WO2019023483A1 - ONCOLYTIC VIRAL VECTORS AND USES THEREOF - Google Patents
ONCOLYTIC VIRAL VECTORS AND USES THEREOF Download PDFInfo
- Publication number
- WO2019023483A1 WO2019023483A1 PCT/US2018/043938 US2018043938W WO2019023483A1 WO 2019023483 A1 WO2019023483 A1 WO 2019023483A1 US 2018043938 W US2018043938 W US 2018043938W WO 2019023483 A1 WO2019023483 A1 WO 2019023483A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- oncolytic virus
- cell
- target sequences
- viral
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/763—Herpes virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16632—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16641—Use of virus, viral particle or viral elements as a vector
- C12N2710/16643—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16641—Use of virus, viral particle or viral elements as a vector
- C12N2710/16645—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16671—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16761—Methods of inactivation or attenuation
Definitions
- the present disclosure relates to recombinant viral vectors for the treatment and prevention of cancer.
- the disclosure relates to oncolytic viral vectors.
- Oncolytic viruses are viruses that preferentially infect cancer cells and have been used in multiple pre-clinical and clinical studies for cancer treatment. Use of oncolytic viruses carries the risk of non-specific viral infection of healthy cells, leading to the death of non-cancerous cells and tissues. However, genetic manipulation of the viruses to exploit pathways, proteins, and genes that are differentially expressed in normal vs. cancerous tissue can increase the specificity of these viruses and limit off-target infection and cell death.
- MicroRNAs are small non-coding endogenous RNAs that regulate gene expression by directing their target messenger RNAs for degradation or translational repression. miRs are intimately associated with normal cellular processes and therefore, deregulation of miRNAs contributes to a wide array of diseases including cancer. Many miR genes are located in cancer associated genomic regions, or in fragile sites, further strengthening the evidence that miRs play a pivotal role in cancer. miRs are differentially expressed in cancer tissues compared to normal tissues and can have a causative relationship to tumorigenesis.
- the cancer therapeutics described herein possess a broad spectrum safety and efficacy profile, wherein oncolytic viral replication is regulated based on the expression of a particular miR or group of miRs.
- the oncolytic viruses described herein may also express proteins that facilitate viral spread throughout a tumor, such as those altering the expression of genes and proteins that regulate the extracellular matrix, thereby increasing their therapeutic efficacy.
- the present disclosure provides oncolytic viral vectors that exhibit improved technical effects compared to the prior art.
- the present inventors have designed various oncolytic viral vectors and performed extensive experiments, described herein, to identify oncolytic viral vectors with superior properties for clinical use in treatment of cancer.
- the invention relates to recombinant viral vectors that are useful for the treatment and prevention of cancer.
- the oncolytic viral vectors described herein are capable of restricting viral vector replication to cancer or tumor cells by virtue of microRNA (miR) target sequences that are inserted into the viral genome.
- the viral vectors comprise two, three, four or more copies of a miR target sequence incorporated into one or more essential viral genes.
- the viral vectors comprise incorporation of one or more polynucleotide sequences into the viral genome whose product(s) disrupt the function of an oncogenic miR and/or alter the extracellular matrix.
- the viral vectors comprise protease-activated antibodies incorporated into the viral particle, thereby allowing forhighly selective targeting of the vectors to cancer/tumor cells.
- Compositions of the viral vectors and methods of use in killing of cancerous cells and the treatment of cancer are further provided herein.
- the present disclosure provides a recombinant oncolytic herpes simplex virus (HSV) comprising at least two micro-RNA (miRNA) target sequence inserted into a locus of one or more essential viral genes, wherein the one or more viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, and UL42.
- the replication of the recombinant HSV is reduced in a non-cancerous cell compared to the replication of the the recombinant HSV in a cancerous cell of the same cell type.
- the one or more viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, and UL42. In an embodiment, the one or more viral genes are selected from the group consisting of UL8, ICP8, and UL30. In an embodiment, the one or more viral genes are selected from the group consisting of ICP27 and ICP4. In an embodiment, the one or more viral genes are selected from the group consisting of ICP4, ICP27, UL8, UL42, and ICP34.5.
- the cell is selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a liver cell.
- the neuronal cell is a a central nervous system cell, a peripheral nervous system cell, a brain cell, or a spinal cord cell.
- the muscle cell is a striated muscle cell or a smooth muscle cell.
- the non-cancerous cell and the cancerous cell are brain cells, and the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-137, miR-219a, miR-124, miR-9, miR-487b, and miR-128.
- the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-137, miR-219a, miR-124, and miR-128
- the non-cancerous cell and the cancerous cell are cardiac or striated muscle cells
- the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-208b, miR-1, miR-208a, miR-133a, miR-4284, miR-499a, miR-126, miR-30e, miR-378i, miR-30b, and miR-378.
- the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-208b, miR-1, and miR-208a
- the non-cancerous cell and the cancerous cell are spinal cord cells
- the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR- 219a, miR-9, miR-204, miR-577, miR-99a, miR-100, miR-132, and miR-135.
- the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-219a, miR-9, and miR-204.
- the non-cancerous cell and the cancerous cell are peripheral nervous system cells, and the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-204, miR-1, miR-206, miR-9, miR-99a, miR-199b, miR-145, miR-100, miR-574.
- the non-cancerous cell and the cancerous cell are liver cells, and the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-122 and miR-126.
- the non-cancerous cell and the cancerous cell are smooth muscle cells, and the at least two miRNA target sequences are target sequences for an miRNA selected from the group consisting of miR-143 and miR-145.
- the two or more miR target sequences are incorporated into a miR-T cassette that is inserted in the 5' untranslated region (UTR) or 3' UTR of the one or more essential viral genes.
- the miR-T cassette comprises a length of less than 1000 nucleotides. In an embodiment, the miR-T cassette comprises a length of between about 25 and about 500 nucleotides. In an embodiment, the miR-T cassette comprises a length of between about 100 and about 500 nucleotides.
- the present disclosure provides a recombinant oncolytic herpes simplex virus (HSV) comprising: (i) a first microRNA (miRNA) target sequence cassette (miR-TS cassette) inserted into a first viral gene and comprising at least 2 target sequences for each of miR- 124, miR-1, and miR-143; (ii) a second miR-TS cassette inserted into a second viral gene and comprising at least 2 target sequences for each of miR- 128, miR-219a, and miR- 122; and (iii) a third miR-TS cassette inserted into a third viral gene and comprising at least 2 target sequences for each of miR-219a, miR-204, and miR- 128.
- HSV herpes simplex virus
- the receombinant HSV further comprises a fourth miR-TS cassette inserted into a fourth viral gene, wherein the fourth miR-TS cassette comprises: (a) at least 2 target sequences for each of miR- 137, miR-208b- 3p, and miR- 126; or (b) at least 2 target sequences for each of miR- 137, miR-217, and miR- 126.
- each of the miR-TS cassettes comprises 4 target sequences for each of the respectively miRNAs.
- the first viral gene is ICP4.
- the second viral gene is ICP27.
- the third viral gene is ICP34.5.
- the fourth viral gene is UL8.
- the replication of the recombinant HSV is reduced in a non-cancerous cell compared to the replication of the the recombinant HSV in a cancerous cell of the same cell type, wherein the cell is selected from the group consisting of a neuronal cell, a cardiac cell, a muscle cell, and a liver cell.
- the first miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 852. In an embodiment, the first miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 852. In an embodiment, the second miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 853. In an embodiment, the second miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 853. In an embodiment, the third miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 854.
- the third miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 854.
- the fourth miR-TS cassette comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 855.
- the fourth miR-TS cassette comprises or consists of the nucleic acid sequence of SEQ ID NO: 855.
- the recombinant HSV further comprises a heterologous polynucleotide sequence encoding one or more payload molecules.
- the heterologous polynucleotide sequence encodes a payload selected from the group consisting of IL- 12, CCL4, and CXCLIO.
- the heterologous polynucleotide sequence encodes two or more pay loads selected from the group consisting of IL-12, CCL4, and CXCLIO.
- the heterologous polynucleotide sequence encodes three pay loads comprising IL-12, CCL4, and CXCLIO.
- the present disclosure provides a recombinant oncolytic virus comprising one or more micro-RNA (miR) target sequences inserted into a locus of one or more viral genes required for viral replication, wherein the virus is herpes simplex virus (HSV), and wherein the one or more viral genes are selected from the group consisting of UL8, ICP34.5, UL42, UL19, ICP4, and ICP27.
- the one or more miR target sequences is incorporated into the 5' untranslated region (UTR) or 3 ' UTR of the one or more viral genes required for viral replication.
- the miR target sequence is a target sequence for a miR selected from the group consisting of miR-122, miR- 184, miR-34a, let7a, miR-145-5p, miR- 199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-l -3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101 , miR-125b, miR-145, miR-559, miR-213, miR-31-5p, and miR-205p.
- one or more copies of the one or more miR target sequences are inserted into a locus of one or more viral genes.
- two, three, four, or more copies of the one or more miR target sequences are inserted into a locus of one or more viral genes.
- replication of the virus is reduced or attenuated in a first cell compared to replication of the virus in a second cell, wherein the first cell has an increased expression of a miR capable of binding to the one or more miR target sequences compared to the expression of the miR in the second cell.
- the expression level of the miR in the first cell is at least 5% greater than the expression level of the miR in the second cell.
- the first cell is a non-cancerous cell.
- the second cell has a reduced expression of a miR capable of binding to the one or more miR target sequences compared to the expression of the miR in the first cell.
- the expression level of the miR in the second cell is at least 5% less than the expression level of the miR in the first cell.
- the second cell is a cancerous cell.
- one copy of a miR-122 target sequence is inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the miR-122 target sequence are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes is ICP27. In an embodiment, one copy of a miR- 125a target sequence inserted into the locus of one or more viral genes required for viral replication. In an embodiment, four copies of the miR- 125a target sequence are inserted into the locus of one or more viral genes required for viral replication. In an embodiment, the one or more viral genes is UL42.
- four copies of a miR-122 target sequence are inserted into the locus of ICP27 and one copy of a miR- 125a target sequence is inserted into the locus of UL42.
- one copy of a miR-122 target sequence is inserted into the locus of ICP27 and one copy of a miR- 125a target sequence is inserted into the locus of UL42.
- one copy of a miR-122 target sequence is inserted into the locus of ICP27 and three copies of a miR- 125a target sequence are inserted into the locus of UL42.
- four copies of a miR-122 target sequence are inserted into the locus of ICP27 and four copies of a miR- 125a target sequence are inserted into the locus of UL42.
- the present disclosure provides a recombinant oncolytic virus comprising: (a) one or more micro-RNA (miR) target sequences inserted into a locus of one or more viral genes required for viral replication; and (b) one or more polynucleotides encoding (i) one or more proteins or oligonucleotides, wherein the proteins or oligonucleotides reduce the expression or inhibit the function of a miR, a gene, or a tissue inhibitor of metalloproteinases (TIMP); or (ii) a protease-activated antibody; wherein the virus is an HSV, wherein the one or more viral genes are selected from the group consisting of UL42, UL19, ICP4, and ICP27.
- miR micro-RNA
- ICP4 tissue inhibitor of metalloproteinases
- the miR is an oncogenic miR or a microenvironment remodeling miR.
- oncogenic miR is selected from the miRs listed in Table 4.
- the gene is an oncogenic gene.
- the oncogenic gene is selected from the genes listed in Table 7.
- the microenvironment remodeling miR is selected from the miRs listed in Table 5.
- the one or more miR target sequences is incorporated into the 5' untranslated region (UTR) or 3' UTR of the one or more viral genes required for viral replication.
- the miR target sequence is a target sequence for a miR selected from the group consisting of miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR-199a-5p, miR- 451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-l-3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101 , miR-125b, miR-145, miR-559, miR- 213, miR-31-5p, and miR-205p.
- one or more copies of the one or more miR target sequences are inserted into a locus of one or more viral genes.
- two, three, four, or more copies of the one or more miR target sequences are inserted into a locus of one or more viral genes.
- one copy of a miR-122 target sequence is inserted into the locus of one or more viral genes required for viral replication.
- four copies of the miR- 122 target sequence are inserted into the locus of one or more viral genes required for viral replication.
- the one or more viral genes is ICP27.
- one copy of a miR- 125a target sequence is inserted into the locus of one or more viral genes required for viral replication.
- four copies of the miR-125a target sequence are inserted into the locus of one or more viral genes required for viral replication.
- the one or more viral genes is UL42.
- four copies of a miR-122 target sequence are inserted into the locus of ICP27 and one copy of a miR-125a target sequence is inserted into the locus of UL42.
- one copy of a miR-122 target sequence is inserted into the locus of ICP27 and one copy of a miR-125a target sequence is inserted into the locus of UL42.
- one copy of a miR-122 target sequence is inserted into the locus of ICP27 and three copies of a miR-125a target sequence are inserted into the locus of UL42. In an embodiment, four copies of a miR-122 target sequence are inserted into the locus of ICP27 and four copies of a miR- 125a target sequence are inserted into the locus of UL42.
- the TIMP is selected from TIMP1, TIMP2, ⁇ 3 and
- the oligonucleotide is an shRNA or a decoy oligonucleotide.
- the protein is a nuclease, a bispecific T-cell engager (BiTE), an anti- immunosuppressive protein, or an immunogenic antigen.
- the nuclease is selected from a Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR)-associated endonuclease, a zinc-finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN).
- CRISPR Clustered Regulatory Interspaced Short Palindromic Repeats
- ZFN zinc-finger nuclease
- TALEN transcription activator-like effector nuclease
- the CRISPR-associated endonuclease is selected from SpCas9, SpCas9-HFl, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpfl, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, Cs
- the recombinant virus further comprises a heterologous polynucleotide encoding an tracr-RNA (trRNA) and a crispr-RNA (crRNA), wherein the crRNA is targeted to a genomic DNA sequence encoding a miR or a TIMP and wherein the trRNA facilitates binding and activation of a CRISPR-associated endonuclease.
- trRNA tracr-RNA
- crRNA crispr-RNA
- the anti-immunosuppressive protein is an anti-regulatory
- T-cell (Treg) protein or an anti-myeloid-derived suppressor cell (MDSC) protein In an embodiment, the anti-immunosuppressive protein is a VHH-derived blocker or a VHH-derived BiTE. In an embodiment, the protein induces an anti-tumor immune response. In an embodiment, the protein binds to an antigen expressed on a cell surface, wherein the antigen is selected from the group consisting of EpCAM, CTLA-4, PD1, FGF2, FGFR/FGFR2b, endothelin B Receptor, and SEMA4D.
- the protein is selected from, folate, IFNP, , A2A, , CCL5, CD137, CD200, CD38, CD44, CSF-IR, CXCL10, CXCL13, IL-12, IL-15, IL-2, IL-21, IL- 35, ISRE7, LFA-1, NG2 (also known as SPEG4), a SMAD protein, STING, TGFp, and VCAM1.
- the at least one protease-activated antibody is incorporated into a viral glycoprotein envelope.
- the protease-activated antibody is activated by a protease selected from a cysteine cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin metalloproteinase (ADAM).
- a protease selected from a cysteine cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin metalloproteinase (ADAM).
- the protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hKl, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP- 16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP- 25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6.
- the protease- activated antibody binds to a protein expressed more highly by a cancer cell or in a cancer microenvironment than by a non-cancer cell or in a non-cancer microenvironment.
- the protease-activated antibody binds NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD 133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM.
- one or more polynucleotides are inserted into a gene locus of the viral genome, or inserted between two gene loci of the viral genome.
- the viral gene loci are selected from the group consisting of the internal repeat joint region (comprising one copy each of the diploid genes ICPO, ICP34.5, LAT, ICP4, and the ICP47 promoter), ICPO, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53,
- the present disclosure provides a nucleic acid molecule encoding an oncolytic virus described herein.
- the present disclosure provides a viral stock comprising an oncolytic virus described herein.
- the present disclosure provides a composition comprising an oncolytic virus described herein and a pharmaceutically-acceptable carrier.
- the present disclosure provides a method of killing a cancerous cell, comprising exposing the cancerous cell to an oncolytic virus described herein or compositions thereof under conditions sufficient for the oncolytic virus to infect and replicate within said cancerous cell, and wherein replication of the oncolytic virus within the cancerous cell results in cell death.
- the cancerous cell has a reduced expression of a miR capable of binding to the one or more miR-target sequences compared to the expression of the miR in a non-cancerous cell.
- the expression level of the miR in the cancerous cell is at least 5% less than the expression level the miR in the non-cancerous cell.
- replication of the oncolytic virus is increased or maintained in cancerous cells with a reduced expression of the miR capable of binding to the one or more miR-target sequences.
- the viral replication is at least 5% greater in the cancerous cells compared to the viral replication in the non-cancerous cell.
- the cell is in vivo. In an embodiment, the cell is within a tumor.
- the present disclosure provides a method of treating cancer in a subject in need thereof, comprising administering an oncolytic virus described herein or compositions thereof to a subject in need thereof.
- the subject is a mouse, a rat, a rabbit, a cat, a dog, a horse, a non-human primate, or a human.
- the oncolytic virus or compositions thereof are administered intravenously, subcutaneously, intratumorally, intramuscularly, or intranasally.
- the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL).
- the lung cancer is small cell lung cancer or non-small cell lung cancer.
- the liver cancer is hepatocellular carcinoma (HCC).
- a recombinant oncolytic virus described herein further comprises a payload molecule, wherein the payload molecule or protein is an anti-FAP/anti-CD3 bispecific T cell engager. In an embodiment, a recombinant oncolytic virus described herein further comprises a payload molecule, wherein the payload molecule or protein is an anti-PDl-Fc- 41BBL protein.
- Fig. 1 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous brain tissue corresponding to 25 selected miRNAs.
- Fig. 2 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous bladder tissue corresponding to 25 selected miRNAs.
- Fig. 3 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous breast tissue corresponding to 25 selected miRNAs.
- Fig. 4 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous colon tissue corresponding to 25 selected miRNAs.
- Fig. 5 illustrates a heat map of an miRNA expression profile in glioblastoma and non-cancerous brain tissue corresponding to 25 selected miRNAs.
- Fig. 6 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous head and neck tissue corresponding to 25 selected miRNAs.
- Fig. 7 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous lung tissue corresponding to 25 selected miRNAs.
- Fig. 8 illustrates a heat map of an miRNA expression profile in cancerous and non-cancerous pancreatic tissue corresponding to 25 selected miRNAs.
- Fig.9 illustrates a heat map of an miRNA expression profile in schwannoma and non-schwannoma tissue corresponding to 25 selected miRNAs.
- Fig. 10A - Fig. IOC illustrate an miRNA expression and attenuation reporter gene system described in Example 2.
- Fig. 10A shows a schematic of a pTetRtet repressor plasmid that induces expression of an miRNA expression plasmid.
- Fig. 10B shows a schematic of a pTF-002 miRNA expression plasmid containing a tet-inducible mCherry and miRNA expression cassette.
- Fig. IOC shows a schematic of a pTF-004 miRNA attenuation reporter enabling the readout of destabilized GFP (dsGFP).
- dsGFP destabilized GFP
- FIG. 11 illustrates miR-122 expression and attenuation using the reporter system shown in Fig. 10 and described in Example 2.
- Fig. 12 illustrates miR-122, miR-184, miR-34a, and Let7a-mediated GFP attenuation using the reporter system shown in Fig. 10 and described in Example 2. Circled wells indicate reduced GFP expression levels.
- Fig. 13 illustrates expression of miR-122, miR-184, miR-34a, and Let7a, indicated by mCherry expression, using the reporter system shown in Fig. 10 and described in Example 2.
- Fig. 14 illustrates miR-122, miR-124, miR-145, miR-199, and miR-451- mediated GFP attenuation using the reporter system shown in Fig. 10 and described in Example 2. Circled wells indicate reduced GFP expression levels.
- Fig. 15 illustrates expression of miR-122, miR-124, miR-145, miR-199, and miR-451, indicated by mCherry expression, using the reporter system shown in Fig. 10 and described in Example 2.
- Fig. 16 shows quantitation of miR-122 and miR-184-attenuated GFP fluorescence.
- Fig. 17 shows quantitation of miR-34a and miR-184-attenuated GFP fluorescence.
- Fig. 18 shows quantitation of Let7a and miR-184-attenuated GFP fluorescence.
- Fig. 19 shows quantitation of miR-124 and miR-184-attenuated GFP fluorescence.
- Fig. 20 shows quantitation of miR-145 and miR-184-attenuated GFP fluorescence.
- Fig. 21 shows quantitation of miR-199 and miR-451 -attenuated GFP fluorescence.
- Fig. 22 shows quantitation of miR-125 and miR-451 -attenuated GFP fluorescence.
- Fig. 23 shows quantitation of miR-126 and miR-451 -attenuated GFP fluorescence.
- Fig. 24 shows quantitation of miR-127 and miR-451 -attenuated GFP fluorescence.
- Fig. 25 shows quantitation of miR-133 and miR-451 -attenuated GFP fluorescence.
- Fig. 26 shows quantitation of miR-223 and miR-451 -attenuated GFP fluorescence.
- Fig. 27A - Fig. 27D illustrate fluorescence-based quantitation of HSV attenuation by miR- 125 in non-cancerous post-mitotic lung cells and cancerous A253 cells.
- Fig. 27A shows fluorescence-based quantitation of HSV attenuation in post-mitotic lung cells.
- Fig. 27B shows fluorescence-based quantitation of HSV attenuation in A253 cells.
- Fig. 27C shows qPCR-based quantitation of HSV attenuation in post-mitotic lung cells.
- Fig. 27D shows qPCR- based quantitation of HSV attenuation in A253 cells.
- Fig. 28A - Fig. 28B illustrate fluorescence-based (Fig. 28A) and qPCR- based (Fig. 28B) quantitation of HSV attenuation by miR-145 in HCC1395 vs. A253 cells.
- Fig. 29A - Fig. 29B illustrates fluorescence-based (Fig. 29 A) and qPCR- based (Fig. 29B) quantitation of HSV attenuation by miR-199a-5p vs. miR-143-3p in normal lung cells.
- Fig. 30A - Fig. 30C illustrate miRNA-125a (Fig. 30A) and miRNA-122
- FIG. 30B expression and effect on viral replication (Fig. 30C) in A253, Huh7, and Hep3B cell lines.
- Fig. 31 shows a Western blot illustrating reduced viral spread and protein expression after infection with miR-T122 and/or miR-T125a containing HSV in cells expressing miR- 122 and miR- 125a.
- Fig. 32A - Fig. 32D illustrate effects of miRNA expression on miR- attenuated HSV replication.
- Fig. 32A - Fig. 32B shows increased intracellular expression of miR- 125a and mir-122 after transfection with a miR- 125a mimic (Fig. 32A) or a miR- 122 mimic (Fig. 32B).
- Fig. 32C shows attenuation of replication of oncolytic HSV vectors with cognate miR target sequences at distinct genetic loci shown by fluorescence images and quantification of GFP fluorescence (Fig. 32D).
- Fig. 33 illustrates a schematic of an ICP4-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB NT: virus entry- enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- ICP4:TmiRNA insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR)
- miRNA target sequences e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.
- Fig. 34 shows a schematic of an ICP27-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB NT: virus entry- enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- ICP27:TmiRNA insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101 , miR-125b, miR-145, etc.) into the 3' UTR of the ICP27 gene (also may be placed in 5' UTR)
- miRNA target sequences e.g. let-7, miR-34a, miR-101 , miR-125b, miR-145, etc.
- Fig. 35 shows a schematic of a ULl 9-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB NT: virus entry-enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- UL19:TmiRNA insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3' UTR of the UL19 gene (also may be placed in 5' UTR).
- miRNA target sequences e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.
- Fig. 36 shows a schematic of an UL19-TmiRNA and ICP27-TmiRNA- attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB NT: virus entry-enhancing double mutation in gB gene;
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences;
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene;
- UL19:TmiRNA & ICP27:TmiRNA insertion of miRNA target sequences (e.g. let- 7, miR-34a, miR-101 , miR-125b, miR-145, etc.) into the 3 ' UTR of the UL19 and ICP27 genes (also may be placed in 5' UTR)
- miRNA target sequences e.g. let- 7, miR-34a, miR-101 , miR-125b, miR-145, etc.
- Fig. 37 shows a schematic of an UL19-TmiRNA and ICP4-TmiRNA- attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB NT: virus entry-enhancing double mutation in gB gene;
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences;
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene;
- UL19:TmiRNA & ICP4:TmiRNA insertion of miRNA target sequences (e.g.
- Fig. 38 shows a schematic of an UL19-TmiRNA, ICP27-TmiRNA, and
- ICP4-TmiRNA-attenuated HSV vector for the treatment of cancer or benign hyper-proliferative disorders.
- gB:NT virus entry-enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- UL19:TmiRNA, ICP27:TmiRNA, & ICP4:TmiRNA insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.) into the 3' UTR of the UL19, ICP27, and ICP4 genes (also may be placed in 5' UTR).
- miRNA target sequences e.g. let-7, miR-34a, miR-101, miR-125b, miR-145, etc.
- Fig.39 shows a schematic of an ICP4-TmiRNA-attenuated, genome-editing
- HSV vector for the treatment of cancer gB:NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; Ajoint: deletion of the complete internal repeat region including one copy of the ICP4 gene; ICP4:TmiRNA: insertion of miRNA target sequences (e.g. let-7, miR-34a, miR-101, miR-125b, miR-145) into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR); Pol II promoter: Constitutive (CAG, UbC, EFla, PGK) or cell-specific (e.g.
- TRPV1, Navl.7, hSYN Endonuclease: CRISPR associated endonuclease (e.g. SpCas9, SaCas9, FnCpfl, FnCas9, etc.); Poly(A): polyadenylation signal (e.g. bGH); gRNA: Single crRNA-trRNA fusion (DR-crRNA-DR-trRNA); crRNA targeted to oncogenic microRNA (e.g. miR-17, miR-21, miR-155); Pol III promoter: E.g. U6, HI, 7SK.
- CRISPR associated endonuclease e.g. SpCas9, SaCas9, FnCpfl, FnCas9, etc.
- Poly(A) polyadenylation signal (e.g. bGH)
- gRNA Single crRNA-trRNA fusion (DR-crRNA-DR-trRNA); crRNA targeted to on
- Fig. 40 shows a schematic of an ICP4-TmiRNA-attenuated, genome- editing, microenvironment-remodeling HSV vector for the treatment of cancer.
- gB NT: virus entry-enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- ICP4:TmiRNA insertion of miRNA target sequences (e.g.
- let-7 miR-34a, miR-101, miR-125b, miR-145) into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR);
- Pol II promoter Constitutive (CAG, UbC, EFla, PGK) or cell-specific (e.g. TRPVl, Navl.7, hSYN);
- Endonuclease CRISPR associated endonuclease (e.g. SpCas9, SaCas9, FnCpfl, FnCas9, etc.);
- Poly(A) polyadenylation signal (e.g. bGH);
- gRNA2 crRNA targeted to microenvironment remodeling miRNA (e.g. miR-143, miR-218) or TIMP (e.g. TIMPl, TIMP2);
- Pol III promoter E.g. U6, HI, 7SK.
- Fig. 41 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA- attenuated HSV vector for the treatment of pancreatic, lung, and colon cancer.
- gB NT: virus entry- enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- ICP4:TmiRNA insertion of miR-124 target sequence cassette into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR);
- ICP27:TmiRNA insertion of miR-451a, miR-143-3p, and miR-559 target sequence cassettes into the 3' UTR of the ICP-27 gene (also may be placed in 5' UTR).
- Fig. 42 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA- attenuated HSV vector for the treatment of multiple cancer types.
- gB NT: virus entry-enhancing double mutation in gB gene; BAC: loxP-flanked choramphenicol-resistance and lacZ sequences; Ajoint: deletion of the complete internal repeat region including one copy of the ICP4 gene;
- ICP4:TmiRNA insertion of miR-124 target sequence cassette into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR);
- ICP27:TmiRNA insertion of miR-451a, miR-145-5p, and miR-559 target sequence cassettes into the 3' UTR of the ICP-27 gene (also may be placed in 5' UTR).
- Fig. 43 shows a schematic of an ICP4-TmiRNA and ICP27-TmiRNA- attenuated HSV vector for the treatment of schwannoma.
- gB NT: virus entry-enhancing double mutation in gB gene
- BAC loxP-flanked choramphenicol-resistance and lacZ sequences
- Ajoint deletion of the complete internal repeat region including one copy of the ICP4 gene
- ICP4:TmiRNA insertion of miR-124 target sequence cassette into the 3' UTR of the remaining ICP4 gene (also may be placed in 5' UTR);
- ICP27:TmiRNA insertion of miR-205p, miR-141 -5p, and miR-31 -5p target sequence cassettes into the 3 ' UTR of the ICP-27 gene (also may be placed in 5' UTR).
- Fig. 44 shows a schematic of a miR-attenuated HSV virus, wherein multiple copies of miR-122, miR-125a, and/or miR-124 target sites are inserted into ICP27, UL42 and/or ICP4.
- Fig. 45 shows a schematic of a miR-attenuated HSV virus (ONCR-157), wherein miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5
- Fig. 46 shows a schematic of a miR-attenuated HSV virus (ONCR-159), wherein miR target site cassettes are inserted into UL8, ICP12, ICP4, and ICP34.5.
- Fig. 47 A shows GFP intensity generated by a reporter virus engineered to expression GFP in cells treated with pooled siRNAs against various viral genes.
- Fig. 47B shows results in the same assay for individual siRNAs.
- Figs. 48A and 48B shows GFP intensity generated by a reporter virus engineered to expression GFP in cells treated with pooled siRNAs against various viral genes using the HSV vector ONCR-003 (left) or ONCR-010 (right).
- Fig. 49 shows a Western blot to detect expression of viral proteins in cells infected with HSV vector and treated with siRNA against viral genes as indicated. Beta-actin is a positive control for the Western blot.
- Figs. 50A and 50B show Nanostring assay data for normal brain tissue compared to malignant tissue as ratio of miRNA expression (Fig. 5 OA) and normalized counts (Fig. 50B).
- Figs. 51A and 51B show Nanostring assay data for normal heart tissue compared to malignant tissue as ratio of miRNA expression (Fig. 51 A) and normalized counts (Fig. 51B).
- Figs. 52A shows Nanostring assay data for normal spinal-cord tissue compared to malignant tissue as ratio of miRNA expression.
- Figs. 52A and 52B show Nanostring assay data for normal nerve or ganglion tissue compared to malignant tissue as ratio of miRNA expression (Fig. 52A) and normalized counts (Fig. 52C).
- Figs. 53A and 53B show lucif erase assay testing of miR-TS cassettes for cassette 1 (Fig. 53A) or cassette 2 (Fig. 53B)
- Fig. 54A - Fig. 54G show cytotoxicity of oncolytic HSV viral vectors
- ONCR-125, ONCR-131, ONCR-142, and ONCR-157 in cancer cell lies SW837 (Fig. 54A), SKMEL28 (Fig. 54B), COLO 205 (Fig. 54C), A375 (Fig. 54D), H446 (Fig. 54E), BXPC3 (Fig. 54F), and BT549 (Fig. 54G).
- Fig. 55 shows tumor growth inhibitor effect of vehicle compared to virus
- ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle treated controls (p ⁇ 0.0001). ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p ⁇ 0.005), indicating an enhanced abscopal effect.
- Fig. 56 shows tumor growth inhibitor effect of vehicle compared to virus
- Fig. 57 shows tumor growth inhibitor effect of vehicle compared to virus
- Fig. 58 shows tumor growth inhibitor effect of vehicle compared to virus
- Fig. 59 A - Fig. 59B show replication of injected virus occurs only in the injected tumor, not in the non-injected tumor, suggesting that the anti -tumor effect observed in the non-injected tumor is immune-mediated. Data is ploted as raw genome copies per microgram DNA (Fig. 59A) or as normalized expression (Fig. 59B). HSV was detected in the injected tumors, but not in the non-injected tumors, indicating that the tumor growth inhibition observed in the non- injected tumors was not due to viral spread, but rather the abscopal effects of virus administration.
- Fig. 60A - Fig. 60C show payload expression peaked in the injected tumors at 24-hours post-treatment and decreased thereafter.
- Fig. 61A - Fig. 61C shows levels of the payloads in the serum of mice treated with ONCR-153, where only CXCLIO expression was observed.
- Fig. 62 A shows the expression level of interferon gamma in the injected and non-injected tumors. Treatment of mice with ONCR-153 induced an intra-tumoral IFNy response in both injected and non-injected tumors.
- Fig. 62B shows the expression level of interferon gamma in the plasma of the host animal.
- Fig. 63 shows tumor growth inhibitor effect of vehicle compared to virus
- the increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.
- Fig. 64 shows tumor growth inhibitor effect of vehicle compared to virus
- the increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.
- Fig. 65 shows tumor growth inhibitor effect of vehicle compared to virus
- the increase in tumor volume of the injected tumor is compared to the increase in tumor volume of the non-injected tumor.
- Fig. 66A shows tumor growth inhibitor effect of vehicle compared to virus
- Fig. 66B shows decreased incident of metasteses to the lung.
- Fig. 66C shows images of lung tissue from vehicle (PBS) control or vector- treated animals.
- Fig. 67 shows tumor growth inhibitor effect of vehicle compared to virus
- the present invention utilizes differential miR expression profiles to effectively restrict viral vector replication to tumor cells by incorporating miR target sequences into one or more genes required for viral replication.
- the viral vectors described herein comprise two, three, four or more copies of a miR target sequence incorporated into one or more viral genes.
- the viral vectors described herein also disrupt the expression of specific miRNAs for reduced tumor proliferation, metastasis, and/or remodeling of the tumor microenvironment to enable enhanced viral spread.
- the viral vectors described herein encompass the use of surface molecules on viral vectors to facilitate targeting to tumor cells.
- the invention further encompasses recombinant oncolytic viral vectors for use in the treatment and prevention of diseases and disorders (e.g., cancer).
- this invention utilizes endogenous microRNA (miR) expression to enable a safe and efficacious recombinant viral vector suitable to treat a broad array of cancers.
- miR microRNA
- any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
- the terms “a” and “an” as used herein refer to “one or more” of the enumerated components unless otherwise indicated.
- the use of the alternative ⁇ e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives.
- the terms “include” and “comprise” are used synonymously.
- “plurality” may refer to one or more components (e.g., one or more miRNA target sequences).
- the terms “about” and “approximately” are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art.Jn certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
- Decrease or “reduce” refers to a decrease or a reduction in a particular value of at least 5%, for example, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99 or 100% as compared to a reference value.
- a decrease or reduction in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000- fold, or more, decrease as compared to a reference value.
- Increase refers to an increase in a particular value of at least 5%, for example, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, 100, 200, 300, 400, 500% or more as compared to a reference value.
- An increase in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, at least 1 -fold, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold or more, increase as compared to the level of a reference value.
- sequence identity refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same, and in the same relative position. As such one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. The term “reference sequence” refers to a molecule to which a test sequence is compared.
- “Complementary” refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non-naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof. For example, if a base at one position of a nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a target, then the bases are considered to be complementary to each other at that position. Nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding.
- Base pairings may include both canonical Watson-Crick base pairing and non- Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine- type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T.
- A adenosine-type bases
- T thymidine-type bases
- U uracil-type bases
- C cytosine- type bases
- G guanosine-type bases
- universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T.
- Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.
- operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
- a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.
- subject includes animals, such as e.g. mammals.
- the mammal is a primate.
- the mammal is a human.
- subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; or domesticated animals such as dogs and cats.
- subjects are rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like.
- rodents e.g., mice, rats, hamsters
- rabbits primates, or swine such as inbred pigs and the like.
- the term "effective amount” refers to the minimum amount of an agent or composition required to result in a particular physiological effect (e.g., an amount required to increase, activate, and/or enhance a particular physiological effect).
- the effective amount of a particular agent may be represented in a variety of ways based on the nature of the agent, such as mass/volume, # of cells/volume, particles/volume, (mass of the agent)/(mass of the subject), # of cells/(mass of subject), or particles/(mass of subject).
- the effective amount of a particular agent may also be expressed as the half-maximal effective concentration (ECso), which refers to the concentration of an agent that results in a magnitude of a particular physiological response that is half-way between a reference level and a maximum response level.
- ECso half-maximal effective concentration
- phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable carrier includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, and/or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans and/or domestic animals.
- oncolytic virus refers to a virus that has been modified to, or naturally, preferentially infect cancer cells.
- microRNA refers to small non-coding endogenous RNAs of about 21-25 nucleotides in length that regulate gene expression by directing their target messenger RNAs (mRNA) for degradation or translational repression.
- Epssential viral gene refers to a viral gene that is required for one or more essential viral function, such as viral replication, viral packaging, or viral infectivity.
- vector is used herein to refer to a nucleic acid molecule capable transferring or transporting another nucleic acid molecule.
- the transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule.
- a vector may include sequences that direct autonomous replication in a cell, or may include sequences sufficient to allow integration into host cell DNA.
- the present invention provides for recombinant oncolytic viruses, wherein one or more copies of one or more micro-RNA (miRNA) target sequences are inserted into a locus of one or more essential viral genes required for viral replication.
- oncolytic viruses are known in the art including, but not limited to, herpes simplex virus (HSV), an adenovirus, a polio virus, a vaccinia virus, a measles virus, a vesicular stomatitis virus, an orthomyxovirus, a parvovirus, a maraba virus or a coxsackievirus.
- HSV herpes simplex virus
- adenovirus adenovirus
- polio virus a virus
- vaccinia virus a measles virus
- vesicular stomatitis virus an orthomyxovirus
- parvovirus a parvovirus
- maraba virus a coxsackievirus
- an oncolytic virus described herein is a herpesvirus
- the recombinant viral vector is an HSV capable of tumor-selective vector replication as described in International PCT Publication No. WO 2015/066042, which is incorporated by reference in its entirety.
- HSV- based vectors and methods for their construction are described in, for example, U.S. Pat. Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Applications WO 91/02788, WO 96/04394, WO 98/15637, and WO 99/06583, which are incorporated herein by reference in their entireties.
- the sequence of HSV is published (NCBI Accession No. NC_001806; see also McGoech et al, J. Gen.
- the oncolytic virus of the invention is a herpes simplex virus (HSV) and comprises a deletion of the internal repeat (joint) region comprising one copy each of the diploid genes ICPO, ICP34.5, LAT, and ICP4 along with the promoter for the ICP47 gene.
- HSV herpes simplex virus
- the recombinant viral vector of the invention is an
- HSV vectors of the present invention can directly infect cells through interaction with cell proteins other than typical mediators of HSV infection (e.g., other than nectin-1, HVEM, or heparan sulfate/chondroitin sulfate proteoglycans).
- the recombinant viral vector of the invention is an HSV and further comprises a mutation of the gB or gH gene that facilitates vector entry through non-canonical receptors.
- the invention provides an HSV vector further comprising mutant gH glycoproteins that exhibit lateral spread in cells typically resistant to HSV lateral spread, such as cells lacking gD receptors.
- an HSV vector of the invention comprises one or more of the mutant gB or gH proteins as described in U.S. Patent Publication No. 2013/0096186, which is incorporated herein by reference in its entirety.
- the mutant entry protein within an HSV vector is a glycoprotein involved with viral entry, such as gB, gH, and the mutant HSV vector can comprise mutated versions of both.
- the mutant entry protein can be any protein effecting entry of the HSV vector into cells.
- the mutant entry protein is other than gD, although the HSV vector can additionally comprise a mutant gD, such as containing a ligand or other desired mutation.
- Non-limiting mutations of gB or gH glycoprotein for use in the inventive HSV vector occur at one or more of the following residues: gB:D285, gB:A549, gB:S668, gH:N753, and gH: A778.
- the inventive HSV vector comprises mutations at both gB:D285 and gB:A549, at both gH:N753 and gH: A778, and/or at each of gB:S668, gH:N753, and gH:A778.
- the HSV vector contains two or more of such mutations (e.g., 3 or more, 4 or more), and the HSV vector can comprise mutations in all five of these residues.
- an HSV vector has mutations at gB:285, gB;549, gH:753, and gH:778. The mutations are referred to herein relative to the codon (amino acid) numbering of the gD, gB, and gH genes of the HSV-1 strain KOS derivative K26GFP.
- K26GFP may contain additional differences in the region of the gene corresponding to nucleotides 2,079-2,102 of GenBank X03896.
- sequence of either KOS derivative K26GFP or GenBank Accession No. AF311740 can serve as a reference sequence for the gB mutations discussed herein.
- sequence of either KOS derivative K26GFP or GenBank Accession No. X03896 can serve as a reference sequence for the gH mutations discussed herein.
- HSV vectors of the invention may include homologous mutations in gB and gH of any HSV strain.
- the mutation of the entry protein for inclusion in an HSV vector is a substitution mutation; however, mutations are not limited to substitution mutants.
- mutant gB or gH glycoproteins for use in an HSV vector are selected from the group of substitution mutations consisting of gB:D285N, gB:A549T, gB:S668N, gH:N753K, gH:A778V.
- an HSV vector includes combinations of these substitutions (such as two or more of such substitutions (e.g., 3 or more, 4 or more, or all)), with the gB:D285N/gB:A549T double mutant, the gH:N753K/gH:A778V double mutant, and the gB:S668N/gH:N753K/gH:A778V triple mutant being examples of embodiments.
- an HSV vector comprises gB:D285N/gB:A549T/gH:N753K/gH:A778V.
- an HSV vector comprises a mutant gB and/or a mutant gH glycoprotein, wherein the mutations in the glycoproteins are substitution mutations in at least two residues, wherein, when the vector is HSV-1 K26GFP, the at least two residues are selected from the group consisting of gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778, or wherein when the vector is a homologous HSV, the at least two residues are selected from amino acids that correlate to gB:D285, gB:A549, gB:S668, gH:N753, and gH:A778 wherein the gB:D285 residue correlates to X in VYPYXEFVL (SEQ ID NO: 838), the gB:A549 residue correlates to X in KLNPNXIAS (SEQ ID NO: 839), the gB:S
- the oncolytic HSV viruses described herein comprise one or more mutations in the UL37 gene that reduce HSV infection of neuronal cells, such as those described in International PCT Publication No. WO 2016/141320 and Richard et al., Plos Pathogens, 2017, 13(12), el 006741.
- miRs are differentially expressed in a broad array of disease states, including multiple types of cancer. Importantly, miRNAs are differentially expressed in cancer tissues compared to normal tissues, enabling them to serve as a targeting mechanism in a broad variety of cancers. miRNAs that are associated (either positively or negatively) with carcinogenesis, malignant transformation, or metastasis are known as "oncomiRs".
- the expression level of a particular oncomiR is positively associated with the development or maintenance of a particular cancer.
- Such miRs are referred to herein as "oncogenic miRs.”
- the expression of an oncogenic miR is increased in cancerous cells or tissues compared to the expression level observed in non-cancerous controls cells ⁇ i.e., normal or healthy controls) or is increased compared to the expression level observed in cancerous cells derived from a different cancer type.
- the expression of an oncogenic miR is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 1000% or more compared to the expression of the oncogenic miR in a non-cancerous control cell or a cancerous cell derived from a different cancer type.
- a cancerous cell or tissue may express an oncogenic miR that is not expressed in non-cancerous control cells or tissues. Examples of oncogenic miRNAs that are frequently over-expressed in cancer tissues include, but are not limited to, miR-21, miR-155 and miR-17-92. Additional examples of oncogenic miRs are listed in Table 4.
- the expression of a particular oncomiR is negatively associated with the development or maintenance of a particular cancer and/or metastasis.
- Such oncomiRs are referred to herein as “tumor-suppressor miRs” or “tumor-suppressive miRs,” as their expression prevents or suppresses the development of cancer.
- the expression of a tumor-suppressor miRNA is decreased in cancerous cells or tissues compared to the expression level observed in non-cancerous control cells (i.e., normal or healthy controls), or is decreased compared to the expression level of the tumor-suppressor miRNA observed in cancerous cells derived from a different cancer type.
- the expression of a tumor- suppressor miRNA in a cancerous cell may be decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the expression of the tumor-suppressor miRNA in a non-cancerous control cell or a cancerous cell derived from a different cancer type.
- a non-cancerous control cell may express a tumor- suppressor miRNA that is not expressed in cancerous cells.
- tumor-suppressive miRNAs include, but are not limited to, miR-122, miR-184, miR-34a, let7a, miR-145-5p, miR- 199a-5p, miR-451a, miR-125a, miR-125a-5p, miR-126-3p, miR-233-3p, miR-143-3p, miR-l -3p, miR-133a-3p, miR-127a-3p, miR-133b, miR-134-3p, miR-124, miR-101 , miR-125b, miR-145, miR-559, miR-213, miR-31-5p, miR-205p, miR-15a, miR-16-1, miR-34, as well as miRNAs of the let-7 family. Additional examples of tumor-suppressive miRs are listed in Table 3 and Table 8.
- Cancer pathogenesis is a heterogeneous and multigenic process. As such, activation of particular pathways and the expression of particular genes may lead to cancer development in one context, and result in distinct or opposing results when activated or expressed in a different context. Therefore, the characterization of a particular gene or miR as an "oncogene” or “oncogenic miR” or as a “tumor-suppressor” or “tumor-suppressive miR” is not a binary distinction and will vary according to the type of cancer. For example, the expression of one miRNA may be increased in a particular cancer and associated with the development of that cancer, while the expression of the same miRNA may be decreased in a different cancer and associated with prevention of the development of that cancer.
- miRNAs may function as oncogenic miRNAs independent of the type of cancer.
- some miRNAs target mRNA transcripts of tumor suppressor genes for degradation, thereby reducing expression of the tumor suppressor protein.
- miR-152b functions as an oncogenic miR in the vast majority of hematologic malignancies, but functions as a tumor-suppressive miR in many solid tumors.
- a particular miR may be highly expressed in both cancerous and non-cancerous cells.
- miR-155 is highly expressed in normal cells, playing an essential role in macrophage polarization, and is also highly expressed in cancer cells.
- the development of the miR- attenuated, genome-editing, and microenvironment-remodeling oncolytic viruses described herein is based on the differential expression of a particular miR or group of miRs in one cell population or tissue compared to another cell population or tissue.
- tumor-suppressive miR generally refers to a miR that is more highly expressed in a noncancerous cell or tissue compared to a cancerous cell or tissue
- oncogenic miR generally refers to a miR that is more highly expressed in a cancerous cell or tissue compared to a non-cancerous cell or tissue.
- a miR characterized as a tumor-suppressive miR in one type of cancer may or more may not function as a tumor- suppressive miR in a different type of cancer
- a miR characterized as an oncogenic miR in one type of cancer may or more may not function as an oncogenic miR in a different type of cancer.
- Table 1 shows the relationship between 12 select oncomiRs (9 tumor suppressors and 3 oncogenic miRNAs) and numerous cancers. A list of 3,410 oncomiR-cancer relationships is shown in Table 2.
- miRNAs regulate many transcripts of proteins that are involved in the control of cellular proliferation and apoptosis. Regulated proteins include conventional proto- oncoproteins and tumor suppressors such as Ras, Myc, Bcl2, PTEN and p53. Aberrant expression of miRNAs therefore often is involved in development of cancer and can therapeutically be corrected by either inhibiting oncogenic miRNAs or replacing the depleted tumor suppressor miRNA. Further, the differential expression of particular oncomiRs in cancerous vs.
- the oncolytic viral vectors described herein can comprise the following properties individually or in combination: insertion of miRNA target sequences into the viral genome, thereby restricting viral vector replication to cancer or tumor cells; one or more polynucleotides incorporated into the viral genome whose product(s) disrupt the function of an oncogenic miRNA, modulate the cancer extracellular matrix, and/or enhance or activate an anti-cancer immune response; and/or protease-activated antibodies incorporated into the viral particle in order to selectively target the vectors to cancer and/or tumor cells.
- One aspect of the invention comprises a recombinant oncolytic virus (or viral vector) comprising a plurality of copies of one or more miRNA target sequences inserted into a locus of one or more essential viral genes.
- a recombinant oncolytic virus may comprise miRNA target sequences inserted into a locus of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten essential viral genes.
- miRNAs expressed in normal (non-cancerous) cells can bind to such target sequences and suppress expression of the viral gene containing the miRNA target sequence, thereby limiting viral replication in healthy, non-cancerous cells.
- Such recombinant oncolytic viruses are referred to herein as "miR-attenuated” or “replication-restricted” as they demonstrate reduced or attenuated viral replication in cells that express one or more miRNAs capable of binding to the incorporated miR target sequences compared to cells that do not express, or have reduced expression of, the miR.
- miRNA target sequences By incorporating miRNA target sequences into key genes required for viral replication, viral replication can be conditionally suppressed in normal diploid cells expressing the miRNAs and can proceed normally in cells that do not express themiRNAs. In such embodiments, healthy, non-cancerous cells are protected from the normal cells from lytic effects of infection by the recombinant viral vector.
- the one or more miRNA target sequences is incorporated into the 5' untranslated region (UTR) and/or 3' UTR of one or more essential viral genes.
- the oncolytic virus is a herpes simplex virus (HSV)
- the viral genes required for viral replication include any of UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP34.5, ICP47,
- the oncolytic virus is HSV and comprises one or more miRNA target sequences incorporated into the 5' or 3' UTR of one or more essential viral genes.
- the oncolytic virus is HSV, and the one or more miRNA target sequences is incorporated into one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5.
- the oncolytic virus is HSV, and the one or more miRNA target sequences is incorporated into the 5' or 3' UTR of one or more of ICP4, ICP27, UL8, UL42, UL19, and ICP34.5 miRNA Target Sequence Cassettes
- genes for miRNAs are transcribed to a primary miRNA (pri- miRNA), which is then processed in the nucleus by Drosha, a class 2 RNase III enzyme, to form a precursor miRNA (pre-miRNA) hairpin.
- pri- miRNA primary miRNA
- pre-miRNA hairpin are transported to the cytoplasm, where they are cleaved by the RNase III enzyme Dicer. This endoribonuclease interacts with 5' and 3' ends of the hairpin and cuts away the loop joining the 3' and 5' arms, yielding a duplex RNA molecule about 22 nucleotides in length.
- RISC effector RNA-induced silencing complex
- MIR122 refers to the gene encoding a hairpin mir- 122 pre-miRNA molecule, which is then processed into a mature miR- 122 molecule. Due to the hairpin structure of the pre-miRNA, it is possible that two mature microRNAs can originate from opposite arms of the same pre-miRNA.
- expression data clearly indentify one strand as the predominantly expressed miRNA and the other as the minor product.
- the mature miRNA sequences are assigned names of the form miR-## (the predominant product) and miR-##* (minor product from the opposite arm of the precursor).
- miR-56 the major and minor products of mir-56
- miR-56* the major and minor products of mir-56
- miR-56* the major and minor products of mir-56
- the two mature miRNA products are denoted as miR-##-5p (from the 5' arm of the pre-miRNA hairpin) and miR-##-3p (from the 3' arm of the pre-miRNA hairpin).
- the two mature miRNA products of mir- 142 are denoted as miR-142-5p and miR-142-3p. Because they originate from opposite ends of the pre-miRNA hairpin, the -3p and -5p products of a particular miRNA will comprise different RNA sequences and will therefore recognize different target sequences.
- miRNA target sequences are inserted into the locus of one or more essential viral genes in the form of a "miR target sequence cassette" or "miR-TS cassette.”
- a miR- TS cassette which refers to a polynucleotide sequence comprising one or more miRNA target sequences and capable of being inserted into a specific locus of a viral gene.
- the miR-TS cassettes described herein comprise at least one miRNA target sequence.
- the miR-TS cassettes described herein comprise a plurality of miRNA target sequences.
- the miR-TS cassettes described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more miRNA target sequences.
- the two or more target sequences are arranged such that the total length of the miR-TS cassette (m) is less than or equal to the average length of the miRNA target sequences (n) multiplied by the total number of miRNA target sequences in the cassette (y) plus the average length of a linker sequence (/) multiplied by the total number of miRNA target sequences in the cassette plus 1 (y + 1).
- n the average length of the miRNA target sequences
- / the average length of the linker sequences
- y the total number of target sequences in the miR-TS cassette.
- the length of the miR-TS cassette (m) is between about 104 nt and about 205 nt.
- the "length" of a miR-TS cassette is defined as the total number of nucleotides (basepairs for double-stranded polynucleotides) from the 5' nucleotide of the first miR-TS to the 3' nucleotide of the last miR-TS in the polynucleotide, inclusive of any intervening sequences.
- the minimum length of a miR-TS cassette will be the sum of the lengths of the miR-TSs. Spacers increase the length. The choice of spacer length determines the number of additional nucleotides in the cassette. Longer spacers increase the length of the cassette more than shorter spacers. By recognizing that shorter spacers (as short as 0,
- 1, 2, 3, 4, 5, or 6 nt can be used when miR-TSs are interleaved (minimizing the number of mi- TSs for the same miRNA that are adjacent to one another)— the interleaved miR-TSs serving to increase the space between the other miR-TSs— the present inventors have determined that it is possible to generate shorter miR-TS cassettes than is possible in miR-TS cassettes in which miR- TSs for the same miRNA are arrayed in tandem, e.g. four of one type followed by four of the next type.
- the length of the miR-TS cassette is less than 1000 nt.
- the length of the miR-TS cassette is less than 900 nt, less than 800 nt, less than 700 nt, less than 600 nt, less than 500 nt, less than 400 nt, less than 300 nt, less than 200 nt, less than 100 nt, or less than 50 nt. In some embodiments, the length of the miR-TS cassette is less than 26, 27, 28, 29, or 30 nt times the number of miR-TS sites, less than about 30 nt times the number of miR-TS sites, less than about 35 nt times the number of miR-TS sites, or less than about 40 nt times the number of miR-TS sites.
- the miR-TS cassettes comprise a plurality miRNA target sequences, wherein each miRNA target sequence in the plurality is a target sequence for the same miRNA.
- the miR-TS cassettes may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of the same miR target sequence.
- the miR-TS cassettes comprise between 2 to 6 copies of the same miR target sequence.
- the miR-TS cassettes comprise 3 copies of the same miR target sequence.
- the miR-TS cassettes comprise 4 copies of the same miR target sequence.
- the miR-TS cassettes described herein comprise a plurality of miRNA target sequences, wherein the plurality comprises at least two different miRNA target sequences. In some embodiments, the miR-TS cassettes described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 different miRNA target sequences. For example, in some embodiments, the miR-TS cassette may one or more copies of a first miRNA target sequence and one or more copies of a second miRNA target sequence. In some embodiments, the miR-TS cassette comprises at least
- the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence and 3 or 4 copies of a second miR target sequence.
- the plurality of miRNA target sequences comprises at least 3 different miRNA target sequences.
- the miR-TS cassette comprises one or more copies of a first miR target sequence, one or more copies of a second miR target sequence, and one or more copies of a third miR target sequence.
- the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a third miR target sequence.
- the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence, 3 or 4 copies of a second miR target sequence, and 3 or 4 copies of a third miR target sequence.
- the plurality of miRNA target sequences comprises at least 4 different miRNA target sequences.
- the miR-TS cassette comprises one or more copies of a first miR target sequence, one or more copies of a second miR target sequence, one or more copies of a third miR target sequence, and one or more copies of a fourth miR target sequence.
- the miR-TS cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a first miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a second miR target sequence, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a third miR target sequence, and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of a fourth miR target sequence.
- the miR-TS cassette comprises 3 or 4 copies of a first miR target sequence, 3 or 4 copies of a second miR target sequence, 3 or 4 copies of a third miR target sequence, and 3 or 4 copies of a fourth miR target sequence.
- the miR-TS cassettes described herein comprise a plurality of miRNA target sequences, wherein
- the miR-TS cassettes comprise a plurality of miRNA target sequences
- the plurality of miRNA target sequences may arranged in tandem, without any intervening nucleic acid sequences.
- the plurality of miRNA target sequences may be separated by a linker sequence.
- the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or more nucleotides.
- the linker sequence comprises about 4 to about 20 nucleotides. In further embodiments, the linker sequence comprises about 4 to about 16 nucleotides.
- a miR-TS cassette may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the following subunits: (a) a first miRNA target sequence - linker - a second miRNA target sequence, wherein adjacent subunits are separated by an additional linker sequence.
- the first and the second miRNA target sequence are targets of the same miRNA.
- the first and the second miRNA target sequence are targets of different miRNAs.
- miR-TS cassettes described herein comprise a miRNA target sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the reverse complement of a sequence selected from SEQ ID NOs: 1 - 803. In some embodiments, miR-TS cassettes described herein comprise a miRNA target sequence that comprises or consists of the reverse complement of a sequence selected from SEQ ID NOs: 1 - 803.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-122-5p target sequences. In some embodiments, the miR-122-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 804. In some embodiments, the miR-122-5p target sequences comprise or consist of SEQ ID NO: 804. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-124-3p target sequences.
- the miR-124-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 805. In some embodiments, the miR-124-3p target sequences comprise or consist of SEQ ID NO: 805. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-125a-5p target sequences. In some embodiments, the miR-125a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 806. In some embodiments, the miR-125a-5p target sequences comprise or consist of SEQ ID NO: 806.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-126-3p target sequences. In some embodiments, the miR-126-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 807 or SEQ ID NO: 808. In some embodiments, the miR-126-3p target sequences comprise or consist of SEQ ID NO: 807 or SEQ ID NO: 808. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-127a-3p target sequences.
- the miR-127a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 809. In some embodiments, the miR-127a-3p target sequences comprise or consist of SEQ ID NO: 809.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-128-3p target sequences.
- the miR-128-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 810 or SEQ ID NO: 811.
- the miR-128-3p target sequences comprise or consist of SEQ ID NO: 810 or SEQ ID NO: 811.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-129-3p target sequences.
- the miR-129-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 812. In some embodiments, the miR-129-3p target sequences comprise or consist of SEQ ID NO: 812.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-129-5p target sequences. In some embodiments, the miR-129-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 813. In some embodiments, the miR-129-5p target sequences comprise or consist of SEQ ID NO: 813. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-130b-3p target sequences.
- the miR-130b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 814. In some embodiments, the miR-130b-3p target sequences comprise or consist of SEQ ID NO: 814. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-130b-5p target sequences. In some embodiments, the miR-130b-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 815. In some embodiments, the miR-130b-5p target sequences comprise or consist of SEQ ID NO: 815.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-133a-3p target sequences. In some embodiments, the miR-133a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 816. In some embodiments, the miR-133a-3p target sequences comprise or consist of SEQ ID NO: 816. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-133b-3p target sequences.
- the miR-133b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 817. In some embodiments, the miR-133b-3p target sequences comprise or consist of SEQ ID NO: 817. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-134-3p target sequences. In some embodiments, the miR-134-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 818. In some embodiments, the miR-134-3p target sequences comprise or consist of SEQ ID NO: 818.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-137-3p target sequences. In some embodiments, the miR-137-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 819. In some embodiments, the miR-137-3p target sequences comprise or consist of SEQ ID NO: 819. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-l-3p target sequences.
- the miR-l-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 820.
- the miR-l-3p target sequences comprise or consist of SEQ ID NO: 820.
- the miR-TS cassettes described herein comprise at least 1 , at least 2, at least 3, or at least 4 miR-143-3p target sequences.
- the miR-143-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 821.
- miR-143- 3p target sequences comprise or consist of SEQ ID NO: 821.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-145-3p target sequences. In some embodiments, the miR-145-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 822. In some embodiments, the miR-145-3p target sequences comprise or consist of SEQ ID NO: 822. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-145-5p target sequences.
- the miR-145-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 823. In some embodiments, the miR-145-5p target sequences comprise or consist of SEQ ID NO: 823. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-184-3p target sequences. In some embodiments, the miR-184-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 824. In some embodiments, the miR-184-3p target sequences comprise or consist of SEQ ID NO: 824.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-199a-3p target sequences. In some embodiments, the miR-199a-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 825. In some embodiments, the miR-199a-3p target sequences comprise or consist of SEQ ID NO: 825. In some embodiments, the miR-TS cassettes described herein comprise at least 1 , at least 2, at least 3, or at least 4 miR-199a-5p target sequences.
- the miR-199a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 826. In some embodiments, the miR-199a-5p target sequences comprise or consist of SEQ ID NO: 826. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-204-5p target sequences. In some embodiments, the miR-204-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 827. In some embodiments, the miR-204-5p target sequences comprise or consist of SEQ ID NO: 827.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-208b-3p target sequences. In some embodiments, the miR-208b-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 828. In some embodiments, the miR-208b-3p target sequences comprise or consist of SEQ ID NO: 828. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-214-3p target sequences.
- the miR-214-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 829. In some embodiments, the miR-214-3p target sequences comprise or consist of SEQ ID NO: 829. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-217-5p target sequences. In some embodiments, the miR-217-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 830. In some embodiments, the miR-217-5p target sequences comprise or consist of SEQ ID NO: 830.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-219a-5p target sequences. In some embodiments, the miR-219a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 831. In some embodiments, the miR-219a-5p target sequences comprise or consist of SEQ ID NO: 831. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-223-3p target sequences.
- the miR-223-3p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 832.
- the miR-223-3p target sequences comprise or consist of SEQ ID NO: 832.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-34a-5p target sequences.
- the miR-34a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 833.
- the miR-34a-5p target sequences comprise or consist of SEQ ID NO: 833.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-451a target sequences.
- the miR-451a target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 834.
- the miR-451 a target sequences comprise or consist of SEQ ID NO: 834.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-559-5p target sequences.
- the miR-559-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 835. In some embodiments, the miR-559-5p target sequences comprise or consist of SEQ ID NO: 835. In some embodiments, the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-Let-7a-5p target sequences. In some embodiments, the miR-Let-7a-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 836.
- the miR-Let-7a-5p target sequences comprise or consist of SEQ ID NO: 836.
- the miR-TS cassettes described herein comprise at least 1, at least 2, at least 3, or at least 4 miR-9-5p target sequences.
- the miR-9-5p target sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 837.
- the miR-9-5p target sequences comprise or consist of SEQ ID NO: 837.
- Table 10 provides sequences of exemplary miRNAs that can bind to the miRNA target sequences in the oncolytic viruses described herein. Additional miRNA sequences are provided in SEQ ID NOs: 33 - 803.
- the miR-TS cassettes comprise one or more additional polynucleotide sequences that enable the cassette to be inserted into the locus of a viral gene.
- a miR-TS cassette may further comprise short polynucleotide sequence on the 5' and 3' ends that are complementary to a nucleic acid sequence at a desired location in the viral genome. Such sequences are referred to herein as "homology arms" and facilitate the insertion of a miR-TS cassette into a specific locaton in the viral genome.
- the miR-TS cassettes disclosed comprise two or more pluralities of miR-TSs each corresponding to a different miRNA and the miR-TSs are selected to protect diverse cell types or organs from an oncolytic virus.
- the pluralities of miR-TSs are interleaved rather than in tandem to one another.
- the miR-TS cassettes have short (e.g., 4 - 15 nt in length) spacers, resulting in a more compact cassette.
- the miR-TS cassettes are free from (or have reduced) RNA secondary structures that inhibit activity of the miR-TSs.
- the miR-TS cassettes are free from (or have reduced) seed sequences for miRNAs associated with carcinogenesis, malignant transformation, or metastasis (i.e., "oncomiRs"). In some embodiments, the miR-TS cassettes are free from (or have reduced) polyadenylation sites.
- a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into a locus of one essential viral gene, wherein the miR-TS cassette comprises a plurality of miRNA target sequences, such that the recombinant oncolytic virus comprises a plurality of miRNA target sequences incorporated into a locus of one essential viral gene.
- the miR-TS cassette may comprise a plurality of miRNA target sequences, wherein each miRNA target sequence of the plurality is a target for the same miRNA, such that the recombinant oncolytic virus comprises a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) copies of the same miRNA target sequence incorporated into a locus of an essential viral gene.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, 5, 6 or more target sequences inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, or more target sequences inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising 2, 3, 4, 5, 6 or more target sequence inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- the plurality of miRNA target sequences comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, such that the recombinant oncolytic virus comprises one or more copies of at least 2, 3, or 4 different miRNA target sequence incorporated into a locus of an essential viral gene.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a- 5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a-5p, and miR- Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-34a-5p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184- 3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184-3p, and miR- Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p, miR-184-3p, and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-122-5p and miR-Let-7a-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR- 122-5p and miR-Let-7a-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR- 145-5p, miR-199a-5p, and miR-599-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-l-3p, and miR-124-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-l-3p, and miR-124-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-124-3p, miR-l-3p, and miR-124-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-219a-5p, miR-122-5p, and miR-128-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-208b-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-137-3p, miR-217-3p, and miR-126-3p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic HSV may comprise a miR-
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- a recombinant oncolytic HSV may comprise a miR-TS cassette comprising one or more target sequences for miR-128-3p, miR-204-5p, and miR-219-5p inserted into one of ICP4, ICP27, ICP34.5, UL8, or UL9.
- a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into the 3' or 5' untranslated region (UTR) of the viral genome.
- the miR-TS cassette may comprise one copy of a miRNA target sequence, such that the recombinant oncolytic virus comprises one copy of a miRNA target sequence incorporated into the 3' or 5' UTR of the viral genome.
- a recombinant polio virus, S W, or Coxsackievirus may comprise a miR-TS cassette comprising a miRNA target sequence shown in Table 10 inserted into the 3' or 5' UTR of the viral genome.
- a recombinant oncolytic virus may comprise one miR-TS cassette incorporated into the 3' or 5' UTR of the viral genome, wherein the miR-TS cassette comprises a plurality of miRNA target sequences shown in Table 10, such that the recombinant oncolytic virus comprises a plurality of miRNA target sequences incorporated into the 3' or 5' UTR of the viral genome.
- the plurality of miRNA target sequences comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, such that the recombinant oncolytic virus comprises one or more copies of at least 2, 3, or 4 different miRNA target sequence incorporated into the 3' or 5' UTR of the viral genome.
- a recombinant polio virus, SW, or Coxsackievirus may comprise a miR-TS cassette comprising one or more copies of at least 2, 3, or 4 different miRNA target sequences selected from Table 10 inserted into the 3' or 5' UTR of the viral genome.
- a recombinant oncolytic virus may comprise a miR-
- the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP8, ICP22, ICP34.5, UL5, UL8, UL9, UL30, UL39/40, or UL42.
- the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP4, ICP27, ICP34.5, UL8, or UL9. In some embodiments, the recombinant oncolytic virus is an HSV virus and the two or more essential viral genes are selected from the group consisting of ICP27, ICP4, ICP34.5, UL8, and UL42.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4 and a second miR-TS cassette comprising a plurality of miRNA target sequences into a locus of ICP27.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124; 1, 2, 3, or 4 copies of a target sequence for miR-l-3p; and 1, 2, 3, or 4 copies of a target sequence for miR-143-3p.
- the plurality of miRNA target sequences in the first miR-TS cassettes are arranged as follows:
- the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-l-3p; 1, 2, 3, or 4 copies of a target sequence for miR-145-5p; 1, 2, 3, or 4 copies of a target sequence for miR-199-5p; and 1, 2, 3, or 4 copies of a target sequence for miR-559.
- the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-219a-5p; 1, 2, 3, or 4 copies of a target sequence for miR-122-5p; and 1, 2, 3, or 4 copies of a target sequence for miR-128.
- the first miR-TS cassette comprises 4 copies of a target sequence for miR-124 and the second miR-TS cassette comprises 2, 3, or more copies of a target sequence for each of l-3p, 145-5p, 199a-5p, and 559. In some embodiments, the first miR- TS cassette comprises 4 copies of a target sequence for miR-124 and the second miR-TS cassette comprises 4 copies of a target sequence for each of 219a-5p, 122-5p, 128T.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; and (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL42.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124.
- the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows:
- the second miR-TS cassette is inserted into a locus of UL42 comprises 1, 2, 3, or 4 copies of a target sequence for miR-122-5p.
- the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows:
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising 4 copies of a target sequence for miR-124 inserted into a locus of ICP4; and (ii) a second miR-TS cassette comprising 3 copies of a target sequence for miR-122-5p inserted into a locus of UL42.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; and (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences is inserted into a locus of UL42.
- the first miR- TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124.
- the plurality of miRNA target sequences in the second miR- TS cassettes are arranged as follows:
- the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-122.
- the plurality of miRNA target sequences in the second miR-TS cassettes are arranged according to one of the following:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassettes are arrang according to one of the following:
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA- 124-3 p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 1, 2, 3, or 4 copies of a target sequence for miR-122-5p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125- 5p.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-122; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 1, 2, 3, or 4 copies of a target sequence for miR-125-5p.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA-124; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-122-3p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125-5p.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miRNA- 124-3p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 3 copies of a target sequence for miR-122-3p; and (iii) a third miR-TS cassette inserted into a locus of UL42 and comprising 4 copies of a target sequence for miR-125-5p.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette a plurality of miRNA target sequences inserted into a locus of UL8.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for miR-124.
- the plurality of miRNA target sequences in the second miR-TS cassettes are arranged as follows:
- the second miR-TS cassette is inserted into a locus of UL8 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-137, miR-208b-3p, and miR-126.
- the plurality of miRNA target sequences in the second miR- TS cassettes are arranged as follows:
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for miR-124; (ii) a second miR-TS cassette inserted into a locus of UL8 and comprising 4 copies of a miR-137 target sequence, 4 copies of a miR-208b-3p target sequence, and 4 copies of a miR-126-3p target sequence.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; and (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL8.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-124, miR-l-3p, and miR-143-3p.
- the plurality of miRNA target sequences in the first miR-TS cassette are arranged as follows:
- the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-219a-5p, miR- 122-5p, and miR-128.
- the plurality of miRNA target sequences in the second miR-TS cassette are arranged as follows:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising 4 copies of a target sequence for each of miR-124, miR-l-3p, and miR-143-3p; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 copies of a target sequence for miR-219a-5p, 4 copies of a target sequence for miR-122-5p, and 4 copies of a target sequence for miR-128; and (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 copies of a target sequence for miR-137, 4 copies of a target sequence for miR-208a, and 4 copies of a target sequence for miR-126.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP4; (ii) a second miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP27; (iii) a third miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of UL8; and (iv) a fourth miR-TS cassette comprising a plurality of miRNA target sequences inserted into a locus of ICP34.5.
- the first miR-TS cassette is inserted into a locus of ICP4 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miR-124, miR-l-3p, and miR-143-3p.
- the plurality of miRNA target sequences in the first miR-TS cassette are arranged as follows:
- the second miR-TS cassette is inserted into a locus of ICP27 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miRNA 219a-5p, miRNA 122-5p, and miRNA 128.
- the plurality of miRNA target sequences in the second miR-TS cassette are arranged as follows: (a) (219a-5p) - (122-5p) - (128-3p) - (122-5p) - (219a-5p) - (128-3p) - (122-5p) - (128-3p) - (219a-5p) - (128-3p) - (122-5p) - (219a-5p) - (128-3p) - (122-5p) - (219a-5p).
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows: (a) (137-3p) - (129-3p) - (217-5p) - (129-3p) - (217-5p) - (137-3p) - (217-5p) - (137-3p) - (217-5p) - (129-3p) - (137-3p) - (219-5p) - (137-3p).
- the third miR-TS cassette is inserted into a locus of
- the plurality of miRNA target sequences in the third miR-TS cassette are arranged as follows:
- the fourth miR-TS cassette is inserted into a locus of
- ICP34.5 and comprises 1, 2, 3, or 4 copies of a target sequence for each of miRNA 128M, miRNA 204, and miRNA 219-3p.
- the plurality of miRNA target sequences in the fourth miR-TS cassette are arranged as follows:
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising4 of a target sequence for each of miR-137, miR-208b-3p, and miR-126; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 4 copies of a target sequence for miR-204, and 4 copies of a target sequence for miR- 219
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4of a target sequence for each of miR-219a-5p, miR-122-5p, and miR- 128; and (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for each of miR-137, miR-208a, and miR-126.
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-126-3p; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 4 copies of a target sequence for miR- 204
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and 4 of a target sequence for miR-127; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR-217-5p, and4 of a target sequence for miR-128; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising 4 of a target sequence for miR-128, 3 copies of a target sequence for miR-204, and
- the recombinant oncolytic virus is an HSV virus comprising (i) a first miR-TS cassette inserted into a locus of ICP4 and comprising four copies of a target sequence for each of miR-124, miR-l-3p, and miR-14; (ii) a second miR-TS cassette inserted into a locus of ICP27 and comprising 4 of a target sequence for each of miR-219a-5p, miR-122-5p, and miR-128; (iii) a third miR-TS cassette inserted into a locus of UL8 and comprising 4 of a target sequence for miR-137-3p, 4 of a target sequence for miR- 217-5p, and 4 of a target sequence for miR-129; and (iv) a fourth miR-TS cassette inserted into a locus of ICP34.5 and comprising4 of a target sequence for miR- 128, 3 copies of a target sequence for miR-204, and 3 copies
- the viral vectors described herein comprise one copy of a miR- 125a target sequence incorporated into one essential viral gene. In some embodiments, the viral vectors described herein comprise one copy of a miR- 125a target sequence incorporated into the UL42 locus. In some embodiments, the viral vectors described herein comprise one copy of a miR-122 target sequence incorporated into one essential viral gene. In some embodiments, the viral vectors described herein comprise one copy of a miR-122 target sequence incorporated into the ICP27 locus (e.g., ONCR-036).
- ICP27 locus e.g., ONCR-036
- the viral vectors described herein comprise 3 copies of a miR- 125a target sequence incorporated a viral gene required for viral replication. In further embodiments, the viral vectors described herein may comprise 3 copies of a miR- 125a target sequence incorporated into the UL42 locus. In some embodiments, 4 copies of a miR target sequence are incorporated into the 3' UTR of an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR- 125a target sequence incorporated into an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR- 125a target sequence incorporated into the UL42 locus.
- the viral vectors described herein may comprise 4 copies of a miR-122 target sequence incorporated into an essential viral gene. In further embodiments, the viral vectors described herein may comprise 4 copies of a miR-122 target sequence incorporated into the ICP27 locus (e.g., ONCR-063). [00192] In some embodiments, 1 copy of a miR-122 target sequence is incorporated into the 3 ' UTR of a first essential viral gene, and 1 copy of a miR-125a target sequence is incorporated into the 3' UTR of a second essential viral gene.
- 1 copy of a miR-122 target sequence is incorporated into the 3 ' UTR of the ICP27 locus, and 1 copy of a miR- 125a target sequence is incorporated into the 3 ' UTR of the UL42 locus (e.g., ONCR-094).
- 1 copy of a miR-122 target sequence is incorporated into the 3' UTR of a first essential viral gene, and 3 copies of a miR-125a target sequence are incorporated into the 3' UTR of a second essential viral gene.
- 1 copy of a miR-122 target sequence is incorporated into the 3 ' UTR of the ICP27 locus, and 3 copies of a miR-125a target sequence are incorporated into the 3' UTR of the UL42 locus (e.g., ONCR-095).
- a first miR target sequence are incorporated into the 3' UTR of a first essential viral gene, and 1 copy of a second miR target sequence is incorporated into the 3' UTR of a second essential viral gene.
- 4 copies of a miR-122 target sequence are incorporated into the 3' UTR of a first essential viral gene, and 1 copy of a miR- 125a target sequence is incorporated into the 3' UTR of a second essential viral gene.
- 4 copies of a miR-122 target sequence are incorporated into the 3' UTR of the ICP27 locus, and 1 copy of a miR- 125a target sequence is incorporated into the 3 ' UTR of the UL42 locus (e.g., ONCR-093).
- 4 copies of a first miR target sequence are incorporated into the 3' UTR of a first essential viral gene, and 4 copies of a second miR target sequence are incorporated into the 3' UTR of a second essential viral gene.
- 4 copies of a miR-122 target sequence are incorporated into the 3' UTR of a first essential viral gene, and 4 copies of a miR- 125a target sequence are incorporated into the 3' UTR of a second essential viral gene.
- 4 copies of a miR-122 target sequence are incorporated into the 3' UTR of the ICP27 locus, and 4 copies of a miR- 125a target sequence is incorporated into the 3' UTR of the UL42 locus (e.g., ONCR-096).
- the miR-attenuated oncolytic viruses described herein result in reduced viral replication in a cell that expresses a miR capable of binding to one or more of the incorporated miR-target sequences.
- “Viral replication” refers to the total number of viral replication cycles that occur in a particular cell or population of cells during a given amount of time. In some embodiments, viral replication can be measured directly by assessing the total viral titer present over the course of the given amount of time, or by assessing the number of viral genome copies present (e.g., by sequencing).
- the viral vector may additionally comprise a detectable label, such as a fluorescent reporter.
- viral replication may be assessed by measuring the fluorescence intensity of the reporter, or the number of cells that express the reporter. In some embodiments, viral replication can be measured indirectly by assessing the number of viable cells over the course of the given amount of time. For example, the level of viral replication would be expected to inversely correlate with the number of viable cells over time.
- Reduced viral replication refers to a level of viral replication that is lower in a first cell or first population of cells compared to a second cell or a second population of cells.
- the level of viral replication in the first cell or first population of cells is reduced by at least 5% compared to the level of viral replication in the second cell or population of cells.
- the level of viral replication in the first cell or first population of cells is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the level of viral replication in the second cell or population of cells.
- viral replication in the first cell or first population of cells is completely inhibited compared to the viral replication in the second cell or population of cells.
- the reduced viral replication in the first cell or first population of cells correlates with the expression of a miR capable of binding to the one or more miR-target sequences incorporated into one or more viral genes required for replication.
- expression of a miR corresponding to the incorporated miR-target sequence therefore inhibits or reduces the expression of the replication gene, thereby inhibiting or reducing viral replication.
- the second cell or second population of cells does not express, or has a reduced expression level, of the t miR.
- absent or reduced expression of a miR (e.g., in a cancer cell) corresponding to the incorporated miR-target sequence allows for viral replication to proceed.
- the expression level of the miR in the second cell or population of cells is at least 5% lower than the expression level of the miR in the first cell or population. In some embodiments, the expression level of the miR in the second cell or population of cells is reduced at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the expression level of the miR in the first cell or population. In some embodiments, the second cell does not express the miR. In particular embodiments, the first cell is a non-cancerous cell and the second cell is a cancerous cell.
- a replication-restricted viral vector (e.g., a miR- attenuated viral vector) comprises at least one let-7 target sequence and is used to treat lung cancer.
- a replication- restricted viral vector comprises at least one miR- 15a and/or at least one miR-16A target sequences and is used to treat B-cell chronic lymphocytic leukemia.
- a replication-restricted viral vector comprises at least one miR- 125b, at least one miR- 145, at least one miR-21, and/or at least one miR- 155 target sequences and is used to treat breast cancer.
- a replication-restricted viral vector comprises at least one miR- 143 and/or at least one miR- 145 target sequences and is used to treat colorectal cancer.
- a replication-restricted viral vector comprises at least one miR-181a, at least one miR- 181b, and/or at least one miR-181c target sequences and is used to treat glioblastoma.
- a replication-restricted viral vector comprises at least one miR-199a*, at least one miR-195, at least one miR-199a, at least one miR-200a, and/or at least one miR- 125a target sequences and is used to treat liver cancer (e.g., hepatocellular carcinoma).
- liver cancer e.g., hepatocellular carcinoma
- a replication-restricted viral vector comprises at least one miR-451a target sequence, at least one miR-143-3p target sequence, at least one miR- 559 target sequence, and at least one miR-124 target sequence and is used for the treatment of pancreatic, lung, and/or colon cancer.
- the target sequences for miR-451a, miR-143-3p, miR-559, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27).
- a replication-restricted viral vector comprises at least one miR-45 la target sequence, at least one miR-145-5p target sequence, at least one miR-559 target sequence, and at least one miR-124 target sequence and is used for the treatment of any type of cancer described herein.
- the target sequences for miR-451a, miR-145-5p, miR-559, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27).
- a replication- restricted viral vector comprises at least one miR-205p target sequence, at least one miR-141-5p target sequence, at least one miR-31-5p target sequence, and at least one miR-124 target sequence and is used for the treatment of schwannoma.
- the target sequences for miR- 205p, miR-141-5p, miR-31 -5p, and miR-124 are incorporated into two or more genes required for viral replication (e.g., ICP4 and ICP27).
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-136-3p, miR-432-5p, miR-l -3p, miR- 127-3p, miR-379-5p, miR-493-5p, miR-223-5p, miR-223-5p, miR-136-5p, miR-451a, miR-487b- 3p, miR-370-3p, miR-410-3p, miR-431-3p, miR-4485-3p, miR-4485-5p, miR-127-5p, miR-409- 3p, miR-338-3p, miR-559, miR-411-5p, miR-133a-5p, miR-143-3p, miR-376b-3p, miR-758-3p, miR-1, miR-101, miR-1180, miR-1236, miR-124-3p, miR-125b, miR-126, miR-12
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-125 l -5p, miR-219a-5p, miR-219a-2- 3p, miR-124-3p, miR-448, miR-138-2-3p, miR-490-5p, miR-129-l -3p, miR-1264, miR-3943, miR-490-3p, miR-383-5p, miR-133b, miR-129-2-3p, miR-128-2-5p, miR-133a-3p, miR-129-5p, miR-l-3p, miR-885-3p, miR-124-5p, miR-759, miR-7158-3p, miR-770-5p, miR-135a-5p, miR- 885-5p, let-7g-5p, miR-100, miR-101 , miR-106a, miR-124, miR-124a, miR
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-10b-5p, miR-126-3p, miR-145-3p, miR-451a, miR-199b-5p, miR-5683, miR-3195, miR-3182, miR-1271 -5p, miR-204-5p, miR-409- 5p, miR-136-5p, miR-514a-5p, miR-559, miR-483-3p, miR-l-3p, miR-6080, miR-144-3p, miR- 10b-3p, miR-6130, miR-6089, miR-203b-5p, miR-4266, miR-4327, miR-5694, miR-193b, let-7a, let-7a-l, let-7a-2, let-7a-3, let-7b, let-7c, let-7d, let-7e, let-7f-l, let-7f-2, let-7
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-143, miR-145, miR-17-5p, miR-203, miR-214, miR-218, miR-335, miR-342-3p, miR-372, miR-424, miR-491-5p, miR-497, miR-7, miR-99a, miR-99b, miR-100, miR-101 , miR-15a, miR-16, miR-34a, miR-886-5p, miR-106a, miR-124, miR-148a, miR-29a, and/or miR-375 inserted into the 5' UTR or 3' UTR of one or more viral genes required for viral replication.
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-133a-5p, miR-490-5p, miR-124-3p, miR-137, miR-655-3p, miR-376c-3p, miR-369-5p, miR-490-3p, miR-432-5p, miR-487b-3p, miR- 342-3p, miR-223-3p, miR-136-3p, miR-136-3p, miR-143-5p, miR-l -3p, miR-214-3p, miR-143- 3p, miR-199a-3p, miR-199b-3p, miR-451a, miR-127-3p, miR-133a-3p, miR-145-5p, miR-145- 3p, miR-199a-5p, let-7a-l , let-7a-2, let
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-101 , miR-130a, miR-130b, miR-134, miR-143, miR-145, miR-152, miR-205, miR-223, miR-301a, miR-301b, miR-30c, miR-34a, miR- 34c, miR-424, miR-449a, miR-543, and/or miR-34b inserted into the 5' UTR or 3' UTR of one or more viral genes required for viral replication.
- This oncolytic virus may be used in methods and compositions for treating endometrial cancer.
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-125b, miR-138, miR-15a, miR-15b, miR-16, miR-16-1 , miR-16-l -3p, miR-16-2, miR-181a, miR-181b, miR-195, miR-223, miR-29b, miR-34b, miR-34c, miR-424, miR-lOa, miR-146a, miR-150, miR-151, miR-155, miR-2278, miR- 26a, miR-30e, miR-31, miR-326, miR-564, miR-27a, let-7b, miR-124a, miR-142-3p, let-7c, miR- 17, miR-20a, miR-29a, miR-30c, miR-720, miR-107, miR-342, miR-34a, miR
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-1, miR-145, miR-1826, miR-199a, miR-199a-3p, miR-203, miR-205, miR-497, miR-508-3p, miR-509-3p, let- 7a, let-7d, miR-106a*, miR-126, miR-1285, miR-129-3p, miR-1291 , miR-133a, miR-135a, miR-138, miR-141, miR-143, miR-182-5p, miR-200a, miR-218, miR-28-5p, miR-30a, miR-30c, miR-30d, miR-34a, miR-378, miR-429, miR-509-5p, miR-646, miR-133b, let-7b, let-7c, miR-200c, miR-204, miR-3
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7a-l, let-7a-2, let-7a-3, let- 7b, let-7c, let- 7d, let-7e, let-7f, let-7f-l , let-7f-2, let-7g, let-7i, miR-1, miR-100, miR-101, miR-105, miR-122, miR-122a, miR-1236, miR-124, miR-125b, miR-126, miR-127, miR-1271, miR-128-3p, miR- 129-5p, miR-130a, miR-130b, miR-133a, miR-134, miR-137, miR-138, miR-139, miR-139-5p, miR-140-5p, miR-141, miR-142-3p, miR-143, miR-144, miR-145, miR-146
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-143-3p, miR-126-3p, miR-126-5p, miR-1266-3p, miR-6130, miR-6080, miR-511-5p, miR-143-5p, miR-223-5p, miR-199b-5p, miR- 199a-3p, miR-199b-3p, miR-451a, miR-142-5p, miR-144, miR-150-5p, miR-142-3p, miR-214- 3p, miR-214-5p, miR-199a-5p, miR-145-3p, miR-145-5p, miR-1297, miR-141, miR-145, miR- 16, miR-200a, miR-200b, miR-200c, miR-29b, miR-381, miR-409-3p, miR-429, miR-451 , miR-
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let- 7b, miR-101, miR-125b, miR-1280, miR- 143, miR-146a, miR-146b, miR-155, miR-17, miR-184, miR-185, miR-18b, miR-193b, miR- 200c, miR-203, miR-204, miR-205, miR-206, miR-20a, miR-21 1, miR-218, miR-26a, miR-31 , miR-33a, miR-34a, miR-34c, miR-376a, miR-376c, miR-573, miR-7-5p, miR-9, and/or miR-98 inserted into the 5' UTR or 3' UTR of one or more viral genes required for viral replication.
- This oncolytic virus may be used in methods and compositions for treating melanoma.
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7d, miR-218, miR-34a, miR-375, miR- 494, miR-100, miR-124, miR-1250, miR-125b, miR-126, miR-1271, miR-136, miR-138, miR- 145, miR-147, miR-148a, miR-181a, miR-206, miR-220a, miR-26a, miR-26b, miR-29a, miR-32, miR-323-5p, miR-329, miR-338, miR-370, miR-410, miR-429, miR-433, miR-499a-5p, miR-503, miR-506, miR-632, miR-646, miR-668, miR-877, and/or miR-9inserted into the 5' UTR or 3' UTR of one or more miRNA target sequences for let-7
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7i, miR-100, miR-124, miR-125b, miR- 129-5p, miR-130b, miR-133a, miR-137, miR-138, miR-141, miR-145, miR-148a, miR-152, miR- 153, miR-155, miR-199a, miR-200a, miR-200b, miR-200c, miR-212, miR-335, miR-34a, miR- 34b, miR-34c, miR-409-3p, miR-411, miR-429, miR-432, miR-449a, miR-494, miR-497, miR- 498, miR-519d, miR-655, miR-9, miR-98, miR-101, miR-532-5p, miR-124a, miR-124a, miRNA target sequence
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-216a-5p, miR-802, miR-217, miR-145- 3p, miR-143-3p, miR-451a, miR-375, miR-214-3p, miR-216b-3p, miR-432-5p, miR-216a-3p, miR-199b-5p, miR-199a-5p, miR-136-3p, miR-216b-5p, miR-136-5p, miR-145-5p, miR-127-3p, miR-199a-3p, miR-199b-3p, miR-559, miR-129-2-3p, miR-4507, miR-l -3p, miR-148a-3p, miR- 101 , miR-1181, miR-124, miR-1247, miR-133a, miR-141, miR-145, miR-146a
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for let-7a-3p, let-7c, miR-100, miR-101, miR- 105, miR-124, miR-128, miR-1296, miR-130b, miR-133a-l, miR-133a-2, miR-133b, miR-135a, miR-143, miR-145, miR-146a, miR-154, miR-15a, miR-187, miR-188-5p, miR-199b, miR-200b, miR-203, miR-205, miR-212, miR-218, miR-221 , miR-224, miR-23a, miR-23b, miR-25, miR- 26a, miR-26b, miR-29b, miR-302a, miR-30a, miR-30b, miR-30c-l, miR-30c-2, miR
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences for miR-101, miR-183, miR-204, miR-34a, miR-365b-3p, miR-486-3p, and/or miR-532-5p inserted into the 5' UTR or 3 ' UTR of one or more viral genes required for viral replication.
- This oncolytic virus may be used in methods and compositions for treating retinoblastoma.
- an oncolytic virus described herein is a herpes simplex virus and wherein the one or more viral genes required for viral replication is selected from the group consisting of UL1, UL5, UL6, UL7, UL8, UL9, ULl l, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US 10, US11, and US12.
- the oncolytic viruses described herein comprise a nucleic acid sequence encoding a payload molecule.
- a "payload molecule” refers to a molecule capable of further enhancing the therapeutic efficacy of a virus.
- Payload molecules suitable for use in the present disclosure include antigen-binding molecules such as antibodies or antigen binding fragments thereof, cytokines, chemokines, soluble receptors, cell-surface receptor ligands, bipartite peptides, enzymes, and nucleic acids (e.g., shRNAs, siRNAs, antisense RNAs, antagomirs, ribozymes, apatamers, a decoy oligonucleotide, or an antagomir).
- antigen-binding molecules such as antibodies or antigen binding fragments thereof, cytokines, chemokines, soluble receptors, cell-surface receptor ligands, bipartite peptides, enzymes, and nucleic acids (e.g., shRNAs, siRNAs, antisense RNAs, antagomirs, ribozymes, apatamers, a decoy oligonucleotide, or an antagomir).
- one or more miRNA target sequences is incorporated in to the 3' or 5' UTR of a polynucleotide sequence encoding a payload molecule. In such embodiments, translation and subsequent expression of the payload does not occur, or is substantially reduced, in cells where the corresponding miRNA is expressed. In some embodiments, one or more miRNA target sequences are inserted into the 3' and/or 5' UTR of the polynucleotide sequence encoding the therapeutic polypeptide.
- the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a payload molecule that that reduces the expression or inhibits the function of an endogenous miRNA, a gene, or a tissue inhibitor of metalloproteinases (TIMP).
- TIMP tissue inhibitor of metalloproteinases
- the encoded protein or oligonucleotide may reduce expression or inhibit the function of a miRNA, gene, or TIMP in any number of ways including targeting the protein (e.g., a TIMP) for degradation (e.g., by ubiquitination and proteosomal degradation or targeting for lysosomal degradation), blocking interactions with cognate receptors (e.g., blocking antibodies or antigen binding fragments thereof or peptide inhibitors), degrading messenger RNA transcripts (e.g., a short interfering RNA or short hairpin RNA), and/or altering the genomic DNA sequence encoding the specific miRNA, gene, or protein (e.g., by an endonuclease).
- targeting the protein e.g., a TIMP
- degradation e.g., by ubiquitination and proteosomal degradation or targeting for lysosomal degradation
- cognate receptors e.g., blocking antibodies or antigen binding fragments thereof or peptide inhibitors
- the protein or oligonucleotide reduces the expression of a miR or a gene involved in carcinogenesis or metastasis (e.g., an oncogenic miR or an oncogene).
- a recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that reduces the expression or function of a miRNA that is an oncogenic miRNA (e.g., one or more of the miRNAs listed in Table 4).
- the recombinant oncolytic virus comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides encoding for a protein or oligonucleotide that reduces the expression or function of an oncogenic miRNA. In some embodiments, the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polynucleotides encoding for a plurality of proteins or oligonucleotides that reduce the expression or function of a plurality of oncogenic miRNAs. In some embodiments, the protein or oligonucleotide reduces the expression of miR- 17-92 and is used to treat lung cancer (e.g., small-cell lung cancer).
- lung cancer e.g., small-cell lung cancer
- the protein or oligonucleotide reduces the expression of miR-221 and/or miR-21 and is used to treat glioblastoma. In certain embodiments, the protein or oligonucleotide reduces the expression of miR-155 and/or miR-17-92 and is used to treat lymphoma (e.g., Burkitt's lymphoma, diffuse large B cell lymphoma, marginal zone lymphoma, or chronic lymphocytic leukemia). In some embodiments, the protein or oligonucleotide reduces the expression of miR-221, miR-222, and/or miR- 146 and is used to treat thyroid cancer.
- lymphoma e.g., Burkitt's lymphoma, diffuse large B cell lymphoma, marginal zone lymphoma, or chronic lymphocytic leukemia.
- the protein or oligonucleotide reduces the expression of miR-221, miR-222, and/or miR- 146
- the protein or oligonucleotide reduces the expression of miR-372 and/or miR-373 and is used to treat testicular cancer (e.g., testicular germ cell tumors). In some embodiments, the protein or oligonucleotide reduces the expression of miR- 18 and/or miR-224 and is used to treat liver cancer (e.g., hepatocellular carcinoma).
- testicular cancer e.g., testicular germ cell tumors
- the protein or oligonucleotide reduces the expression of miR- 18 and/or miR-224 and is used to treat liver cancer (e.g., hepatocellular carcinoma).
- a recombinant viral vectors described herein comprise a polynucleotide encoding a payload molecule that degrades the tumor extracellular matrix (ECM), which in some aspects leads to enhanced viral spread.
- ECM tumor extracellular matrix
- MMPs Matrix metalloproteinases
- These proteases are generally secreted as pro-enzymes (zymogens) and are activated by proteolytic removal of the pro-peptide pro-domain.
- the primary role that MMPs play in cancer is in the degradation of the ECM, which facilitates tumor invasion and metastasis.
- MMPs are also involved in tumor progression, epithelial to mesenchymal transition (EMT), and angiogenesis.
- MMPs are regulated by miRs as well as TIMPs, which comprise a family of four protease inhibitors (TIMP1 , TIMP2, ⁇ 3, and ⁇ 4).
- TIMPs which comprise a family of four protease inhibitors (TIMP1 , TIMP2, ⁇ 3, and ⁇ 4).
- TIMP1 protease inhibitors
- let-7 regulates MMP-2, MMP-9, and MMP-14; miR-143 regulates MMP-2, MMP-9, and MMP-13; miR-218 regulates MMP-2, MMP-7, and MMP-9.
- MMPs may be regulated by a single ⁇ master switch: e.g. ⁇ 1 is known to inhibit most all of the known MMPs and also promotes cell proliferation in a wide range of cell types; ⁇ 2 interacts with MMP-14 and MMP-2.
- the recombinant oncolytic viruses described herin comprise at least one polynucleotide encoding a protein or an oligonucleotide that reduces the expression or function of a miRNA that is capable of altering the extracellular matrix or capable of modulating a pathway that alters the extracellular matrix, particularly in a tumor microenvironment (e.g., one or more of the miRNAs listed in Table 5).
- a microenvironment remodeling miR refers to a miR.
- the protein or oligonucleotide reduces the expression or function of one microenvironment remodeling miR.
- the protein or oligonucleotide reduces the expression or function of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more microenvironment remodeling miRs.
- the recombinant oncolytic virus comprises a plurality of polynucleotides encoding a plurality of protein or oligonucleotides that reduce the expression or function of a plurality of microenvironment remodeling miRs.
- strategies described herein may be utilized by recombinant viral vectors of the present invention to knockdown or disrupt expression or function of miRs or TIMPs which negatively regulate MMPs.
- a recombinant oncolytic virus reduces the expression of a TIMP selected from TIMPl, TIMP2, ⁇ 3 and ⁇ 4.
- the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protein or an oligonucleotide that reduces the expression or function of a gene in the host cell genome.
- the gene is an oncogenic gene (e.g., a gene selected from the genes listed in Table 7).
- the gene encodes an oncogenic miR (e.g., a miRNA listed in Table 4), a microenvironment remodeling miR (e.g., a miRNA listed in Table 5), or a negative regulator of ECM-degradation (e.g., a TIMP).
- Reduction of gene expression and/or function may be accomplished by at the level of transcription (e.g., mutating, deleting, or silencing the genomic DNA sequence) or at the level of translation (e.g., by inhibiting the production of the gene product through mRNA degradation).
- the recombinant oncolytic viruses described herein comprise one or more polynucleotides that encode for nucleases that reduce the expression or function of a gene by enabling the mutation, deletion, or repression of transcription of a gene sequence.
- the nuclease is selected from a Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR)- associated endonuclease, a zinc-finger nuclease (ZFN) or a Transcription activator- like effector nuclease (TALEN).
- CRISPR Clustered Regulatory Interspaced Short Palindromic Repeats
- ZFN zinc-finger nuclease
- TALEN Transcription activator- like effector nuclease
- a CRISPR-associated endonuclease is selected from SpCas9, SpCas9-HFl, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, C2C1, C2C3, Cpfl, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, C
- Recombinant viral vectors of the invention may utilize the CRISPR
- gRNA guide RNA
- the gRNA is comprised of two parts; a crispr-RNA (crRNA) that is specific for a target genomic DNA sequence, and a tracr RNA (trRNA) that facilitates Cas binding.
- the crRNA and trRNA may be present as separate RNA oligonucleotides, or may be present in the same RNA oligonucleotide, referred to as a single guide-RNA (sgRNA).
- sgRNA single guide-RNA
- guide RNA or "gRNA” refers to either the combination of an individual trRNA and an individual crRNA or an sgRNA. See, e.g., Jinek etal. (2012) Science 337:816-821 ; Cong et al. (2013) Science 339:819-823; Mali et al. (2013) Science 339:823-826; Qi et al. (2013) Cell 152: 1173-1183; Jinek et al.
- CRISPR-Cas systems that employ homologous RNA- guided endonucleases of the Cas9 family as effectors have also been identified and experimentally characterized (Barrangou et al., 2007, Garneau et al, 2010, Deltcheva et al, 2011, Sapranauskas et al, 2011, Jinek et al, 2012, Gasiunas et al, 2012).
- a second, putative class 2-type V CRISPR- Cas system has been recently identified in several bacterial genomes.
- the putative type V CRISPR-Cas systems contain a large, ⁇ 1,300 amino acid protein called Cpfl (CRISPR from Prevotella and Francisella 1).
- an oncolytic virus described herein further comprises at least one polynucleotide encoding a trRNA and crRNA targeted to the miRNA or the ⁇ .
- the at least one polynucleotide encoding a trRNA and crRNA is inserted into a locus on the viral genome.
- the polynucleotide is an insulated sequence comprising a synthetic insulator or a native viral (e.g., HSV) insulator.
- an oncolytic virus is a herpes simplex virus and the at least one polynucleotide encoding an RNA binding site is inserted into or between one or more loci including the internal repeat joint region (comprising one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and the ICP47 promoter), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP4,
- an oncolytic virus is a herpes simplex virus (HSV) and the at least one polynucleotide encoding an RNA binding site is inserted into a locus between the UL3 and the UL4 open reading frames ⁇ e.g., Fig. 39 and Fig. 40).
- HSV herpes simplex virus
- the recombinant oncolytic virus comprises at least one polynucleotide encoding a payload molecule that activate or inhances an anti-tumor immune response.
- the payload molecule is a cytokine, a chemokine, an antibody or antigen binding fragment thereof, a bispecific T-cell engager (BiTE).
- the payload molecule is an antibody or antigen binding fragments thereof that bind to and inhibit immune checkpoint receptors ⁇ e.g. CTLA4, LAG3, PDl, PDLl , and others).
- the payload molecule is an anti-PDl antibody or antigen-binding fragement thereof, an anti-PDLl antibody or antigen-binding fragement thereof, or an anti-CTLA4 antibody or antigen-binding fragement thereof.
- the payload molecule is a protein that binds to and activates a cell-surface receptor.
- payload molecule comprises an endogenous cell-surface ligand, such as the extracellular domain of 41BBL, the extracellular domain of CD40L, FLT3L.
- the payload molecule is a cytokine (e.g., IFNy, IFNa, IFNP, TNFa, IL-12, IL-2, IL-6, IL-8, IL-15, GM-CSF, IL-21 , IL-35, TGFP, and others) or chemokine (e.g., CCL4, CXCL10, CCL5, CXCL13, or XCL1).
- cytokine e.g., IFNy, IFNa, IFNP, TNFa, IL-12, IL-2, IL-6, IL-8, IL-15, GM-CSF, IL-21 , IL-35, TGFP, and others
- chemokine e.g., CCL4, CXCL10, CCL5, CXCL13, or XCL1.
- the payload molecule is a protein that binding to and activate an activating receptor (e.g., FcyRI, Fcylla, Fcyllla, costimulatory receptors, and others).
- an activating receptor e.g., FcyRI, Fcylla, Fcyllla, costimulatory receptors, and others.
- the protein is selected from EpCAM, folate, A2A, anti-FGF2, anti-FGFR/FGFR2b, anti-SEMA4D, CD137, CD200, CD38, CD44, CSF-1R, endothelin B Receptor, ISRE7, LFA-1 , NG2 (also known as SPEG4), SMADs, ⁇ , , and VCAM1.
- a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an miRNA, a gene, or a TIMP is inserted into a locus on the viral genome of a recombinant oncolytic virus.
- the polynucleotide is an insulated sequence comprising a synthetic insulator or a native viral (e.g., HSV) insulator.
- the oncolytic virus is a herpes simplex virus and the at least one polynucleotide encoding an RNA binding site is inserted into or between one or more loci including the internal repeat joint region (comprising one copy each of the diploid genes ICP0, ICP34.5, LAT, ICP4, and the ICP47 promoter), ICP0, LAT, UL1, UL5, UL6, UL7, UL8, UL9, UL1 1, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31 , UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICP0, ICP
- the virus is a herpes simplex virus (HSV) and the at least one polynucleotide is inserted into a locus between the UL3 and the UL4 open reading frames (see, e.g., Fig. 39 and Fig. 40).
- HSV herpes simplex virus
- the recombinant oncolytic virus comprises at least one protease-activated antibody.
- protease-activated antibodies such as those described by Metz et al. (Protein Eng Des Sel, 25(10):571-80, 2012) are activated and bind only to targets following protease cleavage of a protective cap.
- tumor microenvironments possess an array of proteases that are well differentiated from surrounding healthy tissues.
- the protease cathepsin B is overexpressed in numerous cancers, including breast, cervix, colon, colorectal, gastric, head and neck, liver, lung, melanoma, ovarian, pancreatic, prostate, and thyroid cancer.
- the human degradome comprised of a complete list of proteases synthesized by human cells, is made up of at least 569 proteases that are distributed into five broad classes (in order from greatest to least number): metalloproteinases (MMPs), serine, cysteine, threonine, and aspartic proteases (Lopez-Otin et al., NatRev Cancer, 7(10):800-8, 2007).
- MMPs metalloproteinases
- protease antibodies specifically cleaved by MMPs can serve as an excellent means of targeting the recombinant viral vectors described herein to the tumor microenvironment, as MMPs are found in the extracellular and pericellular areas of the cell.
- Table 6 summarizes proteases that are overexpressed in cancers which can be exploited to enable specific binding of recombinant viral vectors pseudotyped with protease-activated antibodies.
- the protease-activated antibody is incorporated into the viral glycoprotein envelope.
- Protease-activated antibodies can be incorporated into the glycoprotein envelope of a recombinant viral vector of the invention (e.g., an HSV vector) to increase the therapeutic index and reduce off -target infection.
- a recombinant viral vector of the invention e.g., an HSV vector
- the glycoprotein may be gC or gD.
- the recombinant oncolytic viruses described herein comprise at least one polynucleotide encoding a protease- activated antibody.
- a protease-activated antibody is activated by a protease selected from a cysteine cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin and metalloproteinase (ADAM).
- a protease selected from a cysteine cathepsin, an aspartic cathepsin, a kallikrein (hK), a serine protease, a caspase, a matrix metalloproteinase (MMP), and a disintegrin and metalloproteinase (ADAM).
- a protease is selected from cathepsin K, cathepsin B, cathepsin L, cathepsin E, cathepsin D, hKl, PSA (hK3), hK10, hK15, uPA, uPAR, MMP-1 , MMP-2, MMP- 3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23A, MMP-23B, MMP-24, MMP-25, MMP-26, MMP-27, MMP-28, or a protease listed in Table 6.
- the protease-activated antibody binds a protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments.
- a protease-activated antibody binds NKG2D, c-met, HGFR, CD8, heparan sulfate, VSPG4 (also known as NG2), EGFR, EGFRvIII, CD133, CXCR4, carcinoembryonic antigen (CEA), CLC-3, annexin II, human transferrin receptor, or EpCAM.
- multiple protease activated antibodies may be incorporated into a single viral vector particle to ensure that diverse tumor histotypes are targeted.
- the recombinant oncolytic virus comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more polynucleotides that encodes for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more protease activated antibodies.
- an oncolytic virus comprises a first protease-activated antibody that binds a first protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments, and a second protease-activated antibody that binds a second protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments.
- an oncolytic virus comprises a plurality of protease- activated antibodies binding a plurality of protein expressed more highly by cancer cells or in cancer microenvironments than by non-cancer cells or in non-cancer microenvironments.
- An oncolytic virus comprises, for example, a protease-activated antibody that is a human antibody, a humanized antibody or a chimeric antibody.
- an oncolytic virus comprises an antibody that is a full-length immunoglobulin, an scFv, a Fab, a Fab', an F(ab')2, an Fv, a diabody, a triabody, a minibody, a single-domain antibody, or a multispecific antibody.
- a recombinant oncolytic virus comprises one or more of: one or more micro-RNA (miR) target sequences inserted into a locus of one or more viral genes required for viral replication; one or more polynucleotides encoding one or more proteins or oligonucleotides, wherein the proteins or oligonucleotides reduce the expression or inhibit the function of a miR, a gene, or a TIMP; at least one protease-activated antibody; and/or a polynucleotide encoding at least one protease activated antibody.
- miR micro-RNA
- a recombinant oncolytic virus comprises: a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP.
- a recombinant oncolytic virus comprises: a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or at least one protease-activated antibody.
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP; and/or at least one protease-activated antibody.
- a recombinant oncolytic virus comprises a plurality of copies of one or more miRNA target sequences inserted into a locus of a viral gene required for viral replication in non-cancerous cells; and/or a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a ⁇ ; and/or at least one protease-activated antibody.
- an oncolytic virus described in this paragraph is a herpes simplex virus and the viral gene required for viral replication in non-cancerous cells is UL1, UL5, UL6, UL7, UL8, UL9, UL11, UL12, UL14, UL15, UL17, UL18, UL19, UL20, UL22, UL25, UL26, UL26.5, UL27, UL28, UL29, UL30, UL31, UL32, UL33, UL34, UL35, UL36, UL37, UL38, UL39, UL40, UL42, UL48, UL49, UL52, UL53, UL54, ICPO, ICP4, ICP22, ICP27, ICP47, gamma-34.5, US3, US4, US5, US6, US7, US8, US9, US 10, US11, and US 12.
- the invention relates to a recombinant oncolytic virus comprising a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a TIMP.
- a recombinant oncolytic virus comprises a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and at least one protease-activated antibody.
- a recombinant oncolytic virus comprises a polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a ⁇ ; and at least one protease-activated antibody.
- a recombinant oncolytic virus comprises a first polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of an oncogenic miRNA or an oncogenic gene; and/or a second polynucleotide encoding a protein or an oligonucleotide targeted to reduce expression of a microenvironment remodeling miRNA or a ⁇ ; and/or at least one protease-activated antibody.
- the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3' UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-l-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3' UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; and a third miR-TS cassette inserted into the 3' UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L.
- the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PDl or anti-PDLl antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 843, 844, 847, or 848. In some embodiments, the the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NOs: 843, 844, 847, or 848.
- the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3' UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-l-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3' UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3' UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L.
- the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti- PD1 or anti-PDLl antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 845 or 846.
- the oncolytic virus comprises or consists of the nucleic acid sequence of one of SEQ ID NOs: 845 or 846.
- the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3' UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-l-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3' UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3' UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-208b-3p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3 ' UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-20
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L.
- the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PDl or anti-PDLl antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 850.
- the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 850.
- the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3' UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-l-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3' UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3' UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3' UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-204-5p, and miR-219
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L.
- the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PDl or anti-PDLl antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 849.
- the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 849.
- the oncolytic virus is an HSV virus comprising a first miR-TS cassette inserted into the 3' UTR of ICP4 comprising 4 target sequences for each of miR-124-3p, miR-l-3p, and miR-143-3p; a second miR-TS cassette inserted into the 3' UTR of ICP27 comprising 4 target sequences for each of miR-219a-5p, miR-122-5p, and miR128-3p; a third miR-TS cassette inserted into the 3' UTR of UL8 comprising 4 target sequences for each of miR-137-3p, miR-217-5p, and miR-126-3p; and a fourth miR-TS cassette inserted into the 3' UTR of ICP34.5 comprising 4 target sequences for each of miR-128-3p, miR-204-5p, and miR-219a
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and MMP9. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CXCL10. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding CXCL10 and MMP9.
- the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and XCL1. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and CCL4. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12, CXCL10, and FLT3L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and 41BBL. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding IL-12 and CD40L.
- the oncolytic virus further comprises a polynucleotide sequence encoding 41BBL and CD40L. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-CTLA4 antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus further comprises a polynucleotide sequence encoding an anti-PDl or anti-PDLl antibody or antigen binding fragment thereof. In some embodiments, the oncolytic virus comprises a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 851. In some embodiments, the the oncolytic virus comprises or consists of the nucleic acid sequence of SEQ ID NO: 851. [00241] The invention also encompasses a nucleic acid molecule encoding an oncolytic virus described herein.
- a viral stock comprising an oncolytic virus described herein.
- a viral stock is a homogeneous stock.
- the preparation and analysis of viral stocks is well known in the art. For example, a viral stock can be manufactured in roller bottles containing cells transduced with the viral vector. The viral stock can then be purified on a continuous nycodenze gradient, and aliquotted and stored until needed. Viral stocks vary considerably in titer, depending largely on viral genotype and the protocol and cell lines used to prepare them.
- the titer of a viral stock contemplated herein is at least about 10 5 plaque-forming units (pfu), such as at least about 10 6 pfu or even more preferably at least about 10 7 pfu.
- the titer can be at least about 10 8 pfu, or at least about 10 9 pfu, and high titer stocks of at least about 10 10 pfu or at least about 10 11 pfu are most preferred.
- composition comprising an oncolytic virus or a nucleic acid molecule described herein and a pharmaceutically acceptable carrier.
- pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a subject (e.g., a human).
- composition refers to a formulation of one or more oncolytic virus or a nucleic acid molecules described herein that is capable of being administered or delivered to a subject and/or a cell.
- formulations include all physiologically acceptable compositions including derivatives and/or prodrugs, solvates, stereoisomers, racemates, or tautomers thereof with any physiologically acceptable carriers, diluents, and/or excipients.
- a “therapeutic composition” or “pharmaceutical composition” (used interchangeably herein) is a composition of one or more agents capable of being administered or delivered to a patient and/or subject and/or cell for the treatment of a particular disease or disorder.
- the compositions disclosed herein may be formulated in a neutral or salt form.
- “Pharmaceutically acceptable salt” includes both acid and base addition salts.
- Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor- 10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane- 1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid,
- Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.
- Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2- diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methyl
- Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.
- solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- the formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- solvents dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- pharmaceutically acceptable carrier includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media and/or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans and/or domestic animals.
- Exemplary pharmaceutically acceptable carriers include, but are not limited to, to sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter, waxes, animal and vegetable fats, paraffins, silicones, bentonites, silicic acid, zinc oxide; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen- free water
- compositions Except insofar as any conventional media and/or agent is incompatible with the agents of the present disclosure, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions. [00248] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
- Wetting agents, emulsifiers and lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
- antioxidants examples include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha- tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
- water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
- oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), le
- a composition comprising a carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal or intramuscular administration.
- Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with a viral vector or nucleic acid molecule, use thereof in the pharmaceutical compositions of the invention is contemplated.
- compositions of the invention may comprise one or more polypeptides, polynucleotides, vectors comprising same, infected cells, etc., as described herein, formulated in pharmaceutically-acceptable or physiologically-acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., cytokines, growth factors, hormones, small molecules or various pharmaceutically-active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended therapy.
- compositions of the invention formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.
- solutions are administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective to result in an improvement or remediation of the symptoms.
- the formulations are easily administered in a variety of dosage forms such as ingestible solutions, drug release capsules and the like. Some variation in dosage can occur depending on the condition of the subject being treated. The person responsible for administration can, in any event, determine the appropriate dose for the individual subject.
- preparations meet sterility, general safety and purity standards as required by FDA Center for Biologies Evaluation and Research standards.
- the route of administration will vary, naturally, with the location and nature of the disease being treated, and may include, for example intradermal, transdermal, subdermal, parenteral, nasal, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration.
- Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety).
- the form should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
- polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., vegetable oils
- vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion
- isotonic agents for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- the preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art.
- such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
- the preparation can also be emulsified.
- aqueous solution for parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure.
- one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion (see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition.
- Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the compositions may be delivered by intranasal sprays, inhalation, and/or other aerosol delivery vehicles.
- Methods for delivering polynucleotides and peptide compositions directly to the lungs via nasal aerosol sprays has been described e.g., in U.S. Pat. No. 5,756,353 and U.S. Pat. No. 5,804,212 (each specifically incorporated herein by reference in its entirety).
- the delivery of drugs using intranasal microparticle resins Takenaga et ah, 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No.
- the delivery may occur by use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally mixing with CPP polypeptides, and the like, for the introduction of the compositions of the present invention into suitable host cells.
- the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, a nanoparticle or the like.
- the formulation and use of such delivery vehicles can be carried out using known and conventional techniques.
- compositions of the invention may comprise one or more polypeptides, polynucleotides, and small molecules, as described herein, formulated in pharmaceutically-acceptable or physiologically-acceptable solutions (e.g., culture medium) for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the invention may be administered in combination with other agents as well, such as, e.g., cells, other proteins or polypeptides or various pharmaceutically-active agents.
- a formulation or composition according to the present invention comprises a cell contacted with a combination of any number of polynucleotides or viral vectors, as contemplated herein.
- the present invention provides formulations or compositions suitable for the delivery of viral vector systems.
- Exemplary formulations for ex vivo delivery may also include the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock and various liposome formulations ⁇ i.e., lipid-mediated transfection).
- transfection agents such as calcium phosphate, electroporation, heat shock and various liposome formulations ⁇ i.e., lipid-mediated transfection.
- Liposomes are lipid bilayers entrapping a fraction of aqueous fluid. DNA spontaneously associates to the external surface of cationic liposomes (by virtue of its charge) and these liposomes will interact with the cell membrane.
- Particular embodiments of the invention may comprise other formulations, such as those that are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.
- the present invention provides pharmaceutically acceptable compositions which comprise a therapeutically effective amount of one or more viral vectors or polynucleotides, as described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents ⁇ e.g., pharmaceutically acceptable cell culture medium).
- a "therapeutically effective amount” refers to the amount of a composition or recombinant virus described herein required to achieve a desired physiologic and/or biological outcome.
- a “therapeutically effective amount” of a virus, a viral stock, or a composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the stem and progenitor cells to elicit a desired response in the individual.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the virus or transduced therapeutic cells are outweighed by the therapeutically beneficial effects.
- the term "therapeutically effective amount” includes an amount that is effective to "treat" a subject (e.g., a patient). The therapeutically effective amount may be quantified by the total number of plaque forming units (pfu) ⁇ e.g.
- At least le 1 to at least l e 20 particularly about le 4 to about le 15 , more particularly about le 6 to about le 12 pfu
- number of viral genomes ⁇ e.g. at least l e 1 to at least l e 20 , particularly about le 4 to about l e 15 , more particularly about le 6 to about l e 12 viral genomes.
- the therapeutically effective amount will vary based on the type of virus being administered, nature of the formulation, route of administration, nature and/or severity of the disease to be treated, and/or general health and well-being of the subject.
- Some aspects of the invention encompass a method of killing a cancerous cell, comprising exposing the cancerous cell to an oncolytic virus described herein or compositions thereof under conditions sufficient for the oncolytic virus to infect and replicate within said cancerous cell, and wherein replication of the oncolytic virus within the cancerous cell results in cell death.
- the cancerous cell has a reduced expression of a miR compared to a non-cancerous cell.
- a cancerous cell killed by this method is in vivo.
- a cancerous cell killed by this method is within a tumor.
- the invention relates to a method of treating cancer in a subject in need thereof, comprising administering a prophylactically effective amount or a therapeutically effective amount of an oncolytic virus, a viral stock, or a composition as described herein to the subject.
- a "subject,” as used herein, includes any animal that exhibits a symptom of a disease, disorder, or condition that can be treated with the recombinant viral vectors, compositions, and methods disclosed herein. Suitable subjects (e.g., patients) include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals (such as horse or cow), and domestic animals or pets (such as cat or dog). Non-human primates and, preferably, human patients, are included.
- administering refers herein to introducing an oncolytic virus, a viral stock, or a composition thereof into a subject or contacting an oncolytic virus, a viral stock, or a composition thereof with a cell and/or tissue. Administration can occur by injection, irrigation, inhalation, consumption, electro-osmosis, hemodialysis, iontophoresis, and other methods known in the art.
- the route of administration will vary, naturally, with the location and nature of the disease being treated, and may include, for example auricular, buccal, conjunctival, cutaneous, dental, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-articular, intraarterial, intra-abdominal, intraauricular, intrabiliary, intrabronchial, intrabursal, intracavernous, intracerebral, intracisternal, intracorneal, intracronal, intracoronary, intracranial, intradermal, intradiscal, intraductal, intraduodenal, intraduodenal, intradural, intraepicardial, intraepidermal, intraesophageal, intragastric, intragingival, intrahepatic, intraileal, intralesional, intralingual, intraluminal, intralymphatic, intramammary, intramedulleray, intrameningeal, instramuscular, intran
- treating refers to administering to a subject a therapeutically effective amount of a recombinant virus or composition thereof as described herein so that the subject has an improvement in a disease or condition, or a symptom of the disease or condition.
- the improvement is any improvement or remediation of the disease or condition, or symptom of the disease or condition.
- the improvement is an observable or measurable improvement, or may be an improvement in the general feeling of well-being of the subject.
- a treatment may improve the disease condition, but may not be a complete cure for the disease.
- prophylactically effective amount refers to an amount of a virus, a viral stock, or a composition effective to achieve the desired prophylactic result.
- prophylacticaxis can mean complete prevention of the symptoms of a disease, a delay in onset of the symptoms of a disease, or a lessening in the severity of subsequently developed disease symptoms.
- prophylactically effective amount is less than the therapeutically effective amount.
- Cancer herein refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth.
- Examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, leiomyosarcoma, chordoma, lymphangiosarcoma, lymphangioendotheliosarcoma, rhabdomyosarcoma, fibrosarcoma, myxosarcoma, chondrosarcoma), neuroendocrine tumors, mesothelioma, synovioma, schwannoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies.
- cancers include squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, small cell lung carcinoma, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, testicular cancer, esophageal cancer, tumors of the biliary tract, Ewing's tumor, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary carcinoma, pa
- an oncolytic virus e.g., an HSV
- a viral stock e.g., a viral stock, or a composition as described herein are used to treat a cancer selected from lung cancer (e.g., small cell lung cancer or non-small cell lung cancer), breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer (e.g., hepatocellular carcinoma (HCC)), gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, diffuse large B-cell lymphoma (DLBCL), and marginal zone lymphoma (MZL).
- lung cancer e.g., small cell lung cancer or non-small cell lung cancer
- breast cancer e.g., ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer
- the invention relates to an oncolytic viral vector as shown in any one of the figures or embodiments disclosed herein.
- miRNA sequence profiling of cancer lines and non-cancer control tissue was performed. Sequencing libraries of dicer-processed RNAs were generated for cancer and non-cancer cells, including bladder, colon, breast, pancreas, lung, head and neck, schwannoma, glioblastoma, brain, liver, and bone marrow. These miRNA sequencing libraries were normalized to total RNA, and sequenced using a HiSeq 2500 ultra-high throughput sequencing system with HiSeq V4 chemistry reagents for sequencing reads up to 3e 8 reads/run (Illumina).
- FASTQ files from sequencing runs were analyzed using the miRNAs Analysis tool in Basespace (Illumina). Rankings were made by calculating the mean of normal, the mean of cancer and sorting the ratio of normal/cancer from high to low. Heat maps were generated with natural logarithmic values with zero and negative values converted to zero (scale: black is high, white is low expression). Normalized data across samples were expressed as normalized miRNA read counts in a given sample. Normalization is related to total number of reads in a given sample relative to other samples in the comparison.
- Fig. 1 exemplifies the miRNA expression profile heat map in non-cancerous and cancerous brain tissue of twenty-five miRNAs. Additional examples of miRNA expression profile heat maps are shown for non-cancerous and cancerous bladder (Fig. 2), breast (Fig. 3), colon (Fig. 4), brain (Fig. 5), head and neck (Fig. 6), lung (Fig. 7), pancreas (Fig. 8), and schwannoma (Fig. 9) tissue corresponding to twenty-five miRNAs in each example. Table 12 shows a summary of the expression levels of particular miRs between cancerous and noncancerous tissue.
- miR-451a levels are down regulated in all tumor types compared to non-cancerous tissue, representing a potential pan-tumor suppressor miRNA.
- miR-l-3p is down- regulated in all tumor types tested, present at moderate levels in non-cancerous tissue, and present at high levels in head and neck tissue.
- miR-559 is down-regulated in all tumor types tested, present generally at low levels in non-cancerous tissue, and present at high levels in non-cancerous lung tissue.
- miR-145-5p is down- regulated in all tumor types tested and present generally at high levels in the majority of non-cancerous tissue types tested.
- miR-143-3p is down-regulated in colon, lung, and pancreatic tumors, and is present at high levels in all normal tissue types and some breast tumor lines. miRNA data analysis revealed at least eleven miRNAs that represent novel and unexpected miRNA expression profiles not previously identified in the literature.
- miR-451a miR-l-3p miR-559 miR-145-5p miR-143-3p
- miRNAs are pan- or multi-tumor specific.
- expression of miR-451a, miR-559, miR-l-3p, miR-145-3p, and miR143-3p were generally down-regulated across all cancer cell lines tested compared to control tissues. This was particularly notable for miR-451a, which was highly expressed in all normal tissue type and substantially down-regulated in all cancer types, thus representing a pan-specific tumor- suppressive miRNA.
- the expression of miR-559 was lower in normal tissue types, except for normal lung tissue, and expression of miR-l-3p and mir-145-3p in normal tissue was variable.
- a construct comprising target sequences for miR-124, miR-451a, miR-559, miR-1 , and miR-145-3p may be used in the treatment of all the tumor types tested (e.g., bladder, colon, breast, pancreatic, lung, head and neck, Schwannoma, and glioblastoma).
- the variability in expression levels of miRs in different cancer types indicates the potential need to stratify patients by miR expression or through the use of an additional biomarker.
- Fig. 52A-B peripheral nervous system samples
- miR-204-5p miR-l-3p, miR-206, miR-9-5p, miR-199b-5p, miR-145-5p, miR-100- 5p, miR-574-3p.
- miR-219a-2-3p, miR-9-5, miR-219a-5p, and miR-204-5p are differentially expressed in the spinal cord.
- siRNA screens were performed to test the attenuation phenotype HSV genes.
- An siRNA screen is the ideal modality to test RISC attenuation phenotype of immediate early genes, and select early genes.
- siRNAs targeting the HSV genes ICP27, ICP4, ICP0, UL5, UL8, UL9, ICP8, ULC39/40, ICP22, UL30, UL42, and VP19 were transfected individually and in pools into A253 cells. 24 hours after siRNA transfection, cells were infected with ONCR-003 or ONCR-010 (described below in Table 13), each of which comprise a GFP cassette. Viral spread was measured 48 hours post-infection by quantifying GFP intensity. HSV genes identified as potential hits were validated by Western blots, viral titer measurements, and RT-PCR.
- Fig. 47A and 47B The results of these screen are shown in Fig. 47A and 47B. Individual siRNAs mediating >75% knockdown of the corresponding HSV gene are indicated by arrows in Fig. 47A and GFP intensity for a select subset of the siRNAs are shown in Fig. 47B.
- Fig. 48 siRNA-mediated knockdown of ICP4, UL5, UL8, ICP8, ICP22, and UL30 substantially reduced viral replication of ONCR-003 as indicated by a reduction in GFP intensity.
- siRNA-mediated knockdown of ICP27, ICP4, UL5, UL8, UL9, ICP8, ICP22, and ICP30 substantially reduced viral replication of ONCR-010 as indicated by a reduction in GFP intensity. Cells infected with ONCR-010 were further analyzed by Western blot for expression of particular viral proteins. As shown in Fig. 49, significant reduction in these HSV genes was also observed at the protein level.
- a reporter system was developed to assess miRNA-based gene attenuation using virtually any miRNA target sequence and cognate miRNA.
- the target sequence recognized by miRNAs i.e. hsa-miR-122
- dsGFP de-stabilized green fluorescent protein
- the cognate miRNA was then expressed via a tetracycline (tet) inducible promoter using mCherry as a control for miRNA expression. All expression vectors were cloned into a tet repressible vector pcDNA5 Frt/To that also expresses mCherry (pTF002).
- dsGFP was cloned into cDNA3.1+, generating vector pTF004.
- Attenuation vectors contain four tandem repeats of the reverse complement of the miRNA sequence of interest separated by 8-16 nucleotides. Plasmids were constructed by insertion of synthetically generated oligonucleotides into the 3 'UTR of the dsGFP gene of pTF004 using standard molecular biology techniques.
- HEK293TetR cells were transfected with the miRNA attenuation and reporter expression plasmids (0.15 ⁇ g each, for a total of 0.3 ⁇ g of CMV promotor-containing plasmid) using Lipofectamine 2000 per manufacturers protocol (Invitrogen).
- cells were treated with Tetracycline at 5 ng/ml and allowed to incubate for up to 72 hours. After incubation, GFP and mCherry fluorescence signals were detected daily using a SpectraMax® i3x Minimax multi-mode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with an exposure of 5-6 ms. Fluorescence images were acquired with a GFP (541nm channel) exposure of 10 ms, and an mCherry (713nm channel) of 200-1500ms.
- Fig. 11 exemplifies miR-122 mediated attenuation of GFP expression upon induction of miR-122 expression via tet at 24 hours.
- the control miRNA mimics, miR-184, miR- 34a, and Let7a, do not attenuate GFP levels, nor is GFP attenuation observed in the absence of tet.
- Fig. 11 exemplifies miR-122 mediated attenuation of GFP expression upon induction of miR-122 expression via tet at 24 hours.
- the control miRNA mimics, miR-184, miR- 34a, and Let7a, do not attenuate GFP levels, nor is GFP attenuation observed in the absence of tet.
- Fig. 11 exemplifies miR-122 mediated attenuation of GFP expression upon induction of miR-122 expression via tet at 24 hours.
- the control miRNA mimics, miR-184, miR- 34a, and
- Fig. 12 shows the effect of miR-122, miR-184, miR-34a, and Let7a mimics on attenuation of GFP cassettes with miR-TS cassettes comprising each miR target sequence individually and in cassette combinations of miR-122/Let7a, miR-122/Let7a/miR-34a, or miR-122/Let7a/miR-184. Decreased GFP is only observed when the appropriate miR and cognate target sequence are present together (circled wells).
- Fig. 13 serves as a non-attenuated control and shows mCherry expression as a measure of the expression of the miR- 122, miR- 184, miR-34a, and Let7a mimics.
- Fig. 13 serves as a non-attenuated control and shows mCherry expression as a measure of the expression of the miR- 122, miR- 184, miR-34a, and Let7a mimics.
- FIG. 14 shows the effects of miR- 122, miR- 124, miR- 145, miR- 199, and miR-451 mimic expression on attenuated-GFP cassettes with miR-TS cassettes comprising each miR target sequence individually (circled wells).
- Non-attenuated controls are shown in Fig. 15 and show miR- 122, miR- 124, miR- 145, miR- 199, and miR-451 expression and mCherry expression using each target sequence individually.
- GFP expression in the presence of cognate miR mimics are shown in Fig. 16 - Fig. 26.
- GFP fluorescence is measured at 72 hours post-transfection.
- insertion of the indicated miR target sequences resulted in attenuated GFP expression when the cognate miRs were also expression.
- the effects of insertion of miR- 122 and miR- 184 target sequences (Fig. 16), miR-34a and miR- 184 target sequences (Fig. 17), Let- 7a and miR- 184 target sequences (Fig. 18), miR- 124 and miR- 184 target sequences (Fig. 19), miR- 145 and miR- 184 target sequences (Fig.
- miR-199 and miR-451 target sequences Fig. 21
- miR- 125 and miR-451 target sequences Fig. 22
- miR-126 and miR-451 target sequences Fig. 23
- miR-127 and miR-451 target sequences Fig. 24
- miR-133 and miR-451 target sequences Fig. 25
- miR-223 and miR-451 target sequences Fig. 26
- HSV-based viruses comprising miR-TS cassettes were generated.
- a series of modifications were made in KOS-37 BAC, a full-length genomic clone of the KOS strain of HSV-1 on a bacterial artificial chromosome (BAC) as described (Mazzacurati et al., Mol Ther., 2015).
- the product, KG BAC was deleted for the internal repeat (joint) region containing one copy each of the diploid genes ICPO, ICP34.5, LAT and ICP4 along with the promoter for the ICP47 gene.
- KG BAC also contains the GFP open reading frame (ORF) fused to the glycoprotein C (gC) ORF via a 2A peptide sequence to allow monitoring of late (post- replication) viral gene expression.
- ORF GFP open reading frame
- gC glycoprotein C
- KG BAC contains a pair of mutations in the gB gene shown to enhance HSV entry through non-canonical receptors (See e.g., International PCT Publication No. WO 2011/130749).
- a miR-TS cassette comprising 4 repeats of a target sequence for miR-124-3p were recombined into the 3' UTR of ICP4 to generate the 2A5B vector See e.g., International PCT Publication No. WO 2015/066042), and an expression cassette for MMP9 was inserted into the intergenic region between the UL3 and UL4 genes to generate the 2A5B-MMP9 vector (ONCR-003).
- Additional miRNA target sequence cassettes were recombined into the 3' UTR of the ICP4, ICP27, UL8, UL42, and/or ICP34.5 genes of ONCR-003 to generate the constructs shown in Table 13 below. All BAC constructs were converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero- Cre cells. Following plaque purification, virus stocks were prepared and titered on Vero cells.
- HSV particles were tested in the following in vitro assay. On day one, for each cell type infected, HSV particles were introduced to achieve a multiplicity of infection (moi) of 0.01. On days two through five, viral infectivity was assayed by GFP detection using a SpectraMax® i3x Minimax multi-mode microplate reader (Molecular Devices) and analyzed using Softmax Pro or Metamorph imaging software (Molecular Devices). Phase images were acquired with an exposure of 5-6 ms. Fluorescence images were acquired with a GFP (541 nm channel) exposure of 10 ms and an mCherry (713 nm channel) exposure of 200-1500 ms to evaluated any potential nonspecific autofluorescence signal.
- mCherry 713 nm channel
- ONCR-011 replication was significantly attenuated in post-mitotic lung tissue due to the presence of the miR-T125 cassette in the ICP27 gene and high levels of miR-125a (>3000 counts, Table 14 below) in these cells, as shown in Fig. 27A (read out by GFP positive cell quantitation) and Fig. 27C (read out by quantitative PCR).
- ONCR-011 and the control virus ONCR-003, contain miR-124 target sequences in the ICP4 gene, miR-124 is present at low levels ( ⁇ 100 counts, Table 14 below) which were insufficient to attenuate viral replication (Fig. 27B and Fig. 27D).
- Both ONCR-011 and ONCR-003 replicated freely in head and neck cancer cells (A253) because these cells contain low levels of both miR-125a and miR-124 ( ⁇ 100 counts) (Table 14).
- Fig. 28 shows replication of a miR-145 attenuated construct, ONCR-013, in
- HCC1395 and A253 cells As shown in Fig. 28A (read out by GFP positive cell quantitation) and Fig. 28B (read out by quantitative PCR), replication of ONCR-013 was significantly attenuated in HCC1395 cells, but not in A253 cells due to the high expression of miR-145 in A253 and absence of expression in HCC1395 cells (Table 15).
- Fig. 29 shows attenuation of a miR-143-3p attenuated construct (ONCR-
- Fig. 29A read out by GFP positive cell quantitation
- Fig. 29B read out by quantitative PCR
- RNA total RNA, including the small RNA fraction, were isolated from growing cells with miRNeasy columns. The RNA was then used as the substrate for miR-122 and miR-125 specific TaqMan assays, and a parallel TaqMan assay for the U6 snRNA was performed to normalize expression levels per cell type per the AACT method.
- the data are represented as a fold change relative to lowest cell line in question in each assay (A253 cells, Fig. 30A; Hep3B, Fig. 30B). As shown, A253 cells do not express miR-122 or miR- 125a. Hep3B cells express high levels of miR- 125 and low levels of miR-122, and Huh7 cells express miR- 125a and high levels of miR-122.
- Viral infectivity and replication was assessed in an in vitro assay. Briefly, cells were plated at 45,000 cells/well in a 48-well dish and cultured overnight. On day one HSV particles were introduced into each cell type to achieve a multiplicity of infection (moi) of 0.01. 48 hours post-infection, viral infectivity was assessed by fluorescence microscopy. The results of this experiment are shown in Fig. 30C, and viral replication is indicated by eGFP levels.
- Viral spread and protein expression were also assessed. Briefly, cell lysates were harvested 72 hours post- infection and subjected to PAGE and Western blot analysis. An anti- HSV1 capsid (VP5) antibody was used to monitor viral spread/protein expression and B-actin antibody was used as a loading control. In A253 cells, where there is no miR- 125a or miR-122 expression, a level of high viral replication was observed in all of the miR-attenuated viruses (Fig. 31, lanes 3 - 6) as compared to the non-attenuated control (Fig. 31, ONCR-003 as non-attenuated control). However, viral replication was reduced in Huh7 cells, which express both cognate miRNAs and especially high levels of miR-122. These data exemplify viral attenuation by specific miRs relative to control virus.
- A253 cells which do not express endogenous miR-122 or miR- 125a, were transfected with miR-122 and miR- 125a mimics. Briefly, A253 cells were plated at 35,000 cells/well in a 48 well dish and cultured overnight. The cells were then transfected with Ambion miRNA mimics at 2.5 pM/well with Lipofectamine RNAiMAX. Total RNA, including the small RNA fraction, were isolated from growing cells with miRNeasy columns.
- RNA samples wereused as the substrate for miR-122 and miR- 125 specific TaqMan assays, and a parallel TaqMan assay for the U6 snRNA was performed to normalize expression levels per cell type per the AACT method.
- the results are shown in Fig. 32.
- miR-122 and miR-125 mimics specifically increased intracellular miR- 122 and miR-125 expression levels in A253 cells by orders of magnitude.
- eGFP expressed by productive viral infection was assessed by fluorescence microscopy images taken 48 hrs postinfection. All images were exposed and processed identically. The results of this experiment are shown in Fig. 32C and are quantified by GFP detection using a SpectraMax® i3x Minimax multi- mode microplate reader (Molecular Devices) and analyzed using Softmax Pro in Fig. 32D.
- miR-target sequence cassettes were generated for insertion into particular HSV genes. miR target sequences exhibiting differential expression between cancerous and non-cancerous cells of different tissue types were selected to generate cassettes that are capable of attenuating viral replication in a broad variety of healthy cells, while allowing viral replication in cancerous cells where expression of the cognate miRs is decreased.
- This examples illustrates a method of generating candidate miR-TS cassettes and selected preferred candidates from the list.
- the method implemented in the computer language Python, is depicted in FIG. 1.
- the inputs for the method include a list of seeds for exclusion— in this example, seed sequences for miRNAs that are expressed in cancers were excluded— and a list of miR-TSs to include in the cassette.
- the included miR-TSs used in this example are provided in Table 10, along with the parent miRNA sequence and length in nucleotides (nt) of each. miR-TSs tolerate imperfect matches between the microRNA and the miR- TS, so it will be understood that cassettes can be made with imperfect miR-TSs.
- miR-TS cassettes can be made with other miR-TSs, include miR-TSs based on any of the microRNAs known in the art or prospectively discovered.
- miR-TS cassettes one for each of four essential viral genes: ICP4, ICP27, ICP34.5, and UL8, as shown in Table 16. But in priniciple these cassettes could be used with other viral (or non-viral) genes. Because the viral genes are in the reverse complementary orientation in our favored vectors, in each case the reverse complementary sequence was used.
- the abbreviation "miR-126m” refers to a version of the miR- 126 site mutagenized to improve the site by removing a seed match for the oncomiR miR-155.
- miR-128m refers to a version of the miR-128 site mutagenized to improve the site by removing a seed match for the oncomiR miR-27a-3p.
- the cassette designed for ICP4 can be used to down-regulate any gene, to which it is operatively linked, in smooth muscle (because of miR-143 target site) and striated muscale (because of miR-1 target site).
- the cassette designed for ICP27 can be used to down- regulate any gene, to which it is operatively linked, in healthy tissue because of miR-128m (expressed in cortical neurons), miR-122 (expressed in the liver), and miR-219 (expressed in the brain, spine and nerves) target sites.
- the cassette designed for ICP27 can be used to down-regulate any gene, to which it is operatively linked, in healthy tissue because of miR-128m, miR-204, and miR-219 target sites.
- the cassette designed for UL8 can be used to down-regulate any gene, to which it is operatively linked, in non-tumor tissue because of the mRNA target sites: miR-217, miR-137, and miR-126m.
- the program was run, outputting 10,000-100,000 cassettes for each combination which match the criteria used for list example (each of which is optional): (1) four copies of each miR-TS sites (in reverse-complementary orientation) arranged in a random order; (2) except that the same miR-TS cannot repeat adjacent to itself; (3) seperated by 4 nucleotide spacers having random sequence; (4) no seeds from the excluded seed list; and (4) no polyadenylation sequence (AATAAA).
- the program also can, optionally, add 5' arm (CAT GGAC GAGCT GTACAAGTAAAGC ) and 3' arm (GCGACCGGCTAGCGTACTAGCTTAG) sequences for Gibson assembly cloning (Nat Methods 2009;6(5):343-5).
- the program next calculated a delta-G for folding of the candidate sequences using the "fold" subroutine of the ViennaRNA package (Lorenz et al. Algorithms for Molecular Biology, 6: 1 26, 2011 ; available at https://www.tbi.univie.ac.at/RNA/) with a 40 nt sliding window.
- the values for this sliding window calculation were stored as a list for each candidate sequence, and the candidate sequences are sorted by the maximum value of the absolute values of all delta-G values in the list (i.e., by the folding energy of the strongest secondary- structure element in the RNA). Sequences were further reviewed manually to eliminate candidate sequences with multiple, lower energy minima. Whenever possible, a candidate sequence with no local minima was chosen. In this manner, candidate sequences were identified in which there are no strong RNA secondary structure (low max of abs of delta-G) and also no local minima, or few local minima, in predicted secondary-structure folding energy.
- a microRNA target scanning algorithm (miranda v3.3a) was run on each candidate sequence to ensure that the desired miR-TSs were present and that no undesirable miR-TS were inserted by the program.
- Example sequences generated by this method are provided in Table 17.
- Table 18 HSV constructs comprising candidate miR-TS cassettes
- M comprises a modified target sequence
- ONCR-133 construct comprising an ICP4 miR-TS cassette comprising 4 repeats of miR-124-3p and an expression cassette encoding murine IL-12 was administered to mice in an MC38 tumor model.
- ONCR-133 significantly inhibited tumor growth of injected tumors compared to vehicle treated controls (p ⁇ 0.0001).
- ONCR-133 treatment also significantly inhibited tumor growth of non-injected tumors (p ⁇ 0.005), indicating an enhanced abscopal effect.
- mice treated with ONCR-133 + ONCR-007 demonstrated a significant inhibition of tumor growth compared to vehicle treated controls.
- ONCR-133 + ONCR-007 an HSV construct expressing ULBP3
- ONCR-133 + ONCR-002 an HSV construct that does not express any additional payload molecules
- mice treated with ONCR-153 demonstrated an increase in tumor growth inhibition in the injected tumors and in the non-injected tumors compared to treatment with ONCR-133, whereas ONCR-151 or -152 demonstrated a slight decrease in efficacy compared to treatment with ONCR-133.
- Tumors from mice treated with ONCR-153 were harvested and assessed for the presence of HSV by RT-PCR analysis of the gD gene. As shown in Fig. 59A and Fig 59B, HSV was detected in the injected tumors, but not in the non- injected tumors, indicating that the tumor growth inhibition observed in the non-injected tumors was not due to viral spread, but rather the abscopal effects of virus administration. Tumors were also assessed for the presence of the three payloads, IL-12, CXCL10, and CCL4. As shown in Fig. 60A-60C, payload expression peaked in the injected tumors at 24-hours post-treatment and decreased thereafter. Levels of the payloads were also assessed in the serum (Fig.
- HSV-based viral stocks may be generated that are attenuated by incorporating one or more miRNA target sequences into UL19, ICP4, ICP27, or UL42 (or other viral genes) as shown in FIGs. 39-50.
- genome- editing capabilities for tumor destruction and/or microenvironment remodeling are engineered into the virus in addition to miRNA target sequences, as shown in FIGs. 45-46.
- an HSV-based stock containing miR-124, miR-451a, miR-143-3p, and miR-559 attenuation cassettes incorporated into ICP4 and ICP27 is used.
- an HSV-based stock containing attenuation cassettes with one or more copies of miR-122 and miR-125a target sequences incorporated into ICP27 and/or UL42 genes is generated according to the methods described in Example 3.
- the miRNA target sequence cassettes are introduced into the 3' UTR of the ICP4, ICP27UL19, and/or UL42 genes.
- BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells. Following plaque purification, virus stocks are further purified, buffer exchanged, and titered on Vero cells.
- HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents.
- PBS phosphate buffered solution
- 10 9 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion.
- the patient is monitored for tumor regression using standard of care procedures at an appropriate time interval based on that patient's particular prognosis.
- a patient suffering from brain cancer, bladder cancer, breast cancer, or head and neck cancer is treated using the compositions and methods disclosed herein.
- An HSV-based viral stock is generated containing miR-124, miR-451a, miR-145-3p, and miR-559 attenuation cassettes according to the methods described in Example 3.
- the miRNA target sequence cassettes are introduced into the 3' UTR of the ICP4 (miR-124) and ICP27 (miR-451a, miR-145-3p, miR- 559) genes as shown in FIG. 48.
- BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells.
- virus stocks are further purified, buffer exchanged, and titered on Vero cells.
- HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents.
- PBS phosphate buffered solution
- 10 9 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion.
- the patient is monitored using standard of care procedures at an appropriate time interval based on that patient's particular prognosis. Potential outcomes of these experiments include partial or complete inhibition of tumor growth, inhibition of tumor metastasis, prolonged time in remission, and/or reduced rate of relapse compared to standard of care therapies.
- a patient suffering from schwannoma is treated using the compositions and methods disclosed herein.
- An HSV- based viral stock is generated containing miR-124-3p, miR- 205-5p, miR-141-5p, and miR-31-5p attenuation cassettes according to the methods described in Example 3.
- the miRNA target sequence cassettes were recombined into the 3' UTR of the ICP4 (miR-124) and ICP27 (miR-205-5p, miR-141-5p, miR-31-5p) genes as shown in FIG. 49.
- BAC constructs are converted to virus particles with simultaneous removal of the BAC sequences located between loxP sites by transfection of Vero-Cre cells.
- HSV particles are prepared in phosphate buffered solution (PBS) along with pharmaceutically acceptable stabilizing agents.
- PBS phosphate buffered solution
- 10 9 vector genomes in a volume of 1.0 mL pharmaceutically acceptable carrier are administered via intra-tumoral infusion.
- the patient is monitored using standard of care procedures at an appropriate time interval based on that patient's particular prognosis. Potential outcomes of these experiments include partial or complete inhibition of tumor growth, inhibition of tumor metastasis, prolonged time in remission, and/or reduced rate of relapse compared to standard of care therapies
- Table 1 Summary of relationships between 12 select oncomiRs (9 tumor suppressors and 3 oncogenic miRNAs) and various cancers
- adrenal cortical carcinoma X anaplastic astrocytoma X
- glioma X X X X X X X head and neck cancer Down-regulated Up-regulated miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR- miR-
- T cell lymphoblastic lymphoma X T cell lymphoblastic lymphoma X
- mir-335 mir-339-5p
- mir-33b mir- 34a, mir-34b, mir-34c, mir-374a, mir- 379, mir-381, mir-383, mir-425, mir-429,
- mir-450b-3p mir-494, mir-495, mir-497,
- chondrosarcoma let-7a mir-100, mir-136, mir-145, mir- 199a, mir-222, mir-30a, mir-335, mir- 376a
- pancreatic mir-203, mir-301a pancreatic mir-203, mir-301a
- mir-20a, mir-20a-5p mir-21, mir-210, mir-211, mir-221, mir-223, mir-224, mir-23a, mir-25, mir-27a, mir-29a, mir-301a, mir-31, mir-32, mir-320b, mir-326, mir- 424, mir-429, mir-494, mir-497, mir-499-5p, mir-592, mir-630, mir-720, mir-892a, mir-92, mir-92a, mir-93, mir-95, mir-96
- mir-146b papillary thyroid let-7e, mir-146b, mir-146b-5p, mir-151-5p, mir-155, mir-181a-l, mir-181a-2, mir- carcinoma 181b-l, mir-181b-2, mir-181c, mir-181d, mir-182, mir-183, mir-199b-5p, mir-21, mir- 221, mir-222, mir-339-5p, mir-34a
- mir-100 esophageal squamous mir-100, mir-1179, mir-1290, mir-130b, mir-145, mir-16, mir-17, mir-183, mir-18a, cell carcinoma mir-19a, mir-19b, mir-208, mir-20a, mir-21, mir-218, mir-223, mir-25, mir-30a-5p, mir-31, mir-330-3p, mir-373, mir-9, mir-92a, mir-942
- mir-106a mir-145, mir-155, mir-182, mir-200b, mir-200c, mir-205, mir-21, mir-222- 3p, mir-25, mir-93
- mir-106a mir-141, mir-148b, mir-181b, mir-182, mir-200a, mir-200c, mir-205, mir- 20a, mir-21, mir-210, mir-214, mir-221, mir-224-5p, mir-23b, mir-25, mir-26a, mir- 27a, mir-27b, mir-346, mir-378, mir-424, mir-503, mir-572, mir-9, mir-96 glioma mir-106b, mir-106b-5p, mir-lOb, mir-125b, mir-132, mir-155, mir-17, mir-181a, mir- 182, mir-183, mir-193b, mir-19a, mir-19b, mir-20a, mir-210, mir-214, mir-221, mir- 222, mir-224, mir-23a, mir-24, mir-24-3p, mir-25, mir-26a, mir-27a-3p, mir-27b, mir- 30a-5p, mir-30e, mir-30e*, mir-328, mir
- mir-106b hepatocellular mir-106b, mir-lOb, mir-122, mir-1228, mir-1269, mir-128a, mir-130a, mir-130b, mir- carcinoma 146a, mir-153, mir-155, mir-17-5p, mir-181a, mir-181a-l, mir-181a-2, mir-181b, mir- 181b-l, mir-181b-2, mir-181c, mir-181d, mir-182, mir-183, mir-184, mir-190b, mir- 191, mir-20a, mir-20b, mir-21, mir-210, mir-214, mir-215, mir-216a, mir-217, mir- 221, mir-222, mir-223, mir-224, mir-23a, mir-24, mir-25, mir-27a, mir-301a, mir-30d, mir-31, mir-3127, mir-32, mir-331-3p, mir-362-3p, mir-362-5p, mir-371-5p, mir-372, mir-373, mir-423, mir
- mir-106b medulloblastoma mir-106b, mir-17, mir-18a, mir-19a, mir-19b, mir-20a, mir-30b, mir-30d, mir-92 pituitary carcinoma mir-106b, mir-122, mir-17-5p, mir-20a, mir-493
- cervical cancer mir-lOa mir-155, mir-181a, mir-181b, mir-196a, mir-19a, mir-19b, mir-205, mir-20a, mir-21, mir-215, mir-224, mir-31, mir-494, mir-590-5p, mir-92a, mir-944
- mir-lOb mir-125a, mir-135a, mir-140, mir-141, mir-142, mir-150, mir-155, mir-17, mir-17-5p, mir-181a, mir-181b, mir-182, mir-18a, mir-18b, mir-191, mir-196a, mir- 197, mir-19a, mir-19b, mir-200a, mir-200b, mir-200c, mir-203, mir-205, mir-20a, mir- 20b, mir-21, mir-217, mir-221, mir-222, mir-224, mir-23a, mir-24, mir-24-2-5p, mir- 24-3p, mir-27a, mir-29a, mir-29b-l, mir-29b-2, mir-29c, mir-373, mir-378, mir-423, mir-429, mir-495, mir-503, mir-510, mir-520c, mir-526b, mir-96
- mir-lOb glioblastoma mir-lOb, mir-125b, mir-127-3p, mir-148a, mir-18a, mir-196a, mir-196a-l, mir-196a-2, mir-196b, mir-21, mir-210, mir-210-3p, mir-223, mir-340, mir-576-5p, mir-626, mir- 92b
- mir-lOb nasopharyngeal mir-lOb, mir-144, mir-149, mir-155, mir-18a, mir-21, mir-214, mir-24, mir-421, mir- carcinoma 663, mir-744, mir-93
- non-small cell lung mir-lOb mir-125a-5p, mir-1280, mir-136, mir-140, mir-141, mir-142-3p, mir-145, cancer mir-146a, mir-150, mir-18a, mir-196a, mir-19a, mir-200a, mir-200c, mir-205, mir- 205-3p, mir-205-5p, mir-21, mir-212, mir-22, mir-221, mir-222, mir-24, mir-25, mir- 29c, mir-31, mir-328, mir-330-3p, mir-339, mir-34a, mir-375, mir-494, mir-675-5p, mir-9, mir-92b, mir-93, mir-95
- pancreatic ductal mir-lOb mir-186, mir-18a, mir-192, mir-194, mir-196a, mir-198, mir-203, mir-21, adenocarcinoma mir-212, mir-30b-5p, mir-31, mir-34a, mir-369-5p, mir-376a, mir-541
- mir-141 prostate cancer mir-125b, mir-141, mir-153, mir-155, mir-181a-l, mir-181a-2, mir-181b, mir-181b-l, mir-181b-2, mir-181c, mir-181d, mir-182, mir-182-5p, mir-183, mir-18a, mir-204, mir-20a, mir-21, mir-221, mir-223-3p, mir-31, mir-429, mir-96 mesenchymal cancer mir-125b-l-3p, mir-182
- osteosarcoma mir-128, mir-151-3p, mir-17, mir-181a, mir-181b, mir-181c, mir-18a, mir-191, mir- 195-5p, mir-199a-3p, mir-19a, mir-19b, mir-20a, mir-21, mir-210, mir-214, mir-221, mir-27a, mir-300, mir-320a, mir-374a-5p, mir-802, mir-9, mir-92a
- mir-148a squamous carcinoma mir-137, mir-155, mir-184, mir-196a, mir-203, mir-21, mir-221, mir-27a, mir-34a chordoma mir-140-3p, mir-148a
- mir-196a mir-199a-3p, mir-199a-5p, mir-199b-3p, mir-200a, mir-223 adenocarcinoma
- pancreatic mir-203, mir-301a pancreatic mir-203, mir-301a
- nasopharyngeal cancer mir-218, mir-223, mir-29c
- oral cancer let-7d mir-218, mir-34a, mir-375, mir-494
- oral squamous cell carcinoma mir-100, mir-124, mir-1250, mir-125b, mir-126, mir-1271, mir-136, mir- 138, mir-145, mir-147, mir-148a, mir-181a, mir-206, mir-220a, mir-26a, mir-26b, mir-29a, mir-32, mir-323-5p, mir-329, mir-338, mir-370, mir- 410, mir-429, mir-433, mir-499a-5p, mir-503, mir-506, mir-632, mir-646, mir-668, mir-877, mir-9
- osteosarcoma let-7a mir-1, mir-100, mir-101, mir-122, mir-124, mir-125b, mir-126, mir-127-3p, mir-132, mir-133a, mir-141, mir-142-3p, mir-142-5p, mir- 143, mir-144, mir-145, mir-153, mir-16, mir-183, mir-194, mir-195, mir- 199a-3p, mir-204, mir-212, mir-217, mir-218, mir-22, mir-23a, mir-24, mir-26a, mir-26b, mir-29b, mir-32, mir-320, mir-335, mir-33b, mir-340, mir-34a, mir-34b, mir-34c, mir-375, mir-376c, mir-382, mir-3928, mir- 424, mir-429, mir-449a, mir-451, mir-454, mir-503, mir-519d, mir-646 ovarian cancer let-7i, mir-100, mir-124, mir-125b
- MMP-16 Colon cancer Invasion - miR-149 MMP-2 and CyclinD l Glioma Proliferation and invasion AKT signaling miR-152 MMP-3 Glioma Cell invasiveness MEK-ERK pathway miR-181b MMP-2 and MMP-9 Hepatocellular Migration and invasion TGF- ⁇ , Smad signaling carcinomas
- miR-206 MMP-2 and MMP-9 Breast cancer Invasion and migration - miR-211 MMP-9 Glioblastoma Cell invasion and - multiforme migration
- miR-218 MMP-9 Gliomas Cell invasiveness ⁇ - ⁇ /NF-KB pathway miR-224 MMP-9 via targeting Human hepatocellular Migration and invasion - HOXD10 carcinoma
- miR-338-3p SMO and MMP-9 Hepatocellular Invasion and metastasis - carcinoma
- let-7i mir-100; mir-101; mir-126; mir-142-3p; mir-143; mir-145; mir-192; mir- 200c; mir-21 ; mir-214; mir-215; mir-22; mir-25; mir-302a; mir-320; mir-320a; mir-34a; mir-34c; mir-365; mir-373; mir-424; mir-429; mir-455; mir-484; mir- 502; mir-503; mir-93; mir-98; mir-186; mir-30a-5p; mir-627; let- 7a; mir-1; mir- 124; mir-125a; mir-129; mir-1295b-3p; mir-1307; mir-130b; mir-132; mir- 133a; mir-133b; mir-137; mir-138; mir-139; mir-139-5p; mir-140-5p; mir-148a; mir-148b; mir-149; mir-150-5p; mir-154; mir-15a; mir-15b; mir-16; mir-18a; mir-191
- mir-101 Endometrial mir-101 ; mir-130a; mir-130b; mir-134; mir-143; mir-145; mir-152; mir-205;
- mir-125b Hematologic mir-125b; mir-138; mir-15a; mir-15b; mir-16; mir-16-1; mir-16-l-3p; mir-16-2; (Leukemia, mir-181a; mir-181b; mir-195; mir-223; mir-29b; mir-34b; mir-34c; mir-424;
- mir-lOa mir-146a; mir-150; mir-151; mir-155; mir-2278; mir-26a; mir-30e; Cancer miRNA
- Lymphoma mir-31; mir-326; mir-564; mir-27a; let- 7b; mir-124a; mir-142-3p; let-7c; mir- Myeloma) 17; mir-20a; mir-29a; mir-30c; mir- 720; mir- 107; mir-342; mir-34a; mir-202;
- mir-142-5p mir-29c; mir-145; mir-193b; mir-199a; mir-214; mir-22; mir-137; mir- 197
- mir-381 mir-409-3p; mir-429; mir-451; mir-511 ; mir-99a; let-7a-l; let-7a-2; let-7a-3; let-7b; let-7c; let-7d; let-7e; let-7f-l; let-7f-2; let-7g; let-7i; mir-1; mir- 101; mir-133b; mir-138; mir-142-5p; mir-144; mir-1469; mir-146a; mir-153; mir- 15a; mir-15b; mir- 16-1 ; mir- 16-2; mir- 182; mir- 192; mir-193a-3p; mir- 194; mir-195; mir-198; mir-203; mir-217; mir-218; mir-22; mir-223; mir-26a; mir-26b; mir-29c; mir-33a; mir-34a; mir-34b; mir-34c; mir-365; mir-449a; mir- 449b; mir-486-5p; mir-545; mir-610; mir-614
- mir-361-3p mir-373; mir-375; mir-4500; mir-4782-3p; mir-497; mir-503; mir- 512-3p; mir-520a-3p; mir-526b; mir-625*; mir-96
- mir-7d mir-218; mir-34a; mir-375; mir-494; mir-100; mir-124; mir-1250; mir- 125b; mir-126; mir-1271; mir-136; mir-138; mir-145; mir-147; mir-148a; mir- 181a; mir-206; mir-220a; mir-26a; mir-26b; mir-29a; mir-32; mir-323-5p; mir- 329; mir-338; mir-370; mir-410; mir-429; mir-433; mir-499a-5p; mir-503; mir- 506; mir-632; mir-646; mir-668; mir-877; mir-9
- Ovarian let-7i mir-100; mir-124; mir-125b; mir-129-5p; mir-130b; mir-133a; mir-137;
- pancreatic mir-101 ; mir-1181 ; mir-124; mir-1247; mir-133a; mir-141; mir-145; mir-146a;
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18837388.0A EP3658165A4 (en) | 2017-07-26 | 2018-07-26 | ONCOLYTIC VIRAL VECTORS AND THEIR USES |
| RU2020108004A RU2771110C2 (ru) | 2017-07-26 | 2018-07-26 | Онколитические вирусные векторы и их применение |
| CN201880057565.XA CN111212656B (zh) | 2017-07-26 | 2018-07-26 | 溶瘤病毒载体及其用途 |
| BR112020001559-8A BR112020001559A2 (pt) | 2017-07-26 | 2018-07-26 | vetores virais oncolíticos e usos dos mesmos |
| AU2018306455A AU2018306455A1 (en) | 2017-07-26 | 2018-07-26 | Oncolytic viral vectors and uses thereof |
| CA3070299A CA3070299A1 (en) | 2017-07-26 | 2018-07-26 | Oncolytic viral vectors and uses thereof |
| KR1020207005429A KR20200042904A (ko) | 2017-07-26 | 2018-07-26 | 종양용해성 바이러스 벡터 및 그의 용도 |
| SG11202000691XA SG11202000691XA (en) | 2017-07-26 | 2018-07-26 | Oncolytic viral vectors and uses thereof |
| JP2020504236A JP7249323B2 (ja) | 2017-07-26 | 2018-07-26 | 腫瘍溶解性ウイルスベクター及びその使用 |
| US16/633,653 US11612625B2 (en) | 2017-07-26 | 2018-07-26 | Oncolytic viral vectors and uses thereof |
| MX2020000993A MX2020000993A (es) | 2017-07-26 | 2018-07-26 | Vectores virales oncolíticos y usos de estos. |
| IL271993A IL271993A (en) | 2017-07-26 | 2020-01-12 | Viral vectors of cell lysis and their uses |
| US18/165,770 US12208126B2 (en) | 2017-07-26 | 2023-02-07 | Oncolytic viral vectors and uses thereof |
| JP2023043321A JP7652823B2 (ja) | 2017-07-26 | 2023-03-17 | 腫瘍溶解性ウイルスベクター及びその使用 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762537359P | 2017-07-26 | 2017-07-26 | |
| US62/537,359 | 2017-07-26 | ||
| US201862686802P | 2018-06-19 | 2018-06-19 | |
| US62/686,802 | 2018-06-19 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/633,653 A-371-Of-International US11612625B2 (en) | 2017-07-26 | 2018-07-26 | Oncolytic viral vectors and uses thereof |
| US18/165,770 Continuation US12208126B2 (en) | 2017-07-26 | 2023-02-07 | Oncolytic viral vectors and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019023483A1 true WO2019023483A1 (en) | 2019-01-31 |
Family
ID=65040409
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/043938 Ceased WO2019023483A1 (en) | 2017-07-26 | 2018-07-26 | ONCOLYTIC VIRAL VECTORS AND USES THEREOF |
Country Status (13)
| Country | Link |
|---|---|
| US (2) | US11612625B2 (https=) |
| EP (1) | EP3658165A4 (https=) |
| JP (2) | JP7249323B2 (https=) |
| KR (1) | KR20200042904A (https=) |
| CN (1) | CN111212656B (https=) |
| AU (1) | AU2018306455A1 (https=) |
| BR (1) | BR112020001559A2 (https=) |
| CA (1) | CA3070299A1 (https=) |
| IL (1) | IL271993A (https=) |
| MX (1) | MX2020000993A (https=) |
| RU (1) | RU2771110C2 (https=) |
| SG (1) | SG11202000691XA (https=) |
| WO (1) | WO2019023483A1 (https=) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10391132B2 (en) | 2016-01-27 | 2019-08-27 | Oncorus, Inc. | Oncolytic viral vectors and uses thereof |
| WO2020113151A1 (en) * | 2018-11-29 | 2020-06-04 | Virogin Biotech Canada Ltd | Hsv vector with reduced neurotoxicity |
| CN111235274A (zh) * | 2020-01-18 | 2020-06-05 | 山西医科大学第一医院 | 喉鳞癌血清外泌体标志物筛选方法和外泌体来源miR-941应用 |
| WO2020180864A1 (en) * | 2019-03-05 | 2020-09-10 | Amgen Inc. | Use of oncolytic viruses for the treatment of cancer |
| CN113583977A (zh) * | 2020-04-30 | 2021-11-02 | 杭州康万达医药科技有限公司 | 可受微小rna调控的分离的重组溶瘤痘病毒及其应用 |
| WO2021211902A3 (en) * | 2020-04-15 | 2022-03-03 | Humane Genomics | Artificial oncolytic viruses and related methods |
| JP2022535039A (ja) * | 2019-05-30 | 2022-08-04 | 伍沢堂 | 組換え腫瘍溶解性ウイルスとその調製方法、使用および医薬品 |
| JP2022543610A (ja) * | 2019-08-05 | 2022-10-13 | ヴァイロジン バイオテック カナダ リミテッド | 遺伝子改変エンテロウイルスベクター |
| US11505607B2 (en) * | 2020-11-13 | 2022-11-22 | Binhui Biopharmaceutical Co., Ltd. | Bispecific single-chain antibody, recombinant oncolytic virus for expressing same and virus composition |
| US11612625B2 (en) | 2017-07-26 | 2023-03-28 | Oncorus, Inc. | Oncolytic viral vectors and uses thereof |
| EP4170022A1 (en) * | 2021-10-19 | 2023-04-26 | Consejo Superior De Investigaciones Científicas | Recombinant african swine fever virus and uses thereof |
| WO2024054293A1 (en) * | 2022-09-08 | 2024-03-14 | Research Institute At Nationwide Children's Hospital | Oncolytic virus combination to maximize oncolytic activity |
| WO2024134495A1 (en) * | 2022-12-20 | 2024-06-27 | Janssen Biotech, Inc. | Oncolytic virus and uses thereof |
| EP4298214A4 (en) * | 2021-02-23 | 2025-03-19 | Aldevron, LLC | NUCLEIC ACID VECTORS AND METHODS OF USE |
| EP4313094A4 (en) * | 2021-03-24 | 2025-05-28 | Virogin Biotech Canada Ltd | Dually regulated oncolytic herpes simplex virus vectors for transcription and translation |
| KR102959999B1 (ko) | 2019-05-30 | 2026-04-30 | 제탕 우 | 재조합 종양용해바이러스 및 제조방법, 응용 및 약물 |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11395832B2 (en) * | 2017-12-14 | 2022-07-26 | Unicyte Ev Ag | Pharmaceutical carriers containing miRNAs for use in the treatment of renal cancer |
| ES2856232B2 (es) * | 2020-03-25 | 2023-11-24 | Fundacion Para La Investig Biomedica Del Hospital 12 De Octubre | Biomarcadores para predecir la respuesta de un sujeto a una terapia con bcg, metodos y usos basados en los mismos |
| TWI845834B (zh) * | 2020-04-23 | 2024-06-21 | 輔仁大學學校財團法人輔仁大學 | 癌症化療藥物促敏方法、其促敏劑組合物及其用途 |
| CN111494636A (zh) * | 2020-06-22 | 2020-08-07 | 中国人民解放军空军军医大学 | Mct1抑制剂的应用及含有其的药物组合物 |
| JP2023540427A (ja) * | 2020-07-07 | 2023-09-25 | オリエンジーン バイオテクノロジー リミテッド | Hsv-1遺伝子編集のためのガイドrnaおよびその方法 |
| US20230242994A1 (en) * | 2020-07-10 | 2023-08-03 | Shanghai Miran Biotech Co., Ltd. | Fluorescent cross-linked rnase h mutant conjugate, mirna combination and application thereof |
| CN116744951A (zh) * | 2020-12-25 | 2023-09-12 | 苏州系统医学研究所 | 一种包含溶瘤病毒的组合物及其在肿瘤治疗中的应用 |
| WO2022151078A1 (zh) * | 2021-01-13 | 2022-07-21 | 嘉兴允英医学检验有限公司 | 溶瘤病毒及其应用 |
| EP4395799A4 (en) * | 2021-08-31 | 2025-08-06 | Virogin Biotech Canada Ltd | GENETICALLY MODIFIED ONCOLYTIC HERPES VIRUS |
| CN114010666B (zh) * | 2021-10-22 | 2024-05-07 | 上海交通大学 | 溶瘤病毒、parp抑制剂及pd-1抗体在制备抗肿瘤药物中的应用 |
| JP2025508866A (ja) * | 2022-02-22 | 2025-04-10 | ヴァイロ バイオ インク. | 腫瘍溶解性ウイルスおよび使用方法 |
| CN117379389B (zh) * | 2022-07-12 | 2026-03-06 | 四川大学 | 血小板-溶瘤病毒复合物、其制备方法及其应用 |
| GB2634272A (en) * | 2023-10-04 | 2025-04-09 | Averywell Ltd | Methods |
Citations (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991002788A1 (en) | 1989-08-15 | 1991-03-07 | British Technology Group Plc | Herpes simplex virus type 1 mutant |
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| WO1996004394A1 (en) | 1994-07-29 | 1996-02-15 | British Technology Group Ltd. | Hsv viral vector |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5658724A (en) | 1992-07-31 | 1997-08-19 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains deficient for the essential immediate early genes ICP4 and ICP27 and methods for their production, growth and use |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| WO1998015637A1 (en) | 1996-05-22 | 1998-04-16 | The University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5849571A (en) | 1990-10-10 | 1998-12-15 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Latency active herpes virus promoters and their use |
| US5849572A (en) | 1990-10-10 | 1998-12-15 | Regents Of The University Of Michigan | HSV-1 vector containing a lat promoter |
| WO1999006583A1 (en) | 1997-07-31 | 1999-02-11 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Targeted hsv vectors |
| US5879934A (en) | 1992-07-31 | 1999-03-09 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5998174A (en) | 1997-05-12 | 1999-12-07 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Multigene vectors |
| US6261552B1 (en) | 1997-05-22 | 2001-07-17 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus vectors |
| WO2007025097A2 (en) | 2005-08-26 | 2007-03-01 | Danisco A/S | Use |
| WO2008021207A2 (en) | 2006-08-11 | 2008-02-21 | Dow Agrosciences Llc | Zinc finger nuclease-mediated homologous recombination |
| WO2010011961A2 (en) | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| WO2010054108A2 (en) | 2008-11-06 | 2010-05-14 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| WO2010054154A2 (en) | 2008-11-07 | 2010-05-14 | Danisco A/S | Bifidobacteria crispr sequences |
| WO2011130749A2 (en) | 2010-04-16 | 2011-10-20 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Identification of mutations in herpes simplex virus envelope glycoproteins that enable or enhance vector retargeting to novel non-hsv receptors |
| WO2012054726A1 (en) | 2010-10-20 | 2012-04-26 | Danisco A/S | Lactococcus crispr-cas sequences |
| US20120277120A1 (en) | 2011-04-27 | 2012-11-01 | Amyris, Inc. | Methods for genomic modification |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| WO2013098244A1 (en) | 2011-12-30 | 2013-07-04 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| WO2013126794A1 (en) | 2012-02-24 | 2013-08-29 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| WO2013141680A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2013142578A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US20140255313A1 (en) * | 2013-01-04 | 2014-09-11 | Cytomx Therapeutics, Inc. | Compositions and Methods for Detecting Protease Activity in Biological Systems |
| WO2015066042A1 (en) | 2013-10-28 | 2015-05-07 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Oncolytic hsv vector |
| US20160175462A1 (en) * | 2013-06-17 | 2016-06-23 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components |
| WO2016141320A2 (en) | 2015-03-05 | 2016-09-09 | Northwestern University | Non-neuroinvasive viruses and uses thereof |
Family Cites Families (76)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5244792A (en) | 1984-04-06 | 1993-09-14 | Chiron Corporation | Expression of recombinant glyoprotein B from herpes simplex virus |
| JPH0668B2 (ja) | 1985-08-30 | 1994-01-05 | 財団法人化学及血清療法研究所 | 単純ヘルペスウイルス遺伝子が組込まれた組換えプラスミド |
| GB9415369D0 (en) | 1994-07-29 | 1994-09-21 | Lynxvale Ltd | Mutant virus |
| GB9700411D0 (en) | 1997-01-10 | 1997-02-26 | Univ London | Eukaryotic gene expression cassette and uses thereof |
| US6071742A (en) | 1997-03-05 | 2000-06-06 | Board Of Regents Of The University Of Nebraska | Coxsackie virus as a vector for delivery of anti-inflammatory cytokines |
| AU742757C (en) | 1997-12-17 | 2007-05-17 | Immunex Corporation | Cell surface glycoproteins associated with human B cell lymphomas - ULBP, DNA and polypeptides |
| GB9810423D0 (en) | 1998-05-15 | 1998-07-15 | Cancer Res Campaign Tech | Ionizing radiation or diathermy-switched gene therapy vectors and their use in antitumour therapy |
| EP1002864A1 (en) | 1998-11-10 | 2000-05-24 | Universita' degli studi di Bologna | HIgR and related V domain for the manufacture of a medicament for preventing or treating HSV-1, HSV-2 and BHV infections |
| US6897057B1 (en) | 1999-08-31 | 2005-05-24 | The General Hospital Corporation | Cell-specific and/or tumor-specific promoter retargeting of herpes γ 34.5 gene expression |
| GB9930418D0 (en) | 1999-12-22 | 2000-02-16 | Neurovex Ltd | Replication incompetent herpes virus vectors |
| CA2441663C (en) | 2001-03-27 | 2013-01-22 | Medigene, Inc. | Viral vectors and their use in therapeutic methods |
| WO2002088327A1 (en) | 2001-04-06 | 2002-11-07 | Mount Sinai School Of Medicine Of New York University | Methods for viral oncoapoptosis in cancer therapy |
| CA2462790A1 (en) | 2001-10-04 | 2003-04-10 | Immunex Corporation | Ul16 binding protein 4 |
| KR100900249B1 (ko) | 2001-12-07 | 2009-05-29 | 포항공과대학교 산학협력단 | SIVmac239의 면역원성 플라스미드 및 이들을 함유한AIDS DNA 백신 |
| AU2003216502B2 (en) | 2002-03-01 | 2008-04-10 | Sloan-Kettering Institute For Cancer Research | Prevention of recurrence and metastasis of cancer |
| US8927251B2 (en) | 2002-10-07 | 2015-01-06 | The University Of Chicago | Targeting of herpes simplex virus to specific receptors |
| JP4999330B2 (ja) | 2004-01-22 | 2012-08-15 | 株式会社ディナベック研究所 | サイトメガロウイルスエンハンサーおよびニワトリβ−アクチンプロモーターを含むハイブリッドプロモーターを利用したマイナス鎖RNAウイルスベクターの製造方法 |
| GB0406389D0 (en) | 2004-03-22 | 2004-04-21 | Istituto Superiore Di Sanito | Recombinant herpes simplex virus and uses therefor |
| US7473418B2 (en) | 2004-03-25 | 2009-01-06 | Cell Genesys, Inc. | Pan cancer oncolytic vectors and methods of use thereof |
| CA2577692C (en) | 2004-08-20 | 2014-05-06 | Viralytics Limited | Methods and compositions for treatment of hematologic cancers |
| WO2006050211A2 (en) | 2004-10-28 | 2006-05-11 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Peripherally delivered glutamic acid decarboxylase gene therapy for spinal cord injury pain |
| WO2006074526A1 (en) | 2005-01-17 | 2006-07-20 | Viralytics Limited | Method and composition for treatment of neoplasms |
| PL2002003T3 (pl) | 2005-05-27 | 2016-06-30 | Ospedale San Raffaele Srl | Wektor genetyczny zawierający mi-RNA |
| US8980246B2 (en) | 2005-09-07 | 2015-03-17 | Sillajen Biotherapeutics, Inc. | Oncolytic vaccinia virus cancer therapy |
| US20080008686A1 (en) | 2006-07-10 | 2008-01-10 | The Brigham And Women's Hospital, Inc. | Tetracycline repressor regulated oncolytic viruses |
| EP2125032A4 (en) | 2007-02-20 | 2011-02-23 | Mayo Foundation | CANCER TREATMENT WITH VIRAL NUCLEIC ACID |
| US8586028B2 (en) | 2007-05-09 | 2013-11-19 | Board Of Supervisors Of Lousiana State University And Agricultural And Mechanical College | Synthetic herpes simplex viruses type-1 for treatment of cancers |
| WO2008143875A1 (en) | 2007-05-14 | 2008-11-27 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Targeted delivery of glycine receptors to excitable cells |
| WO2009111892A1 (en) | 2008-03-14 | 2009-09-17 | Ottawa Health Research Institute | Microrna mediated oncolytic targeting |
| GB0807424D0 (en) | 2008-04-23 | 2008-05-28 | Isis Innovation | Virus |
| EP2307033A4 (en) | 2008-05-29 | 2012-06-13 | Gen Hospital Corp | USE OF ONCOLYTIC HERPESVIRUS FOR THE KILLING OF CANCER STEM CELLS |
| EP2700405B1 (en) | 2008-05-29 | 2018-04-04 | Alma Mater Studiorum -Universita' di Bologna | Herpes simplex virus (HSV) with modified tropism, uses and process of preparation thereof |
| GB0810912D0 (en) | 2008-06-13 | 2008-07-23 | Inst Animal Health Ltd | Vector |
| EP2406379A4 (en) | 2009-03-13 | 2012-09-26 | Egen Inc | COMPOSITIONS AND METHODS FOR RELEASING BIOLOGICALLY ACTIVE RNA |
| US20100297072A1 (en) | 2009-05-19 | 2010-11-25 | Depinho Ronald A | Combinations of Immunostimulatory Agents, Oncolytic Virus, and Additional Anticancer Therapy |
| WO2011119925A2 (en) | 2010-03-25 | 2011-09-29 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Synthetic herpes simplex viruses for treatment of cancers |
| WO2011125469A1 (ja) | 2010-04-09 | 2011-10-13 | 国立大学法人東京大学 | マイクロrna制御組換えワクシニアウイルス及びその使用 |
| WO2012006181A2 (en) | 2010-06-29 | 2012-01-12 | Mount Sinai School Of Medicine | Compositions and methods for inhibiting oncogenic micrornas and treatment of cancer |
| EP2543734A1 (en) | 2011-07-07 | 2013-01-09 | Deutsches Krebsforschungszentrum | Adeno-parvovirus chimera with enhanced oncolytical potential |
| EP2591796A1 (en) | 2011-11-10 | 2013-05-15 | Universität Zürich | Combination medicament comprising IL-12 and an anti-CTLA-4 ligand for tumor therapy |
| US11951157B2 (en) | 2011-10-11 | 2024-04-09 | Universitat Zurich | Methods of treating malignant tumour with IL-12 and anti-PD-1 antibody |
| CA3101783C (en) | 2011-10-11 | 2023-01-31 | Universitat Zurich Prorektorat Mnw | Combination medicament comprising il-12 and an agent for blockade of t-cell inhibitory molecules for tumour therapy |
| US20130156808A1 (en) | 2011-11-22 | 2013-06-20 | Stipan Jonjic | Vaccine comprising beta-herpesvirus |
| US20140363469A1 (en) * | 2012-01-19 | 2014-12-11 | Alnylam Pharmaceuticals, Inc. | Viral attenuation and vaccine production |
| JP6726824B2 (ja) | 2013-07-17 | 2020-07-22 | ユニヴァーシティ オヴ ピッツバーグ オヴ ザ コモンウェルス システム オヴ ハイアー エデュケーション | 効率的な遺伝子送達用途のための非毒性hsvベクター及びその製造のための補完細胞 |
| WO2015127501A1 (en) | 2014-02-27 | 2015-09-03 | Viralytics Limited | Combination method for treatment of cancer |
| JP7348708B2 (ja) * | 2014-04-30 | 2023-09-21 | プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ | 組み合わせワクチン装置および癌細胞を殺滅する方法 |
| DK3169341T3 (da) | 2014-07-16 | 2019-08-05 | Transgene Sa | Onkolytisk virus til ekspression af immun-checkpoint-modulatorer |
| US10083137B2 (en) | 2015-04-02 | 2018-09-25 | Atmel Corporation | Peripheral interface circuit for serial memory |
| US9884704B2 (en) | 2015-08-04 | 2018-02-06 | Ernesto A. Aguero-Hernandez | Clip-clamp with top lock device and method |
| US10210575B1 (en) | 2015-08-12 | 2019-02-19 | State Farm Mutual Automobile Insurance Company | System and method of using an image object as a visual data container |
| RU2766200C1 (ru) * | 2015-10-01 | 2022-02-09 | Хит Байолоджикс, Инк. | Композиции и способы для соединения внеклеточных доменов типа i и типа ii в качестве гетерологичных химерных белков |
| JP6954648B2 (ja) | 2015-10-19 | 2021-10-27 | シージー オンコロジー, インコーポレイテッド | 併用療法による固形腫瘍又はリンパ系腫瘍の治療方法 |
| CN108601802A (zh) | 2015-12-02 | 2018-09-28 | 纪念斯隆-凯特林癌症中心 | 塞尼卡谷病毒(svv)细胞受体靶向的肿瘤治疗 |
| EA201891022A1 (ru) * | 2015-12-17 | 2019-01-31 | Псайоксус Терапьютикс Лимитед | Вирус, кодирующий антитело к комплексу tcr или фрагмент указанного антитела |
| EP3778881A1 (en) | 2016-01-08 | 2021-02-17 | Replimune Limited | Modified oncolytic virus |
| RU2749050C2 (ru) | 2016-01-27 | 2021-06-03 | Онкорус, Инк. | Онколитические вирусные векторы и их применение |
| PL3426271T3 (pl) | 2016-03-10 | 2025-11-24 | Cg Oncology, Inc. | Sposoby leczenia guzów litych terapią skojarzoną |
| KR102211838B1 (ko) | 2016-04-22 | 2021-02-03 | 임비라 컴퍼니 리미티드 | 암치료용 종양 용해성 단순 헤르페스 바이러스(oHSV) 절대 벡터 및 그 구조체의 구조 |
| CN109475613B (zh) | 2016-06-14 | 2024-02-20 | 匹兹堡大学-属高等教育联邦体系 | 使癌细胞对胞毒免疫细胞攻击敏感的nkg2d活化配体蛋白表达 |
| RU2021127872A (ru) * | 2016-06-30 | 2021-11-09 | Онкорус, Инк. | Доставка терапевтических полипептидов посредством псевдотипированных онколитических вирусов |
| JP7200104B2 (ja) | 2016-08-01 | 2023-01-06 | ヴァイロジン バイオテック カナダ リミテッド | 免疫系刺激分子を発現する腫瘍溶解性単純ヘルペスウイルスベクター |
| WO2018027316A1 (en) | 2016-08-09 | 2018-02-15 | Alkayyal Almohanad | Oncolytic rhabdovirus expressing il12 |
| CN119614520A (zh) * | 2016-08-29 | 2025-03-14 | 阿卡米斯生物公司 | 携带双特异性t细胞衔接器的腺病毒 |
| WO2018049261A1 (en) | 2016-09-09 | 2018-03-15 | Icellhealth Consulting Llc | Oncolytic virus expressing immune checkpoint modulators |
| US20190275092A1 (en) | 2016-11-01 | 2019-09-12 | Dnatrix, Inc. | Combination therapy for treatment of brain cancers |
| US11298420B2 (en) | 2016-12-21 | 2022-04-12 | Memgen, Llc | Armed oncolytic viruses |
| EP3565578A1 (en) | 2016-12-21 | 2019-11-13 | Memgen LLC | Armed replication-competent oncolytic adenoviruses |
| GB201700350D0 (en) | 2017-01-09 | 2017-02-22 | Replimune Ltd | Altered virus |
| AU2018301701A1 (en) | 2017-07-14 | 2020-02-27 | Elevatebio Technologies, Inc. | Encapsulated polynucleotides and methods of use |
| AU2018306455A1 (en) | 2017-07-26 | 2020-02-27 | Virogin Biotech Canada Ltd | Oncolytic viral vectors and uses thereof |
| EP3875119A4 (en) | 2018-10-30 | 2022-08-31 | The University of Tokyo | ONCOLYTIC VIRUS FOR CANCER THERAPY |
| EP3941514A4 (en) | 2019-03-20 | 2023-08-30 | Turnstone Biologics Inc. | ONCOLYTIC VIROTHERAPY BY HETEROLOGY SEQUENTIAL BOOSTER |
| WO2020186356A1 (en) | 2019-03-20 | 2020-09-24 | Turnstone Biologics Inc. | Methods for inducing an immune response against neoantigens |
| CA3157063A1 (en) | 2019-10-10 | 2021-04-15 | Oncorus, Inc. | Dual viruses and dual oncolytic viruses and methods of treatment |
| US20220409684A1 (en) | 2019-11-18 | 2022-12-29 | The Brigham And Women's Hospital, Inc. | Codon optimized new generation regulatable fusogenic oncolytic herpes simplex virus type 1 virus and methods of use |
-
2018
- 2018-07-26 AU AU2018306455A patent/AU2018306455A1/en not_active Abandoned
- 2018-07-26 RU RU2020108004A patent/RU2771110C2/ru active
- 2018-07-26 EP EP18837388.0A patent/EP3658165A4/en active Pending
- 2018-07-26 CA CA3070299A patent/CA3070299A1/en active Pending
- 2018-07-26 MX MX2020000993A patent/MX2020000993A/es unknown
- 2018-07-26 KR KR1020207005429A patent/KR20200042904A/ko not_active Ceased
- 2018-07-26 JP JP2020504236A patent/JP7249323B2/ja active Active
- 2018-07-26 CN CN201880057565.XA patent/CN111212656B/zh active Active
- 2018-07-26 WO PCT/US2018/043938 patent/WO2019023483A1/en not_active Ceased
- 2018-07-26 BR BR112020001559-8A patent/BR112020001559A2/pt not_active IP Right Cessation
- 2018-07-26 US US16/633,653 patent/US11612625B2/en active Active
- 2018-07-26 SG SG11202000691XA patent/SG11202000691XA/en unknown
-
2020
- 2020-01-12 IL IL271993A patent/IL271993A/en unknown
-
2023
- 2023-02-07 US US18/165,770 patent/US12208126B2/en active Active
- 2023-03-17 JP JP2023043321A patent/JP7652823B2/ja active Active
Patent Citations (49)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5837532A (en) | 1989-08-15 | 1998-11-17 | British Technology Group Limited | Herpes simplex cirus type 1 mutant |
| WO1991002788A1 (en) | 1989-08-15 | 1991-03-07 | British Technology Group Plc | Herpes simplex virus type 1 mutant |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| US5849572A (en) | 1990-10-10 | 1998-12-15 | Regents Of The University Of Michigan | HSV-1 vector containing a lat promoter |
| US5849571A (en) | 1990-10-10 | 1998-12-15 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Latency active herpes virus promoters and their use |
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5804413A (en) | 1992-07-31 | 1998-09-08 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5658724A (en) | 1992-07-31 | 1997-08-19 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains deficient for the essential immediate early genes ICP4 and ICP27 and methods for their production, growth and use |
| US5879934A (en) | 1992-07-31 | 1999-03-09 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| WO1996004394A1 (en) | 1994-07-29 | 1996-02-15 | British Technology Group Ltd. | Hsv viral vector |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| WO1998015637A1 (en) | 1996-05-22 | 1998-04-16 | The University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US7078029B2 (en) | 1996-05-22 | 2006-07-18 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US5998174A (en) | 1997-05-12 | 1999-12-07 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Multigene vectors |
| US6261552B1 (en) | 1997-05-22 | 2001-07-17 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus vectors |
| WO1999006583A1 (en) | 1997-07-31 | 1999-02-11 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Targeted hsv vectors |
| US20130011828A1 (en) | 2005-08-26 | 2013-01-10 | Rodolphe Barrangou | Use |
| US20100093617A1 (en) | 2005-08-26 | 2010-04-15 | Rodolphe Barrangou | Use |
| WO2007025097A2 (en) | 2005-08-26 | 2007-03-01 | Danisco A/S | Use |
| US20100257638A1 (en) | 2006-08-11 | 2010-10-07 | Dow Agrosciences Llc | Zinc finger nuclease-mediated homologous recombination |
| WO2008021207A2 (en) | 2006-08-11 | 2008-02-21 | Dow Agrosciences Llc | Zinc finger nuclease-mediated homologous recombination |
| US8546553B2 (en) | 2008-07-25 | 2013-10-01 | University Of Georgia Research Foundation, Inc. | Prokaryotic RNAi-like system and methods of use |
| WO2010011961A2 (en) | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| WO2010054108A2 (en) | 2008-11-06 | 2010-05-14 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| US20110217739A1 (en) | 2008-11-06 | 2011-09-08 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| WO2010054154A2 (en) | 2008-11-07 | 2010-05-14 | Danisco A/S | Bifidobacteria crispr sequences |
| US20110300538A1 (en) | 2008-11-07 | 2011-12-08 | Danisco A/S | Bifidobacteria crispr sequences |
| US20130096186A1 (en) | 2010-04-16 | 2013-04-18 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Identification of mutations in herpes simplex virus envelope glycoproteins that enable or enhance vector retargeting to novel non-hsv receptors |
| WO2011130749A2 (en) | 2010-04-16 | 2011-10-20 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Identification of mutations in herpes simplex virus envelope glycoproteins that enable or enhance vector retargeting to novel non-hsv receptors |
| WO2012054726A1 (en) | 2010-10-20 | 2012-04-26 | Danisco A/S | Lactococcus crispr-cas sequences |
| US20130288251A1 (en) | 2010-10-20 | 2013-10-31 | Dupont Nutrition Biosciences Aps | Lactococcus crispr-cas sequences |
| WO2012149470A1 (en) | 2011-04-27 | 2012-11-01 | Amyris, Inc. | Methods for genomic modification |
| US20120277120A1 (en) | 2011-04-27 | 2012-11-01 | Amyris, Inc. | Methods for genomic modification |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| WO2013098244A1 (en) | 2011-12-30 | 2013-07-04 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| WO2013126794A1 (en) | 2012-02-24 | 2013-08-29 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| WO2013141680A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2013142578A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US20140255313A1 (en) * | 2013-01-04 | 2014-09-11 | Cytomx Therapeutics, Inc. | Compositions and Methods for Detecting Protease Activity in Biological Systems |
| US20160175462A1 (en) * | 2013-06-17 | 2016-06-23 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components |
| WO2015066042A1 (en) | 2013-10-28 | 2015-05-07 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Oncolytic hsv vector |
| US20170035819A1 (en) * | 2013-10-28 | 2017-02-09 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Oncolytic hsv vector |
| WO2016141320A2 (en) | 2015-03-05 | 2016-09-09 | Northwestern University | Non-neuroinvasive viruses and uses thereof |
Non-Patent Citations (26)
| Title |
|---|
| "GenBank", Database accession no. AF311740 |
| "Immunology Methods Manual", 1997, ACADEMIC PRESS |
| "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT WILLIAMS & WILKINS |
| "Short Protocols in Molecular Biology", 1999, JOHN WILEY & SONS |
| "Viral Vectors", 1995, ACADEMIC PRESS |
| BOLLAG ET AL.: "Protein Methods", 1996, JOHN WILEY & SONS |
| DOYLEGRIFFITHS: "Cell and Tissue Culture: Laboratory Procedures in Biotechnology", 1998, JOHN WILEY & SONS |
| JINEK ET AL., ELIFE, vol. 2, 2013, pages e00563 |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821 |
| LOAKES ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 4039 - 4043 |
| LOPEZ-OTIN ET AL., NAT REV CANCER, vol. 7, no. 10, 2007, pages 800 - 8 |
| LORENZ ET AL., ALGORITHMS FOR MOLECULAR BIOLOGY, vol. 6, no. 1, 2011, pages 26 |
| LU ET AL., NATURE, 2005 |
| MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826 |
| MAZZACURATI ET AL., MOL THER., 2015 |
| MCGOECH ET AL., J. GEN. VIROL, vol. 69, 1988, pages 1531 - 1574 |
| METZ ET AL., PROTEIN ENG DES SEL, vol. 25, no. 10, 2012, pages 571 - 80 |
| NAT METHODS, vol. 6, no. 5, 2009, pages 343 - 5 |
| QI ET AL., CELL, vol. 152, 2013, pages 1173 - 1183 |
| RAN ET AL., NATURE PROTOCOLS, vol. 8, no. 11, 2013, pages 2281 - 2308 |
| RICHARD ET AL., PLOS PATHOGENS, vol. 13, no. 12, 2017, pages e1006741 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, HARBOR LABORATORY PRESS |
| See also references of EP3658165A4 |
| T. NICHOLS ET AL., NATURE, vol. 369, 1994, pages 492 - 493 |
| WATKINSSANTALUCIA, NUCL. ACIDS RESEARCH, vol. 33, no. 19, 2005, pages 6258 - 6267 |
| ZETSCHE ET AL., CELL, vol. 163, no. 3, 2015, pages 759 - 771 |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11452750B2 (en) | 2016-01-27 | 2022-09-27 | Oncorus, Inc. | Oncolytic viral vectors and uses thereof |
| US10391132B2 (en) | 2016-01-27 | 2019-08-27 | Oncorus, Inc. | Oncolytic viral vectors and uses thereof |
| US12208126B2 (en) | 2017-07-26 | 2025-01-28 | Virogin Biotech Canada Ltd. | Oncolytic viral vectors and uses thereof |
| US11612625B2 (en) | 2017-07-26 | 2023-03-28 | Oncorus, Inc. | Oncolytic viral vectors and uses thereof |
| WO2020113151A1 (en) * | 2018-11-29 | 2020-06-04 | Virogin Biotech Canada Ltd | Hsv vector with reduced neurotoxicity |
| AU2020232264B2 (en) * | 2019-03-05 | 2026-02-19 | Amgen Inc. | Use of oncolytic viruses for the treatment of cancer |
| CN113439123A (zh) * | 2019-03-05 | 2021-09-24 | 安进公司 | 溶瘤病毒用于治疗癌症的用途 |
| JP2022522817A (ja) * | 2019-03-05 | 2022-04-20 | アムジエン・インコーポレーテツド | がんを治療するための腫瘍溶解性ウイルスの使用 |
| TWI851676B (zh) * | 2019-03-05 | 2024-08-11 | 美商安進公司 | 溶瘤病毒用於治療癌症之用途 |
| JP7679303B2 (ja) | 2019-03-05 | 2025-05-19 | アムジエン・インコーポレーテツド | がんを治療するための腫瘍溶解性ウイルスの使用 |
| WO2020180864A1 (en) * | 2019-03-05 | 2020-09-10 | Amgen Inc. | Use of oncolytic viruses for the treatment of cancer |
| EP3978601A4 (en) * | 2019-05-30 | 2022-08-17 | Wu, Zetang | RECOMBINANT ONCOLYTIC VIRUS, PROCESS FOR ITS PRODUCTION AND ITS USE AND MEDICINAL PRODUCTS |
| KR102959999B1 (ko) | 2019-05-30 | 2026-04-30 | 제탕 우 | 재조합 종양용해바이러스 및 제조방법, 응용 및 약물 |
| AU2020285252B2 (en) * | 2019-05-30 | 2024-08-22 | Suzhou Zelin Biopharmaceutical Co., Ltd. | Recombinant oncolytic virus, preparation method therefor, use thereof and medicine thereof |
| JP7441245B2 (ja) | 2019-05-30 | 2024-02-29 | 伍沢堂 | 組換え腫瘍溶解性ウイルスとその調製方法、使用および医薬品 |
| JP2022535039A (ja) * | 2019-05-30 | 2022-08-04 | 伍沢堂 | 組換え腫瘍溶解性ウイルスとその調製方法、使用および医薬品 |
| JP2022543610A (ja) * | 2019-08-05 | 2022-10-13 | ヴァイロジン バイオテック カナダ リミテッド | 遺伝子改変エンテロウイルスベクター |
| CN111235274A (zh) * | 2020-01-18 | 2020-06-05 | 山西医科大学第一医院 | 喉鳞癌血清外泌体标志物筛选方法和外泌体来源miR-941应用 |
| WO2021211902A3 (en) * | 2020-04-15 | 2022-03-03 | Humane Genomics | Artificial oncolytic viruses and related methods |
| CN113583977A (zh) * | 2020-04-30 | 2021-11-02 | 杭州康万达医药科技有限公司 | 可受微小rna调控的分离的重组溶瘤痘病毒及其应用 |
| US11505607B2 (en) * | 2020-11-13 | 2022-11-22 | Binhui Biopharmaceutical Co., Ltd. | Bispecific single-chain antibody, recombinant oncolytic virus for expressing same and virus composition |
| EP4298214A4 (en) * | 2021-02-23 | 2025-03-19 | Aldevron, LLC | NUCLEIC ACID VECTORS AND METHODS OF USE |
| EP4313094A4 (en) * | 2021-03-24 | 2025-05-28 | Virogin Biotech Canada Ltd | Dually regulated oncolytic herpes simplex virus vectors for transcription and translation |
| WO2023066920A1 (en) * | 2021-10-19 | 2023-04-27 | Consejo Superior De Investigaciones Científicas | Recombinant african swine fever virus and uses thereof |
| EP4170022A1 (en) * | 2021-10-19 | 2023-04-26 | Consejo Superior De Investigaciones Científicas | Recombinant african swine fever virus and uses thereof |
| WO2024054293A1 (en) * | 2022-09-08 | 2024-03-14 | Research Institute At Nationwide Children's Hospital | Oncolytic virus combination to maximize oncolytic activity |
| WO2024134495A1 (en) * | 2022-12-20 | 2024-06-27 | Janssen Biotech, Inc. | Oncolytic virus and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| JP7249323B2 (ja) | 2023-03-30 |
| US12208126B2 (en) | 2025-01-28 |
| RU2771110C2 (ru) | 2022-04-26 |
| JP2020532951A (ja) | 2020-11-19 |
| EP3658165A1 (en) | 2020-06-03 |
| MX2020000993A (es) | 2020-07-22 |
| CN111212656A (zh) | 2020-05-29 |
| KR20200042904A (ko) | 2020-04-24 |
| JP2023078309A (ja) | 2023-06-06 |
| RU2020108004A3 (https=) | 2021-10-12 |
| US20200206285A1 (en) | 2020-07-02 |
| CA3070299A1 (en) | 2019-01-31 |
| IL271993A (en) | 2020-02-27 |
| SG11202000691XA (en) | 2020-02-27 |
| AU2018306455A1 (en) | 2020-02-27 |
| US11612625B2 (en) | 2023-03-28 |
| BR112020001559A2 (pt) | 2020-08-11 |
| RU2020108004A (ru) | 2021-08-26 |
| US20230241140A1 (en) | 2023-08-03 |
| JP7652823B2 (ja) | 2025-03-27 |
| CN111212656B (zh) | 2024-10-18 |
| EP3658165A4 (en) | 2021-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7652823B2 (ja) | 腫瘍溶解性ウイルスベクター及びその使用 | |
| US20230115116A1 (en) | Oncolytic viral vectors and uses thereof | |
| JP5652830B2 (ja) | マイクロrna制御組換えワクシニアウイルス及びその使用 | |
| EP3652325A1 (en) | Encapsulated polynucleotides and methods of use | |
| CN111936150A (zh) | 抗癌微小rna及其脂质制剂 | |
| US20250049867A1 (en) | Engineered oncolytic herpesviruses | |
| da Costa | MicroRnas as Molecular Targets for Non-Viral Gene Therapy of Glioblastoma: Development of a Lipid-Based Nanosystem for Nucleic Acid Delivery to Brain Tumor Cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18837388 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3070299 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020504236 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112020001559 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20207005429 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018306455 Country of ref document: AU Date of ref document: 20180726 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018837388 Country of ref document: EP Effective date: 20200226 |
|
| ENP | Entry into the national phase |
Ref document number: 112020001559 Country of ref document: BR Kind code of ref document: A2 Effective date: 20200124 |