WO2018021879A1 - 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법 - Google Patents

암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법 Download PDF

Info

Publication number
WO2018021879A1
WO2018021879A1 PCT/KR2017/008176 KR2017008176W WO2018021879A1 WO 2018021879 A1 WO2018021879 A1 WO 2018021879A1 KR 2017008176 W KR2017008176 W KR 2017008176W WO 2018021879 A1 WO2018021879 A1 WO 2018021879A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
carcinoma
cells
stem cells
medium
Prior art date
Application number
PCT/KR2017/008176
Other languages
English (en)
French (fr)
Inventor
라정찬
김은영
Original Assignee
라정찬
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 라정찬 filed Critical 라정찬
Priority to JP2019527108A priority Critical patent/JP6918943B2/ja
Priority to CN201780058891.8A priority patent/CN109790516A/zh
Priority to US16/321,520 priority patent/US11788061B2/en
Priority to EP17834820.7A priority patent/EP3492585A4/en
Publication of WO2018021879A1 publication Critical patent/WO2018021879A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0665—Blood-borne mesenchymal stem cells, e.g. from umbilical cord blood
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/12—Light metals, i.e. alkali, alkaline earth, Be, Al, Mg
    • C12N2500/14—Calcium; Ca chelators; Calcitonin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/33—Insulin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/38—Hormones with nuclear receptors
    • C12N2501/39—Steroid hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/30—Coculture with; Conditioned medium produced by tumour cells

Definitions

  • the present invention relates to a culture medium composition of mesenchymal stem cells for cancer treatment while inhibiting the proliferation of cancer cells while maintaining the activity, and more particularly, for producing mesenchymal stem cells having improved cancer cell proliferation inhibitory ability containing vitamin C and aspirin. It relates to a medium composition.
  • Stem cells are cells that have the ability of self-replication and differentiate into two or more cells. Totipotent stem cells, pluripotent stem cells, and multipotent stem cells can be classified as a multipotent stem cell.
  • Pluripotent stem cells are pluripotent cells that can develop into a complete individual. Cells up to 8 cell stages after fertilization of eggs and sperm have these properties. If you transplant it into a single, complete entity.
  • Pluripotent stem cells are cells that can develop into various cells and tissues derived from ectoderm, mesoderm, and endoderm.Inner cell mass located inside the blastocyst after 4-5 days of fertilization. They are called embryonic stem cells and differentiate into a variety of other tissue cells but do not form new life.
  • Multipotent stem cells are stem cells that can only differentiate into cells specific to the tissues and organs in which they are contained. In addition to growth and development, it is involved in maintaining homeostasis of adult tissues and inducing regeneration in tissue damage. Tissue-specific pluripotent cells are collectively called mesenchymal stem cells.
  • Mesenchymal stem cells (Rebecca SY Wong, et al., J Biomed Biotechnol 24: 2011, 2011) have been used for cell-based treatment in a variety of disease states, such as heart disease, osteopenic insufficiency and spinal cord injury. It is becoming.
  • recent studies on cell-based therapy and regenerative medicine using urine-derived stem cells (Bharadwaj et al., Stem Cells. 31 (9): 1840-56, 2013; Zhang D et al., Genes Dis. 1): 8-17, 2014; Guan et al., Tissue Eng, 20 (13-14): 1794-806, 2014).
  • cancer is characterized by "uncontrolled cell growth,” and this abnormal cell growth forms a mass of cells called tumors, which infiltrate the surrounding tissues and, in severe cases, metastasize to other organs of the body. Sometimes. Academia is also called neoplasia.
  • Anticancer drugs act on unlimited proliferating cancer cells to inhibit the growth and growth of cancer cells.
  • Alkylated anticancer agents such as cisplatin and cyclophosphamide, which are widely used at present, exhibit anticancer activity by covalently binding to nitrogen in nucleotides, which is a component of DNA, and 5-fluorouracil ) Inhibits the enzymes involved in the biosynthesis of nucleic acids, or is directly inserted into DNA or RNA to show activity.
  • antibiotics such as adriamycin have a strong anti-cancer effect by inhibiting DNA's intrinsic function by acting strongly on DNA.
  • these anticancer agents act on bone marrow cells or intestinal epitherium cells that rapidly proliferate and differentiate not only tumor cells but also normal cells, especially living cells, such as pneumonia, vomiting and neurotoxicity. There are drawbacks accompanying various side effects.
  • cancer stem cells remain in a resting state and show less aggressive forms than metastatic cancer cells. Therefore, since the cancer cells are excluded from the attack and survive, the tumors cannot be completely removed only by inducing the death of general cancer cells present in the tumors.
  • the present inventors have made intensive efforts to develop cancer treatments using mesenchymal stem cells that can overcome side effects such as anticancer drugs, and thus, mesenchymal stems in a medium to which aspirin, vitamin C, and the like are added.
  • mesenchymal stem cells thus prepared to inhibit the proliferation of cancer cells while maintaining the activity of the cells, to complete the present invention.
  • An object of the present invention is to provide a medium composition for producing mesenchymal stem cells having improved cancer cell proliferation inhibiting ability containing vitamin C and aspirin, and to prepare mesenchymal stem cells having improved cancer cell proliferation inhibiting ability by culturing mesenchymal stem cells in the medium. To provide a method.
  • the present invention provides a medium composition for producing mesenchymal stem cells having an improved ability to inhibit cancer cell proliferation containing aspirin.
  • the present invention also provides a method for producing mesenchymal stem cells having improved cancer cell proliferation inhibiting ability comprising culturing the mesenchymal stem cells in aspirin-containing medium.
  • the present invention also provides a use of the medium composition for producing stem cells containing aspirin for the production of mesenchymal stem cells having improved cancer cell proliferation inhibitory ability.
  • Figure 2 shows the form of Vit.C-MSC cultured in aspirin containing medium.
  • Figure 3 shows the growth rate, viability and cell size of Vit.C-MSC cultured in aspirin containing medium.
  • Figure 4 is a photograph showing the results of the CFA (colony forming assay) of Vit. C-MSC cultured in aspirin-containing medium.
  • Figure 6 shows the FACS analysis of CD marker expression of Vit.C-MSC cultured in aspirin-free control medium.
  • Figure 7 shows the FACS analysis of CD marker expression of Vit.C-MSC cultured in 0.1 mM aspirin-containing medium.
  • FIG. 8 shows FACS analysis of CD marker expression of Vit.C-MSC cultured in 0.5 mM aspirin-containing medium.
  • Figure 9 is analyzed by FACS CD marker expression of Vit.C-MSC cultured in 1mM aspirin containing medium.
  • FIG. 11 shows the degree of differentiation of Vit.C-MSCs into adipocytes cultured in an aspirin-containing medium at absorbance at 520 nm.
  • Fig. 13 shows the degree of differentiation of Vit.C-MSCs into osteoblasts cultured in aspirin-containing medium at absorbance at 560 nm.
  • FIG. 14 shows co-culture of Vit.C-MSC and MCF-7 cancer cells cultured in aspirin-containing medium in cancer cell culture medium, and confirms the distribution of cancer cells by FACS. .
  • FIG. 15 shows co-culture of Vit.C-MSC and PANC-1 cancer cells cultured in aspirin-containing medium in cancer cell culture medium, and confirms the distribution of cancer cells by FACS. .
  • Figure 16 shows the effect of inhibiting cancer cell proliferation after direct co-culture of Vit.C-MSC and breast cancer MCF-7 or pancreatic cancer PANC-1 cancer cells cultured in 0.5 mM aspirin-containing medium in cancer cell culture medium.
  • Figure 17 shows the number of cancer cells after indirect co-culture of Vit.C-MSC and MCF-7 cancer cells cultured in aspirin-containing medium in cancer cell culture medium.
  • Figure 18 shows the number of cancer cells after indirect co-culture of Vit.C-MSC and PANC-1 cancer cells cultured in aspirin-containing medium in cancer cell culture medium.
  • FIG. 19 shows the effect of inhibiting cancer cell proliferation after indirect co-culture of Vit.C-MSC and breast cancer MCF-7 or pancreatic cancer PANC-1 cancer cells cultured in 0.5 mM aspirin-containing medium in cancer cell culture medium.
  • Figure 21 shows the quantitative expression of Fas L in Vit.C-MSC cultured in aspirin containing medium at 0.1, 0.5 and 1 mM concentration by real-time PCR.
  • FIG. 22 shows the comparison of TRAIL expression by RT-PCR in Vit.C-MSCs cultured in 0.1, 0.5 and 1 mM aspirin containing media.
  • FIG. 23 compares the expression levels of Fas L, TRAIL and CXCR4 in Vit.C-MSCs cultured in 0.5 mM aspirin-containing medium.
  • Figure 24 shows the expression of VEGF in Vit.C-MSC cultured in aspirin containing medium at 0.1, 0.5 and 1 mM concentrations after (A) RT-PCR (B).
  • Vit.C MSC 2: 0.1mM ASP-Vit.C MSC, 3: 0.5mM ASP-Vit.C MSC, 4: 1mM ASP-Vit.C MSC
  • Figure 26 shows the comparison of Sox2, Oct4 and Nanog expression in Vit.C-MSC cultured in 0.5mM aspirin containing medium.
  • Figure 27 shows the expression of Bcl-2 gene in cancer cells cultured indirectly in Vit.C-MSC (Angel-Stem Cell) and cancer cell culture conditions in 0.5mM aspirin-containing medium.
  • Figure 28 shows the expression of PPAR- ⁇ gene in cancer cells cultured indirectly in Vit.C-MSC (Angel-Stem Cell) and cancer cell culture conditions in aspirin-containing medium.
  • Figure 29 shows the expression of Apaf-1 gene in cancer cells cultured indirectly in Vit.C-MSC (Angel-Stem Cell) cultured in aspirin-containing medium and cancer cell culture conditions.
  • Vit.C-MSC Angel-Stem Cell
  • Figure 30 shows the expression of Oct4 gene in cancer cells cultured indirectly in Vit.C-MSC (Angel-Stem Cell) and cancer cell culture conditions in aspirin-containing medium.
  • Embryos are known to have a multipotent that can differentiate only into cells specific to tissues and organs as stem cells appearing at the stage of formation of each organ of the embryo or adult stage as the developmental process progresses.
  • These stem-specific stem cells are stem cells capable of differentiating only into cells specific to the tissues and organs that contain the cells, and each tissue and organ of the prenatal, neonatal and adult periods. In addition to growth and development, it is involved in maintaining homeostasis of adult tissues and inducing regeneration in tissue damage.
  • adult stem cells preferably human stem cells derived from humans can be used.
  • MSCs mesenchymal stem cells
  • AT-MSCs human adipose tissue-derived mesenchymal stem cells
  • Urine-derived stem cells of the present invention have self-renewal and multipotent and express mesenchymal stem cell markers. That is, they can differentiate into mesodermal cell lineages such as endothelial cells, osteogenic cells, chondrocytes, adipocytes, and skeletal muscle cells and endoderm cell lineages such as urothelial cells.
  • mesodermal cell lineages such as endothelial cells, osteogenic cells, chondrocytes, adipocytes, and skeletal muscle cells and endoderm cell lineages such as urothelial cells.
  • urine-derived stem cells are known to have high telomerase activity and long telomeres (Bharadwaj et al. , Stem Cells. 31 (9): 1840-56, 2013; Stem Cells: Current Challenges and New Directions Part of the series Stem Cell Biology and Regenerative Medicine, 19-28: 2013).
  • stem cell used in the present invention refers to a cell having the ability of self-replicating and differentiating into two or more cells, and "adult stem cell” refers to each organ of the embryo during development. Refers to stem cells appearing in the stage of formation or adulthood.
  • meenchymal stem cell used in the present invention is an undifferentiated stem cell isolated from human or mammalian tissue, and may be derived from various tissues.
  • umbilical cord-derived mesenchymal stem cells umbilical cord blood-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells, muscle-derived mesenchymal stem cells, nerve-derived mesenchymal stem cells, skin-derived mesenchymal stem cells , Amnion derived mesenchymal stem cells and placental derived mesenchymal stem cells, and techniques for isolating stem cells from each tissue are already known in the art.
  • fat-derived stem cell used in the present invention is an undifferentiated stem cell isolated from adipose tissue, and the separation method may be as follows. In other words, the suspension containing fat suspended in physiological saline obtained from liposuction, and then treated with trypsin of the stem cell layer attached to the culture vessel, such as a flask and recovered or scraped with a scraper to directly float in a small amount of physiological saline. Adipose-derived mesenchymal stem cells can be separated by a method such as recovery.
  • adult tissue-derived adult stem cells or "fatty tissue-derived mesenchymal stem cells” are undifferentiated adult stem cells isolated from adipose tissue, and may be abbreviated herein as “fat stem cells”. This can be obtained through conventional methods known in the art.
  • a conventional medium known in the art to be suitable for culturing stem cells may be used.
  • DMEM Densbecco's modified Eagle medium
  • Keratinocyte-SFM Keratinocyte serum free medium
  • Iscove's Modified Dulbecco's Medium IMDM
  • Alpha Modification of Eagle's Medium A-MEM
  • Nutrient Mixture F-12 F12
  • Dulbecco's Modified Eagle Medium Nutrient Mixture F-12 (DMEM / F12) Mixed media
  • IMDM Iscove's Modified Dulbecco's Medium
  • A-MEM Alpha Modification of Eagle's Medium
  • F12 Nutrient Mixture F-12
  • Dulbecco's Modified Eagle Medium Nutrient Mixture F-12 (DMEM / F12) Mixed media
  • DMEM Nutrient Mixture F-12
  • Adipose stem cell culture medium may be supplemented with an additive that promotes proliferation of the undifferentiated phenotype of adipose stem cells while inhibiting differentiation.
  • the medium generally contains neutral buffers (such as phosphates and / or high concentrations of bicarbonate) and protein nutrients (such as serum, such as FBS, serum substitutes, albumin, or essential and non-essential amino acids, such as glutamine) in isotonic solutions. can do.
  • lipids fatty acids, cholesterol, HDL or LDL extracts of serum
  • other components found in most preservative media of this kind such as insulin or transferrin, nucleosides or nucleotides, pyruvate salts, any ionized form or salt
  • Sugar sources such as glucose, selenium, glucocorticoids such as hydrocortisone and / or reducing agents such as ⁇ -mercaptoethanol.
  • the medium also contains anti-clumping agents, such as those sold by Invitrogen (Cat # 0010057AE), with the aim of preventing the cells from adhering to each other, adhering to the vessel wall, or forming too large a bundle. It can be beneficial to do so.
  • anti-clumping agents such as those sold by Invitrogen (Cat # 0010057AE)
  • the medium for obtaining or culturing the adipose stem cells used in one embodiment of the present invention is a basal medium selected from the group consisting of DMEM, Defined Keratinocyte-SFM, ⁇ -MEM, IMDM, F12 and DMEM / F12, L It is preferable to contain aspirin in the medium composition for mesenchymal stem cell culture containing ascorbic acid 2-phosphate (vitamin C), fetal bovine serum and N-acetyl-L-cysteine.
  • vitamin C ascorbic acid 2-phosphate
  • fetal bovine serum fetal bovine serum
  • N-acetyl-L-cysteine N-acetyl-L-cysteine
  • the medium is 0.05-1 mM ascorbic acid 2-phosphate, 2-20% fetal bovine serum, 0.2-20 mM N-acetyl-L-cysteine and 0.1 to It may be characterized by containing 1mM aspirin, but is not limited thereto.
  • the present invention relates to a medium composition for producing mesenchymal stem cells having improved cancer cell proliferation inhibiting ability containing aspirin.
  • the present invention relates to a method for producing mesenchymal stem cells having improved cancer cell proliferation inhibiting ability, comprising culturing the mesenchymal stem cells in aspirin-containing medium.
  • the present invention relates to the use of the medium composition for producing stem cells containing aspirin for the production of mesenchymal stem cells having improved cancer cell proliferation inhibiting ability.
  • the medium preferably further comprises vitamin C, but is not limited thereto.
  • DMEM DMEM or K-SFM containing 5-10% FBS and NAC (N-acetyl Cystein), and more preferably calcium, rEGF, insulin and hydrocortisone. It is not limited.
  • the mesenchymal stem cells are preferably pretreated with vitamin C, but are not limited thereto.
  • the mesenchymal stem cells are preferably derived from a tissue selected from the group consisting of fat, uterus, bone marrow, muscle, placenta, umbilical cord blood, urine, hair follicles and skin, and more preferably from fat, It is not limited.
  • the concentration of the aspirin is preferably 0.1mM to 1mM, but is not limited thereto.
  • the incubation time is preferably 24 hours, but is not limited thereto.
  • the cancer cells are glioma, neuroeducoma, anaplastic astrocytoma, medulloblastoma, lung cancer, small cell lung carcinoma, cervical carcinoma, colon cancer, rectal cancer, chordoma, throat cancer, Kaposi's sarcoma, lymphatic sarcoma, lymphatic endothelium Sarcoma, colorectal cancer, endometrial cancer, ovarian cancer, leukemia, prostate cancer, renal cell carcinoma, liver carcinoma, cholangiocarcinoma, chorionic carcinoma, normal carcinoma, testicular tumor, Wilm's tumor, Ewing's tumor, bladder carcinoma, angiosarcoma, endothelial sarcoma , Adenocarcinoma, Korean gland carcinoma, Sebaceous gland carcinoma, Papillary carcinoma, Papilloma sarcoma, Cyst adenocarcinoma, Bronchial carcinoma, Medulla carcinoma, Mast cell carcinoma, Mesothelioma,
  • the present invention provides a method for treating cancer, comprising the step of administering mesenchymal stem cells having improved cancer cell proliferation inhibiting ability prepared by culturing the mesenchymal stem cells in aspirin-containing medium.
  • the present invention provides a use of mesenchymal stem cells having improved cancer cell proliferation inhibitory ability, which is prepared by culturing mesenchymal stem cells in aspirin-containing medium, for the treatment of cancer.
  • 'Cancer' is characterized by uncontrolled cell growth, and this abnormal cell growth forms a mass of cells called tumors that penetrate into surrounding tissues and, in severe cases, metastasize to other organs of the body.
  • anti-cancer' includes not only treatment of cancer diseases, ie, inhibiting the proliferation of cancer cells or cancer stem cells, or killing cancer cells or cancer stem cells, but also prevention of cancer diseases, that is, increasing resistance to cancer before the onset of cancer. It is interpreted as. Therefore, the terms “cancer prevention or treatment” or “inhibition of cancer proliferation” and the term “anticancer” are used interchangeably herein.
  • cancer cells include cells with abnormal cell growth due to genetic modification during normal cell proliferation and growth, and cells with aggressive other organ mobility, which may be referred to as an ex.
  • cancer stem cells are known to exist in tumors and are thought to be caused by abnormal metastasis of genetic information of normal stem cells. Cancer stem cells are maintained and proliferated due to the presence of a microenvironment, a niche for their survival, and it is known that normal cells, immune-related cells, or differentiated cancer cells existing around them affect these properties.
  • 'treating' is used to reverse, alleviate, inhibit the progression of, or prevent the disease or condition to which the term applies, or one or more symptoms of the disease or condition, unless otherwise noted. Means that.
  • treatment' refers to the act of treating when 'treating' is defined as above.
  • treatment or “therapy” of cancer includes one or more of the following:
  • Cancer is an intractable chronic disease that, even if treated with surgery, radiation, and chemotherapy, in many cases does not heal fundamentally, suffers the patient, and ultimately leads to death. Surgery, chemotherapy and radiation therapy over the last few decades have not been the ultimate solution to cancer despite many advances.
  • Stem cells as cancer therapeutic agents have conflicting reports on cancer inhibition and cancer promotion. In the present invention, it was confirmed that such opposite effects vary depending on the culture medium and method of stem cells.
  • mesenchymal stem cells with improved cancer cell proliferation inhibitory ability was prepared. That is, it may be a stem cell having anticancer function prepared by culturing fat-derived mesenchymal stem cells cultured by pretreatment with vitamin C in a medium containing aspirin, and fat-derived mesenchyme in a medium containing vitamin C and aspirin.
  • Stem cells may be prepared by culturing stem cells, and may also be anti-cancer function prepared by culturing fat-derived mesenchymal stem cells pre-treated with vitamin C in a medium containing vitamin C and aspirin.
  • Branches may be stem cells. We named all of these cells "Angel-Stem Cells”.
  • Human adipose tissue obtained from abdominal fat by liposuction was isolated and washed with PBS.
  • the tissue was chopped and digested for 2 hours at 37 ° C using DMEM medium containing collagenase type1 (1 mg / ml). After washing with PBS and centrifuged for 5 minutes at 1000rpm. The supernatant was suctioned and the pellet remaining on the bottom was washed with PBS, and then centrifuged at 1000 rpm for 5 minutes. Debris was removed by filtering on a 100 ⁇ m mesh, washed with PBS, and then cultured in DMEM medium containing 10% FBS, 2 mM NAC, and 0.2 mM ascorbic acid.
  • Adipose tissue-derived multipotent mesenchymal stem cells were isolated by subculture with alternating Keratinocyte-SFM medium every two days.
  • Adipocyte-derived multipotent mesenchymal stem cells isolated as described above were Vit.C-MSC cultured in a medium containing vitamin C, that is, vitamin C pre-treated MSC and used in the following examples.
  • the cells After exchange with medium added at concentrations of mM, 0.001 mM, 0.05 mM, 0.1 mM, 0.5 mM, 1 mM, 5 mM and 10 mM, the cells were incubated for 24 hours. After reacting for 2 hours by adding cck-8 (Cell Counting Kit-8, Dojindo) solution (10 ⁇ l / 100 ⁇ L) to each well, 450 nm absorbance values were measured using a Plate Reader (LonZa).
  • cck-8 Cell Counting Kit-8, Dojindo
  • Example 3 Characteristics of Vit.C-MSC incubated in aspirin containing medium
  • Vit.C-MSC The aspirin-induced cell morphology of Vit.C-MSC was confirmed by X100 magnification electron microscopy (Leica DMIL) (FIG. 2), and the proliferation rate, survival rate and cell size were analyzed using an automated cell counter Luna (Logoy) (FIG. 3) was done.
  • PE forming ability
  • Vit.C-MSC cultured in an aspirin-containing medium below 1 mM concentration showed no change in colony forming ability, and it was found that stem cells did not lose stemness and there was no change in stem cell ability (FIGS. 4 and 5). .
  • Vit.C-MSC cultured in a medium containing vitamin C was incubated for 2 days to attach and stabilize, followed by incubation for 24 hours by exchange of aspirin with RKCM-N medium added at concentrations of 0.1 mM, 0.5 mM and 1 mM. It was.
  • Example 5 Confirmation of differentiation ability of Vit.C-MSC cultured in aspirin-containing medium
  • Vit.C-MSC cultured in a medium containing vitamin C was incubated for 2 days to attach and stabilize, followed by incubation for 24 hours by exchange of aspirin with RKCM-N medium added at concentrations of 0.1 mM, 0.5 mM and 1 mM. It was. Then, 2 x 10 4 cells were inoculated into 12-well plates, and cultured for 14 days with medium replacement every two to three days with STEMPRO Adipogenesis differentiation Kit.
  • Vit.C-MSC cultured in a medium containing vitamin C was incubated for 2 days to attach and stabilize, followed by incubation for 24 hours by exchange of aspirin with RKCM-N medium added at concentrations of 0.1 mM, 0.5 mM and 1 mM. It was. Then, 2 x 10 4 cells were inoculated into 12-well plates and cultured for 21 days with medium replacement every 2-3 days with STEMPRO Osteogenesis differentiation Kit.
  • Example 6 Confirmation of anticancer effect through direct co-culture of Vit.C-MSC and cancer cells cultured in aspirin-containing medium
  • Vit.C-MSC cultured in the medium containing vitamin C of Example 1 RKCM-N at 10% density (0.5 ⁇ 10 6 cells) in a T75 flask The medium was inoculated. Keratinocyte containing 5% FBS, 2mM NAC, 0.2mM ascorbic acid, 0.09mM calcium, 5ng / ml rEGF, 5 ⁇ g / ml insulin and 74ng / ml Hydrocortisone in RKCM-N medium after 2 days Aspirin was treated in -SFM medium at concentrations of 0.5 mM, 1 mM and 10 mM, respectively, and cultured for 24 hours to recover ASP-Vit.C-MSC (Angel-Stem Cell).
  • ASP-Vit.C-MSC In order to confirm the anticancer effect by direct co-culture of ASP-Vit.C-MSC and cancer cells, ASP-Vit.C-MSC by aspirin treatment concentration in a 100 mm cell culture plate in which MCF-7 and PANC-1 cancer cells were attached and cultured, respectively. 0.5 ⁇ 10 6 cells were further inoculated. The total cell number of cancer cells and stem cells was 1 ⁇ 10 6 cells, and cultured in DMEM medium containing 10% FBS for 48 hours to recover total cells. The cell number, viability, and cell size of the recovered cells were confirmed by using an automated cell counter Luna (Logoy). Fluorescently stained cancer cells were recovered by FACS.
  • MSCs of control MSC + cancer cells of FIGS. 14 to 16 are Vit.C-MSCs pre-treated with vitamin C, cultured in a medium containing 0.2 mM ascorbic acid during cell culture.
  • ASP-Vit.C-MSC As in Example 6-1, ASP-Vit.C-MSC, a Vit.C-MSC treated with aspirin, was prepared, and then the anticancer effect of ASP-Vit.C-MSC was directly co-cultured with cancer stem cells. Confirmed.
  • CSCs are red fluorescence (red fluorescence) as a cover and then, 0.5 ⁇ 10 6 cells of the ASP-Vit.C-MSC is to the 100mm cell culture plate is inoculated inoculated with 0.5 ⁇ 10 5 cells / dish CO 2 incubator Direct incubation for 48 hours at 37 °C.
  • cancer stem cells were collected to measure the total cell number, viability and size, and the distribution of cancer stem cells labeled with red fluorescence was confirmed by FACS to determine the anti-cancer ability of cancer stem cells of Angel-MSC. Comparative analysis.
  • Example 7 Confirmation of anticancer effect through indirect co-culture of Vit.C-MSC and cancer cells cultured in aspirin-containing medium
  • cancer cells were attached to the bottom of the well using a transwell capable of dual cell culture, and Vit.C-MSC was attached to the insert membrane in the well. Co-cultured for 48 hours at 37 ° C. and 5% CO 2 feed in DMEM medium with% FBS.
  • Vit. C-MSC cultured in the medium containing vitamin C of Example 1 is inoculated in RKCM-N medium at 10% density (0.5 ⁇ 10 6 cells) in a T75 flask.
  • Aspirin was treated in -SFM medium at concentrations of 0.1 mM, 0.5 mM and 1 mM, and cultured for 24 hours to recover ASP-Vit.C-MSC (Angel-Stem Cell).
  • Each ASP-Vit.C-MSC recovered by aspirin concentration was inoculated at 1.4 ⁇ 10 5 cells / well in insert transwell (6-well) and placed on the underwell with cancer cells.
  • ASP-Vit.C-MSC ASP- by aspirin concentration in the underwell of transwell (6-well) to which MCF-7 and PANC-1 cancer cells were attached and cultured, respectively.
  • Insert transwells (6-wells) with Vit.C-MSC were raised and incubated for 48 hours in DMEM medium containing 10% FBS to recover cancer cells.
  • the cell number, viability, and cell size of the recovered cancer cells were confirmed using an automated cell counter Luna (Logoy).
  • MSCs of control MSC + cancer cells of FIGS. 17 to 19 are Vit.C-MSCs pretreated with vitamin C, cultured in a medium containing 0.2 mM ascorbic acid during cell culture.
  • cancer stem cells cultured in a sphere form of 200 to 400 ⁇ m were inoculated with 1.4 ⁇ 10 5 cells in an underwell of a transwell (6-well), and then ASP-Vit.C-MSC was 1.4 a ⁇ 10 5 cells / well transwell inserts (6-well), which is placed on the under-inoculated well.
  • ASP-Vit.C-MSC was prepared in Vit.C-MSC cultured in the medium containing the vitamin C of Example 1 in the same manner as in Example 7-1.
  • Vit.C-MSC cultured in the medium containing the vitamin C of Example 1 was incubated for 2 days to attach and stabilize, the aspirin was replaced with a medium containing 0.1mM, 0.5mM and 1mM, respectively, for 24 hours. Incubated for Next, expression of genes related to anticancer mechanisms, apoptosis and genes related to angiogenesis was confirmed.
  • Random hexamers (Invitrogen, N8080127) and RiboLock RNase (Thermo Scientific, EO0384) were used together to increase cDNA synthesis efficiency, and each reagent was mixed at the concentration according to the manufacturer's instructions, followed by Tprofessional TRIO Thermocycler (Biometra). It synthesize
  • RT-PCR contains 25 ⁇ l of 2 ⁇ h-Tag PCR Smart mix (SolGent, STD01-M50h), 2 ⁇ l of Primer F (10 pmole / ⁇ l, Bioneer), and 2 ⁇ l of Primer R (10 pmole / ⁇ l, Bioneer).
  • the primer was heated at each annealing temperature for 30 seconds, and the reaction of stretching the PCR product for 1 minute at 72 ° C was performed using Tprofessional TRIO Thermocycler (Biometra) under 30 cycle conditions. Primer sequences for each gene are shown in Table 3.
  • PCR products were subjected to electrophoresis for 1 hour and 30 minutes at 110V using 2.0% agarose gel and 1X TAE reagent, and images were measured by Fuji molecular imaging software. Beta-actin was used as a control gene.
  • THUNDERBIRD SYBR qPCR Mix TOYOBO QPS-201T
  • 10 ⁇ l THUNDERBIRD SYBR qPCR Mix 0.5 ⁇ l 10 ⁇ M Primer Fw (Bionia), 0.5 ⁇ l 10 ⁇ M Primer Rv (Bionia), 1 ⁇ l cDNA was denatured at 95 ° C. for 15 seconds, followed by heating the primer for 60 seconds at each annealing temperature.
  • the reaction was analyzed using ABapplied Biosystems (StepONE real time PCR system, life technologies) under 40 cycle conditions.
  • Example 9 Gene analysis related to anticancer, apoptosis and angiogenesis in Vit.C-MSC cultured in aspirin containing medium
  • Vit.C-MSC cultured in the medium containing the vitamin C of Example 1 was incubated for 2 days to attach and stabilize, the aspirin was replaced with a medium containing 0.1mM, 0.5mM and 1mM, respectively, for 24 hours. Incubated for
  • Fas L expressed in stem cells binds to Fas of cancer cells and promotes apoptosis of cancer cells through an apoptosis pathway, thus confirming the expression of the Fas L gene involved in cancer cell apoptosis.
  • DR4 / DR5 belongs to the Fas-Associated protein with Death Domain (FDA), a receptor involved in the apoptosis pathway, and TRAIL binds to a receptor called DR4 / DR5 to induce apoptosis. Therefore, expression of not only Fas L but also TRAIL gene was confirmed.
  • RT-PCR and real-time PCR were performed in the same manner as in Example 8, and the primers of Table 3 were used.
  • Fas L and TRAIL genes related to anticancer mechanisms involved in apoptosis of cancer cells, was the highest in Vit.C-MSC cultured in aspirin-containing medium at 0.5 mM concentration (FIGS. 21 to 23). ). That is, it was confirmed that the anti-cancer effect of Angel-Stem Cell, ASP-Vit.C-MSC, was the best in 0.5mM aspirin.
  • Vit.C-MSCs cultured in aspirin-containing medium had anticancer activity through pathways associated with Fas L, TRAIL and CXCR4.
  • Vit.C-MSC cultured in the medium containing the vitamin C of Example 1 was incubated for 2 days to attach and stabilize, the aspirin was replaced with a medium containing 0.1mM, 0.5mM and 1mM, respectively, for 24 hours. Incubated for
  • VEGF expressed in stem cells is involved in angiogenesis of cancer cells, expression of VEGF gene was confirmed.
  • RT-PCR was performed in the same manner as in Example 8, and the primers of Table 3 were used.
  • Nrf2, c-myc, and p21 genes in Vit.C-MSC (Angel-Stem Cell) and MSC cultured in 0.5 mM aspirin-containing medium under the same conditions as in Example 7 were compared.
  • RT-PCR was performed in the same manner as in Example 8, and the primers of Table 3 were used.
  • Nrf2 As a result, as shown in FIG. 25, the expression of Nrf2, c-myc and p21 genes were all reduced, which is evidence that adipose derived stem cells cultured in aspirin-containing medium could be free from oncogenic transformation into cancer cells. (Juan et al., Molecular Cancer. 13:20, 2014). The reduced p21 gene may be expected to make stem cells much younger.
  • Vit.C-MSC Angel-Stem Cell
  • Oct4 has been reported to be used as an indicator of cancer metastasis (Liu et al., Ann Surg. 253 (6): 1165-71, 2011; HAI LIN et al., MOLECULAR MEDICINE REPORTS 9: 1335-1342 , 2014). Therefore, when the expression of Oct4 decreases, it can be determined that the degree of metastasis is low.
  • FIG. 30 showed that Oct4 expression was decreased in indirectly co-cultured breast and pancreatic cancer cells.
  • the medium for producing mesenchymal stem cells containing vitamin C and aspirin according to the present invention can produce mesenchymal stem cells that inhibit the proliferation of cancer cells while maintaining the activity, securing safety from cancer of stem cell therapeutics and anticancer cell therapeutics It is very useful for the preparation as.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 분화능과 활성을 유지하면서 암세포의 증식을 억제하는 암 치료용 중간엽 줄기세포의 배양 배지 조성물 및 상기 조성물을 이용한 암 치료용 중간엽 줄기세포의 제조방법에 관한 것으로, 더욱 자세하게는 비타민 C와 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물 및 상기 조성물을 이용한 암 치료용 중간엽 줄기세포의 제조방법에 관한 것이다.

Description

암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법
본 발명은 활성을 유지하면서 암세포의 증식을 억제하는 암 치료용 중간엽 줄기세포의 배양 배지 조성물에 관한 것으로, 더욱 자세하게는 비타민 C와 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물에 관한 것이다.
줄기세포(stem cell)란 자기 복제 능력을 가지면서 두 개 이상의 세포로 분화하는 능력을 갖는 세포를 말하며, 만능 줄기세포(totipotent stem cell), 전분화능 줄기세포(pluripotent stem cell), 다분화능 줄기세포(multipotent stem cell)로 분류할 수 있다.
만능 줄기세포(totipotent stem cell)는 하나의 완전한 개체로 발생해 나갈 수 있는 만능의 성질을 가진 세포로 난자와 정자의 수정 이후 8세포기까지의 세포가 이러한 성질을 가지며, 이 세포를 분리하여 자궁에 이식하면 하나의 완전한 개체로 발생해 나갈 수 있다.
전분화능 줄기세포(pluripotent stem cell)는 외배엽, 중배엽, 내배엽 유래의 다양한 세포와 조직으로 발생할 수 있는 세포로서, 수정 4~5일 후 나타나는 배반포(blastocyst)의 안쪽에 위치한 내세포괴(inner cell mass)에서 유래하며, 이를 배아 줄기세포라 하며 다양한 다른 조직 세포로 분화되지만 새로운 생명체를 형성하지는 못한다.
다분화능(또는 다능성) 줄기세포(multipotent stem cell)는 이 세포가 포함되어 있는 조직 및 기관에 특이적인 세포로만 분화할 수 있는 줄기세포로서, 태아기, 신생아기 및 성체기의 각 조직 및 장기의 성장과 발달은 물론 성체조직의 항상성 유지와 조직손상시 재생을 유도하는 기능에 관여하고 있으며 조직 특이적 다능성 세포들을 총칭하여 중간엽 줄기세포라 한다.
중간엽 줄기세포(Rebecca S. Y. Wong, et al., J Biomed Biotechnol 24:2011, 2011)는 심장 질환, 골형성 부전증 및 척수 손상과 같은 다양한 질병 상태에서 세포 기반 치료에 사용되어 왔으며, 그 결과가 주목되고 있다. 또한, 최근에는 소변 유래 줄기세포를 이용한 세포 기반 치료 및 재생의학에 관한 연구 (Bharadwaj et al., Stem Cells. 31(9):1840-56, 2013; Zhang D et al., Genes Dis. 1(1):8-17, 2014; Guan et al., Tissue Eng, 20(13-14):1794-806, 2014)도 진행되고 있다.
그러나, 일부 연구에서 MSC 치료의 부작용 보고가 있다. 특히, 몇몇 연구에서 종양으로 변이 및 악성 변이로 종양의 성장과 전이가 빠르게 진행되는 것을 확인하였으며, 항암 약물에 내성을 보였다. 이와 더불어 다양한 연구에서 중간엽 줄기세포의 자발적 악성 변화로 나타난 것을 알 수 있었다.
한편, "암"이란 '제어되지 않은 세포성장'으로 특징지어지며, 이러한 비정상적인 세포성장에 의해 종양(tumor)이라고 불리는 세포 덩어리가 형성되어 주위의 조직으로 침투하고 심한 경우에는 신체의 다른 기관으로 전이되기도 한다. 학문적으로는 신생물(neoplasia)이라고도 불린다.
암을 치료하기 위한 방법으로는 수술요법, 방사선 요법 및 항암제를 투여하는 화학요법 등이 있다. 항암제는 무제한 증식하는 암세포에 작용하여 암세포의 증식과 성장을 억제시키는 약물이다. 현재 널리 사용되고 있는 시스플라틴(cisplatin)이나, 사이크로포스파미드(cyclophosphamide) 등과 같은 알킬화 항암제는 DNA의 구성성분인 뉴클레오타이드 내의 질소와 공유결합하여 항암작용을 나타내며, 5-프루오로우라실(5-fluorouracil)은 핵산의 생합성에 관여하는 효소들을 억제하거나, DNA 혹은 RNA에 직접 삽입되어 활성을 나타내게 된다.
또한, 아드리아마이신(adriamycin) 등의 항생물질(antibiotics)들은 DNA에 강력하게 작용하여 DNA 고유의 기능을 억제하여 항암 효과를 나타낸다. 그러나, 이들 항암제는 종양세포뿐만 아니라 정상세포 특히, 생체세포 중에서 빠른 증식과 분화를 하는 골수전구세포(bone marrow cells)나 장관상피세포(intestinal epitherium cell)에도 작용하여 신중독증, 구토 및 신경독성 등의 여러가지 부작용을 수반하는 단점이 있다.
아울러, 종양 내에서 암줄기세포는 다른 암세포와는 달리 휴지기 상태에 머물러 있으며, 전이암세포에 비해 공격성이 적은 형태를 보인다. 따라서, 항암제의 공격에서 배제되어 살아남게 되므로 종양내에 존재하는 일반 암세포의 사멸을 유도하는 것만으로는 완전하게 종양을 제거할 수 없다.
이에, 본 발명자들은 항암제 등의 부작용을 극복할 수 있는 중간엽 줄기세포를 이용한 암 치료제를 개발하기 위해 예의 노력한 결과, 아스피린(Aspirin), 비타민 C(Vitamin C) 등을 첨가한 배지에서 중간엽 줄기세포를 배양할 경우, 이렇게 제조된 중간엽 줄기세포가 세포의 활성을 유지하면서 암세포의 증식을 억제하는 효과를 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 비타민 C와 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물 및 상기 배지에서 중간엽 줄기세포를 배양하여 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물을 제공한다.
본 발명은 또한, 아스피린을 함유하는 배지에서 중간엽 줄기세포를 배양하는 단계를 포함하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조방법을 제공한다.
본 발명은 또한, 아스피린을 함유하는 줄기세포 제조용 배지 조성물을 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조에 사용하는 용도를 제공한다.
도 1은 Vit.C-MSC에 대한 아스피린 농도에 따른 독성을 분석한 것이다.
도 2는 아스피린 함유 배지에서 배양한 Vit.C-MSC의 형태를 나타낸 것이다.
도 3은 아스피린 함유 배지에서 배양한 Vit.C-MSC의 증식률, 생존율 및 세포크기를 나타낸 것이다.
도 4는 아스피린 함유 배지에서 배양한 Vit.C-MSC의 CFA(colony forming assay) 결과를 사진으로 나타낸 것이다.
도 5는 아스피린 함유 배지에서 배양한 Vit.C-MSC의 콜로니 형성능을 측정한 것이다.
도 6은 아스피린이 첨가되지 않은 대조군 배지에서 배양한 Vit.C-MSC의 CD 마커 발현을 FACS로 분석한 것이다.
도 7은 0.1mM 아스피린 함유 배지에서 배양한 Vit.C-MSC의 CD 마커 발현을 FACS로 분석한 것이다.
도 8은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC의 CD 마커 발현을 FACS로 분석한 것이다.
도 9는 1mM 아스피린 함유 배지에서 배양한 Vit.C-MSC의 CD 마커 발현을 FACS로 분석한 것이다.
도 10은 아스피린 함유 배지에서 배양한 Vit.C-MSC의 지방세포로의 분화능을 Oil Red O 염색으로 확인한 것이다.
도 11은 아스피린 함유 배지에서 배양한 Vit.C-MSC의 지방세포로의 분화정도를 흡광도 520nm에서 측정한 것이다.
도 12는 아스피린 함유 배지에서 배양한 Vit.C-MSC의 골세포로의 분화능을 Alizarin Red S 염색으로 확인한 것이다.
도 13은 아스피린 함유 배지에서 배양한 Vit.C-MSC의 골세포로의 분화정도를 흡광도 560nm에서 측정한 것이다.
도 14는 아스피린 함유 배지에서 배양한 Vit.C-MSC와 MCF-7 암세포를 암세포 배양 배지에서 직접-공배양한 후, 암세포의 분포를 FACS로 확인 후 전체 세포 수에서의 암세포를 계산하여 나타낸 것이다.
도 15는 아스피린 함유 배지에서 배양한 Vit.C-MSC와 PANC-1 암세포를 암세포 배양 배지에서 직접-공배양한 후, 암세포의 분포를 FACS로 확인 후 전체 세포 수에서의 암세포를 계산하여 나타낸 것이다.
도 16은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC와 유방암 MCF-7 또는 췌장암 PANC-1 암세포를 암세포 배양 배지에서 직접-공배양한 후, 암세포 증식억제 효과를 확인한 것이다.
도 17은 아스피린 함유 배지에서 배양한 Vit.C-MSC와 MCF-7 암세포를 암세포 배양 배지에서 간접-공배양한 후, 암세포 수를 나타낸 것이다.
도 18은 아스피린 함유 배지에서 배양한 Vit.C-MSC와 PANC-1 암세포를 암세포 배양 배지에서 간접-공배양한 후, 암세포 수를 나타낸 것이다.
도 19는 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC와 유방암 MCF-7 또는 췌장암 PANC-1 암세포를 암세포 배양 배지에서 간접-공배양한 후, 암세포 증식억제 효과를 확인한 것이다.
도 20은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC와 PANC-1 암세포 (red)를 암세포 배양 배지에서 직접-공배양 후, 0시간 및 48시간의 형광 현미경 사진이다.
도 21은 0.1, 0.5 및 1mM 농도의 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 Fas L의 발현을 실시간 PCR로 정량하여 나타낸 것이다.
도 22는 0.1, 0.5 및 1mM 농도의 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 TRAIL의 발현을 RT-PCR로 비교하여 나타낸 것이다.
도 23은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 Fas L, TRAIL 및 CXCR4의 발현 정도를 비교하여 나타낸 것이다.
도 24는 0.1, 0.5 및 1mM 농도의 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 VEGF의 발현을 (A) RT-PCR로 측정 후 (B) 비교하여 나타낸 것이다. (1:Vit.C MSC, 2:0.1mM ASP-Vit.C MSC, 3:0.5mM ASP-Vit.C MSC, 4:1mM ASP-Vit.C MSC)
도 25는 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 Nrf2, c-myc 및 p21의 발현 정도를 비교하여 나타낸 것이다.
도 26은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 Sox2, Oct4 및 Nanog의 발현을 비교하여 나타낸 것이다.
도 27은 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 암세포 배양조건에서 간접 공배양 한 암세포에서 Bcl-2 유전자의 발현을 분석한 것이다.
도 28은 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 암세포 배양조건에서 간접 공배양 한 암세포에서 PPAR-γ 유전자의 발현을 분석한 것이다.
도 29는 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 암세포 배양조건에서 간접 공배양 한 암세포에서 Apaf-1 유전자의 발현을 분석한 것이다.
도 30은 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 암세포 배양조건에서 간접 공배양 한 암세포에서 Oct4 유전자의 발현을 분석한 것이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
성체 줄기세포는 발생과정이 진행되어 배아의 각 장기가 형성되는 단계 혹은 성체단계에서 나타나는 줄기세포로 조직 및 기관에 특이적인 세포로만 분화할 수 있는 분화능(multipotent)을 가지고 있는 것으로 알려져 있다. 이러한 조직 특이적 분화능을 가진 줄기세포(multipotent stem cell)는 이 세포가 포함되어 있는 조직 및 기관에 특이적인 세포로만 분화할 수 있는 줄기세포로서, 태아기, 신생아기 및 성체기의 각 조직 및 장기의 성장과 발달은 물론 성체조직의 항상성 유지와 조직손상 시 재생을 유도하는 기능에 관여하고 있다.
본 발명에서는 성체 줄기세포, 바람직하게는 인간 유래 성체 줄기세포를 사용할 수 있다.
이는 지방, 자궁, 골수, 근육, 태반, 제대혈, 소변 또는 피부(상피) 등의 조직 유래일 수 있다. 바람직하게는 지방조직, 또는 모낭ㆍ양막 등 상피조직에서 얻어지는 성체 줄기세포를 이용할 수 있다. 특히, 중간엽 줄기세포(mesenchymal stem cells, MSCs)인 것이 바람직하고, 가장 바람직하게는 인간 지방 조직 유래 중간엽 줄기세포(Human adipose tissue-derived mesenchymal stem cell, AT-MSCs)일 수 있다.
본 발명의 소변 유래 줄기세포는 자기-재생능 (self-renewal) 및 다분화능을 가지며, 중간엽 줄기세포 마커를 발현한다. 즉, 내피세포, 골형성 세포, 연골세포, 지방세포, 골격 근육 세포와 같은 중배엽 세포 계통 및 요로상피세포 (urothelial cells)와 같은 내배엽 세포 계통으로 분화할 수 있다. 아울러, 소변 유래 줄기세포는 높은 텔로머라제 활성 및 긴 텔로미어를 가지는 것으로 알려져 있다 (Bharadwaj et al., Stem Cells. 31(9):1840-56, 2013; Stem Cells: Current Challenges and New Directions Part of the series Stem Cell Biology and Regenerative Medicine, 19-28: 2013).
본 발명에서 사용하는 용어 "줄기세포(stem cell)"이란 자기 복제 능력을 가지면서 두 개 이상의 세포로 분화하는 능력을 갖는 세포를 말하며, "성체 줄기세포"는 발생과정이 진행되어 배아의 각 장기가 형성되는 단계 혹은 성체단계에서 나타나는 줄기세포를 의미한다.
본 발명에서 사용하는 용어 "중간엽 줄기세포"는 인간 또는 포유류의 조직으로부터 분리해 낸 미분화된 줄기세포로서, 다양한 조직에서 유래할 수 있다. 특히, 제대 유래 중간엽 줄기세포, 제대혈 유래 중간엽 줄기세포, 골수 유래 중간엽 줄기세포, 지방 유래 중간엽 줄기세포, 근육 유래 중간엽 줄기세포, 신경 유래 중간엽 줄기세포, 피부 유래 중간엽 줄기세포, 양막 유래 중간엽 줄기세포 및 태반 유래 중간엽 줄기세포일 수 있으며, 각 조직에서 줄기세포를 분리하는 기술은 당해 업계에 이미 공지되어 있다.
본 발명에서 사용하는 용어 "지방 유래 줄기세포"란 지방조직에서 분리해 낸 미분화 줄기세포로, 그 분리 방법은 예를 들어 다음과 같을 수 있다. 즉, 지방흡입술로부터 얻어지는 생리 식염수에 부유된 지방 함유 suspension을 배양한 다음, 플라스크 등 배양용기에 부착된 줄기세포 층을 트립신으로 처리한 다음 회수하거나, 스크래퍼로 긁어서 소량의 생리 식염수에 부유되는 것을 직접 회수하거나 하는 방법 등을 통해 지방 유래 중간엽 줄기세포를 분리할 수 있다.
이러한, "지방 조직 유래 성체 줄기세포" 또는 "지방 조직 유래 중간엽 줄기세포"는 지방 조직으로부터 분리해 낸 미분화된 성체 줄기세포로서, 본 명세서에서는 축약하여 "지방 줄기세포"라고 지칭하기도 한다. 이는 당업계에 공지된 통상의 방법을 통해 수득할 수 있다.
상기 지방 줄기세포물의 획득에 사용되는 배지로서는 당업계에서 줄기세포 배양에 적합하다고 알려져 있는 통상적인 배지를 사용할 수 있는데, 바람직하게는 DMEM (Dulbecco's modified Eagle medium) 또는 Keratinocyte-SFM (Keratinocyte serum free medium)을 사용할 수 있으며, IMDM (Iscove's Modified Dulbecco's Medium), a-MEM (Alpha Modification of Eagle's Medium), F12 (Nutrient Mixture F-12) 및 DMEM/F12 (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12) 배지를 혼합한 배지도 사용할 수 있으나, 이에 한정되는 것은 아니다.
지방 줄기세포 배양용 배지는 지방 줄기세포의 미분화된 표현형의 증식을 촉진하면서 분화는 억제하는 첨가제로 보충될 수 있다. 또한, 배지는 일반적으로, 등장액 중의 중성 완충제(예컨대 인산염 및/또는 고농도 중탄산염) 및 단백질 영양분(예를 들면 혈청, 예컨대 FBS, 혈청 대체물, 알부민, 또는 필수 아미노산 및 비필수 아미노산, 예컨대 글루타민)을 함유할 수 있다. 나아가, 지질(지방산, 콜레스테롤, 혈청의 HDL 또는 LDL 추출물) 및 이 종류의 대부분의 보존액 배지에서 발견되는 기타 성분(예컨대 인슐린 또는 트랜스페린, 뉴클레오시드 또는 뉴클레오티드, 피루빈산염, 임의의 이온화 형태 또는 염인 당원, 예컨대 글루코스, 셀레늄, 글루코코르티코이드, 예컨대 히드로코르티존 및/또는 환원제, 예컨대 β-메르캅토에탄올)을 함유할 수 있다.
또한, 배지는 세포가 서로 유착하거나, 용기벽에 유착하거나, 너무 큰 다발을 형성하는 것을 방지할 목적으로, 항응집제 (anti-clumping agent), 예컨대 Invitrogen이 판매하는 것들(Cat # 0010057AE)을 포함하는 것이 유익할 수 있다.
특히, 본 발명의 일 구체예에서 사용되는 지방 줄기세포를 수득 또는 배양하기 위한 배지는 DMEM, Defined Keratinocyte-SFM, α-MEM, IMDM, F12 및 DMEM/F12로 구성된 군에서 선택되는 기본 배지, L-아스코르브산 2-인산 (비타민 C), 우태아혈청 및 N-아세틸-L-시스테인(N-acetyl-L-cysteine)을 함유하는 중간엽 줄기세포 배양을 위한 배지 조성물에 아스피린을 함유하는 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 배지는 0.05~1 mM의 아스코르브산 2-인산, 2~20% 우태아혈청, 0.2~20mM의 N-아세틸-L-시스테인(N-acetyl-L-cysteine) 및 0.1 내지 1mM 아스피린을 함유하는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명은 일관점에서, 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물에 관한 것이다.
본 발명은 다른 관점에서, 아스피린을 함유하는 배지에서 중간엽 줄기세포를 배양하는 단계를 포함하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조방법에 관한 것이다.
본 발명은 또 다른 관점에서, 아스피린을 함유하는 줄기세포 제조용 배지 조성물을 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조에 사용하는 용도에 관한 것이다.
본 발명에서, 상기 배지는 비타민 C를 추가로 포함하는 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 5~10% FBS 및 NAC (N-acetyl Cystein)을 함유하는 DMEM 또는 K-SFM인 것이 바람직하며, 추가로 칼슘, rEGF, 인슐린 및 하이드로코티손을 함유하는 것이 더욱 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 중간엽 줄기세포는 비타민 C로 전처리된 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 중간엽 줄기세포는 지방, 자궁, 골수, 근육, 태반, 제대혈, 소변, 모낭 및 피부로 구성된 군에서 선택된 조직 유래인 것이 바람직하며, 더욱 바람직하게는 지방 유래인 것이나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 아스피린의 농도는 0.1mM 내지 1mM인 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 배양의 시간은 24시간인 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 암세포는 신경교종, 신경교육종, 역형성 성상세포종, 수모세포종, 폐암, 소세포 폐암종, 자궁경부 암종, 결장암, 직장암, 척삭종, 인후암, 카포시 육종, 림프관 육종, 림프관 내피 육종, 결직장암, 자궁내막암, 난소암, 백혈병, 전립선암, 신장 세포 암종, 간 암종, 담관 암종, 융모막 암종, 정상피종, 고환 종양, 윌름 종양, 유잉 종양, 방광 암종, 혈관육종, 내피육종, 선암종, 한선 암종, 피지선 암종, 유두 암종, 유두선육종, 낭선육종, 기관지 암종, 수질 암종, 비만세포종, 중피종, 활막종, 흑색종, 평활근종, 횡문근종, 신경모세포종, 망막모세포종, 핍지교종, 청신경종, 혈관모세포종, 수막종, 송과체종, 상의세포종, 두개인두종, 상피 암종, 배아 암종, 편평 세포 암종, 기저 세포 암종, 섬유육종, 점액종, 점액육종, 지방육종, 연골육종, 골원성 육종 세포 또는 암줄기세포인 것이 바람직하며, 더욱 바람직하게는 유방암 또는 췌장암인 것이나, 이에 한정되는 것은 아니다.
본 발명은 또 다른 관점에서, 아스피린을 함유하는 배지에서 중간엽 줄기세포를 배양하여 제조된 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포를 투여하는 단계를 포함하는 암치료 방법을 제공한다.
본 발명은 또 다른 관점에서, 아스피린을 함유하는 배지에서 중간엽 줄기세포를 배양하여 제조된 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포를 암치료에 사용하는 용도를 제공한다.
'암'이란 제어되지 않은 세포성장으로 특징지어지며, 이러한 비정상적인 세포성장에 의해 종양(tumor)이라고 불리는 세포 덩어리가 형성되어 주위의 조직으로 침투하고 심한 경우에는 신체의 다른 기관으로 전이되기도 한다.
'항암'이라는 용어는 암 질환의 치료 즉, 암세포 또는 암줄기세포의 증식을 억제하거나 암세포 또는 암줄기세포를 죽이는 것뿐만 아니라, 암 질환의 예방, 즉 암 발병 이전에 암에 대한 저항력을 높이는 것도 함께 포함하는 것으로 해석된다. 따라서, 본 명세서에서 "암 예방 또는 치료" 또는 "암의 증식 억제"라는 용어와 '항암'이라는 용어는 혼재하여 사용되었다.
본 발명에 있어서, "암세포"는 정상세포의 증식 및 생장기전에 유전적인 변형으로 인해 비정상적인 세포생장을 하며, 전이라고 지칭할 수 있는 공격적인 타 기관 이동성을 지니는 세포를 포함한다. 또한, "암줄기세포"는 종양 내 존재하는 것으로 알려져 있으며 정상 줄기세포의 유전적인 정보의 비정상적인 전이로 인해 발생하는 것으로 생각되고 있다. 암줄기세포는 그들이 생존하기 위한 미세환경, 니쉬(niche)의 존재로 인해 유지, 증식되며 주변에 존재하는 정상 세포, 면역관련 세포 또는 분화된 암세포가 이들 특성 유지와 증식에 영향을 미치는 것으로 알려져 있다.
'치료하는'이란 용어는, 달리 언급되지 않는 한, 상기 용어가 적용되는 질환 또는 질병, 또는 상기 질환 또는 질병의 하나 이상의 증상을 역전시키거나, 완화시키거나, 그 진행을 억제하거나, 또는 예방하는 것을 의미한다.
본원에서 사용된 바와 같이, '치료'란 용어는 '치료하는'이 상기와 같이 정의될 때 치료하는 행위를 말한다.
따라서, 포유 동물에 있어서 암의 "치료" 또는 "치료요법" 은 하기의 하나 이상을 포함한다:
(1) 암의 성장을 저해함, 즉, 그 발달을 저지시킴,
(2) 암의 확산을 예방함, 즉, 전이를 예방함,
(3) 암을 경감시킴, 즉, 암의 퇴행을 야기시킴,
(4) 암의 재발을 예방함, 및
(5) 암의 증상을 완화함(palliating).
암은 수술, 방사선 및 화학요법으로 치료를 하더라도 많은 경우에 근본적인 치유가 되지 못하고 환자에게 고통을 주며 궁극적으로는 죽음에 이르게 하는 난치성 만성질환이다. 지난 수십 년간의 수술요법, 화학요법(항암제치료), 방사선요법 등은 많은 발전에도 불구하고 암에 대한 궁극적인 해결책이 되지 못하고 있다.
암 치료제로의 줄기세포는 암 억제 및 암 촉진에 대한 상반된 보고가 있다. 본 발명에서는 이러한 상반된 효과가 줄기세포의 배양 배지 및 방법에 따라 달라지는 것을 확인하였다.
본 발명의 일 양태에서는 비타민 C 함유 배지에서 배양된 지방 유래 중간엽 줄기세포를 아스피린을 함유하는 배지에서 배양하여, 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포를 제조하였다. 즉, 비타민 C를 전처리하여 배양한 지방 유래 중간엽 줄기세포를 아스피린을 함유하는 배지에서 배양하여 제조된 항암 기능을 가지는 줄기세포일 수 있으며, 비타민 C와 아스피린을 함께 함유하는 배지에서 지방 유래 중간엽 줄기세포를 배양하여 제조된 항암 기능을 가지는 줄기세포일 수 있으며, 또한, 비타민 C를 전처리하여 배양한 지방 유래 중간엽 줄기세포를 비타민 C와 아스피린을 함께 함유하는 배지에서 배양하여 제조된 항암 기능을 가지는 줄기세포일 수 있다. 본 발명자들은 이러한 세포를 모두 "Angel-Stem Cell"로 명명하였다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 인간 지방조직 유래 중간엽 줄기세포의 분리
지방흡입술(Liposuction)에 의해 복부지방으로부터 얻어진 인간 지방조직을 분리하여 PBS로 세척하였다. 조직을 잘게 자른 후 collagenase type1 (1mg/ml)을 첨가한 DMEM 배지를 이용하여 37℃에서 2시간 동안 digestion하였다. PBS로 세척 후 1000rpm에서 5분간 원심분리 하였다. 상층액은 suction하고 바닥에 남은 펠렛은 PBS로 세척한 후, 1000rpm으로 5분간 원심분리하였다. 100㎛ mesh에 필터링하여 debris를 제거하고 PBS로 세척한 후, 10% FBS, 2mM NAC, 0.2mM ascorbic acid를 함유하는 DMEM 배지에 배양하였다.
하룻밤 지난 후 부착되지 않은 세포들은 PBS로 세척하고, RKCM-N 배지인 5% FBS, 2mM NAC, 0.2mM ascorbic acid, 0.09mM calcium, 5ng/ml rEGF, 5㎍/ml 인슐린 및 74ng/ml Hydrocortisone를 함유한 Keratinocyte-SFM 배지를 2일마다 교체하면서 계대배양하여 지방조직 유래 다분화능 중간엽 줄기세포를 분리하였다.
상기와 같이 분리한 지방조직 유래 다분화능 중간엽 줄기세포는 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC로, 즉 비타민 C 전처리 MSC이며 이후 실시예에서 사용하였다.
이하 실시예에서 사용한 각종 배지 및 시약의 입수처는 하기 표 1에 기재된 바와 같다.
구성성분 입수처
Ascorbic acid Sigma
CaCl2 Sigma
Collagenase type I Gibco
DMEM (Dulbecco's modified Eagle medium) Gibco
DPBS (Dulbecco's Phosphate-Buffered Salines) Welgene
EGF (Epidermal growth factor) Gibco
FBS (Fetal Bovine Serum) Gibco
Hydrocortisone Sigma
Insulin Gibco
K-SFM (Keratinocyte-SFM) Gibco
NAC (N-acetyl Cysteine) Sigma
실시예 2: 아스피린의 Vit.C-MSC에 대한 독성 평가
실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 96-웰 세포배양 플레이트에 1×104 cells/plate 농도로 접종한 후, 하룻밤 배양하여 부착 및 안정화 시킨다. 그 다음, RKCM-N 배지인 5% FBS, 2mM NAC, 0.2mM ascorbic acid, 0.09mM calcium, 5ng/ml rEGF, 5㎍/ml 인슐린 및 74ng/ml Hydrocortisone를 함유한 Keratinocyte-SFM에 아스피린을 각각 0.005mM, 0.001mM, 0.05mM, 0.1mM, 0.5mM, 1mM, 5mM 및 10mM의 농도로 첨가한 배지로 교환 후, 24시간 동안 배양하였다. 각 웰에 cck-8 ( Cell Counting Kit-8, Dojindo) 용액 (10㎕/100㎕)을 첨가하여 2시간 동안 반응시킨 후, Plate Reader (LonZa)를 이용하여 450nm 흡광도 값을 측정하였다.
그 결과, 도 1에 나타난 바와 같이, 아스피린 농도 5mM 이하에서는 Vit.C-MSC에 대해 세포독성을 거의 나타내지 않는 것을 알 수 있었다. 따라서, 이하 분석에서는 0.1 내지 1mM 농도의 아스피린을 사용하였다.
실시예 3: 아스피린 함유 배지에서 배양한 Vit.C-MSC의 특성
실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 각각 0.1mM, 0.5mM, 1mM 및 10mM의 농도로 첨가한 RKCM-N 배지로 교환하여 24시간 동안 배양하였다.
Vit.C-MSC의 아스피린에 의한 세포의 형태를 X100 배율의 전자현미경 (Leica DMIL)으로 확인하고 (도 2), 증식률, 생존율 및 세포크기를 automated cell counter Luna (Logoy)를 이용하여 분석 (도 3) 하였다.
그 결과, 아스피린 농도 1mM 이하는 줄기세포의 형태, 증식률, 생존율 및 세포크기에 영향을 미치지 않는 것을 확인하였다 (도 2 및 도 3).
실시예 4: 아스피린 함유 배지에서 배양한 Vit.C-MSC의 줄기세포능 (stemness) 분석
4-1: CFA (Colony forming assay)
비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 각각 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 RKCM-N 배지로 교환하여 24시간 동안 배양하였다. 그 다음, 각각의 아스피린 농도별 세포 300개를 RKCM-N 배지에 혼합하여 100mm 세포배양 접시에 접종하였다. 2~3일 마다 배지를 교환하면서 10일간 37℃, 5% CO2에서 배양하였다. 10일 후 배지를 제거하고, 0.1% 크리스탈 바이올렛 시약 3ml을 첨가하여 10분간 반응시킨 후, 세척하여 건조하였다. 형성된 콜로니 갯수를 측정하고, 형성능(PE)=콜로니 형성 개수/전체 접종 세포수 x 100%를 계산하였다.
그 결과, 1mM 농도 이하의 아스피린 함유 배지에서 배양한 Vit.C-MSC는 콜로니 형성능에 변화가 없어, 줄기세포가 stemness를 잃지 않고 줄기세포능에 변화가 없는 것을 알 수 있었다 (도 4 및 도 5).
4-2: 표면 CD 마커 확인
비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 RKCM-N 배지로 교환하여 24시간 동안 배양하였다.
하기 [표 2]의 줄기세포 표면 CD 마커 발현을 FACS를 이용하여 Vit.C-MSC와 아스피린에서 배양한 2개의 Vit.C-MSC에서 비교하였다.
Marker Vit.C MSC(%) 0.1mM ASP-Vit.C MSC(%) 0.5mM ASP-Vit.C MSC(%) 1mM ASP-Vit.C MSC(%)
CD34 0.03 0.12 0.01 0.01
CD45 0.00 0.02 0.02 0.00
CD73 99.92 99.93 99.98 99.72
CD90 100 100 100 100
CD105 99.97 99.96 99.99 99.85
그 결과, 도 6 내지 도 9에 나타난 것과 같이, 0.1mM, 0.5mM 및 1mM 농도의 아스피린에 의해 줄기세포 표면 CD 마커의 발현은 변화가 없었다. 즉, 아스피린 함유 배지에서 배양한 Vit.C-MSC는 줄기세포의 특성인 stemness를 잃지 않고 줄기세포능에 변화가 없는 것을 알 수 있었다.
실시예 5: 아스피린 함유 배지에서 배양한 Vit.C-MSC의 분화능 확인
5-1: 지방세포 분화유도
비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 RKCM-N 배지로 교환하여 24시간 동안 배양하였다. 그 다음, 12웰 플레이트에 2×104 cells로 접종하고, 지방분화 유도 배지 (STEMPRO Adipogenesis differentiation Kit)로 2~3일에 한번씩 배지를 교환해주며 14일 동안 배양하였다.
14일 분화 유도 후 Oil Red O로 염색하여 현미경으로 분석한 결과, 지방세포로의 분화를 확인할 수 있었다 (도 10). Oil Red O 염색을 isopropanol로 de-staining 하여 분화 정도를 520nm 흡광도에서 확인하였다 (도 11).
5-2: 골세포 분화유도
비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 RKCM-N 배지로 교환하여 24시간 동안 배양하였다. 그 다음, 12웰 플레이트에 2×104 cells로 접종하고, 골분화유도 배지(STEMPRO Osteogenesis differentiation Kit)로 2~3일에 한번씩 배지를 교환해주며 21일 동안 배양하였다.
21일 분화 유도 후 Alizarin Red S로 염색하여 현미경으로 분석한 결과, 골세포로의 분화를 확인할 수 있었다 (도 12). Alizarin Red 염색을 10% cetylpytidium chloride로 de-staining 하여 분화 정도를 560nm 흡광도에서 확인하였다 (도 13).
실시예 6: 아스피린 함유 배지에서 배양한 Vit.C-MSC와 암세포와의 직접 공배양을 통한 항암 효과 확인
6-1: 유방암 및 췌장암 세포
직접 공배양 (direct co-culture)를 실시하기 위해, 실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 T75 flask에 10% 밀도 (0.5×106 cells)로 RKCM-N 배지에 접종하였다. 2일 후 50~60% 밀도가 되면 RKCM-N 배지인 5% FBS, 2mM NAC, 0.2mM ascorbic acid, 0.09mM calcium, 5ng/ml rEGF, 5㎍/ml 인슐린 및 74ng/ml Hydrocortisone를 함유한 Keratinocyte-SFM 배지에 각각 0.5mM, 1mM 및 10mM의 농도로 아스피린을 처리하여, 24시간 동안 배양한 후 ASP-Vit.C-MSC (Angel-Stem Cell)를 회수하였다.
그 다음, 2×107 세포수의 유방암 세포 MCF-7 및 췌장암 세포 PANC-1를 각각 serum이 없는 DMEM 배지로 2회 세척한다. PKH26 Red Fluorescent Cell Linker Kit (Sigma)를 이용하여 Diluent C solution 1ml 당 4㎕ red staining solution으로 세포를 10분간 염색한 후, 동량의 serum (FBS)을 넣어 1분간 block 시켜 serum이 첨가된 DMEM 배지로 2회 세척하고, serum (FBS)가 첨가된 배지에서 30분간 반응시킨다. 염색된 암세포를 X100 배율의 형광 현미경(ZEISS, Mirax)으로 확인하였다 (도 20). Red fluorescence로 형광 표지된 MCF-7 및 PANC-1 암세포를 100mm 세포배양 접시에 0.5×105 cells/dish로 접종하여 하룻밤 동안 부착 및 안정화시킨다.
ASP-Vit.C-MSC와 암세포의 직접 공배양으로 항암 효과를 확인하기 위해, MCF-7 및 PANC-1 암세포가 각각 부착 배양된 100mm 세포배양 접시에 아스피린 처리 농도별로 ASP-Vit.C-MSC 0.5×106 cells를 추가 접종하였다. 암세포와 줄기세포의 전체 세포수가 1×106 cells이 되도록 하고, 10% FBS가 함유된 DMEM 배지에서 48시간 배양하여, 전체 세포를 회수하였다. 회수한 세포의 세포수, 생존율, 세포크기를 automated cell counter Luna (Logoy)를 이용하여 확인하고, 회수한 전체 세포 중 형광 염색된 암세포는 FACS로 그 분포를 확인하였다.
그 결과, 유방암 세포 MCF-7 및 췌장암 세포 PANC-1 모두에서 Vit.C-MSC에 비해 아스피린 농도 0.5mM의 ASP-Vit.C-MSC에서 형광 염색된 암세포의 분포가 현저히 낮은 것을 알 수 있었다. 즉 Angel-Stem Cell의 항암 효과가 우수한 것을 확인하였다 (도 14 내지 도 16).
도 14 내지 도 16의 대조군 MSC+암세포의 MSC는 세포배양시 0.2mM 아스코브산이 포함된 배지에서 배양되어, 비타민 C가 전처리된 Vit.C-MSC이다.
6-2: 암줄기세포
실시예 6-1과 동일하게 아스피린을 처리한 Vit.C-MSC인 ASP-Vit.C-MSC를 제조한 다음, 암줄기세포와의 직접 공배양을 통해 ASP-Vit.C-MSC의 항암 효과를 확인하였다.
암줄기세포는 붉은색 형광 (red fluorescence)으로 표지한 후, 0.5×106 cells의 ASP-Vit.C-MSC이 접종되어 있는 100mm 세포배양 접시에 0.5×105 cells/dish로 접종하여 CO2 배양기에서 37℃로 48시간 동안 직접 공배양 하였다.
48시간 후, 암줄기세포를 회수하여 전체 세포 수, 생존율 및 크기를 측정하고, 붉은색 형광 (red fluorescence)으로 표지된 암줄기세포의 분포를 FACS로 확인하여 Angel-MSC의 암줄기세포에 대한 항암 능력을 비교 분석하였다.
실시예 7: 아스피린 함유 배지에서 배양한 Vit.C-MSC와 암세포와의 간접 공배양을 통한 항암 효과 확인
7-1: 유방암 및 췌장암 세포
간접 공배양 (indirect co-culture)를 실시하기 위해, 이원화 세포배양을 할 수 있는 트랜스 웰을 사용하여 웰 바닥에 암세포를 부착시키고 웰에 있는 insert membrane 위에는 Vit.C-MSC를 부착시킨 후, 10% FBS가 포함된 DMEM 배지에서 5% CO2 공급 및 37℃ 조건으로 48시간 동안 공배양하였다.
먼저, 실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 T75 flask에 10% 밀도 (0.5×106 cells)로 RKCM-N 배지에 접종한다. 2일 후 50~60% 밀도가 되면 RKCM-N 배지인 5% FBS, 2mM NAC, 0.2mM ascorbic acid, 0.09mM calcium, 5ng/ml rEGF, 5㎍/ml 인슐린 및 74ng/ml Hydrocortisone를 함유한 Keratinocyte-SFM 배지에 각각 0.1mM, 0.5mM 및 1mM의 농도로 아스피린을 처리하여, 24시간 동안 배양한 후 ASP-Vit.C-MSC (Angel-Stem Cell)를 회수하였다. 아스피린 농도별로 회수한 ASP-Vit.C-MSC 각각은 인서트 트랜스 웰 (6-웰)에 1.4×105 cells/well로 접종하여 암세포가 있는 언더 웰 위에 놓는다.
ASP-Vit.C-MSC와 암세포의 간접 공배양으로 항암 효과를 확인하기 위해, MCF-7 및 PANC-1 암세포가 각각 부착 배양된 트랜스 웰 (6-웰)의 언더 웰에 아스피린 농도별 ASP-Vit.C-MSC가 있는 인서트 트랜스 웰 (6-웰)을 올려, 10% FBS가 함유된 DMEM 배지에서 48시간 배양하여, 암세포를 회수하였다. 회수한 암세포의 세포수, 생존율, 세포크기를 automated cell counter Luna (Logoy)를 이용하여 확인하였다.
그 결과, 유방암 세포 MCF-7 및 췌장암 세포 PANC-1 모두에서 Vit.C-MSC에 비해 아스피린 농도 0.5mM의 ASP-Vit.C-MSC에서 암세포의 증식이 억제되어 암세포 수가 감소한 것을 알 수 있었다 (도 17 내지 도 19). 즉, Vit.C-MSC에 비해 ASP-Vit.C-MSC인 Angel-Stem Cell의 항암 효과가 우수한 것을 확인하였다.
도 17 내지 도 19의 대조군 MSC+암세포의 MSC는 세포배양시 0.2mM 아스코브산이 포함된 배지에서 배양되어, 비타민 C가 전처리된 Vit.C-MSC이다.
7-2: 암줄기세포
이원화 세포배양을 할 수 있는 트랜스 웰을 사용하여 암줄기세포와 Vit.C-MSC의 간접 공배양 (indirect co-culture)를 실시하여 ASP-Vit.C-MSC의 항암 효과를 확인하였다.
먼저, 200~400㎛ 크기의 스피어 형태 (sphere form)로 배양한 암줄기세포를 트랜스 웰 (6-웰)의 언더 웰에 1.4×105 cells로 접종한 후, ASP-Vit.C-MSC가 1.4×105 cells/well로 접종되어 있는 인서트 트랜스 웰 (6-웰)을 언더 웰 위에 놓는다. ASP-Vit.C-MSC는 실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 상기 실시예 7-1과 동일한 방법으로 제조하였다.
CO2 배양기에서 37℃로 48시간 동안 간접 공배양 후, 암줄기세포를 회수하여 전체 세포 수, 생존율 및 세포 크기를 측정하여 Angel-MSC의 암줄기세포에 대한 항암 능력을 비교 분석하였다.
실시예 8: 아스피린 함유 배지에서 배양한 Vit.C-MSC의 유전자 발현 분석
실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 각각 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 배지로 교환하여 24시간 동안 배양하였다. 그 다음, 항암 메커니즘에 관련된 유전자들, 아폽토시스 및 혈관신생 관련 유전자들의 발현을 확인하였다.
T75 Flask에서 배양한 ASP-Vit.C-MSC를 0.25% trypsin/1mM EDTA를 처리하여 세포를 분리한 다음 PBS로 세척하고, 1,500 rpm에서 5분 동안 원심분리 하여 세포를 수집하였다. 수집한 세포는 TRIzol® Reagent (15596-026, Thermo)를 이용하여 total RNA를 추출하였다. RNA 1~3μg을 DiaStar 2X RT Pre-Mix (Solgent, DR41-P096)로 cDNA를 합성하였다. cDNA 합성효율을 높이기 위해 Random hexamers(Invitrogen, N8080127)와 RiboLock RNase (Thermo Scientific, EO0384)를 같이 사용하였으며, 각각의 시약은 제조사의 지시에 따른 농도로 혼합한 뒤 Tprofessional TRIO Thermocycler(Biometra)를 이용하여 50~55℃에서 60분, 95℃에서 5분 조건으로 합성하였다. RT-PCR은 2Xh-Tag PCR Smart mix (SolGent, STD01-M50h) 25㎕, Primer F(10pmole/㎕, 바이오니아) 2㎕, Primer R(10pmole/㎕, 바이오니아) 2㎕로 cDNA를 98℃에서 10초 동안 DNA를 변성시킨 후, 각 어닐링 온도에서 30초간 primer를 가열시키고, 72℃에서 1분간 PCR 산물을 신장시키는 반응을 30 cycle 조건으로 Tprofessional TRIO Thermocycler(Biometra)를 이용하여 유전자 증폭을 실행하였다. 각각의 유전자에 대한 프라이머 서열은 표 3에 나타내었다.
PCR 산물을 2.0 % 아가로스겔과 1X TAE 시약을 이용하여 110V에서 1시간 30분 동안 전기영동 한 후 Fuji molecular imaging software로 이미지 측정을 하였다. 컨트롤 유전자로 베타-엑틴을 사용하였다.
또한, 유전자 발현을 정량하기 위해 THUNDERBIRD SYBR qPCR Mix (TOYOBO QPS-201T)로 실시간-PCR을 수행하였다. THUNDERBIRD SYBR qPCR Mix 10㎕, 10μM Primer Fw (바이오니아) 0.5㎕, 10μM Primer Rv (바이오니아) 0.5㎕, cDNA 1㎕를 95℃에서 15초 동안 DNA를 변성시킨 후, 각 어닐링 온도에서 60초간 primer를 가열시키는 반응을 40 cycle 조건으로 ABapplied Biosystems (StepONE real time PCR system, life technologies)을 이용하여 분석하였다.
유전자 발현양을 비교하기 위해서는 PikoReal™ Real-Time PCR (Thermo Fisher Scientific) 기기와 Maxima SYBR Master Mix(x2) (Thermo PIKOREAL 96) (Thermo, #K0221)를 사용하여 Real-time PCR을 진행하였다. PCR Cycle은 95℃에서 15초간 변성(denaturation)시켜준 뒤 60℃에서 60초간 Annealing ＆ Extension 과정을 거쳤다. 이러한 사이클을 총 40회 실시하였다. 발현양의 비교는 House keeping gene (b-act)의 Ct값과 목적 유전자의 Ct값을 활용하여 상대비교를 통해 유전자 발현양을 비교하였다.
Table Primer used for qPCR amplification of target genes
Gene primer sequences 5'-->3'
hTRAIL FW ATGGCTATGATGGAGGTCCAGG (서열번호 1)
Rv TCAGCTCGTTGGTAAAGTACACG (서열번호 2)
h Fas L FW CTGGGGATGTTTCAGCTCTT (서열번호 3)
Rv GTGGCCTATTTGCTTCTCCAA (서열번호 4)
h CXCR4 FW GCGGAAAACCAAGACGCTC (서열번호 5)
Rv TTCATGTGCGCGTAACTGTC (서열번호 6)
h VEGF-A FW TGAGCTTCCTACAGCACAAC (서열번호 7)
Rv GAACGCTCCAGGACTTATACC (서열번호 8)
h Nrf2 FW ACCAGTGGATCTGCCAACTA (서열번호 9)
Rv ACGTAGCCGAAGAAACCTCA (서열번호 10)
h c-Myc FW AAGGCCCCCAAGGTAGTTAT (서열번호 11)
Rv TTCCGCAACAAGTCCTCTTC (서열번호 12)
h p21 FW TGTCTTGTACCCTTGTGCCT (서열번호 13)
Rv GCGTTTGGAGTGGTAGAAATC (서열번호 14)
h Sox2 FW cvGCGGAAAACCAAGACGCTC (서열번호 15)
Rv TTCATGTGCGCGTAACTGTC (서열번호 16)
h Nanog FW TCCAACATCCRCAACCTCAGC (서열번호 17)
Rv CCTTCTGCGTCACACCATTG (서열번호 18)
h Oct4 FW CACTGTACTCGGTCCCTTTC (서열번호 19)
Rv CAGGCACCTCAGTTTGAATGC (서열번호 20)
실시예 9: 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 항암, 아폽토시스 및 혈관신생 관련 유전자 분석
9-1: Fas L, TRAIL 및 CXCR4 유전자 발현 분석을 통한 항암메커니즘 확인
실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 각각 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 배지로 교환하여 24시간 동안 배양하였다.
줄기세포에서 발현되는 Fas L는 암세포의 Fas와 결합하여 아폽토시스 경로를 통해 암세포의 아폽토시스를 진행시키므로, 암세포의 아폽토시스에 관여하는 Fas L 유전자의 발현을 확인하였다. 또한, 이러한 FAS를 포함하여 DR4/DR5도 세포사멸 경로에 관여하는 수용체인 FDAA(Fas-Associated protein with Death Domain)에 속하며, TRAIL이 DR4/DR5라는 수용체와 결합하여 아폽토시스를 유도한다. 따라서, Fas L 뿐만 아니라 TRAIL 유전자의 발현도 확인하였다. 실시예 8과 동일한 방법으로 RT-PCR 및 실시간 PCR을 수행하였으며, 표 3의 프라이머를 사용하였다.
그 결과, 암세포의 아폽토시스에 관여하는 항암 메커니즘에 관련된 유전자들인 Fas L와 TRAIL의 발현이 0.5mM 농도의 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 가장 높은 것을 확인할 수 있었다 (도 21 내지 도 23). 즉, ASP-Vit.C-MSC인 Angel-Stem Cell의 항암 효과가 0.5mM 아스피린에서 가장 우수한 것을 확인하였다.
또한, homing effect 인자인 CXCR4 유전자 발현 증가를 확인하였다 (도 23). 이로써, 아스피린 함유 배지에서 배양한 Vit.C-MSC는 Fas L, TRAIL 및 CXCR4와 연관된 경로를 통해 항암 작용을 하는 것을 확인할 수 있었다.
9-2: VEGF 유전자 발현 분석을 통한 암세포의 혈관신생 확인
실시예 1의 비타민 C를 함유하는 배지에서 배양한 Vit.C-MSC를 2일간 배양하여 부착 및 안정화시킨 다음, 아스피린을 각각 0.1mM, 0.5mM 및 1mM의 농도로 첨가한 배지로 교환하여 24시간 동안 배양하였다.
줄기세포에서 발현되는 VEGF는 암세포의 혈관신생에 관여하므로 VEGF 유전자의 발현을 확인하였다. 실시예 8과 동일한 방법으로 RT-PCR을 수행하였으며, 표 3의 프라이머를 사용하였다.
그 결과, 암세포의 혈관신생에 관여하는 VEGF의 발현이 0.5mM 농도의 아스피린 함유 배지에서 배양한 Vit.C-MSC에서 가장 낮은 것을 확인할 수 있었다 (도 24). 즉, ASP-Vit.C-MSC인 Angel-Stem Cell의 항암 효과가 0.5mM 아스피린에서 가장 우수한 것을 확인하였다.
9-3: Oncogenic transformation 감소 효과
실시예 7과 같은 조건으로 0.5mM 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 MSC에서 Nrf2, c-myc 및 p21 유전자의 발현을 비교하였다. 실시예 8과 동일한 방법으로 RT-PCR을 수행하였으며, 표 3의 프라이머를 사용하였다.
그 결과, 도 25에서와 같이, Nrf2, c-myc 및 p21 유전자의 발현이 모두 감소하였으며, 이는 아스피린 함유 배지에서 배양한 지방유래줄기세포가 암세포로의 변성 (Oncogenic transformation)으로부터 자유로울 수 있다는 증거이다 (Juan et al., Molecular Cancer. 13:20, 2014). p21 유전자가 감소하였다는 것은 줄기세포가 훨씬 젊어진 것으로 기대할 수도 있다.
또한, Angel-Stem Cell에서 줄기세포 특성을 분석하기 위해 Sox2, Oct4 및 Nanog의 발현을 분석하여 MSC와 비교하였다.
그 결과, Angel-Stem Cell은 MSC와 같은 양상으로 유전자를 발현하고 있었으며, 줄기세포의 특성이 변하지 않고 유지되고 있음을 알 수 있었다 (도 26).
실시예 10: 아스피린 함유 배지에서 배양한 Vit.C-MSC와 간접 공배양한 암세포의 유전자 발현 분석
실시예 7과 같은 조건으로 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와 암세포를 간접 공배양 한 다음, 암세포에서 유전자 발현을 분석하였다. 유전자 발현 분석은 실시예 8과 동일한 방법으로 수행하였다.
유전자 발현 분석에 사용한 각각의 유전자의 프라이머는 표 3 및 표 4에 나타내었다.
Table Primer used for qPCR amplification of target genes
primer sequences 5'-->3'
h Bcl2 FW GGGTACGATAACCGGGAGATAGTGA (서열번호 21)
Rv GGAGGAGAAGATGCCCGGTG (서열번호 22)
h PPAR-γ FW TTAGATGACAGCGACTTGGC (서열번호 23)
Rv GGCTTGTAGCAGGTTGTCTT (서열번호 24)
h Apaf 1 FW CTTCTTCCAGTGTAAGGACAGT (서열번호 25)
Rv CAGCCTGCCATTCCATGTAT (서열번호 26)
10-1: 암세포에서의 아폽토시스 유전자 발현
아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)의 암세포 증식 억제 메커니즘을 밝히고자, 암세포에서 아폽토시스 관련 인자들의 발현을 분석하였다.
그 결과, 간접 공배양한 유방암, 췌장암 세포에서 Bcl-2 발현이 감소한 것을 확인할 수 있었다 (도 27). 또한, 간접 공배양한 유방암 세포에서 PPAR-γ 및 Apaf-1의 발현이 증가한 것을 확인할 수 있었다 (도 28 및 도 29). 이는 아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)와의 공배양에 의해 암세포에서 아폽토시스가 증가한다는 것을 나타낸다.
10-2: Angel-Stem Cell에 의한 암세포 전이 억제 효과
아스피린 함유 배지에서 배양한 Vit.C-MSC (Angel-Stem Cell)의 암세포 전이 억제 효과를 확인하고자, 암세포에서 Oct4 유전자의 발현을 분석하였다. Oct4 프라이머는 실시예 9-3에서 사용한 것과 동일한 프라이머 (표 3)로 분석하였다.
Oct4는 암의 전이 정도를 판단하는 지표로 사용된다는 보고가 있다 (Liu et al., Ann Surg. 253(6):1165-71, 2011; HAI LIN et al., MOLECULAR MEDICINE REPORTS 9:1335-1342, 2014). 따라서, Oct4의 발현이 감소하면 전이 정도가 낮은 것으로 판단할 수 있다.
도 30의 결과를 보면 간접 공배양한 유방암, 췌장암 세포에서 Oct4의 발현이 감소한 것을 확인할 수 있었다.
본 발명에 따른 비타민 C와 아스피린을 함유하는 중간엽 줄기세포 제조용 배지는 활성을 유지하면서 암세포의 증식을 억제하는 중간엽 줄기세포를 제조할 수 있으므로, 줄기세포 치료제의 암으로부터 안전성 확보와 항암 세포치료제로서의 제조에 매우 유용하다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. 본 발명의 단순한 변형 내지 변경은 이 분야의 통상의 지식을 가진 자에 의하여 용이하게 이용될 수 있으며, 이러한 변형이나 변경은 모두 본 발명의 영역에 포함되는 것으로 볼 수 있다.
전자파일 첨부하였음.

Claims (16)

  1. 아스피린을 함유하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포 제조용 배지 조성물.
  2. 제1항에 있어서, 비타민 C를 추가로 포함하는 것을 특징으로 하는 배지 조성물.
  3. 제1항에 있어서, 5~10% FBS 및 NAC (N-acetyl Cystein)을 함유하는 DMEM 또는 K-SFM인 것을 특징으로 하는 배지 조성물.
  4. 제3항에 있어서, 칼슘, rEGF, 인슐린 및 하이드로코티손을 추가로 함유하는 것을 특징으로 하는 배지 조성물.
  5. 제1항에 있어서, 상기 중간엽 줄기세포는 지방, 자궁, 골수, 근육, 태반, 제대혈, 소변, 모낭 및 피부로 구성된 군에서 선택된 조직 유래인 것을 특징으로 하는 배지 조성물.
  6. 제1항에 있어서, 상기 아스피린의 농도는 0.1mM 내지 1mM인 것을 특징으로 하는 배지 조성물.
  7. 제1항에 있어서, 상기 암세포는 유방암, 췌장암, 신경교종, 신경교육종, 역형성 성상세포종, 수모세포종, 폐암, 소세포 폐암종, 자궁경부 암종, 결장암, 직장암, 척삭종, 인후암, 카포시 육종, 림프관 육종, 림프관 내피 육종, 결직장암, 자궁내막암, 난소암, 백혈병, 전립선암, 신장 세포 암종, 간 암종, 담관 암종, 융모막 암종, 정상피종, 고환 종양, 윌름 종양, 유잉 종양, 방광 암종, 혈관육종, 내피육종, 선암종, 한선 암종, 피지선 암종, 유두 암종, 유두선육종, 낭선육종, 기관지 암종, 수질 암종, 비만세포종, 중피종, 활막종, 흑색종, 평활근종, 횡문근종, 신경모세포종, 망막모세포종, 핍지교종, 청신경종, 혈관모세포종, 수막종, 송과체종, 상의세포종, 두개인두종, 상피 암종, 배아 암종, 편평 세포 암종, 기저 세포 암종, 섬유육종, 점액종, 점액육종, 지방육종, 연골육종, 골원성 육종 세포 또는 암줄기세포인 것을 특징으로 하는 배지 조성물.
  8. 아스피린을 함유하는 배지에서 중간엽 줄기세포를 배양하는 단계를 포함하는 개선된 암세포 증식 억제능을 가지는 중간엽 줄기세포의 제조방법.
  9. 제8항에 있어서, 상기 배지는 비타민 C를 추가로 포함하는 것을 특징으로 하는 제조방법.
  10. 제8항에 있어서, 상기 배지는 5~10% FBS 및 NAC (N-acetyl Cystein)을 함유하는 DMEM 또는 K-SFM인 것을 특징으로 하는 제조방법.
  11. 제10항에 있어서, 칼슘, rEGF, 인슐린 및 하이드로코티손을 추가로 함유하는 것을 특징으로 하는 제조방법.
  12. 제8항에 있어서, 상기 중간엽 줄기세포는 비타민 C로 전처리된 것을 특징으로 하는 제조방법.
  13. 제8항에 있어서, 상기 중간엽 줄기세포는 지방, 자궁, 골수, 근육, 태반, 제대혈, 소변, 모낭 및 피부로 구성된 군에서 선택된 조직 유래인 특징으로 하는 제조방법.
  14. 제8항에 있어서, 상기 아스피린의 농도는 0.1mM 내지 1mM인 것을 특징으로 하는 제조방법.
  15. 제8항에 있어서, 상기 암세포는 유방암, 췌장암, 신경교종, 신경교육종, 역형성 성상세포종, 수모세포종, 폐암, 소세포 폐암종, 자궁경부 암종, 결장암, 직장암, 척삭종, 인후암, 카포시 육종, 림프관 육종, 림프관 내피 육종, 결직장암, 자궁내막암, 난소암, 백혈병, 전립선암, 신장 세포 암종, 간 암종, 담관 암종, 융모막 암종, 정상피종, 고환 종양, 윌름 종양, 유잉 종양, 방광 암종, 혈관육종, 내피육종, 선암종, 한선 암종, 피지선 암종, 유두 암종, 유두선육종, 낭선육종, 기관지 암종, 수질 암종, 비만세포종, 중피종, 활막종, 흑색종, 평활근종, 횡문근종, 신경모세포종, 망막모세포종, 핍지교종, 청신경종, 혈관모세포종, 수막종, 송과체종, 상의세포종, 두개인두종, 상피 암종, 배아 암종, 편평 세포 암종, 기저 세포 암종, 섬유육종, 점액종, 점액육종, 지방육종, 연골육종, 골원성 육종 세포 또는 암줄기세포인 것을 특징으로 하는 제조방법.
  16. 제8항에 있어서, 상기 배양의 시간은 24시간인 것을 특징으로 하는 제조방법.
PCT/KR2017/008176 2016-07-29 2017-07-28 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법 WO2018021879A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2019527108A JP6918943B2 (ja) 2016-07-29 2017-07-28 癌細胞の増殖を抑制する間葉幹細胞の製造方法
CN201780058891.8A CN109790516A (zh) 2016-07-29 2017-07-28 制备抑制癌细胞增殖的间充质干细胞的方法
US16/321,520 US11788061B2 (en) 2016-07-29 2017-07-28 Method for producing mesenchymal stem cells that inhibit proliferation of cancer cells
EP17834820.7A EP3492585A4 (en) 2016-07-29 2017-07-28 PROCESS FOR PRODUCING MESENCHYMAL STEM CELLS THAT INHIBIT CANCER CELL PROLIFERATION

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0097107 2016-07-29
KR20160097107 2016-07-29

Publications (1)

Publication Number Publication Date
WO2018021879A1 true WO2018021879A1 (ko) 2018-02-01

Family

ID=61016341

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/008176 WO2018021879A1 (ko) 2016-07-29 2017-07-28 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법

Country Status (5)

Country Link
US (1) US11788061B2 (ko)
EP (1) EP3492585A4 (ko)
JP (1) JP6918943B2 (ko)
CN (1) CN109790516A (ko)
WO (1) WO2018021879A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019240559A1 (ko) * 2018-06-15 2019-12-19 주식회사 알바이오 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법
KR102233568B1 (ko) * 2019-12-13 2021-03-30 주식회사 알바이오 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109423473A (zh) * 2017-08-21 2019-03-05 青岛瑞思德生物科技有限公司 用于制备胎盘干细胞的试剂盒
CN109423476A (zh) * 2017-08-21 2019-03-05 青岛瑞思德生物科技有限公司 用于制备脂肪间充质干细胞的试剂盒
CN115975036B (zh) * 2022-08-18 2023-06-09 北京诺赛国际医学研究院 包含干细胞的药物组合物及其治疗癌症的用途
CN116515754B (zh) * 2023-03-17 2024-01-30 创芯国际生物科技(广州)有限公司 一种脂肪肉瘤类器官、培养基及培养方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130117343A (ko) * 2012-04-18 2013-10-25 라정찬 혈관 내 투여에 적합한 크기를 가지는 줄기세포의 제조방법

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2341869B1 (en) 2008-09-29 2015-05-27 SIFI MEDTECH S.r.l. Systems for designing and implanting a customized biometric intraocular lens
KR101261884B1 (ko) * 2009-04-15 2013-11-27 주식회사 강스템홀딩스 제대혈 또는 지방조직유래 성체줄기세포를 함유한 항암용 조성물
US20120263685A1 (en) * 2009-10-08 2012-10-18 Rnl Bio Co., Ltd Anti-tumor composition comprising human-derived adult stem cells
WO2011070974A1 (ja) 2009-12-07 2011-06-16 国立大学法人名古屋大学 脂肪組織由来間葉系幹細胞を含有する、前立腺癌治療用細胞製剤
EP2837682B1 (en) 2012-04-13 2017-09-20 Jeong Chan Ra Use of aspirin in composition for preventing stem cell disruption and aggregation
KR101523040B1 (ko) * 2012-06-26 2015-05-26 라정찬 고농도의 줄기세포 제조방법
KR101564325B1 (ko) 2013-04-19 2015-10-29 창원대학교 산학협력단 지방유래줄기세포에 t항원을 도입한 adsc-t 세포의 배양액을 유효성분으로 포함하는, 염증질환의 예방 또는 치료용 조성물
KR101583569B1 (ko) * 2013-05-15 2016-01-08 라정찬 정맥 투여용 줄기세포 조성물
EP3043806A4 (en) * 2013-09-11 2017-05-17 University Of Southern California A composition of stem cells having highly expressed fas ligand
CN105132369B (zh) * 2015-08-25 2018-06-26 青岛瑞思科生物科技有限公司 一种将间充质干细胞转化为睾酮分泌细胞的诱导剂及诱导培养基

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130117343A (ko) * 2012-04-18 2013-10-25 라정찬 혈관 내 투여에 적합한 크기를 가지는 줄기세포의 제조방법

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
ATSUTA, IKIRU ET AL.: "Mesenchymal Stem cells Inhibit Multiple Myeloma Cells via the Fas/Fas Ligand Pathway", STEM CELL RESEARCH & THERAPY, vol. 4, no. 5, 11 September 2013 (2013-09-11), pages 111, XP021162905, DOI: doi:10.1186/scrt322 *
BHARADWAJ ET AL., STEM CELLS, vol. 31, no. 9, 2013, pages 1840 - 56
BURN, JOHN ET AL.: "Effect of Aspirin or Resistant Starch on Colorectal Neoplasia in the Lynch Syndrome", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 359, no. 24, 11 December 2008 (2008-12-11), pages 2567 - 2578, XP055580775 *
GUAN ET AL., TISSUE ENG, vol. 20, no. 13-14, 2014, pages 1794 - 806
HAI LIN ET AL., MOLECULAR MEDICINE REPORTS, vol. 9, 2014, pages 1335 - 1342
HSIEH, CHIA-CHIEN ET AL.: "Aspirin Breaks the Crosstalk between 3T3-L1 Adipocytes and 4T1 Breast Cancer Cells by Regulating Cytokine Production", PLOS ONE, vol. 11, no. 1, 21 January 2016 (2016-01-21), pages 1 - 17, XP055580772 *
JUAN ET AL., MOLECULAR CANCER, vol. 13, 2014, pages 20
LIU ET AL., ANN SURG., vol. 253, no. 6, 2011, pages 1165 - 71
REBECCA SY WONG ET AL., J BIOMED BIOTECHNOL, vol. 24, 2011, pages 2011
STEM CELLS: CURRENT CHALLENGES AND NEW DIRECTIONS PART OF THE SERIES STEM CELL BIOLOGY AND REGENERATIVE MEDICINE, 2013, pages 19 - 28
ZHANG D ET AL., GENES DIS., vol. 1, no. 8-17, 2014
ZHANG, YIYAO ET AL.: "Aspirin Counteracts Cancer Stem Cell Features, Desmoplasia and Gemcitabine Resistance in Pancreatic Cancer", ONCOTARGET, vol. 6, no. 12, 5 February 2015 (2015-02-05), pages 9999 - 10015, XP055452876, DOI: doi:10.18632/oncotarget.3171 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019240559A1 (ko) * 2018-06-15 2019-12-19 주식회사 알바이오 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법
KR102233568B1 (ko) * 2019-12-13 2021-03-30 주식회사 알바이오 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법
WO2021118325A1 (ko) * 2019-12-13 2021-06-17 주식회사 알바이오 항암 바이러스가 도입을 통한 생존능이 향상된 중간엽 줄기세포의 제조방법
KR20210075911A (ko) * 2019-12-13 2021-06-23 주식회사 알바이오 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법
KR102317328B1 (ko) * 2019-12-13 2021-10-26 주식회사 네이처셀 항암 바이러스가 도입된 중간엽 줄기세포의 세포 생존능을 향상시키는 방법

Also Published As

Publication number Publication date
EP3492585A4 (en) 2020-01-01
US11788061B2 (en) 2023-10-17
CN109790516A (zh) 2019-05-21
US20200010805A1 (en) 2020-01-09
EP3492585A1 (en) 2019-06-05
JP6918943B2 (ja) 2021-08-11
JP2019526277A (ja) 2019-09-19

Similar Documents

Publication Publication Date Title
WO2018021879A1 (ko) 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법
JP7108537B2 (ja) Ｃｄ２０１、ｃｄ４６、ｃｄ５６、ｃｄ１４７及びｃｄ１６５からなる群より選択される少なくとも１種の細胞表面マーカーを発現する間葉系幹細胞及びその調製方法、並びに上記間葉系幹細胞を含む医薬組成物及びその調製方法
WO2011049414A2 (ko) 지방조직 유래 성체 줄기세포 이동을 유도하는 방법
WO2014181954A1 (ko) 줄기세포의 재생능 향상을 위한 배지 조성물 및 이를 이용한 줄기세포의 배양방법
WO2011043524A1 (ko) 인간 유래 성체 줄기세포를 함유하는 항암용 조성물
WO2016117816A1 (ko) 인간 중간엽 줄기세포의 줄기세포능을 증가시키는 방법
WO2018088693A1 (ko) 2ｄｇ를 이용한 줄기세포 역량 향상 방법
WO2016068596A1 (ko) 줄기세포 배양을 위한 배지조성물
Lee et al. Transdifferentiation of mouse adipose-derived stromal cells into acinar cells of the submandibular gland using a co-culture system
WO2012008733A2 (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
WO2013165120A1 (ko) 신경능선줄기세포의 배양방법 및 그 용도
WO2019017691A9 (ko) 인간 유래 만능줄기세포에서 모유두전구세포로의 분화방법 및 이의 용도
WO2011102680A9 (ko) Pi3k/akt/gsk3 경로를 통해 성체줄기세포의 증식, 다분화능 및 재프로그래밍을 촉진하는 cd49f
WO2022004938A1 (ko) 유사 중간엽 줄기세포의 제조방법
WO2021071289A2 (ko) 줄기세포능을 증대시키기 위한 조성물 및 이의 용도
WO2019190246A1 (ko) 인간 제대로부터 줄기세포를 분리하는 방법
WO2021034168A1 (ko) 줄기세포의 증식 및 전능성 증진용 조성물
WO2013162330A1 (ko) 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법
WO2021107234A1 (ko) Hiv 감염 치료 또는 예방을 위한 ccr5/cxcr4 유전자 동시 넉아웃 환자맞춤형 조혈모세포 및 이의 제조방법
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2021118325A1 (ko) 항암 바이러스가 도입을 통한 생존능이 향상된 중간엽 줄기세포의 제조방법
WO2022255836A1 (ko) 조직 내재성 uPAR+/Nestin+ 줄기세포 분리 배양 방법 및 이의 용도
WO2019117454A1 (ko) 세포 소기관 스트레스 조절 인자를 이용하는 고효율 세포전환용 배지 첨가제
WO2022234998A1 (ko) 골 분화능 기능강화 중간엽 줄기세포 및 이의 용도
WO2017026838A1 (ko) 향상된 탯줄 유래 부착형 줄기세포, 그의 제조방법 및 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17834820

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019527108

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017834820

Country of ref document: EP

Effective date: 20190228