulas (A-1) to (A-6)
  • the FreSH-tracer used the compound of formula A-1 above.
  • a 3-7-membered ring is heterocycloalkyl that R 1 in the general formula B comprises at least one N, wherein the heterocycloalkyl and the substituent R 2 is bonded;
  • x is an integer of 1-4.
  • R < 1 > of the present invention is a 6-membered ring heterocycloalkyl containing 1 or 2 N atoms.
  • the term " 6-membered ring " included in the term “ 6-membered ring heterocycloalkyl " in the present invention refers to a monocyclic compound such as a bicyclic compound or a spiro compound, &Quot; Heterocycloalkyl " refers to a non-aromatic cyclic alkyl wherein at least one of the carbon atoms contained within the ring is replaced by a heteroatom such as nitrogen, oxygen, or sulfur Substituted "
  • R 1 is comprising one or two nitrogen as a six-membered ring heterocycloalkyl containing as the heteroatom in the ring.
  • the compound of formula (B) for use in the MitoFreSH-tracer is a compound selected from the group consisting of compounds represented by formulas (B-2) to (B-4)
  • the MitoFreSH-tracer used the compound of formula B-4 above.
  • R 4 (CH 2) p- (OCH 2 CH 2 O) q- (CH 2) r, or - (CH 2 CH 2) s- compound (wherein p, q, r, s is an integer of 1-5). More specifically, in the general formula B-5 R 4 is (OCH 2 CH 2 O) - , - (CH 2 CH 2) -, and - (CH 2 (0CH 2 CH 2) 2 OCH 2) - which of It is one.
  • the compound represented by the above formula (B-5) for use in the GolgiFreSH-tracer is a compound selected from the group consisting of the compounds represented by the formulas (B-6) to (B-8)
  • GolgiFreSH-tracer used the compound of formula B-8 above.
  • the compound A or B or the composition containing the same according to the present invention it is possible to measure the antioxidant activity of mitochondria or Golgi, which is an intracellular organelle of all cells including stem cells, Active cell sorting is possible. Measurement of cell activity using the composition of the present invention includes, but is not limited to, measuring antioxidant activity.
  • a compound represented by the formula (A) or (B) Mixtures of racemates, optical isomers, diastereoisomers, mixtures of optical isomers, or mixtures of diastereomers; A composition for measuring the antioxidative capacity of an intracellular organelle containing a pharmaceutically acceptable salt thereof as an active ingredient.
  • the FreSH-tracer was used to measure the cell activity of the live cells, and the following experimental conditions were established in order to isolate cells with high cell activity.
  • HBM-MSC human bone marrow mesenchymal stem cell, purchased from Lonza
  • hUC-MSC human umbilical cord mesenchymal stem cell
  • HES-MSC human embryonic stem cell-derived mesenchymal stem cell, purchased from the laboratory of Professor Jeong, Hyungmin of Konkuk University
  • the FreSH-tracer used the compound of the above formula A-1
  • the MitoFreSH-tracer used the compound of the following formula B-4
  • the GolgiFreSH-tracer used the following formula B-8.
  • Example 2 Isolation of live cells according to FreSH-tracer-based GSH concentration using FACS
  • HBM-MSC stem cells were seeded in a culture medium (MSCGM Bullet Kit; Lonza # PT-3001) at a density of 1 ⁇ 10 3 cells / cm 2 and after 3 days, cells were cultured for 1.5 hours in a culture medium containing 2 ⁇ M FreSH Respectively.
  • DPBS WELGENE # LB 001-02
  • the TrypsinLE gibco # 12604-013 solution was treated to desorb the cells and then trypsin was inactivated with fresh medium containing 2 ⁇ M FreSH. Thereafter, the cells were centrifuged at 1800 rpm for 10 minutes at 4 DEG C, and then the cells were resuspended in a fresh medium containing 2 mu M FreSH.
  • FACS Fluorescence phosphate
  • the F510 / F580 ratio in the following FACS instruction conditions (BD ARIAIII, wavelength 405 (for F510 measurement) and 488 (for F580 measurement) laser, nozzle size 100 ⁇ m, 2,000-3,000 events / sec) And 3.9-35% of the upper 3.9-35% were subjected to FACS separation by gating.
  • Human diploid fibroblast (HDF) isolated from the foreskin of a human penis was made into an aged old cell (p32) [replicative aging model according to pass passage] (Phenol red free) DMEM (Dulbecco's Modified Eagle's Medium) containing 10% fetal bovine serum containing 2 ⁇ M FreSH and 1% penicillin-streptomycin ) ≪ / RTI > medium for 2 hours. After 2 hours, the cells were washed 2 times with PBS, treated with TrypsinLE (Invitrogen) solution to desorb the cells, and trypsin was inactivated with fresh medium, and then left on ice for 5 minutes.
  • PBS Human diploid fibroblast
  • the cells were centrifuged at 1000 rpm for 10 minutes at 4 DEG C, and then the cells were resuspended in a fresh medium containing 2 mu M FreSH at a density of 2 x 10 < 7 > cells / ml.
  • DPBS WELGENE #LB 001-02
  • nucleated cells were isolated by density gradient separation method using Ficoll-Paque Plus (GE Healthcare, 17-1440-02) do.
  • the number of isolated cells was confirmed, and 90 ⁇ L of 2% FBS-containing DPBS and 10 ⁇ L of CD14 MicroBead (Milteny biotech # 130-050-201) per 1 ⁇ 10 7 cells were added and reacted at 4 ° C. for 15 minutes CD14 + monocyte was isolated using LS column.
  • 1x10 6 cells per well were seeded in 2 mL of dendritic cell differentiation medium (RPMI 1640, 2 mM L-Glutamine, 10% FBS, 1% penicillin-streptomycin, 100 ⁇ M ß- mercaptoethanol, 20 ng / mL hGMCSF, 20 ng / mL IL- 4) for 6 days. After 6 days, the dendritic cells that had been differentiated were regarded as immature dendritic cells and mature dendritic cells were cultured by treatment with 0.5 ⁇ g / mL LPS for 24 hours.
  • RPMI 1640 2 mM L-Glutamine, 10% FBS, 1% penicillin-streptomycin, 100 ⁇ M ß- mercaptoethanol, 20 ng / mL hGMCSF, 20 ng / mL IL- 4
  • the cells were labeled with FreSH-containing medium as in Example 2-3.
  • CD3 antibody (Biolegend # 100340) was coated on a 24-well plate for 4 hours at 37 ° C and washed with DPBS.
  • FreSH was added to the culture medium to a final concentration of 2 ⁇ M and the cells were labeled for 2 hours. After centrifugation at 4 ° C.
  • the cells were cultured in a fresh medium containing 2 ⁇ M FreSH at a density of 2 ⁇ 10 7 cells / And resuspend.
  • the cells were then separated into three cell groups according to the F510 / F580 ratio under the following FACS Instruction conditions (BD ARIAIII, wavelength 405 (for F510 measurement) and 488 (for F580 measurement) laser, nozzle size 70 M).
  • HES-MSC stem cells at a density of 3x10 6 cells / ml were seeded in 150 pi tissue culture media, and after 12 hours, they were washed twice with 30 ml of PBS and then treated with EGM- Cells were labeled with 2 MV medium for 2 hours. After 2 hours, the cells were washed 2 times with PBS containing 2 ⁇ M FreSH, treated with TrypsinLE (Invitrogen) solution to desorb the cells, and then trypsin was inactivated with fresh EGM-2 MV medium containing 2 ⁇ M FreSH.
  • TrypsinLE Invitrogen
  • the cells were centrifuged at 2000 rpm for 20 minutes at 4 DEG C, and the cells were resuspended in a new EGM-2 MV medium containing 2 ⁇ M FreSH at a density of 5 ⁇ 10 7 cells / ml.
  • a new EGM-2 MV medium containing 2 ⁇ M FreSH at a density of 5 ⁇ 10 7 cells / ml.
  • PBS containing 2 [mu] M FreSH (diluted by about 1 ml at a time to maintain 4 [deg.] C).
  • F510 / F580 ratios were then calculated for the total number of cells in the following FACS instruction conditions (BD ARIAIII, wavelength 405 (for F510 measurement) and 488 (for F580 measurement) laser, nozzle size 100 ⁇ M, 2,000-3,000 events / sec) And 3.9-35% of the upper 3.9-35% were subjected to FACS separation by gating.
  • CFU-F colony forming unit-fibroblast
  • engraftment rate the main factors determining the therapeutic efficacy of hBM-MSC stem cells
  • GSH GSH High Low cells are cells Lt; / RTI > (Fig. 4B).
  • Human diploid fibroblast (HDF) prepared by separating from the foreskin of a human penis was classified into a young cell (p6) and an aged cell (p32) (replicative aging model according to pass passage) GSH level was measured using Promega's GSH / GSSG-Glo TM assay kit, and GSH level of young cells was reduced by about 44% as compared to aged cells (FIG. 5A).
  • the human fibroblasts were separated into GSH High and GSH Low fibroblasts by the method of Example 2-2.
  • GSH Low cells showed 1.5 times larger than GSH High cells, and according to the existing announcement that the cell size (FSC, Forward scattering) increases with aging (Refer to Reference 1) (Fig. 5B).
  • FSC Forward scattering
  • Fig. 5B the cell size
  • DHR123 Dihydrorhodamine 123
  • the antibodies against various surface proteins related to the immune activity of human monocyte-derived dendritic cells were simultaneously stained with FreSH Tracer and analyzed by flow cytometry to determine GSH High (upper 0.2-30.2% cell), GSH Mid (upper 30.2-62.5% cell) And GSH Low (lower 0.3-32.7% cell group) were gated and the expression level of surface protein in each cell group was confirmed.
  • GSH High upper 0.2-30.2% cell
  • GSH Mid upper 30.2-62.5% cell
  • GSH Low lower 0.3-32.7% cell group
  • Rat T lymphocytes were activated with CD3 and CD28 antibodies and then separated into three experimental groups according to GSH concentration using FreSHtracer.
  • To the separated T cells foxp3 mRNA level extracting mRNA and a transcription factor expressed in Treg cells specific using Trizol (Invitrogen # 15596026) was analyzed by the RQ-PCR, GSH High, GSH Low as compared to GSH Mid (Fig. 7). This suggests that the presence of Treg cells in GSH-high T cells is low.
  • Example 4 Establishment of evaluation parameters for quality evaluation of FreSH-tracer-based cell therapy agent
  • Each of the four types of cells has an average value (or median) of Glutathione Mean Level (GM) and Glutathione Heterogeneity (GH), Glutathione Regeneration Capacity (GRC), Oxidative Stress Resistance Capacity (ORC) to be.
  • GM Glutathione Mean Level
  • GH Glutathione Heterogeneity
  • GRC Glutathione Regeneration Capacity
  • ORC Oxidative Stress Resistance Capacity
  • GM is calculated as an average value or a median value of the cell FRs.
  • GH is calculated by the coefficient of variation of the cell FR or the robust coefficient of variation.
  • GRC is a value obtained by monitoring FR in real time after oxidizing agent treatment on living cells. It is an area under the curve (AUC) of oxidizing agent (diamide, H 2 O 2, etc.) Minus the AUC of the maleimide (NEM) treated group, divided by the AUC of the control group without any treatment, minus the AUC of the NEM treated group, and then multiplied by 100.
  • the FR of the NEM-treated group is a value to increase the sensitivity of the GRC value by treating the blank value of the cell FR.
  • ORC was treated with 0.5 ⁇ M or 1 ⁇ M of glutathione peroxidase 4 (GPX4) inhibitor RSL3, an oxidizing agent, in live hUC-MSC and incubated at 37 ° C for 2 hours. After the medium containing RSL3 was removed, 100 ⁇ l of 15 ⁇ M Mito-FreSHtracer was added and cultured at 37 ° C. for 1 hour.
  • HBSS Woods' Balanced Salt Solution
  • 10 mM HEPES was used as a medium used at this time.
  • CFU-F colony-forming unit-fibroblasts
  • migration performance were analyzed according to passage number (P) of hBM-MSC subculture in order to confirm the relationship between the above-mentioned glutathione evaluation parameters and stem cell quality.
  • P passage number
  • the hBM-MSC of p4.5 was significantly higher than the hBM-MSC of p9.5 (Fig. 9a) and the SDF-1a (angiogenic factor) or PDGF-AA (platelet- (Fig. 9B).
  • the glutathione evaluation parameters of stem cells were compared and analyzed using FreSH-tracer for cell-wide glutathione measurement and GolgiFreSH-tracer and MitoFreSH-tracer specific for Golgi and mitochondria, respectively (FIG.
  • the mean value of FR and Mito-FR in hBM-MSC were significantly lower in GM subculture, but the mean value of Golgi-FR did not change significantly (FIG. 10b).
  • the FR rCV value and the Mito-FR rCV value were significantly increased in hBM-MSC, but the Golgi-FR rCV value was not significantly changed as the subculture of GH was higher (FIG. 10C).
  • the FR-based% GRC and Mito-FR-based% GRC decreased by the diamide treatment in hBM-MSC, but the GRC based GRC was not changed. This suggests that the quality of stem cells correlates positively with the FreSH-tracer and MitoFreSH-tracer-based GM and GRC, and that the FreSH-tracer and the MitoFreSH-tracer-based GH show an inverse correlation.
  • the MitoFreSH-tracer-based glutathione evaluation parameter was found to be highly sensitive to stem cell quality.
  • Butohionine sulfoximine (GSH-EE) and glutathione ethyl ester (GSH-EE) were tested by FreSH-EE to test whether direct GSH regulation of stem cells results in changes in cell function.
  • BSO or GSH-EE was treated with hES-MSC not separated by FreSH-tracer, cell migration ability to PDGF-AA decreased or increased (Fig. 13B).
  • hUC-MSC antioxidants ascorbic acid 2-glucoside
  • N naive cell population of the tracer FreSH- based ORC GSH compared to High
  • the present inventors treated each stem cell with a substance that improved the glutathione evaluation parameter, and observed the effect of the substance on stem cells.
  • human umbilical cord mesenchymal stem cells hUC-MSC
  • a medium containing L-ascorbic acid 2-glucoside AA2G
  • CFU-F Effect was observed.
  • hUC-MSC was cultured with gamma-glutamyl cysteine (GGC, 0.1, 0.25, and 0.5 mM), a precursor of glutathione.
  • STI571 was used as a PDGFR kinase inhibitor. As shown in FIGS. 20A to 20C, it was confirmed that the migration ability was enhanced by SDF1alpha and PDGF-AA as the GCC treatment concentration was increased.
  • ORC as shown in Figure 21, to prepare the living cells, were each inoculated with a 3 ⁇ 10 3 cells to the wells.
  • ⁇ -MEM medium was treated with 10% fetal bovine serum, 1 ⁇ penicillin-streptomycin. Materials that could raise the level of glutathione were treated.
  • the medium used was HBSS (Hanks' Balanced Salt Solution) containing 10 mM HEPES.
  • the present inventors have found that leaf as materials that can increase the level of glutathione in the hUC-MSC lock -1 statins, vitamin D3, vitamin E, flavonoids series of Baikal Lin, Baikal lane, Lu Theo Lin, quercetin, retain part, plant extracts of chrysanthemum
  • the ORC was analyzed by treating flower extracts, leather tree leaf extract, evening primrose extract, potato extract, sweet potato leaf extract, and tomato extract (LYCOBEADS®) (see FIGS. 22A to 26F ).
  • the concentrations of lipoprotein-1 were treated at 0, 2.5, 5, and 10 ⁇ M
  • RSL3 was treated at 0, 0.5, and 1 ⁇ M, respectively.
  • HUC-MSC was also cultured with ferrostatin-1 (0.2, 1, 2, 4 ⁇ M) and liprostatin-1 (0.1, 0.5, 1, 2 ⁇ M), which suppresses lipid oxidation and regulates intracellular glutathione levels. As shown in Fig. 27, it was confirmed that CFU-F was improved. On the other hand, hUC-MSC was treated with 1 ⁇ M ferrostatin-1 for 24 hours, treated with 0.2 mM GGC for 2 hours, and treated with 2 mM GSH-EE for 2 hours. From this, it was observed that lowering of T-cell proliferative capacity and lowering of T-cell differentiation ability, and promotion of Treg cell differentiation was observed. Materials such as ferrostatin-1 and liprostatin-1 showed no change in the anti-inflammatory effect of hUC-MSC as shown in Figs. 28a to 27c. This confirms that substances that improve glutathione evaluation parameters improve therapeutic stem cell function.
  • the inventors of the present invention have confirmed the cartilage regeneration effect according to the stem cell antioxidant ability in an animal model of osteoarthritis.
  • Rats with ruptures of the anterior cruciate ligament (ACL) and induced osteoarthritis were prepared.
  • HES-MSC (2 x 10 < 5 >) which was subcultured three times in a culture medium containing AA2G (250 g / mL), was injected into the joints.
  • Fig. 29 (a) it was confirmed that cartilage regeneration efficacy was remarkably improved in high GSH MSC when compared with general stem cells.
  • a joint tissue implanted with hES-MSC (2 x 10 5 ) as described above was prepared and stained with H & E and Safranin-O (FIG. 29B).
  • joint tissues injected with hES-MSC (2 x 10 5 ) as described above were prepared, and type II collagen was immunostained (Fig. 29C). GAG and type II collagen (type II collagen). This confirms that the glutathione parameter improving substance improves the therapeutic effect of the stem cell disease.
  • the cells were treated with various concentrations of RSL3 at various concentrations in hUC-MSC passaged cultures 4, 7, and 15 cultured in this laboratory, and stained with Mito-FreSH, followed by flow cytometry and confocal imaging to measure mitochondrial GSH (mGSH ) Were examined through histograms.
  • hUC-MSC human umbilical cord-derived mesenchymal stem cells
  • 7 and 15 70000 cells per well were added to a 6-well cell culture plate, Time.
  • the medium used here contained 10% fetal bovine serum and 1 ⁇ penicillin-streptomycin in ⁇ -MEM.
  • RSL3, a glutathione peroxidase 4 (GPX4) inhibitor was added at a concentration of 0.1 / 0.5 / 1 ⁇ M and incubated at 37 ° C for 1.5 hours.
  • the medium used here contained 10% fetal bovine serum and 1 ⁇ penicillin-streptomycin in ⁇ -MEM.
  • Mito-FreSHtracer was added and incubated at 37 ° C. for 1.5 hours.
  • the medium used here contained 10% fetal bovine serum and 1 ⁇ penicillin-streptomycin in ⁇ -MEM.
  • the cells were washed twice with 2 mL of DPBS.
  • the cells were reacted at 37 ° C. for 2 minutes and 30 seconds, and the cells were then removed from the plate by adding the same amount of DPBS containing 2% FBS. Cells removed from the plate were transferred to a FACS tube and stored on ice. Fluorescence values were measured using a flow cytometry instrument.
  • hUC-MSC human umbilical cord-derived mesenchymal stem cells
  • the medium used here contained 10% fetal bovine serum and 1 ⁇ penicillin-streptomycin in ⁇ -MEM. After the medium containing RSL3 was removed, 100 ⁇ l of 15 ⁇ M Mito-FreSHtracer was added and cultured at 37 ° C. for 1 hour.
  • the medium used was HBSS (Hanks' Balanced Salt Solution) containing 10 mM HEPES. To remove Mito-FreSHtracer on the medium before measurement, the medium was exchanged with HBSS containing 10 mM HEPES, and fluorescence images were measured using a confocal image equipment operator.
  • Fluorescence values of F510 (Mito-FreSHtracer binding to SH group) and F580 (Mito-FreSHtracer, self-fluorescence value without binding SH) in each cell were measured and the fluorescence value of F510 divided by F580 The value was determined as the F510 / F580 ratio value, which means the intracellular GSH mean value.
  • the F510 / F580 ratio value of each cell using the prism 5 program is plotted on the X-axis and the amount of cells corresponding to the F510 / F580 ratio value is represented by the Y-axis histogram. All samples were analyzed for Alexa 430 / PE (F510 / F580) parameters using Flowjo software to analyze flow cytometry. The histogram showing the distribution of F510 / F580 was divided into two peaks, GSH High ) And Low cell (left peak), and the percentage of the corresponding cells was expressed as%
  • the green-looking cells are mGSH-retaining cells and the yellow-looking cells are mGSH-reduced cells.
  • the yellow cells are larger and larger than the green cells in the same cells.
  • the treatment with Ferrostatin-1 disappeared the effect of RSL3, which is a result of dependence on lipid oxidation stress (FIG. 32).
  • Cells are stained in the same manner as the mitochondrial GSH level measurement using flow cytometry described above, and trypsin is used to remove the cells from the plate.
  • the detached cells were treated with an antibody for flow cytometry analysis of CD146 conjugated with the fluorescent substance BUV395 at 4 ° C for 30 minutes, followed by washing with PBS.
  • Flow cytometry was used to measure the F510 and F580 fluorescence values for GSH level measurement and the BUV395 fluorescence values for CD146 expression measurement. Then, using the FlowJo software, the histogram showing the distribution of F510 / F580 is divided into two peaks, GSH High (right peak) and Low cell (left peak), and the CD146 positive ratio %.
  • the FreSHtracer and evaluation parameters according to the present invention can be used to monitor the intracellular GSH level of living stem cells in real time and to differentiate cells according to the level of GSH and to measure the quality of the cell therapeutic agent and to evaluate its quality .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Biophysics (AREA)
  • Optics & Photonics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Developmental Biology & Embryology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 실시간 글루타치온 측정을 통하여 치료용 세포의 품질을 측정하는 방법을 제공하는 것이다.

Description

실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법
본 발명은 실시간 글루타치온 측정을 통한 세포 품질 측정하는 방법에 관한 것이다.
인체는 항산화계의 작용을 통해 활성 산소종을 적절히 제거하여 항상성을 유지하나, ROS 생성과 항산화계 작용 사이의 균형이 깨지면 산화적 스트레스(oxidative stress)가 증가하고, 이는 노화를 비롯하여 퇴행성 관절염, 백내장, 알쯔하이머 등의 노화 관련 퇴행성 질환, 각종 암, 섬유화 질환을 비롯하여 최근에는 당뇨병, 비만, 심혈관 질환 등의 대사성 증후군의 발병에 중요한 공통 원인 인자로 주목받고 있다. 상기 ROS는 불안정하고 반응성이 높아 생체 분자를 산화시켜 생화학적, 생리적 손상을 유발시키고 이는 노화의 주요 기전 중 하나이다. 따라서 인체의 산화도 뿐 아니라 항산화도나 항산화 능력은 생체 나이 계측에 주요한 바이오 마커가 될 수 있다.
활성산소종(ROS)은 세포 대사, 증식 및 생존을 조절하는 중요한 신호 분자이다. ROS의 증가는 신호전달 단백질 상의 시스테인 잔기의 티올 산화를 유도하여, 세포 기능을 조절하기 위한 단백질 활성의 변화를 가져온다. 특히, ROS 매개 산화는 OCT4, NRF2, FoxOs, APE1/Ref-1, ATM, HIF-1, p38, 및 p53를 포함하여 자가 재생 능력, 다능성, 생존력 및 게놈 안정성에 영향을 미치는 줄기세포(SC)의 다양한 신호 단백질을 조절하는데 중요한 역할을 한다(Wang et al., 2013).
한편, 줄기세포 및 세포 배양물의 품질, 일관성 및 효능을 평가하는데 이용되는 다수의 방법이 있다. 줄기세포의 경우, 자가-재생능(self-renewal capacity) 및 특이적 마커의 발현에 의해 정의된다. 원하는 세포군의 동일성이 정의되어야 한다. 현 hESC 세포주는 일련의 표준화된 메트릭스(metrics), 즉 표면 항원, 특정 효소 활성(예컨대, 알칼리성 포스파타제)의 발현, 유전자 발현, 후생유전학적 마커(epigenetic markers), 게놈 안정성 평가, 세포학 및 형태뿐만 아니라 시험관내(배아체 형성) 및 생체내 분화 잠재성(테라토마계 이종이식류(teratoma-like xenografts) 형성)을 이용하여(일본 등록특허 제 5185443호), 측정가능한 미생물학적 감염의 부재에 의해 특성화된다. 그러나, 이들 줄기세포 특성을 평가하는데 이용되는 절차는 숙련된 인원을 필요로 하나 정보 내용이 상대적으로 적고 시간 소비적이며 비용이 많이 든다. 게다가, 안전성 프로파일 및/또는 이로부터 생성된 세포의 목적 적합성에 관한 결정적인 정보를 보여주지 못한다. 줄기세포의 경우, 미분화 세포의 증식을 지원하는 조건 하에 세포군의 확장을 포함하여, 배양에 있어서 계속적인 계대배양 하에 유도 단계의 줄기세포주의 품질 및 일관성에 관한 정보의 제공 및 정확한 세포 품질 측정 및 품질 향상이 필요한 실정이다.
본 발명의 목적은 실시간 글루타치온 측정을 통하여 치료용 세포의 품질을 측정하는 방법을 제공하는 것이다. 또한, 본 발명은 세포를 특성화하고 및/또는 시험관내 세포 배양계의 품질 및 안전성 프로파일을 향상시키는데 그 목적이 있다.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다. 명세서에서 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.
본 발명의 일 구체예에서, 용어 "FreSH-트레이서(Fluorescent Real-time SH group-Tracer)" 또는 "FreSH"는 하기 화학식 A로 표시되는 화합물 또는 이의 염을 포함하는 화합물을 의미하고, 세포 소기관에 제한없는 티올 검출용 형광물질로서 사용된다. 따라서, FreSH-트레이서는 세포 소기관에 특이적인 화합물 및 이에 한정하지 않는 화합물 모두를 포함한다.
[화학식 A]
Figure PCTKR2018014825-appb-I000001
상기 화학식 A에서
R1 및 R2는 각각 독립적으로 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이거나, R1, R2 및 X가 함께 5각 또는 6각 고리를 이루는 헤테로 사이클로알킬 또는 헤테로 사이클로알케닐이고; R3은 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이며; R4 및 R5는 각각 독립적으로 수소, C1-5 직쇄 또는 가지쇄 알킬, -(CH2)m-COO-C1-5 직쇄 또는 가지쇄 알킬이거나(상기 m는 1-5의 정수이다), R4, R5 및 Y는 함께 C3-7 헤테로 사이클로알킬을 이루고, 상기 헤테로 사이클로알킬은 비치환 또는 R6으로 치환된 헤테로 사이클로알킬이고; 상기 R6은 -COO(CH2)n-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 n은 1-5의 정수이다), -(CONH)-(CH2)o-PPh3 +Cl-(상기 o는 1-5의 정수이다) 또는 -(CONH)-CHR7-COO(CH2)p-OCO-C1-5 직쇄 또는 가지쇄 알킬이며(상기 p는 1-5의 정수이다); 상기 R7은 -(CH2)q-COO(CH2)r-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 q 및 r은 각각 1-5의 정수이다)이고; X 및 Y는 각각 독립적으로 N 또는 O이다.
본 발명의 일 구체예에서, 용어 "MitoFreSH-트레이서(Mitochondria Fluorescent Real-time SH group-Tracer)" 또는 "GolgiFreSH-트레이서(Golgi Fluorescent Real-time SH group-Tracer)"는 하기 화학식 B 로 표시되는 화합물 또는 이의 염을 포함하는 화합물을 의미하고, 이에 제한되지는 않지만, 미토콘드리아 또는 골지체 내의 티올의 양을 측정하는데 사용한다. 또한 이의 구체예에서, 특히 화학식 B-8로 표시되는 화합물은 GolgiFreSH-트레이서로 사용되고, 화학식 B-4로 표시되는 화합물은 MitoFreSH-트레이서로 사용된다. 상기 이러한 화합물을 통해서 미토콘드리아 또는 골지체 내의 티올의 양에 따라 형광세기가 연속적이고 비율계량적이며 가역적으로 증감한다는 것을 규명할 수 있다.
[화학식 B]
Figure PCTKR2018014825-appb-I000002
상기 화학식 B에서 R1은 하나 이상의 N을 포함하는 3-7원 고리인 헤테로사이클로알킬이다.
본 명세서에서, 용어 "비율계량적(ratiometric)"은 산출량이 투입량(input)에 직접적으로 비례하는 것을 의미한다. 구체적으로, 본 발명의 일 구현예에서, "비율계량적"은 본 발명의 조성물이 티올 투입량에 따라 직접적으로 비례해서 형광세기 또는 형광세기의 비율이 증가 또는 감소하는 것을 의미한다.
본 명세서에서, 용어 "검출"은 시료 속에서 화학종이나 생물학적 물질의 존재 유무나 그 양을 측정하는 것을 의미한다.
본 명세서에서, 용어 "가역적(reversible)"은 화학반응에서 반응물과 생성물의 혼합물이 평형상태의 혼합물을 생성하는 것이 가능한 상태를 의미한다.
본 명세서에서, 용어 "티올(thiol)"은 탄소와 결합된 설프히드릴기를 포함하는 유기 화합물을 의미하고, 설프히드릴기 또는 티올기는 혼용되어 사용된다.
본 발명의 일 구현예에 있어서, 본 발명의 미토콘드리아는 생세포(living cell) 내에 포함된 것이다. 본 발명의 조성물은 미토콘드리아 내 티올 수준을 측정하는데 있어서, 세포로부터 분리된 미토콘드리아에 국한되지 않고, 세포 내에 포함된 상태의 미토콘드리아 내 티올 수준을 측정할 수 있는 특징이 있다. 특히 살아있는 세포 내 미토콘드리아에서의 티올 수준을 특이적으로 검출할 수 있다.
본 명세서에서, GolgiFreSH-트레이서는 시아노아크릴아마이드 친전자체(cyanoacrylamide electrophile)를 갖는 쿠마린(coumarin) 유도체로서 본원의 화학식 B로 표시되는 화합물을 의미하고, 본 발명에서의 골지체 내 티올 검출용 형광물질로서 사용된다. 본 발명자들은 세포 내 골지체에서 티올의 양을 실시간으로 정량 또는 정성적으로 검출 가능한 바이오 센서인 GolgiFreSH-트레이서를 개발하였다. 그 결과, 본원의 화학식 B-5로 표시되는 본 발명의 GolgiFreSH-트레이서(Golgi Fluorescent Real-time SH group-Tracer)가 세포 내 골지체에서의 티올의 양에 따라 형광세기가 연속적이고 비율계량적이며 가역적으로 증감한다는 것을 규명하고, 세포 내 골지체에서 티올의 양을 실시간으로 정량 또는 정성적으로 검출하는데 현저한 민감성을 갖는 바이오 센서로서 유용하게 이용될 수 있다는 것을 입증하였다.
본 발명의 일 구현예에 있어서, 세포 또는 줄기세포의 "안전성" 및 "품질"과 관련해서, 안전하지 못한(예를 들어 종양형성) 세포 또는 세포들 및/또는 좋지 못한 품질(아마도 특이적 마커의 발현 부족)의 세포 간의 표현형 차이가 있다. 이는 표준 방법에 의해서 검출되지 않을 수 있다. 본 발명은 세포 또는 세포계(예를 들어 세포 배양물의 세포군)가 일련의 사전결정된 표준에 부합하는지 여부를 결정하고 부합하도록 세포의 특성을 향상시키는 고도로 민감하고 정교한 수단을 제공한다. 종래에 있어서는, 세포 품질 특성을 파악하기 위해, 숙련자가 일련의 사전결정된 안전성 및/또는 품질 표준에 부합하는 것으로 알려져 있는 세포의 마이크로RNA 프로파일을 확립하고, 동일 유형의 다른 세포에 대해 마이크로 RNA의 비교에 의해 사전결정된 품질 및/또는 특성에 부합하는지를 평가할 수 있었다.
본 발명의 일 구현예에 있어서, "부티오닌 설폭시민(Buthionine-sulfoximine, BSO)"은 글루타치온(GSH)의 합성을 위한 필수 효소인 γ-글루타밀 시스테인 합성효소를 비가역적으로 억제함으로써 세포에 산화 스트레스를 유도한다. GSH 결핍에 의해 유도된 산화 스트레스가 DNA 결실과 같은 게놈 재배열을 유도할 수 있다고 공지되어 있으며, 외인성 항산화제인 N-아세틸-L-시스테인(NAC)에 의한 산화촉진 조건을 막음으로써 DNA 결실을 억제할 수 있다.
본 발명에서 용어, "줄기세포"는 자기 복제능 및 분화증식능을 갖는 미분화 세포를 의미한다. 줄기세포에는, 분화 능력에 따라서, 만능성 줄기세포(pluripotent stem cell), 다능성 줄기세포(multipotent stem cell), 단분화능 줄기세포(unipotent stem cell) 등의 아집단이 포함된다. 상기 만능성 줄기세포는 생체를 구성하는 모든 조직이나 세포로 분화할 수 있는 능력을 갖는 세포를 의미한다. 또한, 다능성 줄기세포는 모든 종류는 아니지만, 복수 종의 조직이나 세포로 분화할 수 있는 능력을 갖는 세포를 의미한다. 단분화능 줄기세포는 특정한 조직이나 세포로 분화할 수 있는 능력을 갖는 세포를 의미한다. 만능성 줄기세포로서는, 배아 줄기세포(ES Cell), 미분화생식선세포(EG Cell), 역분화줄기세포(iPS cell) 등을 들 수 있다. 다능성 줄기세포로서는, 간엽계 줄기세포(지방유래, 골수유래, 제대혈 또는 탯줄유래 등), 조혈계 줄기세포(골수 또는 말초 혈액 등에서 유래), 신경계 줄기세포, 생식 줄기세포 등의 성체 줄기세포 등을 들 수 있다. 또한, 단분화능 줄기세포로는 평소에는 분열능이 낮은 상태로 존재하다가 활성화 이후 왕성한 분열로 오직 간세포들만을 만드는 간세포(Committed stem cell) 등을 들 수 있다. 특히, 본원 발명에서 중간엽 줄기세포(MSC)는 hES-MSC(Human embryonic stem cell-derived mesenchymal stroma cells), BM-MSC(Bone marrow mesenchymal stem cell), UC-MSC(Umbilical cord mesenchymal stem cell), 및 ADSC(Adipose Derived Stem Cell-Condtioned Medium)인 것이 바람직하며, 이에 한정되는 것은 아니다.
본 발명에서 용어, "배아줄기세포(embryonic stem cell, ESC)"는 수정란이 착상하기 직전인 배반포기(blastocyst)의 내부세포 덩어리(세포내괴, inner cell mass)를 분리하여 체외에서 배양한 세포로, 개체의 모든 조직의 세포로 분화할 수 있는 만능성(pluripotency)을 갖는다. 넓은 의미로는 배아줄기세포로부터 유래한 배아체를 포함한다. 본 발명에서 용어, "배아체(embryonic body 또는 embryoid body, EB)"는 부유 배양 상태에서 생성된 구형의 줄기세포의 덩어리를 의미하며, 잠재적으로 내배엽, 중배엽, 외배엽으로 분화할 수 있는 능력을 가지고 있어 조직특이적 분화 세포를 확보하기 위한 대부분의 분화 유도 과정에서 전구체로 이용된다.
본 발명에서 용어, “추출물(extract)”은 생약을 적절한 침출액으로 짜내고 침출액을 증발시켜 농축한 제제를 의미하는 것으로, 이에 제한되지는 않으나, 추출처리에 의해 얻어지는 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 이들의 조정제물 또는 정제물일 수 있다. 추출방법으로는, 이에 제한되지는 않으나, 바람직하게 열탕 추출, 열수 추출, 냉침 추출, 환류 냉각 추출 또는 초음파 추출 등의 방법을 사용할 수 있다.
본 발명에 있어서, 추출물은 추출용매로 추출하거나 추출용매로 추출하여 제조한 추출물에 분획용매를 가하여 분획함으로써 제조할 수 있다. 상기 추출용매는 이에 제한되지 않으나, 물, 유기용매 또는 이들의 혼합용매 등을 사용할 수 있으며, 상기 유기용매는 탄소수 1 내지 4의 알코올이나, 에틸아세테이트 또는 아세톤 등의 극성용매, 헥산 또는 디크르르메탄의 비극성용매 또는 이들의 혼합용매를 사용할 수 있다.
글루타치온 프로브를 통해 세포 전체 또는 세포 소기관에 따라 GSH의 양을 측정할 수 있다. 본 발명의 FreSHracer는 살아있는 세포 내 글루타치온(GSH)의 양을 빠르고 쉽게 측정할 수 있도록 새롭게 합성된 형광 염료이다. FreSHtracer는 세포와 세포 소기관 내에 쉽게 들어갈 수 있는 작은 분자 프로브로 GSH의 티올(-SH)기와 결합하여 작용한다(도 1 참고). FreSHtrace가 GSH에 결합하면 510nm (F510)의 파장대의 형광을 나타내며 GSH와 결합하지 않으면 580nm (F580)의 파장대의 형광을 나타낸다. 이렇게 측정된 F510/F580의 형광 값으로 세포 내 GSH 양을 측정할 수 있다. FreSHtracer와 GSH 사이의 반응은 가역적이며 측정하는데 세포 내 GSH를 소비하지 않는다.
본 발명에서 용어 “글루타치온 평균값 또는 중앙값(Glutathione Mean Level, GM)”은 상기 글루타치온의 측정방법을 이용하여, 배양된 세포에서의 GSH의 평균값 또는 중앙값을 측정하여 세포의 항산화능력을 측정할 수 있는 파라미터이다.
본 발명에서 용어 “글루타치온 산포도(Glutathione Heterogeneity, GH)”는 상기 글루타치온의 측정방법을 이용하여, 배양된 세포에서의 GSH의 분포양상을 측정하여 세포의 항산화능력을 측정할 수 있는 파라미터이다. 이 산포도는 변동계수(Coefficient of variation)이나 강건 변동계수(Robust coefficient of variation)"이고 변동계수 구하는 법은 도 8에 나타나 있는 것이다.
본 발명에서 용어 “글루타치온 재생산 능력(Glutathione Regeneration Capacity, GRC)”은 디아미드를 처리하여 GSH가 GSSG로 환원되는 조건을 유발하고 세포의 GSH 농도를 실시간으로 측정하여 다시 GSH로 회복시키는 능력을 측정하여 세포의 항산화능력을 객관적으로 분석할 수 있는 파라미터이다. 즉, 살아있는 세포에 산화제 처리 후 실시간으로 FR이나 F510을 모니터링하여 얻어지는 수치로 제1산화제 처리군의 제 1 곡선하면적(area under the curve, AUC)에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값을 무처리 대조군의 제 3 곡선하면적에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값으로 나눈 후 100을 곱한 값으로 산출한 값이다.
본 발명에서 “가역적 산화제” 또는 “제1산화제”는 H2O2, 및 tert-부틸 과산화물을 포함한 히드로과산화물 (hydroperoxide); 디아미드, GSSG (oxidized GSH), 5,5′-디티오비스(2-니트로벤조산), 말레이미드, N-에틸말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산 및 요오드아세트아미드을 포함한 티올 산화제; 비스-클로로에틸니트로조우레아를 포함한 글루타치온 환원효소 억제제; PX-12을 포함한 티오레독신 억제제; 안티마이신 A, 로테논, 올리고마이신 및 카르보닐 시아나이드 m-클로로페닐 하이드라존을 포함한 미토콘드라아 전달전달계 억제제; 포르볼 12-미리스테이트 13-아세테이트을 포함한 NADPH 산화효소 활성화제; 1S,3R-RAS-셀렉티브 레탈 3(1S,3R-RAS- selective lethal 3; 1S,3R-RSL3), DPI19, DPI18, DPI17, DPI13, DPI12, DPI10 (ML210), DPI7 (ML162), 또는 알트레타민을 포함한 gpx4 억제제; 에라스틴(Erastin), 설파살라진, 소라페닙, 글루타메이트, 피페라진 에라스틴, 이미다졸 케톤 에라스틴, 및 에라스틴 유사체를 포함한 시스템 x- c 억제제; 페로토시스 유도체 56(FIN56)를 포함한 GPX4 단백질량 및 CoQ10 양 감소유도제; 카스파제-의존성 레탈 56 (CIL56) 및 페로토시스 유도체 엔도페록시드 (FINO2)를 포함한 지질 과산화유도제; 부티오닌-(S, R)-설폭시민을 포함한 글루탐산염 시스타인 연결효소 (GCL) 억제제; 디에틸말레산염을 포함한 GSH 감소 유도제; DPI2, 시스플라틴, 시스테네이즈(cysteinase), 스타틴, 구연산 철 암모늄, 트리고넬린, 사염화탄소, 실리카계 나노입자 및 비열플라즈마를 포함할 수 있다. 상기 산화스트레스의 농도는 0.05~20 μM일 수 있다.
본 발명에서 용어 ”비가역적 티올 산화제”, “비가역적 산화제” 또는 “제2산화제”는 세포독성제 내에 임의의 반응되지 않은 기(가령, 티올)가 진정되도록 담보하는데 이용될 수 있는 제제이다. 이는 세포독성제, 특히 반응되지 않은 티올 기를 갖는 세포독성제 (가령, DM1)의 이합체화를 예방하는데 도움을 줄 수 있다. 즉, 비가역적 티올 산화제는 GSH를 완전히 없애는 블랭크(blank)군을 만들기 위한 물질이다. 예를 들면, 말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산, 에틸말레이미드, N-에틸말레이미드, 요오드아세트아미드, 5,5'-디티오비스(2-니트로벤조산), 또는 요오드아세트아미도프로피온산을 들 수 있으나, 이에 한정되는 것은 아니며, 에틸말레이미드가 바람직하다.
일 구체예에서, 줄기세포의 품질은 GM, GH 및 GRC 기준값 범위로 결정할 수 있는데, 대상 세포의 GM, GH 및 GRC의 값과 대상세포의 표준 줄기세포의 값을 비교하여 결정할 수 있다.
본 발명에서 용어 “산화제”는 통상적으로 산화시키는 물질 외에 세포에 산화스트레스를 유발시키는 처리를 포함한다. 바람직하게는, 이는 제1산화제 또는 제2산화제를 포함한다.
본 발명에서 용어 “산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)”은 살아있는 세포에 제1산화제 처리 후 GSH 수준을 정량하여 얻어지는 수치로 GSH 수준을 산화제 처리하지 않은 대조군 세포 또는 산화제 처리하기 전의 대조군 세포에서 정량된 GSH 수준을 비교하여, GSH 발현이 변동된 세포양으로 산출한 값이다. 예를 들어, 바람직하게는 세포에 산화스트레스를 가한 후, 미토콘드리아 글루타치온(mGSH) 발현 수준을 정상 레벨로 유지할 수 있는 지 측정할 수 있다. 또한, 일 구체예에서, 줄기세포의 품질은 ORC 값이 10%에서 100%, 바람직하게는 30%에서 90%, 보다 바람직하게는 40%에서 90%으로 결정될 수 있다.
본 발명에서 ORC에서의 용어 “산화스트레스”는 세포에 제1산화제를 가한 것을 의미한다.
본 발명은 목적하는 세포를 분리하는 단계; 분리한 세포의 글루타치온의 수준을 측정하는 단계; 및 글루타치온의 수준에 따른 세포 품질을 판단하는 단계;를 포함하는 세포의 품질을 측정하는 방법에서, 글루타치온의 수준에 따른 세포 품질을 판단하는 단계는 하기 평가파라미터 중 어느 하나 이상인 방법: i) 세포의 글루타치온 평균값 또는 중앙값(Glutathione Mean Level, GM); ii) 세포의 글루타치온 산포도(Glutathione Heterogeneity, GH); iii) 세포의 글루타치온 재생산 능력(Glutathione Regeneration Capacity, GRC); 및 iv) 산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)을 들 수 있고, 여기서, GM은 세포 FR(FreSHtracer Ratio)이나 F510의 평균값이나 중앙값으로 산출하고, GH는 세포 FR이나 F510의 변동계수(Coefficient of variation)이나 강건 변동계수(Robust　coefficient of variation)로 산출하며, GRC는 살아있는 세포에 산화제 처리 후 실시간으로 FR이나 F510을 모니터링하여 얻어지는 수치로 제1산화제 처리군의 제 1 곡선하면적(area under the curve, AUC)에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값을 무처리 대조군의 제 3 곡선하면적에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값으로 나눈 후 100을 곱한 값으로 산출하며, ORC는 살아있는 세포에 제1산화제 처리 후 GSH 수준을 정량하여 얻어지는 수치로 GSH 수준을 제1산화제 처리하지 않은 대조군 세포 또는 제1산화제 처리하기 전의 대조군 세포에서 정량된 GSH 수준을 비교하여, GSH 발현이 변동된 세포양으로 산출한 값인, 방법을 제공한다.
본 발명의 일 구체예에서, 글루타치온의 수준을 측정은 하기 화학식 A 또는 B를 첨가하여 글루타치온의 수준을 측정하는 방법:
[화학식 A]
Figure PCTKR2018014825-appb-I000003
상기 화학식 A에서
R1 및 R2는 각각 독립적으로 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이거나, R1, R2 및 X가 함께 5각 또는 6각 고리를 이루는 헤테로 사이클로알킬 또는 헤테로 사이클로알케닐이고; R3은 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이며; R4 및 R5는 각각 독립적으로 수소, C1-5 직쇄 또는 가지쇄 알킬, -(CH2)m-COO-C1-5 직쇄 또는 가지쇄 알킬이거나(상기 m는 1-5의 정수이다), R4, R5 및 Y는 함께 C3-7 헤테로 사이클로알킬을 이루고, 상기 헤테로 사이클로알킬은 비치환 또는 R6으로 치환된 헤테로 사이클로알킬이고; 상기 R6은 -COO(CH2)n-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 n은 1-5의 정수이다), -(CONH)-(CH2)o-PPh3 +Cl-(상기 o는 1-5의 정수이다) 또는 -(CONH)-CHR7-COO(CH2)p-OCO-C1-5 직쇄 또는 가지쇄 알킬이며(상기 p는 1-5의 정수이다); 상기 R7은 -(CH2)q-COO(CH2)r-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 q 및 r은 각각 1-5의 정수이다)이고; X 및 Y는 각각 독립적으로 N 또는 O이거나;
[화학식 B]
Figure PCTKR2018014825-appb-I000004
상기 화학식 B에서
R1은 하나 이상의 N을 포함하는 3-7원 고리인 헤테로사이클로알킬이다. 본 발명의 다른 구체예에서, 화학식 A 또는 B는 하기 화학식 A-2 내지 화학식 A-6, 화학식 B-2 내지 화학식 B-8 중 어느 하나이다. 본 발명의 또 다른 구체예에서, FR은 430-550 nm에서 형광 세기 (F510) 및 550-680 nm에서 형광 세기 (F580)의 비율이다. 본 발명의 또 다른 구체예에서, 산화 스트레스를 처리하기 전이나 처리한 후에 세포의 글루타치온 평균값 또는 중앙값은 증가할수록 양질의 품질이다. 본 발명의 또 다른 구체예에서, 산화 스트레스를 처리하기 전이나 처리한 후에 세포의 글루타치온 산포도(Glutathione Heterogeneity, GH)는 감소할수록 양질의 품질이다. 본 발명의 또 다른 구체예에서, 세포의 글루타치온 재생산 능력(Glutathione Regeneration Capacity, GRC)은 증가할수록 양질의 품질이다. 본 발명의 또 다른 구체예에서, 산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)은 산화제 처리시 측정한 GSH 양이, 산화제 처리하지 않은 대조군 세포 또는 산화제 처리하기 전의 대조군 세포의 GSH 양에 비해 감소한 세포의 수가 적거나, 산화제 처리하지 않은 대조군 세포 또는 산화제 처리하기 전의 대조군 세포의 GSH 양보다 높거나 그 양과 같은 세포의 수가 많을수록 양질의 품질이다. 본 발명의 또 다른 구체예에서, 제1산화제는 H2O2, 및 tert-부틸 과산화물을 포함한 히드로과산화물 (hydroperoxide); 디아미드, GSSG (oxidized GSH), 5,5′-디티오비스(2-니트로벤조산), 말레이미드, N-에틸말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산 및 요오드아세트아미드을 포함한 티올 산화제; 비스-클로로에틸니트로조우레아를 포함한 글루타치온 환원효소 억제제; PX-12을 포함한 티오레독신 억제제; 안티마이신 A, 로테논, 올리고마이신 및 카르보닐 시아나이드 m-클로로페닐 하이드라존을 포함한 미토콘드라아 전달전달계 억제제; 포르볼 12-미리스테이트 13-아세테이트을 포함한 NADPH 산화효소 활성화제; 1S,3R-RAS-셀렉티브 레탈 3(1S,3R-RAS- selective lethal 3; 1S,3R-RSL3), DPI19, DPI18, DPI17, DPI13, DPI12, DPI10 (ML210), DPI7 (ML162), 또는 알트레타민을 포함한 gpx4 억제제; 에라스틴(Erastin), 설파살라진, 소라페닙, 글루타메이트, 피페라진 에라스틴, 이미다졸 케톤 에라스틴, 및 에라스틴 유사체를 포함한 시스템 x- c 억제제; 페로토시스 유도체 56(FIN56)를 포함한 GPX4 단백질량 및 CoQ10 양 감소유도제; 카스파제-의존성 레탈 56 (CIL56) 및 페로토시스 유도체 엔도페록시드 (FINO2)를 포함한 지질 과산화유도제; 부티오닌-(S, R)-설폭시민을 포함한 글루탐산염 시스타인 연결효소 (GCL) 억제제; 디에틸말레산염을 포함한 GSH 감소 유도제; DPI2, 시스플라틴, 시스테네이즈(cysteinase), 스타틴, 구연산 철 암모늄, 트리고넬린, 사염화탄소, 실리카계 나노입자 및 비열플라즈마를 포함한다. 본 발명의 또 다른 구체예에서, 제2산화제는 말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산, 에틸말레이미드, N-에틸말레이미드, 요오드아세트아미드, 5,5′-디티오비스(2-니트로벤조산), 또는 요오드아세트아미도프로피온산을 포함한다. 목적하는 세포는 성체줄기세포, 배아줄기세포 및 유도만능줄기세포(induced pluripotent stem cell)로 구성된 군으로부터 선택된 어느 하나인 줄기세포; 수지상세포(dendritic cell), 자연살해세포(natural killer cell), T 세포(T cell), B 세포 (B cell), 조절 T 세포 (regulatory T cell, Treg cell), 자연 살해 T 세포(natural killer T cell), 선천성 림프구 세포(Innate lymphoid cell), 대식세포(macrophage), 과립구(Granulocyte), 키메릭 항원 수용체 발현 T 세포(CAR-T: Chimeric antigen receptor-T cell), 림포카인 활성 살해세포(LAK: Lymphokine-activated killer Cell) 및 사이토카인 유도성 살해세포(CIK: Cytokine Induced Killer Cell)로 구성된 군으로부터 선택된 어느 하나인 면역세포; 섬유아세포(fibroblast), 연골세포(chondrocyte), 활액막 세포(synovial cell), 피부각질세포(keratinocyte), 지방세포(adipocyte), 조골세포(osteoblast), 파골세포(osteoclast) 및 말초혈액 단핵세포(peripheral blood mononuclear cell) 로 구성된 군으로부터 선택된 어느 하나인 체세포(Somatic cell); CHO 세포, NS0 세포, Sp2/0 세포, BHK 세포, C127 세포, HEK293 세포, HT-1080 세포, PER.C6 세포로 구성된 군으로부터 선택된 어느 하나인 단백질 제재의 생산에 사용되는 세포주; 또는 인체나 동물의 구강, 비강, 폐, 피부, 위장관, 및 비뇨관에서 유래한 미생물로 구성된 군으로부터 선택된 어느 하나인 인체 마이크로바이옴 (Microbiome)이다. 본 발명의 또 다른 구체예에서, T 세포는 조절 T 세포(Treg cell)를 제외한 것이다.
본 발명에 따른 FreSHtracer 및 평가파라미터는 살아있는 줄기세포의 세포 내 GSH 수준을 실시간으로 모니터링하고 GSH 수준에 따라 세포를 분화하는 데 사용되며, 세포 치료제 품질을 측정할 수 있고, 또한 그 품질을 평가할 수 있는 신규한 방법에 관한 것이다.
도 1은 본 발명의 FreSH-트레이서가 글루타치온(GSH)과 가역적으로 반응하는 반응식(도 1a), FreSH-트레이서의 가역반응을 UV 가시광선 흡수 스펙트럼에 의하여 측정한 결과(도 1b), 430nm 및 520nm 각각에서 여기(excitation)에 의하여 발생된 FreSH-트레이서의 형광 방출 스펙트럼을 510nm(F510) 및 580nm(F580)에서 각각 모니터링한 결과(도 1c), 상기 도 1c의 결과를 그래프로 나타낸 결과(도 1d), F510/F580(FR)로 나누어서 계산하고 증가된 농도의 GSH에 맞춘 방출 비율(도 1e)를 나타낸다.
도 2는 hBM-MSC를 F510/F580(FR)로 FACS 선별(sorting)하는 단계를 나타내는 그래프이다.
도 3은 FreSH-트레이서가 세포에서 제거 가능한 것을 보여주는 그래프로 FreSH-트레이서로 염색된 세포를 세척후 새로운 배양액에서 배양한 후 시간에 따라 FACS 분석한 결과(도 3a), 이를 수치화한 그래프(도 3b)를 나타낸다.
도 4는 FreSH-트레이서 기반으로 FASC 분리한 hBM-MSC의 CFU-F(도 4a)와 SDF-1alpha와 PDGF-AA에 대한 이동능(도 4b)를 측정한 결과를 나타낸다.
도 5a 내지 도 5f는 FreSH-트레이서에 의하여 분리된 섬유아세포의 항노화 활성 나타낸 결과이다.
도 6는 FreSH-트레이서에 의하여 분리된 수지상 세포의 활성을 나타낸 결과이다.
도 7는 FreSH-트레이서에 의하여 분리된 T 세포에서 Treg 세포의 활성을 나타낸 결과이다.
도 8은 치료용 세포 품질 평가를 위한 네 가지 글루타치온 파라미터들, 도출식, 그 결과 예시들을 개략적으로 나타낸다.
도 9은 hBM-MSC의 계대배양에 따른 CFU-F 분석(도 9a) 및 SDF-1alpha와 PDGF-AA에 대한 이동능(도 9b)을 나타낸 결과이다.
도 10a 내지 10c는 hBM-MSC의 계대배양에 따른 FreSH-트레이서나 GolgiFreSH-트레이서, MitoFreSH-트레이서 기반의 GM과 GH를 분석한 결과이다.
도 11은 hBM-MSC의 계대배양에 따른 FreSH-트레이서나 GolgiFreSH-트레이서, MitoFreSH-트레이서 기반의 GRC를 분석한 결과이다.
도 12는 쥐 골수세포를 Lineage에 따라 분리한 후 MitoFreSH-트레이서 기반의 GM과 GH를 분석한 결과이다.
도 13은 FreSH-트레이서를 이용하여 FACS 분리된 hES-MSC(도 13a) 또는 분리없이 배양한 hES-MSC(도 13b)에 BSO나 GSH-EE를 처리한 후 CFU-F(도 13a) 또는 PDGF-AA에 대한 세포 이동능(도 13b)을 분석한 결과이다.
도 14a 내지 도 14c는 hUC-MSC를 AA2G가 포함된 배양액에 세 번 계대배양한 후 FreSH-트레이서 기반의 GRC를 분석한 결과이다.
도 15a 내지 도 15b는 hUC-MSC를 AA2G가 포함된 배양액에 세 번 계대배양한 후 FreSH-트레이서 기반의 ORC를 분석한 결과이다.
도 16a는 hUC-MSC에 AA2G 125μg/mL(좌측 사진) 또는 250μg/mL(우측 사진)를 3일간 처리하여 CFU-F 어세이를 실시한 결과를 나타내는 사진이다.
도 16b는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 CFU-F 어세이(n = 3)를 실시한 결과의 그래프이다.
도 17a는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 PDGF-AA에 의한 이동능을 나타내는 사진이다.
도 17b는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 PDGF-AA에 의한 이동능(n = 3)을 분석한 결과의 그래프이다.
도 18a는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 T 세포의 증식능 저하 효과(n = 3)를 관찰한 그래프이다.
도 18b는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 T 세포의 분화능 저하 효과(n = 3)를 관찰한 그래프이다.
도 18c는 hUC-MSC에 AA2G 125μg/mL 또는 250μg/mL을 3일간 처리하여 Treg 세포의 분화 촉진 효과(n = 3)를 관찰한 그래프이다.
도 19은 hUC-MSC에 감마-글루타밀 시스테인(GGC) 0.1, 0.25, 및 0.5mM을 2시간 처리하여 CFU-F 어세이(n = 3)를 실시한 결과의 그래프이다.
도 20a는 hUC-MSC에 GGC를 처리하지 않고 SDF1alpha와 PDGF-AA에 의한 이동능(n = 3)을 분석한 결과의 그래프이다. STI571은 PDGFR 키나아제 억제제로 사용하였다.
도 20b는 hUC-MSC에 GGC 0.1mM을 처리하고 SDF1alpha와 PDGF-AA에 의한 이동능(n = 3)을 분석한 결과의 그래프이다. STI571은 PDGFR 키나아제 억제제로 사용하였다.
도 20c는 hUC-MSC에 GGC 0.25mM을 처리하고 SDF1alpha와 PDGF-AA에 의한 이동능(n = 3)을 분석한 결과의 그래프이다. STI571은 PDGFR 키나아제 억제제로 사용하였다.
도 21은 GM, GH, 및 ORC 분석을 통해 세포의 GSH를 조절하는 물질을 스크리닝하는 실험 단계를 도식화한 도면이다.
도 22a 내지 도 22b는 hUC-MSC에서 리프록스타틴-1의 ORC를 분석 결과이다.
도 23a 내지 도 23c는 hUC-MSC에서 비타민D3의 GM, GH, 및 ORC를 분석 결과이다.
도 24는 hUC-MSC에서 비타민E의 GM, GH, 및 ORC를 분석 결과이다.
도 25a 내지 도 25e는 hUC-MSC에서 플라보노이드의 GM, GH, 및 ORC를 분석한 결과이다.
도 25a는 hUC-MSC에서 바이칼린의 GM, GH, 및 ORC 분석 결과이다.
도 25b는 hUC-MSC에서 바이칼레인의 GM, GH, 및 ORC 분석 결과이다.
도 25c는 hUC-MSC에서 루테오린의 GM, GH, 및 ORC 분석 결과이다.
도 25d는 hUC-MSC에서 퀘르세틴의 GM, GH, 및 ORC 분석 결과이다.
도 25e는 hUC-MSC에서 부테인의 GM, GH, 및 ORC 분석 결과이다.
도 26a 내지 도 26e는 hUC-MSC에서 식물추출물의 GM, GH, 및 ORC를 분석한 결과이다.
도 26a는 hUC-MSC에서 국화꽃 추출물의 GM, GH, 및 ORC 분석 결과이다.
도 26b는 hUC-MSC에서 가죽나무잎 추출물의 GM, GH, 및 ORC 분석 결과이다.
도 26c는 hUC-MSC에서 달맞이순 추출물의 GM, GH, 및 ORC 분석 결과이다.
도 26d는 hUC-MSC에서 쇠뜨기 추출물의 GM, GH, 및 ORC 분석 결과이다.
도 26e는 hUC-MSC에서 고구마잎 추출물의 GM, GH, 및 ORC 분석 결과이다.
도 26f는 hUC-MSC에서 토마토 추출물(LYCOBEADS®)의 GM, GH, 및 ORC 분석 결과이다.
도 27은 hUC-MSC에 0.2, 1, 2, 및 4μM의 페로스타틴-1(Ferrostatin-1) 및 0.1, 0.5, 1, 및 2μM의 리프록스타틴-1(Liproxstatin-1)을 24시간 처리하여 CFU-F 어세이(n = 3)를 실시한 결과의 그래프이다.
도 28a는 hUC-MSC에 1μM 페로스타틴-1을 24시간 처리하거나 0.2mM GGC 또는 2mM GSH-EE를 2시간 처리한 후 T 세포 증식능 저하 효과(n = 3)를 관찰한 그래프이다.
도 28b는 hUC-MSC에 1μM 페로스타틴-1을 24시간 처리하거나 0.2mM GGC 또는 2mM GSH-EE를 2시간 처리한 후 T 세포 분화능 저하 효과(n = 3)를 관찰한 그래프이다.
도 28c는 hUC-MSC에 1μM 페로스타틴-1을 24시간 처리하거나 0.2mM GGC 또는 2mM GSH-EE를 2시간 처리한 후 Treg 세포 분화 촉진효과(n = 3)를 관찰한 그래프이다.
도 29는 계대배양 4, 7, 15에 해당하는 세포에 대한, mGSH 발현 수준의 유세포분석 결과 히스트그램이다.
도 30은 계대배양 4, 7, 15에 해당하는 세포에 대한, mGSH 발현 수준의 Confocal imaging 히스토그램 결과이다.
도 31은 줄기세포의 계대배양 수와 RSL3의 농도에 따른 mGSH High cell 과 Low Cell의 분포양상 분석결과이다.
도 32는 Ferrostatin-1 처리를 통한 중간엽줄기세포에서의 RSL3 처리 효과의 지질산화물 의존성을 확인한 결과이다.
도 33은 RLS3 처리 후 mGSH High 세포와 Low 세포의 CD146 표면 발현을 비교한 결과이다.
도 34는 섬유아세포의 계대배양 정도에 따른 mGSH High cell 과 Low Cell의 분포양상를 확인한 결과이다.
본 발명에 따른 FreSHtracer 및 평가파라미터는 살아있는 줄기세포의 세포 내 GSH 수준을 실시간으로 모니터링하고 GSH 수준에 따라 세포를 분화하는 데 사용되며, 세포 치료제 품질을 측정할 수 있고, 또한 그 품질을 평가할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
<화합물 준비>
FreSH-트레이서에서 사용하기 위해 하기의 화학식 A로 표시되는 화합물 또는 그의 염을 포함하는 조성물을 준비하였다:
[화학식 A]
Figure PCTKR2018014825-appb-I000005
상기 화학식에서 R1 및 R2는 각각 독립적으로 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이거나, R1, R2 및 X가 함께 5각 또는 6각 고리를 이루는 헤테로 사이클로알킬 또는 헤테로 사이클로알케닐이고; R3은 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이며; R4 및 R5는 각각 독립적으로 수소, C1-5 직쇄 또는 가지쇄 알킬, -(CH2)m-COO-C1-5 직쇄 또는 가지쇄 알킬이거나(상기 m는 1-5의 정수이다), R4, R5 및 Y는 함께 C3-7 헤테로 사이클로알킬을 이루고, 상기 헤테로 사이클로알킬은 비치환 또는 R6으로 치환된 헤테로 사이클로알킬이고; 상기 R6은 -COO(CH2)n-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 n은 1-5의 정수이다), -(CONH)-(CH2)o-PPh3 +Cl-(상기 o는 1-5의 정수이다) 또는 -(CONH)-CHR7-COO(CH2)p-OCO-C1-5 직쇄 또는 가지쇄 알킬이며(상기 p는 1-5의 정수이다); 상기 R7은 -(CH2)q-COO(CH2)r-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 q 및 r은 각각 1-5의 정수이다)이고; X 및 Y는 각각 독립적으로 N 또는 O이다.
보다 바람직하게는, FreSH-트레이서에서 사용하기 위해 상기 화학식 A로 표시되는 화합물은 화학식 A-1 내지 화학식 A-6으로 표시되는 화합물로 구성된 군으로부터 선택되는 화합물인 것을 사용하였다:
[화학식 A-1]
Figure PCTKR2018014825-appb-I000006
[화학식 A-2]
Figure PCTKR2018014825-appb-I000007
[화학식 A-3]
Figure PCTKR2018014825-appb-I000008
[화학식 A-4]
Figure PCTKR2018014825-appb-I000009
[화학식 A-5]
Figure PCTKR2018014825-appb-I000010
[화학식 A-6]
Figure PCTKR2018014825-appb-I000011
더욱 바람직하게는, FreSH-트레이서는 상기 화학식 A-1의 화합물을 사용하였다.
이어서, MitoFreSH-트레이서에서 사용하기 위해 하기의 화학식 B로 표시되는 화합물 또는 그의 염을 포함하는 조성물을 준비하였다:
[화학식 B]
Figure PCTKR2018014825-appb-I000012
상기 화학식 B에서 R1은 하나 이상의 N을 포함하는 3-7원 고리인 헤테로사이클로알킬이고, 상기 헤테로사이클로알킬은 R2 치환기가 결합되어 있으며; 상기 R2는 -(C(=O)NH)-(CH2)m-PPh3 +Cl-(상기 m은 1-4의 정수임), -(CH2)n-PPh3 +Cl-(상기 n은 1-6의 정수임), 또는 -(C(=O)-(CH2)p-R3(상기 p는 1-4의 정수임)이고; 상기 R3은 -C(NHC(=O)-R4)이며, 상기 R4는 다음 화학식 B-1로 표시되는 치환기이다.
[화학식 B-1]
Figure PCTKR2018014825-appb-I000013
상기 화학식 B-1에서 상기 x는 1-4의 정수이다.
또한, 본 발명의 R1은 1 또는 2개의 N을 포함하는 6원고리 헤테로사이클로알킬이다. 본 발명에서 "6원고리 헤테로사이클로알킬"에 포함된 용어 "6원고리"는 바이사이클릭 화합물(bicyclic compound) 또는 스피로 화합물(Spiro compound)과 같이 복수개의 고리가 접합된 고리화합물 형태가 아닌 모노사이클릭 화합물로서의 하나의 6각고리 형태를 의미하고, "헤테로사이클로알킬"은 비-방향족성 고리형 알킬로서, 고리 내에 포함된 탄소 원자 중 적어도 하나가 헤테로원자, 예컨대 질소, 산소 또는 황에 의해 치환되어 있는 것을 의미한다. 바람직하게는, R1은 6원고리 헤테로사이클로알킬로서 1개 또는 2개의 질소를 고리 내에 포함된 헤테로원자로서 포함한다.
보다 바람직하게는, MitoFreSH-트레이서에서 사용하기 위해 상기 화학식 B로 표시되는 화합물은 화학식 B-2 내지 B-4로 표시되는 화합물로 구성된 군으로부터 선택되는 화합물인 것을 사용하였다:
[화학식 B-2]
Figure PCTKR2018014825-appb-I000014
[화학식 B-3]
Figure PCTKR2018014825-appb-I000015
[화학식 B-4]
Figure PCTKR2018014825-appb-I000016
더욱 바람직하게는, MitoFreSH-트레이서는 상기 화학식 B-4의 화합물을 사용하였다.
이어서, GolgiFreSH-트레이서에서 사용하기 위해 하기의 화학식 B-5로 표시되는 화합물 또는 그의 염을 포함하는 조성물을 준비하였다:
[화학식 B-5]
Figure PCTKR2018014825-appb-I000017
상기 화학식 B-5에서 R4는 (CH2)p-(OCH2CH2O)q-(CH2)r, 또는-(CH2CH2)s-인 화합물(상기 p,q,r,s는 1-5의 정수임)이다. 보다 상세하게는, 상기 화학식 B-5에서 R4는 (OCH2CH2O)-, -(CH2CH2)-, 및 -(CH2(0CH2CH2)2OCH2)- 중의 어느 하나이다.
보다 바람직하게는, GolgiFreSH-트레이서에서 사용하기 위해 상기 화학식 B-5로 표시되는 화합물은 화학식 B-6 내지 B-8로 표시되는 화합물로 구성된 군으로부터 선택되는 화합물인 것을 사용하였다:
[화학식 B-6]
Figure PCTKR2018014825-appb-I000018
[화학식 B-7]
Figure PCTKR2018014825-appb-I000019
[화학식 B-8]
Figure PCTKR2018014825-appb-I000020
더욱 바람직하게는, GolgiFreSH-트레이서는 상기 화학식 B-8의 화합물을 사용하였다.
본 발명에 따른 화합물A 또는 B 또는 이를 포함하는 조성물을 사용하여, 줄기세포를 포함하는 모든 세포의 세포 내 소기관인 미토콘드리아 또는 골지체의 항산화능을 측정하여 항산화능에 관련된 세포 활성을 정확하게 측정할 수 있고 고활성의 세포 분류가 가능하다. 본 발명의 조성물을 사용한 세포의 활성 측정은 항산화능 측정을 포함하지만, 이에 한정되는 것은 아니다.
또한, 화학식 A 또는 B로 표시되는 화합물; 이의 라세미체, 광학이성질체, 부분입체이성질체, 광학이성질체의 혼합물, 또는 부분입체이성질체의 혼합물; 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 세포 내 소기관의 항산화능 측정용 조성물을 제공하였다.
실시예
실시예 1: FreSH-트레이서(Fluorescent Real-time SH group-Tracer)를 이용한 실험 조건 수립 및 세포 내 발현 양상 확인
FreSH-트레이서를 이용하여 생 세포의 세포 활성을 측정하고, 세포 활성이 높은 세포를 분리하기 위하여 하기와 같은 실험 조건을 수립하였다.
세포는 인간 골수 중간배엽줄기세포(hBM-MSC; human bone marrow mesenchymal stem cell, Lonza에서 구입)와 인간 탯줄 유래 중간배엽줄기세포(hUC-MSC; human bone marrow mesenchymal stem cell, 서울대병원 산부인과에서 탯줄 시료를 받아 제작), 인간 배아줄기세포 분화 중간배엽줄기세포(hES-MSC: human embryonic stem cell derived mesenchymal stem cell, 건국대학교 정형민 교수 실험실에서 분양받음)를 이용하였다.
이때, FreSH-트레이서는 상기 화학식 A-1의 화합물을 사용하였고, MitoFreSH-트레이서는 하기 화학식 B-4의 화합물을 사용하였으며, GolgiFreSH-트레이서는 하기 화학식 B-8을 사용하였다.
GSH(0-200mM)와 FreSH-트레이서(10μM)가 혼합된 완충용액(인산염 10mM, NaCl 150mM, pH 7.4, H2O:DMSO=98:2)을 제조하고, 이 용액의 시간에 따른 UV 가시광선 흡수 스펙트럼과 형광 방출 스펙트럼 변화를 각각 신코 S-3100와 Hitachi F-7000 분광광도계로 측정하였다. 구체적으로 FreSH-트레이서에 GSH의 농도를 증가시키면서 첨가한 경우, 자외선 및 가시광선에 대한 흡광도가 λmax = 430nm에서 증가하고 λmax = 520nm에서는 감소하였고(도 1a), 형광 방출 세기는 약 510nm(F510, λex = 430nm; λem = 510nm)에서 증가하였고 약 580nm(F580, λex = 520nm; λem = 580nm)에서 감소하였다(도 1b 내지 도 1c). 또한, FreSH 트레이서의 F510과 F580의 형광방출세기 비(F510/F580, FR)가 넓은 GSH 농도 범위에서 비례적으로 변함을 확인하였다(도 1d). FR 형광비로부터 수득된 회귀 곡선은 세포내 존재하는 GSH 농도보다 넓은 범위(0-50mM)에서 선형성(R2 = 0.9938)을 나타내었다(도 1e).
더불어 FreSH-트레이서에 포함되는 다양한 유도체들(상기 화합물 A 또는 B) 또한 자외선 및 가시광선에 대한 흡광도가 λmax = 430nm에서 증가하고 λmax = 520nm에서는 감소하였고, 형광 방출 세기는 F510에서 증가하였으며 F580에서 감소함을 확인하였다. 마찬가지로, F510과 F580의 형광방출세기 비(F510/F580) 역시 화학식 B-1와 같이 넓은 GSH 농도 범위에서 비례적으로 변함을 확인하였다(데이터 미기재). 상세한 데이터는 대한민국 출원특허 제10-2015-0161745호와 제10-2017-0107429을 참고할 수 있다.
[화학식 A-1]
Figure PCTKR2018014825-appb-I000021
[화학식 B-4]
Figure PCTKR2018014825-appb-I000022
[화학식 B-8]
Figure PCTKR2018014825-appb-I000023
따라서, 이러한 결과는 FreSHtracer가 세포 균질 액에서 ROS로 유도된 GSH 변화를 모니터링 할 수 있음을 보여준다.
실시예 2: FACS를 이용하여 FreSH-트레이서 기반 GSH 농도에 따른 생 세포의 분리
2-1. hBM-MSC 분리
1x103세포/cm2의 밀도로 hBM-MSC 줄기세포를 배양 배지(MSCGM Bullet Kit; Lonza #PT-3001)에 접종(seeding)하고, 3일 후 2μM FreSH를 포함하는 배양액으로 1.5시간 동안 세포를 표지하였다. DPBS(WELGENE #LB 001-02)로 두 번 세척한 후, TrypsinLE(gibco #12604-013) 용액을 처리하여 세포를 탈착시킨 후, 2μM FreSH를 포함하는 새로운 배지로 트립신을 불활성화시켰다. 이후, 4℃, 1800rpm에서 10분 동안 원심분리한 후 세포를 2μM FreSH를 포함하는 새로운 배지로 현탁(resuspend)하였다. 이를 FACS에 로딩 직전, 2μM FreSH를 포함하는 PBS로 1/5 희석하였다(4℃ 유지를 위하여 한 번에 약 1ml 씩 희석).
이후, 다음과 같은 FACS Instruction 조건(BD ARIAIII, 파장 405(F510 측정을 위함) 및 488(F580 측정을 위함) 레이저, 노즐 크기 100μm, 2,000-3,000 events/sec)에서 F510/F580 비율이 전체 세포 수의 상위 3.9-35%와 하위 3.9-35%를 게이팅(gating)하여 FACS 분리를 실시하였다.
GSHHigh(상위 1.9-35% 세포군), GSHMiddle(GSHMid, 상위 30.2-62.5% 세포군), GSHLow(하위 1.9-35% 세포군)로 분리 후 새로운 배양액으로 배양 배지를 교체하여 FreSH-트레이서를 제거하였다(도 2). FreSH-트레이서는 GSH와 가역적으로 결합하기 때문에 배양액을 교체하면 FreSH-트레이서는 세포에서 제거된다(도 3).
2-2. 인간섬유아세포 세포 분리
사람 음경의 포피에서 분리하여 제조한 인간섬유아세포(HDF: Human diploid fibroblast)를 노화(Old) 세포(p32)로 만든 후[계대배양(passsage)에 따른 복제성 노화 모델] 150 pi 조직 배양 배지(tissue culture media)에 접종(seeding)하고 2μM FreSH를 포함하는 10% 우태혈청(Fetal bovine serum)과 1% penicillin-streptomycin를 포함하는 페놀 레드를 포함하지 않는(Phenol red free) DMEM(Dulbecco's Modified Eagle's Medium) 배지로 2시간 동안 세포를 표지하였다. 2시간 후, PBS로 2번 세척하고, TrypsinLE(Invitrogen) 용액을 처리하여 세포를 탈착시킨 후, 새로운 배지로 트립신을 불활성화시킨 후, 얼음 위에서 5분간 방치하였다. 이후, 4℃, 1000rpm에서 10분 동안 원심분리한 후 세포를 2x107세포/ml 밀도가 되도록 2μM FreSH를 포함하는 새로운 배지로 현탁(resuspend)하였다.
이후, 다음과 같은 FACS Instruction 조건(BD ARIAIII, 파장 405(F510 측정을 위함) 및 488(F580 측정을 위함) 레이저, 노즐 크기 100μm)에서 F510/F580 비율이 전체 클 세포 수의 GSHHigh(상위 0.2-30.2% 세포군)와 GSHLow(하위 0.2-30.3% 세포군)를 게이팅(gating)하여 FACS 분리를 실시하였다. 이후, 새로운 배양액으로 배양 배지를 교체하여 FreSH를 제거하였다(도 4). FreSH는 GSH와 가역적으로 결합하기 때문에 배양액을 교체하면 FreSH는 세포에서 바로 제거된다(데이터 미기재).
2-3. 단핵구 유래 인간 수지상 세포 배양
인간 혈액을 채취한 후 DPBS(WELGENE #LB 001-02)로 3배 용량이 되도록 희석하고 Ficoll-Paque Plus(GE Healthcare, 17-1440-02) 용액을 이용하여 밀도차 분리 방식으로 유핵세포만 분리한다. 분리된 세포의 개수를 확인하고, 1x107 세포 당 90μL 의 2% FBS 가 함유된 DPBS와 10μL 의 CD14 MicroBead(Milteny biotech #130-050-201)를 넣어 주고, 15분 동안 4℃에서 반응시켜준 후 LS Column을 이용하여 CD14+ 단핵구를 분리하였다. 6웰플레이트에 웰당 1x106개 세포를 2mL의 수지상세포 분화배지(RPMI 1640, 2mM L-Glutamine, 10% FBS, 1% penicillin-streptomycin, 100μM ß-mercaptoethanol, 20ng/mL hGMCSF, 20ng/mL IL-4) 에서 6일간 분화시켰다. 6일 후 분화가 완료된 수지상세포는 미성숙 수지상세포로 간주하고 0.5μg/mL LPS 를 24시간 동안 처리하여 성숙 수지상세포를 배양하였다.
실시예 2-3과 같이 FreSH를 포함하는 배지로 상기 세포를 표지하였다.
2-5. 쥐의 T림프구 분리
5μg/mL의 CD3 항체(Biolegend #100340)를 37℃에서 4시간 동안 24웰플레이트에 코팅한 후 DPBS를 이용하여 세척하였다. 쥐의 비장과 림프절로부터 Mouse Pan T Cell Isolation Kit II(Milteny biotech #130-095-130)를 이용하여 분리한 T림프구를 웰당 2x106개 넣어주고 1μg/mL 농도의 CD28 항체(Biolegend #102112)와 함께 10% FBS가 포함된 RPMI 1640 배지에서 3일 동안 배양하였다. FreSH를 최종 2μM 농도가 되도록 배양 배지에 첨가하고 2시간 동안 세포를 표지 후, 4℃, 1500rpm에서 5분 동안 원심분리한 후 세포를 2x107세포/ml 밀도가 되도록 2μM FreSH를 포함하는 새로운 배지로 현탁(resuspend)하였다. 그 후, 다음과 같은 FACS Instruction 조건(BD ARIAIII, 파장 405(F510 측정을 위함) 및 488(F580 측정을 위함) 레이저, 노즐 크기 70μM)에서 F510/F580 비율에 따라 세 가지 세포군으로 분리하였다.
2-6. hES-MSC 줄기세포 분리
3x106세포/ml 밀도의 hES-MSC 줄기세포를 150 pi 조직 배양 배지(tissue culture media)에 접종(seeding)하고, 12시간 후, 30ml PBS로 두 번 세척한 후, 2μM FreSH를 포함하는 EGM-2 MV 배양액으로 2시간 동안 세포를 표지하였다. 2시간 후, 2μM FreSH를 포함하는 PBS로 2번 세척하고, TrypsinLE(Invitrogen) 용액을 처리하여 세포를 탈착시킨 후, 2μM FreSH를 포함하는 새로운 EGM-2 MV 배지로 트립신을 불활성화시켰다. 이후, 4℃, 2000 rpm에서 20분 동안 원심분리한 후 세포를 5x107세포/ml 밀도가 되도록 2μM FreSH를 포함하는 새로운 EGM-2 MV 배지로 현탁(resuspend)하였다. 이를 FACS에 로딩 직전, 2μM FreSH를 포함하는 PBS로 1/5 희석하였다(4℃ 유지를 위하여 한번에 약 1ml씩 희석).
이후, 다음과 같은 FACS Instruction 조건(BD ARIAIII, 파장 405(F510 측정을 위함) 및 488(F580 측정을 위함) 레이저, 노즐 크기 100μM, 2,000-3,000 events/sec)에서 F510/F580 비율이 전체 세포 수의 상위 3.9-35%와 하위 3.9-35%를 게이팅(gating)하여 FACS 분리를 실시하였다.
GSHHigh(상위 3.9-35% 세포군), GSHLow(하위 3.9-35% 세포군)로 분리 후 새로운 배양액(EGM-2-MV media, LONZA)으로 배양 배지를 교체하여 FreSH를 제거하였다(도 4). FreSH는 GSH와 가역적으로 결합하기 때문에 배양액을 교체하면 FreSH는 세포에서 바로 제거된다(데이터 미기재).
실시예 3: 분리한 세포의 특성 분석
3-1: FreSH-트레이서 기반 분리된 줄기세포의 세포학적 특성 분석
hBM-MSC 줄기세포의 치료 효능을 결정하는 주요 인자인 콜로니 형성 단위(CFU-F, colony forming unit-fibroblast)와 생착률을 세포 배양 모델에서 평가하였다. 200세포/100 pi dish로 접종후 14일간 배양한 후 크리스탈바이올렛 염색을 실시한 결과, GSHHigh 세포가 GSHMid나 GSHLow 세포에 비해 현저히 높은 CFU-F 수치를 나타냄을 확인하였다(도 4a). 또한, 트랜스웰 배양을 활용하여 SDF-1(150ng/ml)이나 PDGF-AA(10ng/mL) ± STI571(0.5μg/mL)에 관한 주화성을 측정한 결과, GSHHigh 세포가 GSHLow 세포에 비해 현저히 높은 세포 이동성을 나타냄을 확인하였다(도 4b).
3-2: FreSH-트레이서 기반 분리된 섬유아세포에서의 노화 특성 분석
사람 음경의 포피에서 분리하여 제조한 인간섬유아세포(HDF: Human diploid fibroblast)를 젊은(Young) 세포(p6)와 노화(Old) 세포(p32)[계대배양(passsage)에 따른 복제성 노화 모델]로 만든 후 Promega사의 GSH/GSSG-GloTM 분석 키트를 이용하여 GSH 수준을 측정하였을 경우, 노화 세포에 비해 젊은 세포의 GSH 수준이 약 44% 감소되어 있음을 확인하였다(도 5a).
상기 인간섬유아세포를 실시예 2-2의 방법에 의하여 GSHHigh 및 GSHLow 섬유아세포로 분리하였다. 세포 크기를 측정한 결과, GSHLow 세포가 GSHHigh 세포에 비해 1.5배 큰 결과를 확인하여 노화가 될수록 세포의 크기(FSC, Forward scattering)가 커진다는 기존의 발표(참고자료 1을 참고)에 부합함을 확인하였다(도 5b). 5μM DHR123(Dihydrorhodamine 123)을 세포에 처리 후 30분간 37℃에서 배양하여 세포내 ROS 양을 측정하였을 경우, GSHLow 세포가 GSHHigh 세포에 비해 염색의 정도가 양호함을 확인하였다(도 5c).
또한, 리포푸신(lipofuscin) 양을 Alexa488 형광필터를 사용하여 자가형광(autofluorescence)로 측정하여 정량하였을 때 GSHLow 세포가 GSHHigh 세포에 비해 강하게 측정되었고(도 5d), GSHLow 세포가 GSHHigh 세포에 비해 ki67 mRNA 발현양은 적은 반면 p21의 mRNA 발현양은 높았다(도 5e). 또한, SASP관련 유전자들의 발현양을 상술한 RQ-PCR로 분석하였을 때, GSHLow 세포가 GSHHigh 세포에 비해 IL-1A 유전자 및 IL-1B 유전자 발현이 증가되어 있음을 확인하였다(도 5f). 세포가 노화됨에 따라 리포푸신이 증가하고(참고자료 2를 참고), 노화가 될수록 ki67 발현양은 감소하고 p21 발현양은 증가하며(참고자료 3을 참고), SASP(senescence associated secretory phenotype)관련 유전자들의 발현양이 증가됨이 알려져 있는바(참고자료 4를 참고), GSHHigh 세포가 GSHLow 세포에 비해 항노화 활성이 있음을 확인할 수 있었다. 본 실시예의 유전자 발현은 상술한 RQ-PCR 분석을 이용하여 측정하였고, 분석에 사용된 모든 프라이머는 QuantPrime(http://www.quantprime.de/)을 이용하여 디자인하였으며, 서열은 하기 표 1에 나타내었다.
프라이머 명칭 프라이머 서열(5‘ -> 3’)
IL1A_For TGTGACTGCCCAAGATGAAGACC
IL1A_Rev TTGGGTATCTCAGGCATCTCCTTC
IL1B_For GAACTGAAAGCTCTCCACCTCCAG
IL1B_Rev AAAGGACATGGAGAACACCACTTG
Ki67_For AGCACCTGCTTGTTTGGAAGGG
Ki67_Rev ACACAACAGGAAGCTGGATACGG
p21_For GGCAGACCAGCATGACAGATTTC
p21_Rev AGATGTAGAGCGGGCCTTTGAG
3-3: FreSH-트레이서 기반 분리된 수지상세포에서 면역 활성 분석
인간 단핵구 유래 수지상세포의 면역활성에 관련된 다양한 표면단백질에 대한 항체를 FreSH Tracer와 동시에 염색한 후 유세포 분석법을 이용하여 GSHHigh(상위 0.2-30.2% 세포군), GSHMid(상위 30.2-62.5% 세포군)와 GSHLow(하위 0.3-32.7% 세포군)를 게이팅(gating)하고 각각의 세포군에서의 표면단백질의 발현정도를 확인하였다. 그 결과, T림프구 활성에 중요한 역할을 한다고 알려진 CD80의 세포 표면의 발현 정도가 수지상세포의 성숙여부와 관계없이 GSHHigh, GSHMid, GSHLow 순서로 감소하는 것을 확인하였다(도 6). 이를 통해 GSH가 높은 수지상세포의 면역활성이 클 것으로 예상할 수 있다. 실험에 사용한 표면단백질 항체는 표 2와 같다.
표면단백질 형광 제조사 Cat. No.
CD40 AlexaFluor®700 Biolegend 334328
CD80 APC Biolegend 305220
HLA-DR BV650 BD 564231
CD86 PE/Cy7 Biolegend 305422
HLA-A,B,C APC/Cy7 Biolegend 311426
CD11c BrilliantViolet711™ Biolegend 301630
3-4: FreSH-트레이서 기반 분리된 T세포에서 Treg 세포 활성 분석
쥐의 T림프구를 CD3 및 CD28 항체를 이용하여 활성화시킨 후 FreSHtracer를 이용하여 GSH 농도에 따라 3가지 실험군으로 분리하였다. 분리된 T림프구를 Trizol(Invitrogen #15596026)을 이용하여 mRNA를 추출하고 Treg 세포특이적으로 발현하는 전사인자인 foxp3 mRNA 수준을 RQ-PCR을 통해 분석한 결과, GSHHigh, GSHMid에 비해 GSHLow에서 4배 가량 증가되어 있음을 확인하였다(도 7). 이를 통해 GSH가 높은 T세포군에서 Treg 세포의 존재비율이 낮을 것으로 예상할 수 있다.
실시예 4: FreSH-트레이서 기반 세포 치료제 품질 평가를 위한 평가파라미터 수립
치료용 세포의 품질을 평가하기 위하여 아래에 기술하는 것과 같이 FreSH-트레이서를 이용한 실시간 글루타치온 측정법을 기반으로 하는 네 가지의 평가 파라미터를 개발하여 분석하였다(도 8). 그 네 가지는 각각 세포의 글루타치온 평균값(또는 중앙값; Glutathione Mean Level, GM) 및 글루타치온 산포도(Glutathione Heterogeneity, GH), 글루타치온 재생산 능력(Glutathione RegenerationCapacity, GRC), 산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)이다.
도 8에 나타내어진 바와 같이, GM은 세포 FR의 평균값이나 중앙값으로 산출한다. 또한, GH는 세포 FR의 변동계수(Coefficient of variation)이나 강건 변동계수(Robust coefficient of variation)로 산출한다. GRC는 살아있는 세포에 산화제 처리 후 실시간으로 FR을 모니터링하여 얻어지는 수치로 산화제(디아미드, H2O2 등) 처리군의 FR 곡선하면적(area under the curve, AUC)에서 0.1~100mM N-에틸말레이미드(NEM) 처리군의 AUC를 뺀 값을 아무것도 처리하지 않은 대조군의 AUC에서 NEM 처리군의 AUC를 뺀 값으로 나눈 후 100을 곱한 값을 의미한다. NEM 처리군의 FR은 해당 세포 FR의 블랭크 값으로 처리하여 GRC 수치의 민감성을 높이기 위한 수치이다. 또한, ORC는 살아있는 hUC-MSC에 산화제인 글루타치온 페록시다아제 4(glutathione peroxidase 4, GPX4) 억제제 RSL3를 0.5μM나 1μM 농도로 처리하여 37℃에서 2시간동안 배양하였다. RSL3가 포함된 배지를 제거한 후 15μM Mito-FreSHtracer를 100㎕씩 넣고 37℃에서 1시간동안 배양하였다. 이 때 사용되는 배지는 10mM HEPES를 포함한 HBSS (Hanks&#39; Balanced Salt Solution)가 사용되었다. 측정 전 배지 상의 Mito-FreSHtracer를 제거해 주기 위해 10mM HEPES를 포함한 HBSS로 배지를 교환해준 후 공초점 이미지 장비인 operetta를 이용해 형광이미지를 측정하였다. RSL3를 처리하지 않은 대조군 세포 또는 RSL3 처리하기 전의 대조군 세포에서 정량된 GSH 수준을 비교하여, GSH 발현이 변동된 세포분포로 산출하였다. 분포를 나타내는 히스토그램이 두 개의 peak 로 나뉘는 지점을 기준으로 GSH High cell (오른쪽 피크), GSH Low cell (왼쪽 피크) 을 나누어 해당하는 세포의 비율을 %로 나타내었다.
상기한 글루타치온 평가 파라미터들의 줄기세포 품질과의 관련성 여부를 확인하기 위해 hBM-MSC 계대배양 횟수(passage, P)에 따른 CFU-F(colony-forming unit-fibroblasts)와 이동능을 분석하였다. 그 결과, p4.5의 hBM-MSC가 p9.5의 hBM-MSC보다 CFU-F가 현저히 높고(도 9a), SDF-1a(혈관 신생인자) 또는 PDGF-AA(혈소판유래증식인자-AA) 의존적 이동능이 큰 것을 확인하였다(도 9b). 이 조건에서 세포 전반적 글루타치온 측정용 FreSH-트레이서와 각각 골지체, 및 미토콘드리아 특이적인 GolgiFreSH-트레이서, 및 MitoFreSH-트레이서를 이용하여 줄기세포의 글루타치온 평가 파라미터들을 비교 분석하였다(도 10a). GM은 계대배양이 높을수록 hBM-MSC에서 FR 평균값 및 Mito-FR 평균값은 유의적으로 낮아졌으나 Golgi-FR 평균값은 유의적인 변화가 나타나지 않았다(도 10b). GH는 계대배양이 높을수록 hBM-MSC에서 FR rCV값과 Mito-FR rCV값이 유의적으로 증가하였으나 Golgi-FR rCV값은 유의적으로 변하지 않았다(도 10c). GRC는 계대배양이 높을수록 hBM-MSC에서 디아미드 처리에 의한 FR기반 %GRC와 Mito-FR 기반 %GRC가 감소하였으나 Golgi-FR 기반 %GRC는 변화가 없었다(도 11). 이를 통해, 줄기세포의 품질과 FreSH-트레이서나 MitoFreSH-트레이서 기반의 GM과 GRC는 비례적 상관관계를 보이며, FreSH-트레이서나 MitoFreSH-트레이서 기반의 GH는 반비례적 상관관계를 보이는 것을 알 수 있었다. 특히 MitoFreSH-트레이서 기반의 글루타치온 평가 파라미터가 줄기세포 품질에 대한 민감성이 큰 것을 확인할 수 있었다.
다음으로 골수세포의 분화 정도에 따른 MitoFreSH-트레이서 기반의 글루타치온 평가 파라미터의 변화를 관찰하였다. 쥐에서 분리한 Lineage+ 세포와 Lin- 세포를 각각 MitoFreSH-트레이서를 이용하여 염색을 실시한 후, Operetta 기기(PerkinElmer)를 이용하여 FR을 측정하고, 세포군 별 MitoFreSH-트레이서 기반의 글루타치온 평가 파라미터를 확인하였다. 그 결과, 분화가 진행된 Lineage+ 세포군에 비해 미분화된 Lin- 세포군에서 미토콘드리아 GM은 높고 GH는 낮아짐을 확인하였다(도 12). 이는 골수세포의 줄기성을 글루타치온 평가 파라미터로 구분할 수 있음을 의미한다.
실시예 5: FreSH-트레이서를 이용한 세포 치료제 품질 향상 물질 탐색
직접적으로 줄기세포내 GSH 양을 조절할 경우 세포기능 변화를 초래하는지를 테스트하기 위해 부티오닌 설폭시민(BSO, buthionine sulfoximine; 글루타치온 합성 억제제)와 글루타치온 에틸 에스터(GSH-EE, Glutathione ethyl ester)를 FreSH-트레이서에 의해 분리된 hES-MSC에 처리하였다. GSHHigh 세포에 BSO(80μM, 24h)를 처리하여 세포내 GSH를 낮출 경우 CFU-F가 증가함을 확인하였고, 역으로 GSHLow 세포에 GSH-EE(1mM, 2h)를 처리하여 GSH를 높혔을 경우 CFU-F가 감소함을 확인하였다(도 13a). 또한 FreSH-트레이서로 분리하지 않은 hES-MSC에 BSO를 처리하거나 GSH-EE를 처리하였을 경우, 각각 PDGF-AA에 대한 세포 이동능이 감소하거나 증가함을 확인하였다(도 13b).
한편, hUC-MSC를 항산화제 아스코르브산 2-글루코시드(AA2G, 250μg/mL)를 넣은 배지에서 세 번 계대배양하는 경우, 그렇지 않은 나이브 세포군에 비해 낮은 농도의 디아미드 처리에 의한 FreSH-트레이서 기반의 GRC가 높아지는 것을 확인하였다(도 14). 이로써 글루타치온 평가파라미터 개선 물질이 세포 기능을 향상시킴을 확인하였다.
또한, hUC-MSC를 항산화제 아스코르브산 2-글루코시드(AA2G, 250μg/mL)를 넣은 배지에서 세 번 계대배양하는 경우, 그렇지 않은 나이브 세포군(NC)에 비해 FreSH-트레이서 기반의 ORC가 GSHHigh 세포에서 더 높아지는 것을 확인하였다(도 15a 및 도 15b).
본원 발명자들은 글루타치온 평가 파라미터를 개선하는 물질을 각각의 줄기세포에 처리하여, 줄기세포에 대한 상기 물질의 영향을 관찰하였다. L-아스코르브산 2-글루코시드(L-Ascorbic Acid 2-Glucoside, AA2G)를 넣은 배지에서 hUC-MSC(human umbilical cord mesenchymal stem cells)를 계대배양한 경우, CFU-F, 이동능, 및 항염증효과를 관찰하였다. hUC-MSC에 AA2G를 125μg/mL 또는 250μg/mL로 3일간 처리하여 CFU-F 어세이(n = 3)를 실시하였다. 도 16a 및 도 16b에 나타나있는 바와 같이, AA2G를 처리한 경우에 CFU-F가 증가한 것을 확인할 수 있었다. 또한, hUC-MSC에 125μg/mL 또는 250μg/mL의 AA2G를 3일간 처리하여 PDGF-AA에 의한 이동능(n = 3)을 분석하였다. 도 17a 및 도 17b에 나타나있는 바와 같이, AA2G를 처리한 경우에 이동능이 증가한 것을 확인할 수 있었다. 추가로, hUC-MSC에 125μg/mL 또는 250μg/mL의 AA2G를 3일간 처리하여 T 세포의 증식능 저하 및 T 세포의 분화능 저하를 관찰하고, Treg 세포 분화의 촉진을 관찰하였다. 도 18a 내지 도 18c에 나타나있는 바와 같이, AA2G를 처리한 경우에 줄기세포의 항염증 효과를 확인할 수 있었다.
한편, hUC-MSC를 글루타치온 전구물질인 감마-글루타밀 시스테인(gamma-glutamyl cysteine; GGC, 0.1, 0.25, 및 0.5mM)으로 배양하였다. hUC-MSC에 각각 농도의 GGC를 2시간 처리하여 CFU-F 어세이(n = 3)를 실시하였다. 그 결과, 도 19에 나타나있는 바와 같이, CFU-F가 증가되어 있는 것을 확인하였다. 또한, hUC-MSC에 GGC를 처리하지 않고 SDF1alpha와 PDGF-AA에 의한 이동능(n = 3)을 분석하고 나서, hUC-MSC에 GCC를 상기한 농도로 증가시켜 처리하고, SDF1alpha와 PDGF-AA에 의한 이동능(n = 3)을 분석하였다. STI571은 PDGFR 키나아제 억제제로 사용하였다. 도 20a 내지 20c에 나타나있는 바와 같이, GCC 처리 농도가 증가함에 따라 SDF1alpha와 PDGF-AA에 의해 이동능이 향상되는 것을 확인하였다.
또한, ORC 분석을 위해, 도 21에 나타낸 바와 같이, 살아있는 세포를 준비하여, 3×103의 세포를 웰에 각각 접종하였다. α-MEM 배지에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신을 처리하였다. 글루타치온의 수준을 높일 수 있는 물질을 처리하였다. 그 다음, 글루타치온 페록시다아제 4(glutathione peroxidase 4, GPX4) 억제제인 RSL3를 처리하였다. 2시간 정도 배양한 후, RSL3가 포함된 배지를 제거한 후 15μM Mito-FreSHtracer를 100㎕씩 넣고 37℃에서 1시간동안 배양하였다. 이 때 사용한 배지는 10mM HEPES를 포함한 HBSS (Hanks' Balanced Salt Solution)를 사용하였다.
본 발명자들은 hUC-MSC에서 글루타치온의 수준을 높일 수 있는 물질로서 리프록스타틴-1, 비타민D3, 비타민E, 플라보노이드 계열인 바이칼린, 바이칼레인, 루테오린, 퀘르세틴, 부테인, 식물 추출물인 국화꽃 추출물, 가죽나무잎 추출물, 달맞이순 추출물, 쇠뜨기 추출물, 고구마잎 추출물, 및 토마토 추출물(LYCOBEADS®)을 처리하여 ORC를 분석하였다(도 22a 내지 도 26f 참고). 예를 들어, 도 22a에 나타난 바와 같이, 리프록스타틴-1의 농도를 각각 0, 2.5, 5, 10μM으로 처리하고, RSL3도 각각 0, 0.5, 1μM 으로 처리하였다. RSL3에 의해 세포의 품질이 저하되어도 리프록스타틴-1의 농도가 높으면 세포의 품질이 증가한 것을 관찰하였다. 즉, GSHHigh 세포의 비율이 증가하는 것을 확인하였다.
hUC-MSC에 0.2, 1, 2, 및 4μM의 페로스타틴-1(Ferrostatin-1) 및 0.1, 0.5, 1, 및 2μM의 리프록스타틴-1(Liproxstatin-1)을 24시간 처리하여 CFU-F 어세이(n = 3)를 실시하였다. 도 28a 내지 27c에 나타내는 바와 같이, GGC 처리로 항염증 효과에 대한 변화는 보이지 않았다.
또한, 지질 산화를 억제하여 세포내 글루타치온 수준을 조절하는 페로스타틴-1(0.2, 1, 2, 4μM) 및 리프록스타틴-1(0.1, 0.5, 1, 2μM)으로 hUC-MSC를 배양하였다. 도 27에 나타나있는 바와 같이, CFU-F가 향상되는 것을 확인할 수 있었다. 한편, hUC-MSC에 각각 1μM의 페로스타틴-1을 24시간 처리하고, 0.2mM의 GGC를 2시간 처리하고, 2mM의 GSH-EE를 2시간 처리하였다. 이로부터, T 세포의 증식능 저하 및 T 세포의 분화능 저하를 관찰하고, Treg 세포 분화의 촉진을 관찰하였다. 페로스타틴-1 및 리프록스타틴-1과 같은 물질들은 도 28a 내지 27c에 나타나있는 바와 같이 hUC-MSC의 항염증 효과에 대한 변화는 보이지 않았다. 이로써 글루타치온 평가파라미터를 개선하는 물질이 치료용 줄기세포 기능을 향상시킴을 확인하였다.
또한, 본원 발명자들은 줄기세포 항산화능에 따른 연골 재생 효과를 골관절염 동물모델에서 확인하였다. 전방십자인대(anterior cruciate ligament, ACL)를 파열하여 골관절염을 유도한 랫(rat)의 관절을 준비하였다. AA2G(250μg/mL)를 포함하는 배양액에서 3번 계대배양한 hES-MSC(2 x 105)를 상기 관절에 주입하였다. 그 결과 도 29a에 나타내는 바와 같이, 일반적인 줄기세포와 비교하여 항산화능 증가 줄기세포 이식(high GSH MSC)시 연골 재생 효능이 현저하게 우수한 것을 확인하였다. 또한, 상기한 바와 같은 hES-MSC(2 x 105)를 주입한 관절조직을 준비하여, H&E 및 사프라닌-O(Safranin-O)으로 염색하였다(도 29b). 또한, 상기한 바와 같은 hES-MSC(2 x 105)를 주입한 관절조직을 준비하여, 2형 콜라겐(Type II collagen)을 면역 염색하였다(도 29c). GAG 및 2형 콜라겐(Type II collagen)의 발현이 우수한 것을 확인할 수 있었다. 이로써 글루타치온 파라미터 개선 물질이 줄기세포의 질환 치료 효능을 향상시킴을 확인하였다.
모든 데이터는 비모수검정의 사후검정(Bonferroni post-hoc tests)과 함께 일원 분산분석(one-way ANOVA) 또는 이원 분산분석(two-way ANOVA)을 이용하여 분석하였다. 모든 분석은 GraphPad Prism 5.0(GraphPad Software, 캐나다)로 수행하였고, p<0.05 또는 p<0.01인 경우 통계학적으로 유의한 것으로 결정하였다.
실시예 6: 지질산화제를 이용한 GSH 발현 수준 측정
본연구실에서 배양된 hUC-MSC 계대배양 4, 7, 15 에 해당하는 세포에 RSL3를 다양한 농도로 처리한 후 Mito-FreSH를 사용하여 염색후 유세포분석과 컨포칼 이미징을 통해 세포의 미토콘드리아 GSH (mGSH) 의 분포양상을 히스토그램을 통해 확인해보았다.
1. RSL3 농도와 계대배양 수에 따른 mGSH 발현수준 변동
1)실험과정
<유세포분석법을 통한 MSC에서의 GSH 분포 측정>
탯줄 유래 중간엽 줄기세포 (human umbilical cord-derived mesenchymal stem cell, hUC-MSC)의 계대배양 4, 7, 15를 준비한 뒤 6-well 세포 배양 플레이트에 well당 70000 cells 를 넣어준 후 37℃에서 24시간 배양하였다. 이 때 사용되는 배지는 α-MEM에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신이 포함되었다. 배지를 제거한 후 글루타치온 페록시다아제 4(glutathione peroxidase 4, GPX4) 억제제인 RSL3를 0.1/0.5/1μM 농도로 넣고 37℃에서 1.5시간동안 배양하였다. 이 때 사용되는 배지는 α-MEM에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신이 포함되었다. RSL3가 포함된 배지를 제거한 후 5μM Mito-FreSHtracer를 넣고 37℃에서 1.5시간동안 배양하였다. 이 때 사용되는 배지는 α-MEM에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신이 포함되었다. Mito-FreSHtracer가 포함된 배지를 제거한 후, 2mL의 DPBS 로 세포를 2회 세척해주었다. 250μL 의 TrypLE Express를 넣고, 37℃에서 2분30초 동안 반응한 뒤, 2% FBS가 포함된 DPBS를 동량 넣어 세포를 플레이트에서 떼어주었다. 플레이트에서 떼어낸 세포를 FACS tube 로 옮겨 얼음에 보관한 뒤, Flow cytometry 장비를 이용해 형광 값을 측정하였다.
<형광 이미징을 이용한 GSH 분포 측정>
탯줄 유래 중간엽 줄기세포 (human umbilical cord-derived mesenchymal stem cell, hUC-MSC)의 계대배양 4, 7, 15를 준비한 뒤 96-well 세포 배양 플레이트에 well당 7000 cells/100㎕를 넣어준 후 37℃에서 24시간 배양하였다. 이 때 사용되는 배지는 α-MEM에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신이 포함되었다. 배지를 제거한 후 글루타치온 페록시다아제 4(glutathione peroxidase 4, GPX4) 억제제인 RSL3를 0.1/0.5/1μM 농도로 100㎕를 넣고 37℃에서 2시간동안 배양하였다. 이 때 사용되는 배지는 α-MEM에 10% 우태아혈청 (fetal bovine serum), 1X 페니실린-스트렙토마이신이 포함되었다. RSL3가 포함된 배지를 제거한 후 15μM Mito-FreSHtracer를 100㎕씩 넣고 37℃에서 1시간동안 배양하였다. 이 때 사용되는 배지는 10mM HEPES를 포함한 HBSS (Hanks' Balanced Salt Solution)가 사용되었다. 측정 전 배지 상의 Mito-FreSHtracer를 제거해 주기 위해 10mM HEPES를 포함한 HBSS로 배지를 교환해준 후 공초점 이미지 장비인 operetta를 이용해 형광이미지를 측정하였다.
<히스토그램 분석방법>
각 세포 내의 F510 (Mito-FreSHtracer가 SH기와 결합했을 때의 형광 값)과 F580 (Mito-FreSHtracer가 SH와 결합하지 않은 상태로 자체 형광 값)의 형광 값을 측정한 뒤 F510값을 F580값으로 나눈 값을 세포 내 GSH 평균 값을 의미하는 F510/F580 ratio 값으로 구하였다. prism 5 프로그램을 사용해 각 세포가 갖는 F510/ F580 ratio 값을 X축으로 F510/F580 ratio값에 해당되는 세포의 %양을 Y축으로 히스토그램으로 나타내었다. Flow cytometry를 분석하는 Flowjo 소프트웨어를 이용하여 모든 샘플에서 Alexa 430 / PE (F510/F580) 파라미터를 분석하였고, F510/F580 의 분포를 나타내는 히스토그램이 두 개의 peak 로 나뉘는 지점을 기준으로 GSH High (오른쪽 피크), Low cell (왼쪽 피크) 을 나누어 해당하는 세포의 비율을 %로 나타내었다
2)실험결과
본연구실에서 배양된 hUC-MSC 계대배양 4, 7, 15 에 해당하는 세포 모두 RSL3를 처리하지 않은 경우 거의 동인한 패턴의 mGSH의 분포를 보였으나 RSL3 농도와 계대배양 수에 의존적으로 mGSH양 이 감소된 집단이 관찰됨을 확인 할 수 있었다 (도 29, 도 30, 및 도 31).
계대배양을 거듭할수록 세포는 항산화 스트레스를 받는다고 알려져있고 이러한 세포는 세포노화를 겪은 세포이며 줄기세포의 기능이 저하되어있다는 것은 많은 연구를 통해 증명되었다. 이를 바탕으로 본 결과를 해석해본다면 RSL3에 의해 유발된 지질산화스트레스 조건에서 항산화능이 저하된 세포는 그렇지 않은 세포에 비해 mGSH 레벨을 정상적으로 유지하지 못한다고 할 수 있다.
도 32에서 세포형광 이미지 사진에서 보이는 바와 같이 녹색으로 보이는 세포는 mGSH를 유지하는 세포이며 노란색으로 보이는 세포는 mGSH가 감소된 세포이다. 계대배양 가 높은 세포일수록 노란색 세포의 비율이 많아짐을 관찰할 수 있으며 같은 세포 안에서 비교하더라도 노란색세포가 녹색세포에 비해 크기가 크고 넓게 퍼져있는 모양으로 관찰된다. 또한 Ferrostatin-1을 처리하게 되면 RSL3의 효과가 사라지는 것으로 보아, 이는 지질산화스트레스에 의존한 결과라고 볼 수 있다 (도 32).
2. Human dermal fibrolast 에서의 mGSH 발현수준 변동
MSC를 통한 실험과 마찬가지로, 다양한 횟수로 계대 배양된 Human dermal fibrolast 에 RSL3를 처리한 후 Mito-FreSHtracer로 세포를 염색하고 컨포칼 이미징을 통해 mGSH의 양을 유지하는 세포와 유지하지 못한 세포의 비율을 백분율로 나타냈다. 그 결과 중간엽줄기세포의 결과와 마찬가지로 계대 배양을 지속할수록 RSL3의 처리에 의해 mGSH이 감소하는 세포의 비율이 증가하는 것으로 나타났다(도 34 참조)
2. mGSH 발현수준과 CD146의 발현량과의 관계
1) 실험과정
실제 RSL3처리에 의한 지질산화스트레스 조건에서 mGSH 레벨이 떨어진 세포들이 줄기세포의 기능이 저하되어있는가를 확인하기 위해 기존 문헌을 통해 밝혀진 좋은 줄기세포가 높게 발현한다고 알려진 세포표면단백질인 CD146의 발현량을 유세포분석을 통해 확인하였다.
위에서 언급한 유세포분석을 이용한 미토콘드리아 GSH 레벨을 측정하는 방식과 동일한 방법으로 세포를 염색하고 트립신을 이용해 세포를 플레이트에서 떼어낸다. 떼어낸 세포를 형광 물질인 BUV395가 결합된 CD146에 대한 유세포분석용 항체를 4℃ 에서 30분간 처리한 후, PBS로 씻어준다. Flow cytometry 장비를 이용해 GSH 레벨 측정을 위한 F510, F580 형광값과, CD146 발현 측정을 위한 BUV395 형광값을 측정하였다. 그 후, FlowJo 소프트웨어를 이용하여 F510/F580 의 분포를 나타내는 히스토그램이 두 개의 peak 로 나뉘는 지점을 기준으로 GSH High (오른쪽 피크), Low cell (왼쪽 피크) 을 나누고, 해당하는 세포의 CD146 양성 비율을 %로 정량하였다.
2) 실험결과
RSL3 처리 후 Mito-FreSH와 CD146 항체를 동시에 염색하여 mGSH High 세포와 Low 세포에서 CD146의 표면발현량을 비교해보면, P4 hUC-MSC에서 RSL3에 의해 mGSH 레벨이 낮아진 집단은 CD146 mGSH 레벨을 유지한 집단에 비해 CD146 양성 비율이 25% 정도 낮아진 것을 확인하였다 (도 33). 이는 P15 줄기세포의 CD146 양성비율과 비슷한 수치였다. P7은 P4와 비교하여 CD146의 양성 비율이 차이가 없기 때문에 이러한 표면단백질 발현 비율을 이용한 세포의 품질 평가방법으로는 두 세포의 품질을 구분을 할 수 없었지만, 도 31에서와 같이 현 기술을 이용하면 이들의 품질도 구분하여 평가할 수 있었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
참고자료
1. E. ROBBINS et al., J Exp Med. 1970 Jun 1;131(6):1211-22.
2. Georgakopoulou EA et al., Aging(Albany NY), 2013 Jan;5(1):37-50.
3. Thomas Kuilman et al.. Genes Dev. 2010 Nov 15;24(22):2463-79.
4. Jean-Philippe Copp´ et al., Annu Rev Pathol. 2010;5:99-118.
본 발명에 따른 FreSHtracer 및 평가파라미터는 살아있는 줄기세포의 세포 내 GSH 수준을 실시간으로 모니터링하고 GSH 수준에 따라 세포를 분화하는 데 사용되며, 세포 치료제 품질을 측정할 수 있고, 또한 그 품질을 평가할 수 있다.

Claims (12)

  1. 목적하는 세포를 분리하는 단계;
    분리한 세포의 글루타치온의 수준을 측정하는 단계; 및
    글루타치온의 수준에 따른 세포 품질을 판단하는 단계;
    를 포함하는 세포의 품질을 측정하는 방법에서,
    글루타치온의 수준에 따른 세포 품질을 판단하는 단계는 하기 평가파라미터 중 어느 하나 이상인 방법:
    i) 세포의 글루타치온 평균값 또는 중앙값(Glutathione Mean Level, GM);
    ii) 세포의 글루타치온 산포도(Glutathione Heterogeneity, GH);
    iii) 세포의 글루타치온 재생산 능력(Glutathione Regeneration Capacity, GRC); 및
    iv) 산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)
    여기서,
    GM은 세포 FR(FreSHtracer Ratio)이나 F510의 평균값이나 중앙값으로 산출하고,
    GH는 세포 FR이나 F510의 변동계수(Coefficient of variation)이나 강건 변동계수(Robust　coefficient of variation)로 산출하며,
    GRC는 살아있는 세포에 산화제 처리 후 실시간으로 FR이나 F510을 모니터링하여 얻어지는 수치로 제1산화제 처리군의 제 1 곡선하면적(area under the curve, AUC)에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값을 무처리 대조군의 제 3 곡선하면적에서 제2산화제 처리군의 제 2 곡선하면적을 뺀 값으로 나눈 후 100을 곱한 값으로 산출하며,
    ORC는 살아있는 세포에 제1산화제 처리 후 GSH 수준을 정량하여 얻어지는 수치로 GSH 수준을 제1산화제 처리하지 않은 대조군 세포 또는 제1산화제 처리하기 전의 대조군 세포에서 정량된 GSH 수준을 비교하여, GSH 발현이 변동된 세포양으로 산출한 값인, 방법.
  2. 제 1항에 있어서,
    글루타치온의 수준을 측정은 하기 화학식 A 또는 B를 첨가하여 글루타치온의 수준을 측정하는 방법:
    [화학식 A]
    Figure PCTKR2018014825-appb-I000024
    상기 화학식 A에서
    R1 및 R2는 각각 독립적으로 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이거나, R1, R2 및 X가 함께 5각 또는 6각 고리를 이루는 헤테로 사이클로알킬 또는 헤테로 사이클로알케닐이고; R3은 수소 또는 C1-4 직쇄 또는 가지쇄 알킬이며; R4 및 R5는 각각 독립적으로 수소, C1-5 직쇄 또는 가지쇄 알킬, -(CH2)m-COO-C1-5 직쇄 또는 가지쇄 알킬이거나(상기 m는 1-5의 정수이다), R4, R5 및 Y는 함께 C3-7 헤테로 사이클로알킬을 이루고, 상기 헤테로 사이클로알킬은 비치환 또는 R6으로 치환된 헤테로 사이클로알킬이고; 상기 R6은 -COO(CH2)n-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 n은 1-5의 정수이다), -(CONH)-(CH2)o-PPh3 +Cl-(상기 o는 1-5의 정수이다) 또는 -(CONH)-CHR7-COO(CH2)p-OCO-C1-5 직쇄 또는 가지쇄 알킬이며(상기 p는 1-5의 정수이다); 상기 R7은 -(CH2)q-COO(CH2)r-OCO-C1-5 직쇄 또는 가지쇄 알킬(상기 q 및 r은 각각 1-5의 정수이다)이고; X 및 Y는 각각 독립적으로 N 또는 O이거나;
    [화학식 B]
    Figure PCTKR2018014825-appb-I000025
    상기 화학식 B에서
    R1은 하나 이상의 N을 포함하는 3-7원 고리인 헤테로사이클로알킬이다.
  3. 제 2항에 있어서,
    화학식 A 또는 B는 하기 화학식 중 어느 하나인 방법.
    [화학식 A-2]
    Figure PCTKR2018014825-appb-I000026
    [화학식 A-3]
    Figure PCTKR2018014825-appb-I000027
    [화학식 A-4]
    Figure PCTKR2018014825-appb-I000028
    [화학식 A-5]
    Figure PCTKR2018014825-appb-I000029
    [화학식 A-6]
    Figure PCTKR2018014825-appb-I000030
    [화학식 B-2]
    Figure PCTKR2018014825-appb-I000031
    [화학식 B-3]
    Figure PCTKR2018014825-appb-I000032
    [화학식 B-4]
    Figure PCTKR2018014825-appb-I000033
    [화학식 B-5]
    Figure PCTKR2018014825-appb-I000034
    [화학식 B-6]
    Figure PCTKR2018014825-appb-I000035
    [화학식 B-7]
    Figure PCTKR2018014825-appb-I000036
    [화학식 B-8]
    Figure PCTKR2018014825-appb-I000037
  4. 제 1항에 있어서,
    FR은 430-550 nm에서 형광 세기 (F510) 및 550-680 nm에서 형광 세기 (F580)의 비율인, 방법.
  5. 제 1항에 있어서,
    산화 스트레스를 처리하기 전이나 처리한 후에 세포의 글루타치온 평균값 또는 중앙값은 증가할수록 양질의 품질인, 방법.
  6. 제 1항에 있어서,
    산화 스트레스를 처리하기 전이나 처리한 후에 세포의 글루타치온 산포도(Glutathione Heterogeneity, GH)는 감소할수록 양질의 품질인, 방법.
  7. 제 1항에 있어서,
    세포의 글루타치온 재생산 능력(Glutathione Regeneration Capacity, GRC)은 증가할수록 양질의 품질인, 방법.
  8. 제 1항에 있어서,
    산화스트레스 저항 능력(Oxidative Stress Resistance Capacity, ORC)은 산화제 처리시 측정한 GSH 양이, 산화제 처리하지 않은 대조군 세포 또는 산화제 처리하기 전의 대조군 세포의 GSH 양에 비해 감소한 세포의 수가 적거나, 산화제 처리하지 않은 대조군 세포 또는 산화제 처리하기 전의 대조군 세포의 GSH 양보다 높거나 그 양과 같은 세포의 수가 많을수록 양질의 품질인, 방법
  9. 제 1항에 있어서,
    제1산화제는 H2O2, 및 tert-부틸 과산화물을 포함한 히드로과산화물 (hydroperoxide); 디아미드, GSSG (oxidized GSH), 5,5′-디티오비스(2-니트로벤조산), 말레이미드, N-에틸말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산 및 요오드아세트아미드을 포함한 티올 산화제; 비스-클로로에틸니트로조우레아를 포함한 글루타치온 환원효소 억제제; PX-12을 포함한 티오레독신 억제제; 안티마이신 A, 로테논, 올리고마이신 및 카르보닐 시아나이드 m-클로로페닐 하이드라존을 포함한 미토콘드라아 전달전달계 억제제; 포르볼 12-미리스테이트 13-아세테이트을 포함한 NADPH 산화효소 활성화제; 1S,3R-RAS-셀렉티브 레탈 3(1S,3R-RAS- selective lethal 3; 1S,3R-RSL3), DPI19, DPI18, DPI17, DPI13, DPI12, DPI10 (ML210), DPI7 (ML162), 또는 알트레타민을 포함한 gpx4 억제제; 에라스틴(Erastin), 설파살라진, 소라페닙, 글루타메이트, 피페라진 에라스틴, 이미다졸 케톤 에라스틴, 및 에라스틴 유사체를 포함한 시스템 x- c 억제제; 페로토시스 유도체 56(FIN56)를 포함한 GPX4 단백질량 및 CoQ10 양 감소유도제; 카스파제-의존성 레탈 56 (CIL56) 및 페로토시스 유도체 엔도페록시드 (FINO2)를 포함한 지질 과산화유도제; 부티오닌-(S, R)-설폭시민을 포함한 글루탐산염 시스타인 연결효소 (GCL) 억제제; 디에틸말레산염을 포함한 GSH 감소 유도제; DPI2, 시스플라틴, 시스테네이즈(cysteinase), 스타틴, 구연산 철 암모늄, 트리고넬린, 사염화탄소, 실리카계 나노입자 및 비열플라즈마를 포함하는, 방법.
  10. 제 1항에 있어서,
    제2산화제는 말레이미드, 4-말레이미도부티르산, 3-말레이미도프로피온산, 에틸말레이미드, N-에틸말레이미드, 요오드아세트아미드, 5,5′-디티오비스(2-니트로벤조산), 또는 요오드아세트아미도프로피온산을 포함하는, 방법.
  11. 제 1항에 있어서,
    목적하는 세포는 성체줄기세포, 배아줄기세포 및 유도만능줄기세포(induced pluripotent stem cell)로 구성된 군으로부터 선택된 어느 하나인 줄기세포;
    수지상세포(dendritic cell), 자연살해세포(natural killer cell), T 세포(T cell), B 세포 (B cell), 조절 T 세포 (regulatory T cell, Treg cell), 자연 살해 T 세포(natural killer T cell), 선천성 림프구 세포(Innate lymphoid cell), 대식세포(macrophage), 과립구(Granulocyte), 키메릭 항원 수용체 발현 T 세포(CAR-T: Chimeric antigen receptor-T cell), 림포카인 활성 살해세포(LAK: Lymphokine-activated killer Cell) 및 사이토카인 유도성 살해세포(CIK: Cytokine Induced Killer Cell)로 구성된 군으로부터 선택된 어느 하나인 면역세포;
    섬유아세포(fibroblast), 연골세포(chondrocyte), 활액막 세포(synovial cell), 피부각질세포(keratinocyte), 지방세포(adipocyte), 조골세포(osteoblast), 파골세포(osteoclast) 및 말초혈액 단핵세포(peripheral blood mononuclear cell) 로 구성된 군으로부터 선택된 어느 하나인 체세포(Somatic cell);
    CHO 세포, NS0 세포, Sp2/0 세포, BHK 세포, C127 세포, HEK293 세포, HT-1080 세포, PER.C6 세포로 구성된 군으로부터 선택된 어느 하나인 단백질 제재의 생산에 사용되는 세포주; 또는
    인체나 동물의 구강, 비강, 폐, 피부, 위장관, 비뇨관 등에서 유래한 미생물로 구성된 군으로부터 선택된 어느 하나인 인체 마이크로바이옴 (Microbiome)인, 방법.
  12. 제 11항에 있어서,
    T 세포는 조절 T 세포(Treg cell)를 제외한 것인, 방법.
PCT/KR2018/014825 2017-11-28 2018-11-28 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법 WO2019107917A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2020546265A JP7262126B2 (ja) 2017-11-28 2018-11-28 リアルタイムなグルタチオンの測定による治療用細胞の品質測定方法
CN201880077236.1A CN111492248B (zh) 2017-11-28 2018-11-28 通过实时谷胱甘肽测定来测量治疗细胞质量的方法
EP18884812.1A EP3719501B1 (en) 2017-11-28 2018-11-28 Method for measuring quality of therapeutic cell through real-time glutathione measurement
US16/768,014 US11499978B2 (en) 2017-11-28 2018-11-28 Method for measuring quality of therapeutic cell through real-time glutathione measurement

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170160563 2017-11-28
KR10-2017-0160563 2017-11-28
KR10-2018-0094878 2018-08-14
KR20180094878 2018-08-14

Publications (1)

Publication Number Publication Date
WO2019107917A1 true WO2019107917A1 (ko) 2019-06-06

Family

ID=66664203

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2018/014825 WO2019107917A1 (ko) 2017-11-28 2018-11-28 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법
PCT/KR2018/014815 WO2019107913A1 (ko) 2017-11-28 2018-11-28 실시간 글루타치온 측정을 통한 치료용 세포의 품질 향상 방법

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/014815 WO2019107913A1 (ko) 2017-11-28 2018-11-28 실시간 글루타치온 측정을 통한 치료용 세포의 품질 향상 방법

Country Status (6)

Country Link
US (2) US11841369B2 (ko)
EP (2) EP3719500B1 (ko)
JP (2) JP7262126B2 (ko)
KR (2) KR102145929B1 (ko)
CN (2) CN111492248B (ko)
WO (2) WO2019107917A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112794857A (zh) * 2019-11-13 2021-05-14 湖南超亟化学科技有限公司 一种可用于亚铁离子高选择性检测的新型荧光探针制备和应用

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019107917A1 (ko) * 2017-11-28 2019-06-06 주식회사 셀투인 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법
KR102407791B1 (ko) * 2019-08-23 2022-06-10 가톨릭대학교 산학협력단 조혈모세포의 줄기세포성 측정용 조성물 및 이를 이용한 방법
KR102347906B1 (ko) * 2019-12-30 2022-01-06 주식회사 셀투인 소포체 내 글루타치온 측정용 실시간 형광 이미징 센서 및 이를 이용하는 방법
WO2021216866A1 (en) * 2020-04-24 2021-10-28 The Trustees Of Columbia University In The City Of New York Methods for treating diseases by targeting oncogenic lipids
KR102428120B1 (ko) * 2020-09-23 2022-08-04 주식회사 티에스바이오 신규 줄기세포 배양용 조성물
CN116762010A (zh) * 2020-12-22 2023-09-15 塞尔吐温株式会社 用于选择高质量干细胞的标记物，以及使用其选择高质量干细胞的方法
CN112791062B (zh) * 2021-01-11 2022-03-08 齐鲁工业大学 一种细胞膜包覆Au-Fe3O4的靶向纳米材料及其制备方法和应用
CN113975291B (zh) * 2021-10-27 2023-02-28 深圳先进技术研究院 一种铁死亡诱导剂及其制备方法和应用
USD1007676S1 (en) 2021-11-16 2023-12-12 Regeneron Pharmaceuticals, Inc. Wearable autoinjector
US11541116B1 (en) 2022-01-07 2023-01-03 Kojin Therapeutics, Inc. Methods and compositions for inducing ferroptosis in vivo
CN116036087B (zh) * 2022-12-26 2023-09-05 中国人民解放军空军军医大学 铁死亡抑制剂在制备修复受损肝脏药物中的用途

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5185443B2 (ja) 2009-07-15 2013-04-17 真理 出澤 生体組織から分離できる多能性幹細胞画分
KR20160059978A (ko) * 2014-11-19 2016-05-27 메타볼랩(주) 세포의 티올 수준을 측정하기 위한 실시간 이미징 센서
WO2017016631A1 (en) * 2015-07-30 2017-02-02 Merck Patent Gmbh Method for increasing the glutathione level in cells
KR20170107429A (ko) 2014-12-23 2017-09-25 막스-플랑크-게젤샤프트 츄어 푀르더룽 데어 비쎈샤프텐 에.파우. 스펙트럼 샘플 반응을 측정하기 위한 방법 및 장치

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11118792A (ja) * 1997-10-17 1999-04-30 Ajinomoto Co Inc マクロファージの分類方法、免疫性疾患等の検定方法及び免疫性疾患治療剤のスクリーニング方法
KR20010078585A (ko) * 2001-06-20 2001-08-21 복성해 효소역학을 이용한 산화형·환원형 글루타치온의 정량적고속측정방법
US6969592B2 (en) * 2001-09-26 2005-11-29 Pharmacia Italia S.P.A. Method for predicting the sensitivity to chemotherapy
WO2006043671A1 (ja) 2004-10-22 2006-04-27 Kirin Beer Kabushiki Kaisha 転写因子Ｎｒｆ２活性化剤およびその機能が付与された食品
EP1877044A4 (en) * 2005-04-21 2009-09-02 Glenn A Goldstein AMIDE N-ACETYLCYSTEINE (AMIDE NAC) FOR THE TREATMENT OF DISEASES AND DISORDERS ASSOCIATED WITH OXIDATIVE STRESS
US20070092632A1 (en) * 2005-10-21 2007-04-26 Stan Kubow Ultra high pressure modified proteins and uses thereof
WO2008019060A2 (en) * 2006-08-03 2008-02-14 U.S. Department Of Veterans Affairs Office Of General Counsel-Psg Iv (024) Method for predicting onset/risk of atrial fibrillation (af)
JP5466842B2 (ja) 2008-10-29 2014-04-09 ポーラ化成工業株式会社 グルタチオン産生促進組成物
CN104717970A (zh) * 2012-07-23 2015-06-17 万德-生物技术及制药有限公司 提高谷胱甘肽的组合物及其用途
ES2815552T3 (es) * 2015-08-24 2021-03-30 Vitrolife Sweden Ab Medio de cultivo
WO2019107917A1 (ko) * 2017-11-28 2019-06-06 주식회사 셀투인 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5185443B2 (ja) 2009-07-15 2013-04-17 真理 出澤 生体組織から分離できる多能性幹細胞画分
KR20160059978A (ko) * 2014-11-19 2016-05-27 메타볼랩(주) 세포의 티올 수준을 측정하기 위한 실시간 이미징 센서
KR20170107429A (ko) 2014-12-23 2017-09-25 막스-플랑크-게젤샤프트 츄어 푀르더룽 데어 비쎈샤프텐 에.파우. 스펙트럼 샘플 반응을 측정하기 위한 방법 및 장치
WO2017016631A1 (en) * 2015-07-30 2017-02-02 Merck Patent Gmbh Method for increasing the glutathione level in cells

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHO, A YOUNG: "A coumarin-based fluorescence sensor for the reversible detection of thiols", CHEMISTRY LETTERS, 2012, pages 1611 - 1612, XP055309332, DOI: 10.1246/cl.2012.1611 *
DANNENMANN, BENJAMIN: "High glutathione and glutathione peroxidase-2 levels mediate cell -type-specific DNA damage protection in human induced pluripotent stem cells", STEM CELL REPORTS, 12 May 2015 (2015-05-12), pages 886 - 898, XP055455633, DOI: 10.1016/j.stemcr.2015.04.004 *
E. ROBBINS ET AL., J EXP MED., vol. 131, no. 6, 1 June 1970 (1970-06-01), pages 1211 - 22
GEORGAKOPOULOU EA ET AL., AGING, vol. 5, no. 1, January 2013 (2013-01-01), pages 37 - 50
JEAN-PHILIPPE COPP ET AL., ANNU REV PATHOL., vol. 5, 2010, pages 99 - 118
JEONG, EUI MAN: "Real-time monitoring of glutathione in living cells reveals that high glutathione levels are required to maintain stem cell function", STEM CELL REPORTS, 4 January 2018 (2018-01-04), pages 600 - 614, XP055616173 *
KIM, YEONG HWAN ET AL.: "Converging Translational Research Center for the Development of Pulmonary Fibrosis Therapeutics", FINAL REPORT, SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION, April 2014 (2014-04-01), pages 1 - 241, XP009520719 *
THOMAS KUILMAN ET AL., GENES DEV., vol. 24, no. 22, 15 November 2010 (2010-11-15), pages 2463 - 79

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112794857A (zh) * 2019-11-13 2021-05-14 湖南超亟化学科技有限公司 一种可用于亚铁离子高选择性检测的新型荧光探针制备和应用
CN112794857B (zh) * 2019-11-13 2023-09-19 湖南超亟检测技术有限责任公司 一种可用于亚铁离子检测的荧光探针及制备和应用

Also Published As

Publication number Publication date
CN111480080A (zh) 2020-07-31
EP3719501B1 (en) 2023-01-04
JP2021504727A (ja) 2021-02-15
KR20190062313A (ko) 2019-06-05
US20210003582A1 (en) 2021-01-07
US20200363422A1 (en) 2020-11-19
JP7336143B2 (ja) 2023-08-31
KR20190062311A (ko) 2019-06-05
CN111492248B (zh) 2023-09-12
CN111492248A (zh) 2020-08-04
CN111480080B (zh) 2023-09-19
KR102119714B1 (ko) 2020-06-16
US11841369B2 (en) 2023-12-12
EP3719501A4 (en) 2021-07-07
WO2019107913A1 (ko) 2019-06-06
EP3719500B1 (en) 2023-01-04
JP2021503957A (ja) 2021-02-15
EP3719500A1 (en) 2020-10-07
US11499978B2 (en) 2022-11-15
EP3719501A1 (en) 2020-10-07
JP7262126B2 (ja) 2023-04-21
KR102145929B1 (ko) 2020-08-20
EP3719500A4 (en) 2021-07-14

Similar Documents

Publication Publication Date Title
WO2019107917A1 (ko) 실시간 글루타치온 측정을 통한 치료용 세포의 품질 측정 방법
WO2018124642A9 (ko) 치수줄기세포의 상아 모전구세포로의 분화용 조성물 및 상아모전구세포 표면에 특이적으로 결합하는 IgG 또는 IgM 타입 단일 클론 항체
WO2018135902A1 (ko) 줄기 세포로부터 분화 유도된 연골세포의 제조방법
WO2019083281A2 (ko) 신규한 근골격계 줄기세포
WO2018190656A1 (ko) In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도
WO2018021879A1 (ko) 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법
WO2021045374A1 (ko) 증식 가능한 간 오가노이드 분화용 배지 조성물 및 이를 이용한 간 오가노이드의 제조방법
WO2022025559A1 (ko) 줄기세포 유래 엑소좀을 포함하는 조성물 및 이의 제조방법
WO2011081465A2 (ko) 혈관신생 억제용 약제학적 조성물
WO2018135907A1 (ko) 슈반 세포 전구체 및 이로부터 분화된 슈반 세포의 제조 방법
WO2022004938A1 (ko) 유사 중간엽 줄기세포의 제조방법
WO2023043278A1 (ko) 항암제 효능 평가 또는 스크리닝 방법
WO2013162330A1 (ko) 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법
WO2021091185A1 (ko) 측분비인자를 포함하는 세포 배양용 조성물
WO2021054806A1 (ko) 직접 리프로그래밍을 통한 유도 도파민성 신경세포 전구체의 제조방법
WO2009151207A1 (ko) 인간 간성장인자를 발현하는 중간엽 줄기세포, 그의 제조방법 및 그의 간질환 치료제로서의 용도
WO2019059713A2 (ko) 자연살해세포의 제조방법 및 그의 용도
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2020149538A1 (ko) 클로날 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 약학적 조성물
WO2024205363A1 (ko) 적혈구 및 혈소판의 제조 방법
WO2020190023A9 (ko) 단일 클로날 줄기세포를 이용한 아토피 피부염 치료 방법
WO2020004698A1 (ko) 세포배양용 배지 조성물 제조방법, 세포배양용 배지 조성물 제조방법과 줄기세포 유효성분 3저 추출법을 이용한 줄기세포파쇄추출물(쉘드줄기세포) 제조방법, 이를 이용한 항관절염 치료용 조성물, 이를 이용한 항염증 치료용 조성물 및 세포재생 치료용 조성물
WO2020017676A1 (ko) Fresh-트레이서 기반 분리된 세포의 유전자 프로파일의 응용
WO2023200257A1 (ko) 줄기세포로부터 분리된 세포외 소포체 및 이의 용도
WO2021145467A1 (ko) 인간 만능 줄기세포로부터 제작된 3d 오가노이드를 해체하여 세포를 다량 확보하는 분화방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18884812

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020546265

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018884812

Country of ref document: EP

Effective date: 20200629