WO2018088693A1 - 2dg를 이용한 줄기세포 역량 향상 방법 - Google Patents
2dg를 이용한 줄기세포 역량 향상 방법 Download PDFInfo
- Publication number
- WO2018088693A1 WO2018088693A1 PCT/KR2017/010773 KR2017010773W WO2018088693A1 WO 2018088693 A1 WO2018088693 A1 WO 2018088693A1 KR 2017010773 W KR2017010773 W KR 2017010773W WO 2018088693 A1 WO2018088693 A1 WO 2018088693A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- stem cells
- cell
- stem
- present
- glucose
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/02—Atmosphere, e.g. low oxygen conditions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/34—Sugars
Definitions
- the present invention relates to a stem cell capacity improving medium composition comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions, and a use thereof.
- 2DG 2-deoxy-D-glucose
- Mesenchymal stem cells are known to be involved in tissue regeneration, treatment, and immune response, as well as their multipotency, and by using such characteristics to separate and culture mesenchymal stem cells from umbilical cord blood, bone marrow, etc. Efforts have been made to develop, but there is a problem that the stem cell capacity (stemness) is lost because aging progresses and cell differentiation occurs by subcultured stem cells.
- glycolysis and oxidative phosphorylation have been decreased in embryonic stem cells (ESC) and induced pluripotent stem cells (iPS) compared to differentiated cells.
- ESC embryonic stem cells
- iPS induced pluripotent stem cells
- the ATP produced in the glycolysis process is only 2-3 mol / mol glucose, but nucleic acid, amino acid, fatty acid metabolism, etc., which occur incidentally through this process, are not only maintained by stem cell function but also building blocks necessary for differentiation process ( Metabolism is a very important metabolic process for building building blocks. Promoting intracellular glycolysis metabolism to an appropriate level can be an important factor in the development of clinically applicable stem cells.
- the oxidative phosphorylation process generates most of the ATP needed to maintain the intrinsic function of the cell, but this process generates reactive oxygen species (ROS) and proapoptotic proteins, which are disadvantageous metabolic processes for maintaining stem cell function.
- ROS reactive oxygen species
- proapoptotic proteins which are disadvantageous metabolic processes for maintaining stem cell function.
- inhibiting intracellular oxidative phosphorylation to an appropriate level may also be an important factor in the development of stem cells capable of clinical application.
- the energy metabolic process affected by the micro-environment is an important factor for maintaining and improving the function of stem cells, but research on this is insufficient.
- the present inventors have studied intensively about the method of inhibiting aging and improving stem cell performance through reprogramming of metabolic processes of stem cells.
- the present invention was completed by discovering that the overall metabolic and proliferative efficiency are improved and the expression level of angiogenesis factors is increased through the increase of glycolysis and inhibition of oxidative phosphorylation.
- an object of the present invention is to provide a medium composition for improving stem cell performance, and a use thereof, comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions.
- the present invention provides a medium composition for improving stem cell performance, comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions.
- 2DG 2-deoxy-D-glucose
- the low oxygen condition is characterized in that the oxygen partial pressure is 1 to 10%.
- the 2-deoxy-D-glucose (2DG) is characterized in that contained in the medium at a concentration of 1 ⁇ M to 10mM.
- the medium is characterized in that DMEM (Dulbecco's modified Eagle's medium) medium with 10% fetal bovine serum (FBS) and 1% penicillin added.
- DMEM Dulbecco's modified Eagle's medium
- FBS fetal bovine serum
- the stem cells are characterized in that the embryonic stem cells or adult stem cells.
- the adult stem cells are mesenchymal stem cells derived from one or more tissues selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta. It features.
- the stem cell ability is characterized in that the expression of Nanog, Oct4 or KLF4 is increased.
- the stem cell capacity is characterized in that cell aging is inhibited, cell proliferation ability and protein homeostasis is improved.
- the present invention also provides a method for improving stem cell performance, comprising culturing stem cells in the medium composition.
- the present invention provides a stem cell improved in the stem cell capacity obtained by the above method.
- the stem cells are mesenchymal stem cells derived from one or more tissues selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane and placenta. do.
- the present invention also provides a cell therapeutic agent for ischemia treatment comprising the stem cells.
- the cell therapeutic agent is characterized by improving angiogenesis.
- the present invention also provides a cell therapeutic agent for cancer treatment, comprising the stem cells.
- the present invention also provides a therapeutic agent for ischemic disease secreted by the stem cells.
- the present invention also provides an anticancer drug secreted from the stem cells.
- the present invention also provides a method for treating cancer and ischemic diseases using the stem cells.
- the present invention also provides a therapeutic use of the cancer, ischemic diseases of the stem cells.
- next generation high efficiency stem cells by reprogramming the metabolic processes of stem cells through a simple and safe method of controlling the culture environment without using genetic manipulations or viral vectors.
- Figure 2 is a result confirming the effect on the stem cell capacity when treated with 2-deoxy-D-glucose (2DG) under hypoxic conditions in the stem cells.
- Figure 4 is a result confirming the effect on the cell proliferation when the treatment of 2-deoxy-D-glucose (2DG) under hypoxic conditions in the stem cells.
- the present invention provides a medium composition for improving stem cell performance, comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions.
- 2DG 2-deoxy-D-glucose
- the low oxygen condition is not limited as long as the oxygen partial pressure is lower than the normal oxygen condition (20% oxygen partial pressure), for example, the oxygen partial pressure is preferably 1 to 10%, more preferably 1%. desirable.
- 2-deoxy-D-glucose (2DG) in the present invention has the following formula, a 2-hydroxy group of glucose is a compound substituted with a hydrogen group.
- the 2DG compound is known as a cancer therapeutic agent due to its function of inhibiting cell growth, but it is disclosed for the first time in the present invention that it can improve stem cell ability.
- 2DG which is known as a glycolysis inhibitor under normal oxygen conditions, increases glycolysis at the gene / protein level in reverse under hypoxic conditions, and that the condition of hypoxic environment changes the role of 2DG to reprogram the metabolic process. It is believed to be.
- the cell has an antioxidant system to block cell damage caused by prooxidants, and 2DG is expected to maximize this antioxidant system.
- DMEM Dulbecco's modified Eagle's medium
- FBS fetal bovine serum
- 'stem cell' refers to a cell having an ability to differentiate into two or more different types of cells while having an autologous ability as an undifferentiated cell.
- Stem cells of the present invention may be autologous or allogeneic stem cells, may be from any type of animal, including humans and non-human mammals, and is not limited to whether the stem cells are derived from adults or embryos Do not.
- Stem cells of the present invention include embryonic stem cells or adult stem cells, preferably adult stem cells.
- the adult stem cells may be mesenchymal stem cells, human tissue-derived mesenchymal stromal cells, human tissue-derived mesenchymal stem cells, multipotent stem cells or amniotic epithelial cells, preferably mesenchymal stem cells
- the mesenchymal stem cells may be mesenchymal stem cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amnion, and placenta, but is not limited thereto.
- the term 'placenta-derived stem cells' includes all stem cells separated from the placenta, and preferably, four types of stem cells separated from the human placenta separated in vitro.
- Cells human chorionic mesenchymal stromal cells or human chorionic mesenchymal stem cells (hCMSC)
- hCTC human chorionic trophoblastic cells
- the improvement of stem cell ability means that expression of a stem cell marker, such as Nanog, Oct4 or KLF4 gene, is increased.
- a stem cell marker such as Nanog, Oct4 or KLF4 gene
- the present invention provides a method for improving stem cell capacity, comprising the step of culturing stem cells in the medium composition, and the stem cell capacity obtained thereby.
- the present invention also provides a cell therapeutic agent for treating ischemic disease, including the stem cells.
- a cell therapeutic agent for treating ischemic disease including the stem cells.
- stem cells with increased expression of angiogenesis inducing factors are effective ingredients, they can be usefully used for the treatment of ischemic diseases by improving angiogenesis.
- the present invention also provides a cell therapeutic agent for cancer treatment, comprising the stem cells.
- Stem cells treated with 2DG in a hypoxic environment have increased expression of cell death factors, increased expression of tumor suppressor factors such as KLF4, and increased ROS due to an increase in the TCA cycle. It may be usefully used for the treatment of cancer diseases.
- HUC-MSC Human placenta-derived mesenchymal stem cells 2 ⁇ 10 5 were seeded in a culture dish and treated with 200 ⁇ M of 2-deoxy-D-glucose (2DG) under hypoxic conditions (1% oxygen partial pressure) for 3 days. Cells were collected, total RNA was extracted by a known method, and used for subsequent qRT-PCR experiments.
- 2DG 2-deoxy-D-glucose
- stem cell capacity such as Nanog, Oct4, and Klf4 was compared to the control group (Nor, Hy). It was confirmed that the expression of marker genes that could be confirmed was increased, and in particular, the expression of KLF4, which acts as a tumor suppressor, was increased by 134.5 times.
- HUC-MSC human placenta-derived mesenchymal stem cells
- RNA was isolated from the cells collected by cell culture by the method of Example 1, and gene expression was confirmed through qRT-PCR using the following PGK1, PKM2, MCT4, and MCT1 primers, which are glycolysis factors, to the total RNA isolated. .
- PGK1 phosphoglycerate kinase 1
- PKM2 pyruvate kinase M2
- PDHA pyruvate dehydrogenase alpha 1
- IDH1 isocitrate dehydrogenase 1
- IDH2 isocitrate dehydrogenase 2
- IDH3 ⁇ isocitrate dehydrogenase 3 ⁇
- RNA was isolated from the cells collected by cell culture by the method of Example 1, and qRT-PCR was prepared by using the following GDH (glutamate dehydrogenase), GLUD1 (glutamate dehydrogenase 1), Glutaminase1, and Glutamine synthase primers. Gene expression was confirmed through.
- RNA was isolated from the cells collected by cell culture by the method of Example 1, and the total CRT1, FABP1, ACACA, FABP1, FASN, LPL, HMGCR, and LCAT primers were separated into total RNA. Gene expression was confirmed.
- CPT1 Carnitine palmitoyltransferases 1
- FABP1 Fatty acid binding protein 1
- ACACA Acetyl-CoA carboxylase alpha
- FABP1 Fatty acid binding protein 1
- FASN Fatty acid synthase
- LPL Lipoprotein lipase
- HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase
- LCAT Lecithin-cholesterol acyltransferase
- 2DG inhibits glycolysis as known in normal oxygen environment (O 2 : 20-21%), but increases glycolysis, improves stemness, increases tumor suppression, and protein homeostasis in hypoxic environment (O 2 : 1%). It can be seen that it induces an increase and leads to an improvement in overall metabolism.
- HUC-MSC human placenta-derived mesenchymal stem cells
- the primer used at this time is as follows.
- AAMP Angio-Associated Migratory Cell Protein
- bFGF basic Fibroblast Growth Factor
- EGFR Epidermal Growth Factor Receptor
- Tie2 Endothelial specific receptor tyrosine kinase 2
- VEGF Vascular Endothelial Growth Factor
- HUC-MSC Human placenta-derived mesenchymal stem cells 2 ⁇ 10 5 were seeded in a culture dish and treated with 200 ⁇ M of 2-deoxy-D-glucose (2DG) under hypoxic conditions (1% oxygen partial pressure) for 3 days The cells were collected and stained with CD105, CD73, which is a stem cell positive (+) marker, and CD34, CD45, which is a netative (-) marker, for FACS analysis.
- 2DG 2-deoxy-D-glucose
- next generation high efficiency stem cells by reprogramming the metabolic processes of stem cells through a simple and safe method of controlling the culture environment without using genetic manipulations or viral vectors.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Hematology (AREA)
- Animal Behavior & Ethology (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Rheumatology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)을 포함하는 줄기세포능 향상용 배지 조성물, 및 이의 용도에 관한 것이다. 본 발명에 의하면, 유전자 조작이나 바이러스 벡터 등을 사용하지 않으면서 배양환경 조절이라는 간편하고도 안전한 방법을 통하여, 줄기세포의 대사과정을 리프로그래밍함으로써 차세대 고효율 줄기세포를 대량 생산할 수 있다. 또한, 본 발명에 의하면, 줄기세포의 대사 과정을 선택적으로 조절할 수 있는 분자생물학적 기전, 대사조절 마커를 규명함으로써 고효율 줄기세포 개발에 대한 새로운 방법론을 제시할 수 있다.
Description
본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는 줄기세포능 향상용 배지 조성물, 및 이의 용도에 관한 것이다.
중간엽 줄기세포는 그 다분화능과 함께, 조직의 재생, 치료 및 면역 반응에 관여하는 세포로 알려져 있어, 이와 같은 특성을 이용하여 제대혈, 골수 등으로부터 중간엽 줄기세포를 분리배양하여 다양한 질환의 치료제로 개발하고자 하는 노력이 있어왔으나, 줄기세포를 계대배양함에 따라 노화가 진행되며 세포 분화가 일어나므로 줄기세포능(stemness)을 잃게 되는 문제가 있다.
이러한 문제를 해결하여 줄기세포 효율을 증진시키기 위한 방안으로서, 바이러스 벡터를 이용한 유전자 조작이나 특정 단백질 과발현이 제안되어 왔으나 이는 안전성 문제로 인하여 임상 적용에는 한계가 있는 바, 1세대 줄기세포 연구를 통해 특정질환 치료를 위한 임상적용 가능성은 검증되었으나 낮은 효율과 효과기전 규명이 미흡하고 안전성 확보 또한 해결되지 않고 있다.
이와 관련하여, 최근 분화세포(differentiated cell)에 비하여 배아줄기세포(ESC)와 유도만능줄기세포(iPS)에서 해당(glycolysis) 대사과정이 증가하고 산화적 인산화(oxidative phosphorylation) 대사과정이 감소되어 있음이 보고됨으로써, 대사과정을 조절하는 리프로그래밍(reprogramming)을 통해 줄기세포의 줄기세포능(stemness) 유지 및 세포 노화억제를 통한 고효율 줄기세포 개발 가능성이 제시되고 있으나, 이에 대한 분자생물학적 기전은 거의 밝혀지지 않았으며, 아직 효율적인 조절기술은 개발되지 못하고 있다.
한편, 해당(glycolysis) 과정에서 생성되는 ATP는 2-3 mol/mol glucose에 불과하지만 이 과정을 통해 부수적으로 일어나는 핵산, 아미노산, 지방산 대사 등은 줄기세포능 유지 뿐만 아니라 분화과정에 필요한 빌딩블록(building block) 등을 만드는데 매우 중요한 대사과정으로 세포내 glycolysis 대사를 적정수준으로 촉진시키는 것은 임상적용이 가능한 줄기세포 개발에 중요한 요소가 될 수 있다.
또한, 산화적 인산화(oxidative phosphorylation) 과정을 통해 세포의 고유 기능 유지에 필요한 대부분의 ATP가 생성되나, 본 과정에서는 ROS(reactive oxygen species) 및 proapoptotic 단백질 등이 발생되므로 줄기세포능 유지에는 불리한 대사과정으로 알려져 있다. 따라서, 세포내 산화적 인산화 대사를 적정수준으로 억제시키는 것 역시 임상적용이 가능한 줄기세포 개발에 중요한 요소가 될 수 있다.
이와 같이, 생체 미세환경의 영향을 받는 에너지 대사과정은 줄기세포의 기능 유지 및 향상에 중요한 인자이나, 이에 대한 연구는 미흡한 실정이다.
이에, 본 발명자는 줄기세포의 대사과정 리프로그래밍을 통하여 노화를 억제하고 줄기세포능을 향상시킬 수 있는 방법에 대하여 예의 연구한 결과, 세포 배양환경의 산소농도를 조절함과 동시에 특정 물질을 처리시, 해당과정 증가 및 산화적 인산화 억제를 통하여 전반적인 대사능 및 증식 효율이 향상되고 혈관신생인자의 발현량이 증대됨을 발견함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)을 포함하는, 줄기세포능 향상용 배지 조성물, 및 이의 용도를 제공하는 것을 목적으로 한다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는, 줄기세포능 향상용 배지 조성물을 제공한다.
본 발명의 일 구체예로서, 상기 저산소 조건은 산소분압이 1∼10%인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 2-데옥시-D-글루코스(2DG)는 배지에 1μM∼10mM의 농도로 포함되어 있는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 배지는 10% 소태아혈청(FBS) 및 1% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 줄기세포는 배아줄기세포 또는 성체줄기세포인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 성체줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 줄기세포능은 Nanog, Oct4 또는 KLF4의 발현이 증가되는 것임을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 줄기세포능은 세포노화가 억제되고, 세포증식능 및 단백질 항상성이 향상되는 것임을 특징으로 한다.
또한, 본 발명은 상기 배지 조성물에 줄기세포를 배양하는 단계를 포함하는, 줄기세포능 향상방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 얻어진, 줄기세포능이 향상된 줄기세포를 제공한다.
본 발명의 일 구체예로서, 상기 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 한다.
또한, 본 발명은 상기 줄기세포를 포함하는, 허혈 치료용 세포 치료제를 제공한다.
본 발명의 일 구체예로서, 상기 세포 치료제는 혈관신생능을 향상시키는 것을 특징으로 한다.
또한, 본 발명은 상기 줄기세포를 포함하는, 암 치료용 세포 치료제를 제공한다.
또한, 본 발명은 상기 줄기세포에서 분비되는, 허혈성 질환 치료제를 제공한다.
또한, 본 발명은 상기 줄기세포에서 분비되는, 항암 치료제를 제공한다.
또한, 본 발명은 상기 줄기세포를 이용한, 암, 허혈성 질환의 치료방법을 제공한다.
또한, 본 발명은 상기 줄기세포의 암, 허혈성 질환의 치료용도를 제공한다.
본 발명에 의하면, 유전자 조작이나 바이러스 벡터 등을 사용하지 않으면서 배양환경 조절이라는 간편하고도 안전한 방법을 통하여, 줄기세포의 대사과정을 리프로그래밍함으로써 차세대 고효율 줄기세포를 대량 생산할 수 있다.
또한, 본 발명에 의하면, 줄기세포의 대사 과정을 선택적으로 조절할 수 있는 분자생물학적 기전, 대사조절 마커를 규명함으로써 고효율 줄기세포 개발에 대한 새로운 방법론을 제시할 수 있다.
도 1은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 단백질 항상성 유지능에 미치는 영향을 확인한 결과이다.
도 2는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 줄기세포능에 미치는 영향을 확인한 결과이다.
도 3은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 세포사멸능에 미치는 영향을 확인한 결과이다.
도 4는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 세포증식능에 미치는 영향을 확인한 결과이다.
도 5는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 glycolysis에 미치는 영향을 확인한 결과이다.
도 6은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 TCA cycle에 미치는 영향을 확인한 결과이다.
도 7은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 glutaminolysis에 미치는 영향을 확인한 결과이다.
도 8은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 PPP(Pentose Phosphate Pathway)에 미치는 영향을 확인한 결과이다.
도 9는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 지질대사에 미치는 영향을 확인한 결과이다.
도 10은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 angiogenesis 마커인 AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF의 발현에 미치는 영향을 확인한 결과이다.
도 11은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리한 후 FACS 분석을 통하여, 줄기세포의 성상에 변화가 없음을 확인한 결과이다.
본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는, 줄기세포능 향상용 배지 조성물을 제공한다.
본 발명에서 저산소 조건은 정상 산소조건(normoxia condition)인 20% 산소분압에 비하여 낮은 산소분압을 갖는 것이면 제한이 없으며, 예를 들면 산소 분압이 1∼10%인 것이 바람직하며, 1%인 것이 더욱 바람직하다.
본 발명에서 2-데옥시-D-글루코스(2DG)는 하기의 화학식을 가지며, 글루코스의 2-히드록실기가 수소기로 치환된 화합물이다. 종래, 2DG 화합물은 세포성장을 저해하는 기능으로 인하여 암 치료제로서의 용도가 알려져 있으나, 줄기세포능을 향상시킬 수 있음은 본 발명에서 최초로 밝힌 것이다.
[화학식]
본 발명에서 배지에 포함되는 2-데옥시-D-글루코스의 농도에 제한은 없으며, 예를 들면 1μM∼10mM의 농도로 포함되는 것이 바람직하며, 200μM인 것이 더욱 바람직하다.
본 발명에서는, 종래 정상산소 조건하에서 glycolysis 억제제로 알려진 2DG가, 저산소 조건하에서는 반대로 유전자/단백질 레벨에서 glycolysis를 증가시킴을 확인하였으며, 이는 저산소 환경이라는 조건이 2DG의 역할을 바꾸어 대사과정을 재프로그램화하는 것으로 여겨진다. 즉, 세포는 prooxidants에 의한 세포 손상을 차단하기 위해 항산화 시스템을 갖추고 있는데, 2DG가 이러한 항산화 시스템을 극대화하는 것으로 예상된다.
본 발명에서 세포 배양에 이용되는 배지에 제한은 없으며, 예를 들면 10% 소태아혈청(FBS) 및 1% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것이 바람직하다.
본 발명에서 '줄기세포'란 미분화된 세포로서 자기 복제 능력을 가지면서 두 개 이상의 서로 다른 종류의 세포로 분화하는 능력을 갖는 세포를 말한다. 본 발명의 줄기세포는 자가 또는 동종 유래 줄기세포일 수 있으며, 인간 및 비인간 포유류를 포함한 임의 유형의 동물 유래일 수 있고, 상기 줄기세포가 성체로부터 유래된 것이든 배아로부터 유래된 것이든 이에 한정되지 않는다.
본 발명의 줄기세포는 배아 줄기세포 또는 성체 줄기세포를 포함하며, 바람직하게는 성체 줄기세포이다. 상기 성체 줄기세포는 중간엽 줄기세포, 인간 조직 유래 중간엽 기질세포(mesenchymal stromal cell), 인간 조직 유래 중간엽 줄기세포, 다분화능 줄기세포 또는 양막상피세포일 수 있으며, 바람직하게는 중간엽 줄기세포이나, 이에 한정되지 않는다. 상기 중간엽 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반 등으로부터 유래된 중간엽 줄기세포일 수 있으나, 이에 한정되지 않는다.
본 발명에서, '태반-유래 줄기세포(placenta-derived stem cells)'라 함은 태반으로부터 분리된 줄기세포를 모두 포함하며, 바람직하게는 체외로 분리된 인간의 태반으로부터 분리된 4종류의 줄기세포, 즉 (1) 양막 상피세포(human amniotic epithelial cells, hAEC), (2) 양막에서 유래한 중간엽 줄기세포(human amniotic mesenchymal stromal cells 또는 human amniotic mesenchymal stem cells, hAMSC), 3) 융모막 중간엽 줄기세포(human chorionic mesenchymal stromal cells 또는 human chorionic mesenchymal stem cells, hCMSC), 및 (4) 융모 영양막 세포(human chorionic trophoblastic cells, hCTC)를 포함한다.
본 발명에서 줄기세포능의 향상이란, 줄기세포 마커인 Nanog, Oct4 또는 KLF4 유전자 등의 발현이 증가됨을 의미하는 것이다. 이들 유전자는 배아줄기세포에서 많이 발현하는 줄기세포의 전분화능, 즉 줄기세포 특성을 유지하는데 중요한 역할을 하는 유전자로 알려져 있다.
또한, 본 발명은 상기 배지 조성물에 줄기세포를 배양하는 단계를 포함하는 줄기세포능 향상방법, 및 이에 의해 얻어진 줄기세포능이 향상된 줄기세포를 제공한다.
또한, 본 발명은 상기 줄기세포를 포함하는, 허혈성 질환(ischemic disease) 치료용 세포 치료제를 제공한다. 본 발명의 세포 치료제에 의하면 혈관신생 유도 인자들의 발현이 증가된 줄기세포를 유효성분으로 하므로, 혈관신생능(angiogenesis)을 향상시킴으로써 허혈성 질환의 치료에 유용하게 이용될 수 있다.
또한, 본 발명은 상기 줄기세포를 포함하는, 암 치료용 세포 치료제를 제공한다. 저산소 환경에서 2DG를 처리한 줄기세포는, 세포 사멸 인자의 발현이 증가되고, KLF4와 같은 tumor suppressor 인자의 발현이 증가될 뿐만 아니라, TCA cycle 의 증가로 ROS가 증가되는 바, 이를 이용하여 저산소 환경을 만드는 암 질환의 치료에 유용하게 이용될 수 있을 것이다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1: 세포배양
인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 세포를 수집하여 공지의 방법으로 total RNA을 추출하여 이후의 qRT-PCR 실험에 이용하였다.
실시예 2: 단백질 항상성 유지능 확인
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 RNA에 HSP90, HSP70, HSP60, HSP40, HSP20, HSF1, EGFR 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
그 결과, 도 1에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 정상 산소군(Nor) 및 저산소 2DG 비처리군(Hy)에 비하여 단백질 항상성 유지를 위한 유전자들(HSP90, HSP70, HSP60, HSP40, HSP20, HSF1, EGFR)의 발현이 증가함을 확인하였다.
이러한 결과는, 세포의 불안정 단백질 또는 손상이나 노화로 인해 mis-folding된 단백질들의 파괴 또는 바른 folding 유도로 세포의 안정성이 향상되었음을 의미한다.
실시예 3: 줄기세포능(stemness) 향상 확인
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기의 Nanog, Oct4, Klf4 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
NANOG | AGTCCCAAAGGCAAACAACCCACTTC | TGCTGGAGGCTGAGGTATTTCTGTCTC |
OCT4 | CTGGGTTGATCCTCGGACCT | CACAGAACTCATACGGCGGG |
KLF4 | TCTCAAGGCAGACCTGCGAA | TAGTGCCTGGTCAGTTCATC |
그 결과, 도 2에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 Nanog, Oct4, Klf4와 같은 줄기세포능(stemness)을 확인할 수 있는 마커 유전자들의 발현이 높게 증가함을 확인하였으며, 특히 tumor suppressor로 작용하는 KLF4의 발현이 134.5배나 증가함을 확인하였다.
실시예 4: 세포사멸능(apoptosis) 증가 확인
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기의 p53, p21, p16 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
P16 | TTATTTGAGCTTTGGTTCTG | CCGGCTTTCGTAGTTTTCAT |
P21 | GCCTGGACTGTTTTCTCTCG | ATTCAGATGTGGGAGGAG |
P53 | GGGTTAGTTTACAATCAGCC | GGGCCTTGAAGTTAGAGAAA |
그 결과, 도 3에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 대표적인 아폽토시스(apoptosis) 인자인 p53, p21, p16의 발현이 현저히 증가하여 세포 사멸이 증가함을 확인하였다.
실시예 5: 세포증식능(proliferation) 감소 확인
인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)과 정산산소 조건(20% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 1% Trypsin EDTA를 처리하여 세포수를 확인하였다.
그 결과, 도 4에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 증식율이 현저히 감소함을 확인하였다.
실시예 6: 대사능 향상 확인
6-1. glycolysis
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 glycolysis 인자인 하기 PGK1, PKM2, MCT4, MCT1 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
PGK1 | GAAGCGGGTCGTTATGAG | GCCTTAATCCTCTGGTTGTT |
PKM2 | TCGGAGGTTTGATGAAAT | TCTCCAGCATCTGAGTAG |
MCT4 | CGTGGAGCTGCAAACAACTG | GCTCTGGCTACCAGGTGAAA |
MCT1 | CTTTGCGGCTTCCGTTGTTG | GGGTCCAACAAGGTCCATCA |
PGK1 : phosphoglycerate kinase 1
PKM2 : pyruvate kinase M2
MCT4 : monocarboxylate transporter 4
MCT1 : monocarboxylate transporter 1
그 결과, 도 5에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 glycolysis에 관여하는 상기 단백질들의 발현이 증가됨을 확인하였다.
6-2. TCA cycle
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 PDHA, IDH1, IDH2, IDH3 alpha, MDH, SDHA 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
PDHA | CAGCAATCTTGCCAGTGTGG | ACTGATTGGCACCACGAACT |
IDH1 | GTTAGCCCACAGAGCAAAGCT | GTAGTCAGAACGTTGCACATTGG |
IDH2 | GTGGAGCCATGACCAAGGA | TGCTCTTGATGGTGTCGAGG |
IDH3A | TGAGTATGCCCGGAACAACC | AAAGCCCATCTGACATCCGC |
MDH | ATCTGCGTCATTGCCAAT | GTACACTCCATGCTTCTTGA |
SDHA | TCGGAACTGCGACTCAGCAT | ACCTTCTTGCAACACGCTTCC |
PDHA : pyruvate dehydrogenase alpha 1
IDH1 : isocitrate dehydrogenase 1
IDH2 : isocitrate dehydrogenase 2
IDH3α : isocitrate dehydrogenase 3α
MDH : malate dehydrogenase
SDHA : succinate dehydrogenase alpha 1
그 결과, 도 6에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 TCA cycle에 관여하는 상기 단백질들의 발현이 증가됨을 확인하였다.
6-3. 글루타민 분해(glutaminolysis)
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 GDH(glutamate dehydrogenase), GLUD1(glutamate dehydrogenase 1), Glutaminase1, Glutamine synthase 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
GDH | ACAATGAAGCTGGTGTGACC | AAGACTGCACAGCCAGATGG |
GLUD 1 | TGGTGGAACTATTCCCATTGTACC | CTGTTCTCAGGTCCAATCCCAG |
Glutaminase1 | GCTGTGCTCCATTGAAGTGACT | TTGGGCAGAAACCACCATTAG |
Glutamine synthase | TTGCAAGTCATCCTGCAAAG | TGATCCTAAGCCCATTCCTG |
그 결과, 도 7에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 glutaminolysis에 관여하는 상기 단백질들의 발현량이 증가됨을 확인하였다.
6-4. PPP (5탄당 인산회로)
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 PHGDH, TKT, TALDO1 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
PHGDH | TGTCCTACCAGACTTCACTGGTG | GAAGGCTTCAGTCACATGCTG |
TKT | GCTGTGTCCAGTGCAGTAGT | TTGGTACCCGGTTAACTGCC |
TALDO1 | AGACGCAAGGCTCTCCTTTG | ATTCGGTCCTTGCTGATCCC |
PHGDH : Phosphoglycerate dehydrogenase
TKT : Transketolase
TALDO1 : Transaldolase 1
그 결과, 도 8에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 PPP(Pentose Phosphate Pathway)에 관여하는 상기 단백질들의 발현이 현저히 증가됨을 확인하였다.
6-5. 지질 대사
실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 CPT1, FABP1, ACACA, FABP1, FASN, LPL, HMGCR, LCAT 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.
Gene | Forward Primer | Reverse Primer |
CPT1 | TCTACCATGATGGGCGGCTGCT | CGTCTGGGCTCGTGCGACATTT |
FABP1 | TAGCCCACGTTGCTGGAGGTCC | TCTTCTTCTGCATGCCTGCGGA |
ACACA | CAAGCCATGTTAAGGCGCTG | CTGCGGATTTGCTTGAGGAC |
FABP1 | TCTTCTTCTGCATGCCTGCGCC | TAGCCCACGTTGCTGGAGGTGA |
FASN | GGACAGAGCAACTACGGCTT | GTGCTCATCGTCTCCACCAA |
LPL | GTGGACTGGCTGTCACGGGC | GCCAGCAGCATGGGCTCCAA |
HMGCR | TGAGGGCTCCTTCCGCTCCG | ACTAGAGGCCACCGAACCCCG |
LCAT | CCCCTGGATGTTTCCCTCTC | AGAAGCGTTGGAAGTCACGG |
CPT1 : Carnitine palmitoyltransferases 1
FABP1 : Fatty acid binding protein 1
ACACA : Acetyl-CoA carboxylase alpha
FABP1 : Fatty acid binding protein 1
FASN : Fatty acid synthase
LPL : Lipoprotein lipase
HMGCR : 3-hydroxy-3-methylglutaryl-CoA reductase
LCAT : Lecithin-cholesterol acyltransferase
그 결과, 도 9에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 지질 대사에 관여하는 단백질들의 발현이 현저히 증가됨을 확인하였다.
이상의 결과들로부터, 2DG는 정상산소 환경(O2: 20-21%)에서는 알려진 것과 같이 glycolysis를 억제시키나, 저산소 환경(O2: 1%)에서는 glycolysis 증가, stemness 향상, tumor suppression 증가, 단백질 항상성 증가를 유도하며, 전반적인 대사(metabolism) 향상을 유도함을 알 수 있다.
실시예 7: 혈관신생능(angiogenesis) 향상 검증
인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)과 정산산소 조건(20% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고 total RNA를 분리하여, qRT-PCR로 angiogensis 인자들(AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF)의 발현변화를 확인하였다.
이때 사용한 프라이머는 다음과 같다.
Gene | Forward Primer | Reverse Primer |
AAMP | CTTAGGCATCAGTGTCAGCAC | CCGGTAGTCAGTAAGCAGGC |
bFGF | CCCTCTCAGAGACCTACGTTC | TCAGCGCCGTTTGAGTCC |
HGF | CTATGATGGCCTATTACGAGTGG | CTCACATGGTCCTGATCCAATC |
EGFR | TGTGCCCACTACATTGACGG | TAGGCCCATTCGTTGGACAG |
COX1 | GCGTTGGAGTTCTACCCTGGA | GGCAGACCAGCTTCTTCAGTG |
KDR | CGGTCAACAAAGTCGGGAGA | CAGTGCACCACAAAGACACG |
Tie2 | ACCTGCCTGACTGTGCTGTTG | GTTGAACTGCACAGCTGGTTCT |
VEGF | CTACCTCCACCATGCCAAGTG | GCGCTGATAGACATCCATGAAC |
AAMP : Angio-Associated Migratory cell Protein
bFGF : basic Fibroblast Growth Factor
EGFR : Epidermal Growth Factor Receptor
COX1 : Cyclooxygenase 1
KDR : Kinase Insert domain receptor
Tie2 : Endothelial specific receptor tyrosine kinase 2
VEGF : Vascular Endothelial Growth Factor
그 결과, 도 10에 나타낸 바와 같이, angiogensis 인자들인 AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF의 발현이 증가됨을 확인하였다.
실시예 8: 줄기세포의 특징 분석
인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 세포를 수집하여 줄기세포 positive(+) 마커인 CD105, CD73와 netative(-) 마커인 CD34, CD45를 염색하여 FACS 분석하였다.
그 결과, 도 11에 나타낸 바와 같이, 2DG를 처리하여도 줄기세포의 성상에 변화가 없음을 학인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.
본 발명에 의하면, 유전자 조작이나 바이러스 벡터 등을 사용하지 않으면서 배양환경 조절이라는 간편하고도 안전한 방법을 통하여, 줄기세포의 대사과정을 리프로그래밍함으로써 차세대 고효율 줄기세포를 대량 생산할 수 있다. 또한, 본 발명에 의하면, 줄기세포의 대사 과정을 선택적으로 조절할 수 있는 분자생물학적 기전, 대사조절 마커를 규명함으로써 고효율 줄기세포 개발에 대한 새로운 방법론을 제시할 수 있다.
Claims (18)
- 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는, 줄기세포능 향상용 배지 조성물.
- 제 1 항에 있어서, 상기 저산소 조건은 산소분압이 1∼10%인 것을 특징으로 하는, 배지 조성물.
- 제 1 항에 있어서, 상기 2-데옥시-D-글루코스는 배지에 1μM∼10mM의 농도로 포함되어 있는 것을 특징으로 하는, 배지 조성물.
- 제 1 항에 있어서, 상기 배지는 10% 소태아혈청(FBS) 및 1% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것을 특징으로 하는, 배지 조성물.
- 제 1 항에 있어서, 상기 줄기세포는 배아줄기세포 또는 성체줄기세포인 것을 특징으로 하는, 배지 조성물.
- 제 5 항에 있어서, 상기 성체줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 하는, 배지 조성물.
- 제 1 항에 있어서, 상기 줄기세포능 향상은 Nanog, Oct4 또는 KLF4의 발현이 증가되는 것임을 특징으로 하는, 배지 조성물.
- 제 1 항에 있어서, 상기 줄기세포능 향상은 세포노화가 억제되고, 세포증식능 및 단백질 항상성이 향상되는 것임을 특징으로 하는, 배지 조성물.
- 제 1 항의 배지 조성물에 줄기세포를 배양하는 단계를 포함하는, 줄기세포능 향상방법.
- 제 1 항의 방법에 의해 얻어진, 줄기세포능이 향상된 줄기세포.
- 제 10 항에 있어서, 상기 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 하는, 줄기세포.
- 제 10 항의 줄기세포를 포함하는, 허혈성 질환 치료용 세포 치료제.
- 제 12 항에 있어서, 상기 세포 치료제는 혈관신생능을 향상시키는 것을 특징으로 하는, 세포 치료제.
- 제 10 항의 줄기세포를 포함하는, 암 치료용 세포 치료제.
- 제 10 항의 줄기세포에서 분비되는, 허혈성 질환 치료제.
- 제 10 항의 줄기세포에서 분비되는, 항암 치료제.
- 제 10 항의 줄기세포를 이용한, 암 또는 허혈성 질환의 치료방법.
- 제 10 항의 줄기세포를 이용한, 암 또는 허혈성 질환의 치료용도.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2016-0150267 | 2016-11-11 | ||
KR1020160150267A KR102002671B1 (ko) | 2016-11-11 | 2016-11-11 | 2dg를 이용한 줄기세포 역량 향상 방법 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2018088693A1 true WO2018088693A1 (ko) | 2018-05-17 |
Family
ID=62109598
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2017/010773 WO2018088693A1 (ko) | 2016-11-11 | 2017-09-28 | 2dg를 이용한 줄기세포 역량 향상 방법 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102002671B1 (ko) |
WO (1) | WO2018088693A1 (ko) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113855650A (zh) * | 2021-09-23 | 2021-12-31 | 苏州大学 | 一种免疫代谢心梗贴片及其制备方法与应用 |
CN115521907A (zh) * | 2022-08-25 | 2022-12-27 | 王意忠 | 一种培养间充质干细胞的方法 |
WO2022266909A1 (zh) * | 2021-06-23 | 2022-12-29 | 苏州大学 | 一种增效干细胞治疗心梗的药物及其应用 |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP4043550A4 (en) * | 2019-10-08 | 2023-10-25 | Genechem Inc. | COMPOSITION FOR INCREASE STEM CELL CAPABILITY AND THEREOF USE |
CN113425731B (zh) * | 2021-06-23 | 2022-09-23 | 苏州大学 | 一种增效干细胞治疗心梗的药物及其应用 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20130013435A (ko) * | 2011-07-28 | 2013-02-06 | 차의과학대학교 산학협력단 | 태반-유래 줄기세포의 증식방법 |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011087299A2 (ko) * | 2010-01-13 | 2011-07-21 | 주식회사 강스템홀딩스 | 제대혈 유래 중간엽 줄기세포의 세포외기질을 유효성분으로 함유하는 암치료용 약제학적 조성물 |
WO2013082241A2 (en) * | 2011-12-02 | 2013-06-06 | Fate Therapeutics, Inc. | Improved methods of treating ischemia |
-
2016
- 2016-11-11 KR KR1020160150267A patent/KR102002671B1/ko active IP Right Grant
-
2017
- 2017-09-28 WO PCT/KR2017/010773 patent/WO2018088693A1/ko active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20130013435A (ko) * | 2011-07-28 | 2013-02-06 | 차의과학대학교 산학협력단 | 태반-유래 줄기세포의 증식방법 |
Non-Patent Citations (4)
Title |
---|
FOTIA, CATERINA ET AL.: "Hypoxia Enhances Proliferation and Sternness of Human Adipose-derived Mesenchymal Stem Cells", CYTOTECHNOLOGY, vol. 67, 6 May 2014 (2014-05-06), pages 1073 - 1084, XP035905606 * |
HSU, SHU-HAN ET AL.: "Inhibitory Effects of Hypoxia on Metabolic Switch and Osteogenic Differentiation of Human Mesenchymal Stem Cells : Hypoxia Inhibits Osteogenesis of Mesenchymal Stem Cells", STEM CELLS, vol. 31, no. 12, 2013, pages 2779 - 2788, XP055485546 * |
KOCABAS, FATIH ET AL.: "Hypoxic Metabolism in Human Hematopoietic Stem Cells", CELL & BIOSCIENCE, vol. 5, no. 39, 2015, pages 1 - 16, XP055485564 * |
VEGA-NAREDO, 1. ET AL.: "Mitochondrial Metabolism Directs Sternness and Differentiation in P19 Embryonal Carcinoma Stem Cells", CELL DEATH & DIFFERENTIATION, (ELECTRONIC PUBLISHING, vol. 21, no. 10, 16 May 2014 (2014-05-16), pages 1560 - 1574, XP055485555 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022266909A1 (zh) * | 2021-06-23 | 2022-12-29 | 苏州大学 | 一种增效干细胞治疗心梗的药物及其应用 |
CN113855650A (zh) * | 2021-09-23 | 2021-12-31 | 苏州大学 | 一种免疫代谢心梗贴片及其制备方法与应用 |
CN113855650B (zh) * | 2021-09-23 | 2022-12-30 | 苏州大学 | 一种免疫代谢心梗贴片及其制备方法与应用 |
CN115521907A (zh) * | 2022-08-25 | 2022-12-27 | 王意忠 | 一种培养间充质干细胞的方法 |
Also Published As
Publication number | Publication date |
---|---|
KR102002671B1 (ko) | 2019-07-23 |
KR20180053461A (ko) | 2018-05-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2018088693A1 (ko) | 2dg를 이용한 줄기세포 역량 향상 방법 | |
WO2018074758A2 (ko) | 면역질환 치료를 위한 고효능 줄기세포 선별방법 | |
WO2014181954A1 (ko) | 줄기세포의 재생능 향상을 위한 배지 조성물 및 이를 이용한 줄기세포의 배양방법 | |
WO2018021879A1 (ko) | 암세포의 증식을 억제하는 중간엽 줄기세포의 제조방법 | |
WO2015016523A1 (ko) | 소분자 화합물을 포함하는 만능성 줄기세포의 염색체 안정성 유지용 조성물 | |
WO2018048220A1 (ko) | 염증 자극된 중간엽 줄기세포를 포함하는 면역질환 또는 염증 질환의 예방 또는 치료용 약학적 조성물 | |
WO2011122889A2 (ko) | miRNA의 발현 억제를 이용한 성체줄기세포의 노화 억제 방법 | |
WO2019004792A9 (ko) | 인간 유래 심장 줄기세포 미세구의 제조 방법 및 용도 | |
WO2018131864A1 (ko) | 옥살산염을 이용한 줄기세포능 향상 방법 | |
WO2014200161A1 (ko) | 효소적 생물연료전지 기반 전기자극에 의한 세포 거동 조절 방법 | |
WO2024076173A1 (ko) | 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물 및 그 조성물을 이용한 분화 방법 | |
WO2013165120A1 (ko) | 신경능선줄기세포의 배양방법 및 그 용도 | |
WO2021071289A2 (ko) | 줄기세포능을 증대시키기 위한 조성물 및 이의 용도 | |
WO2022004938A1 (ko) | 유사 중간엽 줄기세포의 제조방법 | |
WO2020091463A1 (ko) | 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물 | |
WO2011126177A1 (ko) | 인간 줄기세포의 활성을 증가시키는 방법 | |
WO2012036512A2 (ko) | 중간엽 줄기세포의 연골 세포로의 분화 유도를 위한 화합물의 용도 | |
WO2018155913A1 (ko) | 저분자 화합물을 이용한 골격근육세포 분화 방법 | |
WO2020222566A1 (ko) | 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물 | |
WO2021002554A1 (ko) | Cp1p 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 줄기세포 증식 촉진용 조성물 | |
WO2013162330A1 (ko) | 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법 | |
WO2021241782A1 (ko) | 세포외기질 모티프를 포함하는 세포배양용 융합 단백질 및 이의 용도 | |
WO2019190175A9 (ko) | 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법 | |
WO2017176054A1 (ko) | 줄기세포 배양용 배지조성물 및 그를 이용한 줄기세포 배양방법 | |
WO2020149538A1 (ko) | 클로날 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 약학적 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17869921 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 17869921 Country of ref document: EP Kind code of ref document: A1 |