WO2018182355A1 - 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법 - Google Patents

타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법 Download PDF

Info

Publication number
WO2018182355A1
WO2018182355A1 PCT/KR2018/003769 KR2018003769W WO2018182355A1 WO 2018182355 A1 WO2018182355 A1 WO 2018182355A1 KR 2018003769 W KR2018003769 W KR 2018003769W WO 2018182355 A1 WO2018182355 A1 WO 2018182355A1
Authority
WO
WIPO (PCT)
Prior art keywords
tagatose
fructose
culture
present application
enzyme
Prior art date
Application number
PCT/KR2018/003769
Other languages
English (en)
French (fr)
Inventor
이영미
박일향
양성재
조현국
신선미
김성보
이찬형
Original Assignee
씨제이제일제당(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당(주) filed Critical 씨제이제일제당(주)
Priority to JP2019552866A priority Critical patent/JP6961713B2/ja
Priority to BR112019020338-9A priority patent/BR112019020338B1/pt
Priority to CN201880036242.2A priority patent/CN111133103B/zh
Priority to MX2019011730A priority patent/MX2019011730A/es
Priority to EP18777328.8A priority patent/EP3604516A4/en
Priority to CA3057595A priority patent/CA3057595A1/en
Publication of WO2018182355A1 publication Critical patent/WO2018182355A1/ko
Priority to US16/582,629 priority patent/US11408017B2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/24—Preparation of compounds containing saccharide radicals produced by the action of an isomerase, e.g. fructose
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01144—Tagatose-6-phosphate kinase (2.7.1.144)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/02—Aldehyde-lyases (4.1.2)
    • C12Y401/0204—Tagatose-bisphosphate aldolase (4.1.2.40)

Definitions

  • the present application relates to a composition for producing tagatose comprising a fructose-4-epimerase and a method for producing tagatose using the same.
  • Tagatose is similar to sugar in foods such as milk, cheese and cacao, and natural sweeteners present in small amounts in sweet natural fruits such as apples and tangerines.
  • Tagatose has a calories of 1.5 kcal / g, 1/3 of sugar, and GI (Glycemic Index) is 3, which is 5% of sugar, whereas sugar has a similar sweetness and various health functions. It can be used as an alternative sweetener that can satisfy both health and taste at the time of application.
  • tagatose-6-phosphate kinase (EC 2.7.1.144) is the ATP and D-tagatose 6-phosphate (D-tagatose 6-phosphate) as shown in Scheme 1 below. It is known to produce ADP and D-tagatose 1,6-biphosphate as a substrate, but the tagatose-6-phosphate kinase is used to produce fructose (D-fructose). There is no report on the activity of converting to.
  • tagatose-6-phosphate kinase (EC 2.7.1.144) was used to tag fructose. By confirming that there is activity to convert to toss, the present application was completed.
  • One object of the present application is to provide a composition useful for preparing tagatose, the composition comprising tagatose-6-phosphate kinase, a microorganism expressing the enzyme or a culture of the microorganism.
  • Another object of the present application is to prepare a method for producing tagatose comprising the step of converting fructose to tagatose by contacting fructose-4-epimerase, the microorganism expressing the enzyme or a culture of the microorganism with fructose.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the gene may be introduced into the host cell in its own form or in the form of a polynucleotide structure, and may be operably linked to a sequence required for expression in the host cell.
  • the microorganism of the present application may include both prokaryotic and eukaryotic microorganisms, as long as the microorganism capable of producing the fructose-4-epimerase of the present application, including the nucleic acid of the present application or the recombinant vector of the present application.
  • S. genus Escherichia Escherichia
  • An air Winiah Erwinia
  • Serratia marcescens Serratia
  • Providencia Providencia
  • Corynebacterium Corynebacterium
  • Brevibacterium Brevibacterium
  • It may include a microorganism strain belonging to, specifically, E.
  • Corynebacterium corynebacterium glutamicum Corynebacterium corynebacterium glutamicum
  • Examples of such microorganisms are E. coli BL21 (DE3) / CJ_ANT_F4E, E. coli BL21 (DE3) / CJ_AB_F4E, E. coli BL21 (DE3) / CJ_DT_F4E .
  • the microorganism of the present application may include all microorganisms capable of expressing the fructose-4-epimerase enzyme of the present application by various known methods in addition to introducing the nucleic acid or the vector.
  • the culture of the microorganism of the present application may be prepared by culturing the microorganism expressing the tagatose-6-phosphate kinase of the present application in a medium.
  • the term "culture” means growing the microorganisms under appropriately controlled environmental conditions. Cultivation process of the present application can be made according to the appropriate medium and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the strain selected.
  • the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, or the like.
  • the culture conditions are not particularly limited, but using a basic compound (eg sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg phosphoric acid or sulfuric acid) to an appropriate pH (eg pH 5 to 9, specifically PH 7 to 9) can be adjusted.
  • a basic compound eg sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg phosphoric acid or sulfuric acid
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble formation, and in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas is injected into the culture, or anaerobic and microaerobic conditions are maintained. To maintain, it can be injected with no gas or with nitrogen, hydrogen or carbon dioxide gas.
  • the culture temperature may be maintained at 25 °C to 40 °C, specifically 30 °C to 37 °C, but is not limited thereto.
  • the incubation period may continue until the desired amount of useful material is obtained, specifically, may be incubated for about 0.5 hours to 60 hours, but is not limited thereto.
  • the culture medium used may include sugars and carbohydrates (e.g.
  • fats and fats e.g. soybean oil, sunflower seeds
  • Oils, peanut oils and coconut oils fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) may be used individually or in combination. This is not restrictive.
  • Nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and Ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
  • a source of phosphorus potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and the like may be used individually or in combination, but is not limited thereto.
  • the medium may also contain essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
  • composition for producing tagatose of the present application may further include fructose.
  • composition for producing tagatose of the present application includes a tagatose-6-phosphate kinase having a fructose-4-epimerization activity for directly converting fructose to tagatose, a microorganism expressing the same or a culture of the microorganism, It may be characterized by not including other enzymes other than phosphorus fructose.
  • ⁇ -glucan phosphorylase for example, ⁇ -glucan phosphorylase, starch phosphorylase, maltodextrin phosphorylase or sucrose phosphorylase, expressing it Microorganisms or cultures of the microorganisms;
  • Glucose glucokinase a microorganism expressing the same or a culture of the microorganism
  • Tagatose-6-phosphate dephosphorylase a microorganism expressing the same or a culture of the microorganism; And / or
  • ⁇ -amylase pullulanase, glucoamylase, sucrase or isoamylase
  • Microorganisms expressing the amylase, pullulanase, glucoamylase, sucrase or isoamylase Or it may be characterized in that it does not comprise a culture of microorganisms expressing the amylase, pullulanase, glucoamylase, sukrase or isoamylase.
  • composition for producing tagatose of the present application may further include any suitable excipient commonly used in the composition for producing tagatose.
  • excipients may be, for example, but not limited to, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents.
  • the composition for producing tagatose of the present application may further include a metal.
  • the metal of the present application may be a metal comprising a divalent cation.
  • the metal of the present application may be magnesium, nickel, or manganese (Mn). More specifically, the metal of the present application may be a metal ion or a metal salt, and even more specifically the metal salt may be MgCl 2 , MgSO 4 , NiSO 4 , NiCl 2 , MnCl 2 or MnSO 4 .
  • the present application provides a method for converting fructose to tagatose by contacting fructose (D-fructose) with a fructose-4-epimerase of the present application, a microorganism expressing the enzyme or a culture of the microorganism. It provides a tagatose manufacturing method comprising.
  • the contacting may be performed at pH 5.0 to pH 9.0, the temperature is 30 °C to 80 °C temperature conditions, and / or 0.5 hours to 48 hours.
  • the contact of the present application may be performed at pH 6.0 to pH 9.0 conditions or pH 7.0 to pH 9.0 conditions.
  • the contact of the present application is 35 °C to 80 °C, 40 °C to 80 °C, 45 °C to 80 °C, 50 °C to 80 °C, 55 °C to 80 °C, 60 °C to 80 °C, 30 °C to 70 °C, 35 ° C to 70 ° C, 40 ° C to 70 ° C, 45 ° C to 70 ° C, 50 ° C to 70 ° C, 55 ° C to 70 ° C, 60 ° C to 70 ° C, 30 ° C to 65 ° C, 35 ° C to 65 ° C, 40 ° C to 65 degreeC, 45 degreeC-65 degreeC, 50 degreeC-65 degreeC, 55 degreeC-65 degreeC, 30 degreeC-60 degreeC, 35 degreeC-60 degreeC, 40 degreeC-60 degreeC, 45 degreeC-60 degreeC, 50 degreeC
  • the contact of the present application is 0.5 hours to 36 hours, 0.5 hours to 24 hours, 0.5 hours to 12 hours, 0.5 hours to 6 hours, 1 hour to 48 hours, 1 hour to 36 hours, 1 3 hours to 24 hours, 3 hours to 24 hours, 3 hours to 24 hours, 3 hours to 12 hours, 3 hours to 1 hour to 12 hours, 1 hour to 6 hours, 3 hours to 36 hours
  • the contact of the present application may be performed in the presence of a metal.
  • the fructose-4-epimerase enzyme, the microorganism expressing the enzyme, the culture of the microorganism, the metal, the metal ion and the metal salt are as described above in another embodiment.
  • the manufacturing method of the present application may further comprise the step of separating and / or purifying the produced tagatose.
  • the separation and / or purification may use methods commonly used in the art of the present application, and non-limiting examples may use dialysis, precipitation, adsorption, electrophoresis, ion exchange chromatography and fractional crystallization.
  • the purification may be carried out in only one method, or may be performed in combination of two or more methods.
  • the preparation method of the present application may further comprise the step of performing decolorization and / or desalting before or after the step of separating and / or purifying.
  • decolorization and / or desalting By performing the above-mentioned decolorization and / or desalting, tagatose of superior quality can be obtained.
  • the preparation method of the present application may further comprise the step of converting to tagatose, separating and / or purifying the present application, or crystallizing the tagatose after the decolorizing and / or desalting step.
  • the crystallization can be carried out using a conventionally used crystallization method.
  • crystallization may be performed using a cooling crystallization method.
  • the preparation method of the present application may further comprise the step of concentrating tagatose before the step of crystallizing.
  • the concentration can increase the crystallization efficiency.
  • the preparation method of the present application comprises contacting the unreacted fructose with an enzyme of the present application, a microorganism expressing the enzyme or a culture of the microorganism after the separation and / or purification of the present application.
  • the step of crystallizing the application may further comprise reusing the separated mother liquor into the separation and / or purification steps, or a combination thereof.
  • the fructose-4-epimerase of the present application is excellent in heat resistance, industrially capable of producing tagatose, and converts the common sugar fructose into tagatose at a high yield, thereby having a high economic effect.
  • Figure 1 shows the result of analyzing the molecular weight of the tagatose-6-phosphate kinase (CJ_ANT_F4E) generated and isolated in the transformant according to an embodiment of the present application by protein electrophoresis (SDS-PAGE).
  • CJ_ANT_F4E tagatose-6-phosphate kinase
  • FIG. 2 is an HPLC chromatography result showing that tagatose-6-phosphate kinase (CJ_ANT_F4E) prepared in one example of the present application has fructose-4-epimerase activity.
  • CJ_ANT_F4E tagatose-6-phosphate kinase
  • CJ_ANT_F4E tagatose-6-phosphate kinase
  • FIG. 4 is an HPLC chromatography graph showing that the tagatose-6-phosphate kinase enzyme CJ_AB_F4E prepared in one embodiment of the present application has fructose-4-epimerase activity.
  • Figure 5 is a graph showing the fructose-4-epimerization activity according to the temperature change of the tagatose-6-phosphate kinase enzyme CJ_AB_F4E prepared in one embodiment of the present application.
  • FIG. 7 is an HPLC chromatography graph showing that the tagatose-6-phosphate kinase enzyme CJ_DT_F4E prepared in one example of the present application exhibits fructose-4-epimerase activity.
  • FIG. 9 is a graph showing the fructose-4-epimerization activity according to the metal addition of the tagatose-6-phosphate kinase enzyme CJ_DT_F4E prepared in one embodiment of the present application.
  • CJ_ANTA_F4E tagatose-6-phosphate kinase
  • FIG. 11 is an HPLC chromatographic result showing that tagatose-6-phosphate kinase (CJ_TH_F4E) prepared in one example of the present application has fructose-4-epimerase activity.
  • CJ_TH_F4E tagatose-6-phosphate kinase
  • CJ_TAI_F4E tagatose-6-phosphate kinase
  • Example 1 Preparation of tagatose-6-phosphate kinase and its activity evaluation
  • Example 1-1 Preparation of Recombinant Expression Vectors and Transformants Containing Tagatose-6-Phosphate Kinase Gene
  • thermophiles Two Anaerolinea Thermophiles to Provide New Heat-resistant Fructose-4- Epimerase Tagatose-6-phosphate kinase gene information derived from thermophile ) was obtained to prepare E. coli-expressable vectors and transformed microorganisms (transformants).
  • a tagatose-6-phosphate kinase gene sequence was selected for anerolinia thermophilia gene sequences registered in Kyoto Encyclopedia of Genes and Genomes (KEGG), and the amino acid sequence of anerolinia thermophilia (SEQ ID NO: 1).
  • a recombinant expression vector prepared by inserting into pBT7-C-His which is an E. coli expression vector, based on the nucleotide sequence (SEQ ID NO: 2) and the amino acid sequence (SEQ ID NO: 7) and the nucleotide sequence (SEQ ID NO: 8) Requested.
  • PCR conditions were at 94 ° C using primer 1: ATATACATATGATGTTCGGCTCGCCTGCTCCCCTGCTG (SEQ ID NO: 13) and primer 2: TGGTGCTCGAGCCCGCACGCCGCAGCGTAATCTTCCAG (SEQ ID NO: 14).
  • primer 1 ATATACATATGATGTTCGGCTCGCCTGCTCCCCTGCTG
  • primer 2 TGGTGCTCGAGCCCGCACGCCGCAGCGTAATCTTCCAG
  • E. coli BL21 (DE3) / CJ_ANT_F4E and E. coli BL21 (DE3) / CJ_ANTA_F4E were transformed into E. coli BL21 (DE3). Under the Budapest Treaty . E. coli BL21 (DE3) / CJ_ANT_F4E was deposited on March 20, 2017 under accession number KCCM11996P, and E. coli BL21 (DE3) / CJ_ANTA_F4E was deposited on March 23, 2018 under accession number KCCM12232P.
  • the spawn culture was inoculated into a culture flask containing LB (Lysogeny broth) and a liquid medium containing lactose, a protein expression regulator, to carry out the main culture.
  • the stirring speed during the culture process is 180rpm, the culture temperature was maintained at 37 °C.
  • the culture solution was centrifuged for 20 minutes at 4 °C at 8,000rpm to recover the cells.
  • the recovered cells were washed twice with 50 mM Tris-HCl (pH 8.0) buffer and resuspended in 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 10 mM imidazole and 300 mM NaCl.
  • the suspended cells were lysed using a sonicator, and the cell lysates were collected only after centrifugation at 4 ° C. for 20 minutes at 13,000 rpm.
  • the supernatant was purified using His-taq affinity chromatography, and 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 20 mM imidazole and 300 mM NaCl was flowed at 10 times the amount of filler to remove nonspecific bindable protein. 50mM NaH2PO4 (pH8.0) buffer containing the final 250mM imidazole and 300mM NaCl was eluted and purified, followed by dialysis with 50mM Tris-HCl (pH 8.0) buffer and two enzymes for enzyme characterization (CJ_ANT_F4E, CJ_ANTA_F4E) is secured. As a result, the purified recombinant fructose-4-epimerase confirmed that CJ_ANT_F4E was about 47 kDa through SDS-PAGE analysis (FIG. 1).
  • Example 1-2 In order to measure the activity of the enzymes obtained in Example 1-2, 30% by weight fructose was used, where 50 mM Tris-HCl (pH 8.0), 1 mM CoSO 4 , 20 mg / s isolated from Example 1-2 The reaction was carried out at 60 ° C. for 2 hours by adding ml purified enzyme.
  • Fructose-4-epimerase CJ_ANT_F4E, CJ_ANTA_F4E As a result of checking the concentration of tagatose and the conversion rate from fructose to tagatose, the conversion rate of CJ_ANT_F4E is 16.1%, and the conversion rate of CJ_ANTA_F4E is 21.9%.
  • Conversion Tagatose Production / Fructose Substrate Concentration X 100
  • tagatose, a fructose and a product remaining after the reaction was quantified using HPLC.
  • the column used was Shodex Sugar SP0810, the column temperature was 80 °C, the flow rate of the water of the mobile phase was flowed at 1ml / min. 2 and 10 were used to detect and quantify peaks representing the reaction of the enzyme with fructose as a substrate.
  • Example 1-4 fructose-4- Epimerization Effect of temperature on activity
  • Example 2 Preparation of tagatose-6-phosphate kinase and evaluation of its activity
  • Example 2-1 Preparation of Recombinant Expression Vectors and Transformants Containing Tagatose-6-Phosphate Kinase Gene
  • the present inventors obtained the tagatose-6-phosphate kinase gene information from Anaerolineae bacterium Taxon ID: 2654588098 to prepare E. coli-expressable recombinant vectors and transformed microorganisms.
  • the tagatose-6-phosphate kinase gene sequence is selected from uneroline bacterium gene sequences registered in Kyoto Encyclopedia of Genes and Genomes (KEGG) and European Nucleotide Archives (ENA). Based on the amino acid sequence (SEQ ID NO: 3) and nucleotide sequence (SEQ ID NO: 4) information of the L. bacterium-derived tagatose-6-phosphate kinase CJ_AB_F4E, E. coli-expressing recombinant expression vector pBT7-C including the base sequence of the enzyme -His-CJ_AB_F4E was manufactured (Bionia, South Korea).
  • Each recombinant vector was transformed into Escherichia coli BL21 (DE3) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001), and then stored in 50% glycerol and frozen.
  • the transgenic strain was named E. coli BL21 (DE3) / CJ_AB_F4E, and was deposited on August 11, 2017 at the Korean Culture Center of Microorganisms (KCCM), an international depository organization under the Budapest Treaty, and deposited accession number KCCM12093P. Was granted.
  • each of the transformed microorganisms includes an ampicillin antibiotic.
  • the inoculation was inoculated into a culture tube containing 5 mL of the prepared LB liquid medium, and the seed culture was carried out in a 37 ° C. shaker incubator until the absorbance was 2.0 at 600 nm.
  • the seed cultured culture was inoculated into a culture flask containing a liquid medium containing LB and lactose, a protein expression regulator, to carry out the main culture.
  • the seed culture and main culture were carried out at a stirring speed of 180 rpm and 37 °C conditions. Subsequently, the culture solution was centrifuged at 4 ° C. at 8,000 rpm for 20 minutes to recover the cells. The recovered cells were washed twice with 50 mM Tris-HCl (pH 8.0) buffer and reproduced in 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 10 mM imidazole and 300 mM NaCl. It was cloudy. The resuspended cells were disrupted using a sonicator, and the cell debris was centrifuged at 4 ° C. at 13,000 rpm for 20 minutes, and only the supernatant was taken.
  • the supernatant was purified using His-taq affinity chromatography, followed by flowing 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 20 mM imidazole and 300 mM NaCl in 10 times the amount of the filler to make it nonspecific. The bindable protein was removed. Next, 50 mM NaH 2 PO 4 (pH8.0) buffer containing 250 mM imidazole and 300 mM NaCl was further eluted to purify and purified by dialysis with 50 mM Tris-HCl (pH 8.0) buffer solution. Purified enzyme CJ_AB_F4E was obtained for analysis.
  • Example 2-4 Confirmation of activity according to temperature change of recombinant enzyme
  • the CJ_AB_F4E enzyme showed maximum activity at 65 ° C., and it was confirmed that CJ_AB_F4E maintained at least 50% of the maximum activity at 50 ° C. to 70 ° C. (FIG. 5).
  • CJ_AB_F4E 2 mg / mL of CJ_AB_F4E is added to 50 mM Tris HCl (pH 8.0) buffer containing 10% by weight fructose, and various metal ions NiSO 4 , CaCl 2 , ZnSO 4 , MgSO 4 , MnSO 4 , FeSO 4 , CuSO 4 , or (NH 4 ) 2 SO 4 was added 1 mM each to measure the enzyme activity. The case where no metal ion was treated was set as a control. After the reaction was completed, tagatose in the reaction solution was quantitatively analyzed using HPLC.
  • the CJ_AB_F4E enzyme was found to increase in activity by the addition of MnSO 4 or NiSO 4 , indicating that there is a requirement for metal ions such as manganese ions and nickel ions. In particular, it was confirmed that the maximum activity when added NiSO 4 (Fig. 6).
  • Example 3 Preparation of tagatose-6-phosphate kinase and its activity evaluation
  • Example 3-1 Preparation of Recombinant Expression Vectors and Transformants Containing Tagatose-6-Phosphate Kinase Gene
  • the tagatose-6-phosphate kinase gene sequence is selected from the dioctoglomus thermophilum gene sequence registered in Kyoto Encyclopedia of Genes and Genomes (KEGG) to derive the dioctomoglomus thermophilum.
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • amino acid sequence SEQ ID NO: 5
  • nucleotide sequence SEQ ID NO: 6
  • a recombinant expression vector pBT7-C-His-CJ_DT_F4E capable of expressing E. coli, including the nucleotide sequence of the enzyme, was prepared. Synthesized (Bionia, Korea).
  • Each recombinant vector was transformed into E. coli BL21 (DE3) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) to produce a recombinant microorganism, and then used by freezing stored in 50% glycerol.
  • the recombinant microorganism was named E. coli BL21 (DE3) / CJ_DT_F4E, and was deposited on September 13, 2017 at the Korea Culture Center of Microorganisms (KCCM), an international depository organization under the Budapest Treaty, and deposited accession number KCCM12109P. Granted.
  • each transformed microorganism was 5 mL of LB liquid medium containing an ampicillin antibiotic. Inoculated into the culture tube containing, and the seed culture was carried out in a 37 °C shaking incubator until the absorbance at 2.0 nm 600. The seed cultured culture was inoculated into a culture flask containing a liquid medium containing LB and lactose, a protein expression regulator, to carry out the main culture. The seed culture and main culture were carried out at a stirring speed of 180 rpm and 37 °C conditions.
  • the culture medium was recovered after centrifugation at 4 ° C. for 20 minutes at 8,000 rpm.
  • the recovered cells were washed twice with 50 mM Tris-HCl (pH 8.0) buffer and suspended in 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 10 mM imidazole and 300 mM NaCl. It was.
  • the suspended cells were disrupted by using a sonicator, and the cell lysate was centrifuged at 4 ° C. at 13,000 rpm for 20 minutes, and only the supernatant was taken.
  • the supernatant was purified using His-taq affinity chromatography, followed by flowing 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 20 mM imidazole and 300 mM NaCl in 10 times the amount of the filler to make it nonspecific. The bindable protein was removed. Thereafter, 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 250 mM imidazole and 300 mM NaCl was further eluted and purified. Purified enzyme CJ_DT_F4E for characterization was obtained.
  • Example 3- 3 recombination Evaluation of the Conversion Activity of Enzyme Fructose to Tagatose
  • Tagatose the fructose and product remaining after the reaction, was quantified using HPLC.
  • HPLC analysis was performed using Shodex Sugar SP0810 column, the column temperature was 80 °C, the flow rate of the water of the mobile phase was flowed at 1 mL / min (Fig. 7).
  • Example 3-4 Confirmation of activity of recombinant enzyme according to temperature
  • CJ_DT_F4E showed the maximum activity at 60 °C, it was confirmed that at least 80% of the maximum activity at 50 °C to 70 °C, maintaining at least 95% of the maximum activity at 55 °C to 70 °C (Table 1 and Figure 8).
  • CJ_DT_F4E 5 mg / mL of CJ_DT_F4E was added to 50 mM Tris HCl (pH 8.0) buffer containing 5% by weight fructose, and metal ions MgSO 4 and MnSO 4 were added in 1 mM portions to measure enzyme activity. . The case where no metal ion was treated was set as a control (w / o). Tagatose in the reaction complete solution was quantitatively analyzed using HPLC.
  • CJ_DT_F4E was increased by the addition of MnSO 4 and MgSO 4 so that manganese or magnesium ions (or salts thereof) could increase the fructose-4-epimerization activity of CJ_DT_F4E (FIG. 9).
  • CJ_DT_F4E was confirmed to increase the activity more than 2.5 times compared to the control group as a result of adding MnSO 4 (Fig. 9).
  • Example 4-1 Preparation of Recombinant Expression Vectors and Transformants Containing Tagatose-6-Phosphate Kinase Gene
  • a tagatose-6-phosphate kinase gene sequence is selected from a thermobipida halotolelans gene sequence registered in Kyoto Encyclopedia of Genes and Genomes (KEGG), and a tagatose-6 derived from thermobipida halotolelans is selected.
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • a tagatose-6 derived from thermobipida halotolelans is selected.
  • amino acid sequence SEQ ID NO: 9
  • nucleotide sequence SEQ ID NO: 10
  • a recombinant expression vector pBT7-C-His-CJ_TH_F4E capable of expressing E. coli, including the nucleotide sequence of the enzyme, was synthesized. Bioneer, Korea).
  • Each recombinant vector was transformed into E. coli BL21 (DE3) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) to produce a recombinant microorganism, and then used by freezing stored in 50% glycerol.
  • the recombinant microorganism was named E. coli BL21 (DE3) / CJ_TH_F4E, and was deposited on March 23, 2018 to the Korean Culture Center of Microorganisms (KCCM), an international depository organization under the Budapest Treaty, and deposited accession number KCCM12235P. Granted.
  • each transformed microorganism was 5 mL of LB liquid medium containing an ampicillin antibiotic. Inoculated into the culture tube containing, and the seed culture was carried out in a 37 °C shaking incubator until the absorbance at 2.0 nm 600. The seed cultured culture was inoculated into a culture flask containing a liquid medium containing LB and lactose, a protein expression regulator, to carry out the main culture. The seed culture and main culture were carried out at a stirring speed of 180 rpm and 37 °C conditions.
  • the culture medium was recovered after centrifugation at 4 ° C. for 20 minutes at 8,000 rpm.
  • the recovered cells were washed twice with 50 mM Tris-HCl (pH 8.0) buffer and suspended in 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 10 mM imidazole and 300 mM NaCl. It was.
  • the suspended cells were disrupted using a sonicator, and the cell debris was centrifuged at 4 ° C. at 13,000 rpm for 20 minutes, and only the supernatant was taken.
  • the supernatant was purified using His-taq affinity chromatography, followed by flowing 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 20 mM imidazole and 300 mM NaCl in 10 times the amount of the filler to make it nonspecific. The bindable protein was removed. Thereafter, 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 250 mM imidazole and 300 mM NaCl was further eluted and purified. The enzyme was purified by dialysis with 50 mM Tris-HCl (pH 8.0) buffer. Purified enzyme CJ_TH_F4E for characterization was obtained.
  • Tagatose the fructose and product remaining after the reaction, was quantified using HPLC.
  • HPLC analysis was performed using Shodex Sugar SP0810 column, the column temperature was 80 °C, the flow rate of the water of the mobile phase was flowed at 1 mL / min (Fig. 11).
  • Example 5 Preparation of tagatose-6-phosphate kinase and evaluation of its activity
  • Example 5-1 Preparation of Recombinant Expression Vectors and Transformants Containing Tagatose-6-Phosphate Kinase Gene
  • a tagatose-6-phosphate kinase gene sequence is selected from a ThermoErobacter indigenous gene sequence registered in Kyoto Encyclopedia of Genes and Genomes (KEGG), and a tagatose derived from Thermoerobacter indiencesis is selected.
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • SEQ ID NO: 11 amino acid sequence
  • SEQ ID NO: 12 nucleotide sequence
  • Each recombinant vector was transformed into E. coli BL21 (DE3) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) to produce a recombinant microorganism, and then used by freezing stored in 50% glycerol.
  • the recombinant microorganism was named E. coli BL21 (DE3) / CJ_TAI_F4E, and was deposited on March 23, 2018 to the Korean Culture Center of Microorganisms (KCCM), an international depository organization under the Budapest Treaty. Granted.
  • each transformed microorganism was 5 mL of LB liquid medium containing an ampicillin antibiotic. Inoculated into the culture tube containing, and the seed culture was carried out in a 37 °C shaking incubator until the absorbance at 2.0 nm 600. The seed cultured culture was inoculated into a culture flask containing a liquid medium containing LB and lactose, a protein expression regulator, to carry out the main culture. The seed culture and main culture were carried out at a stirring speed of 180 rpm and 37 °C conditions.
  • the culture medium was recovered after centrifugation at 4 ° C. for 20 minutes at 8,000 rpm.
  • the recovered cells were washed twice with 50 mM Tris-HCl (pH 8.0) buffer and suspended in 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 10 mM imidazole and 300 mM NaCl. It was.
  • the suspended cells were disrupted using a sonicator, and the cell debris was centrifuged at 4 ° C. at 13,000 rpm for 20 minutes, and only the supernatant was taken.
  • the supernatant was purified using His-taq affinity chromatography, followed by flowing 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 20 mM imidazole and 300 mM NaCl in 10 times the amount of the filler to make it nonspecific. The bindable protein was removed. Thereafter, 50 mM NaH 2 PO 4 (pH 8.0) buffer containing 250 mM imidazole and 300 mM NaCl was further eluted and purified, and then purified by dialysis with 50 mM Tris-HCl (pH 8.0) buffer solution. Purified enzyme CJ_TAI_F4E for characterization was obtained.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 과당-4-에피머화 효소를 포함하는 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법에 관한 것이다.

Description

타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
본 출원은 과당-4-에피머화 효소를 포함하는 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법에 관한 것이다.
타가토스는 우유, 치즈, 카카오 등의 식품, 사과와 귤과 같은 단맛이 나는 천연과일에 소량 존재하는 천연감미료, 물리적 성질 또한 설탕과 비슷하다. 타가토스의 칼로리는 1.5 kcal/g으로 설탕의 1/3 수준이며 GI(Glycemic index, 혈당지수)는 3으로 설탕의 5% 수준인데 반해, 설탕과 유사한 단맛을 내면서 다양한 건강 기능성을 가지고 있기 때문에 여러 제품 적용 시 건강과 맛을 동시에 만족시킬 수 있는 대체 감미료로 이용될 수 있다.
종래 공지된 타가토스의 제조방법은 갈락토스를 주원료로 한 화학적(촉매 반응)방법과 생물학적(이성화 효소반응) 방법이 있다(PCT WO 2006/058092, 대한민국 등록특허 제10-0964091호 및 제10-1368731호 참조). 그러나 상기 종래의 제조방법에서 갈락토스의 기초 원료가 되는 유당은 국제 시장에서의 원유(原乳) 및 유당의 생산량, 수요 및 공급량 등에 따라 가격의 불안정성이 존재하여, 타가토스 생산 원료의 안정적 수급에 한계가 있다. 따라서, 보편화된 당(설탕, 포도당, 과당 등)을 원료로 타가토스를 제조할 수 있는 새로운 방법이 필요하여 연구된 바 상기 문헌들은 포도당과 갈락토스 및 과당으로부터 각각 갈락토스, 사이코스 및 타가토스를 생산하는 방법을 개시하고 있다(대한민국 등록특허 제10-744479호, 제10-1057873호 및 제10-1550796호).
한편, 타가토스-6-인산 키나아제(Tagatose-6-phosphate kinase, EC 2.7.1.144)는 아래 [반응식 1]에서와 같이, ATP 와 D-타가토스 6-인산(D-tagatose 6-phosphate)를 기질로 하여 ADP 와 D-타가토스 1,6-바이포스페이트(D-tagatose 1,6-biphosphate)를 생산하는 것으로 알려져 있으나, 상기 타가토스-6-인산 키나아제가 과당(D-fructose)을 타가토스로 전환시키는 활성을 가지는지에 대한 보고는 전무하다.
[반응식 1]
Figure PCTKR2018003769-appb-I000001
이러한 배경 하에, 본 발명자들은 과당을 타가토스로 전환시키는 활성을 가지는 효소를 개발하기 위하여 예의 연구 노력한 결과 타가토스-6-인산 키나아제(Tagatose-6-phosphate kinase, EC 2.7.1.144)가 과당을 타가토스로 전환시키는 활성이 있음을 확인함으로써, 본 출원을 완성하였다.
본 출원의 일 목적은 타가토스 제조에 유용한 조성물을 제공하기 위한 것으로, 상기 조성물은 타가토스-6-인산 키나아제, 상기 효소를 발현하는 미생물 또는 상기 미생물의 배양물을 포함한다.
본 출원의 다른 목적은 본원의 과당-4-에피머화 효소, 상기 효소를 발현하는 미생물 또는 상기 미생물의 배양물을 과당과 접촉시켜 과당을 타가토스로 전환시키는 단계를 포함하는 타가토스의 제조방법을 제공하는 것이다.
이하, 본 출원의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사 분야에서 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.
에 작동가능하게 연결되어 있는 프로모터(promoter), 전사 종결 신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 유전자는 그 자체 또는 폴리뉴클레오티드 구조체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
본 출원의 미생물은 본 출원의 핵산 또는 본 출원의 재조합 벡터를 포함하여 본 출원의 과당-4-에피머화 효소를 생산할 수 있는 미생물이라면, 원핵 미생물 및 진핵 미생물 어느 것이나 포함될 수 있다. 예를 들면 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주가 포함될 수 있으며, 구체적으로, 대장균(E. coli) 또는 코리네박테리움 글루타미쿰(Corynebacterium corynebacterium glutamicum)일 수 있으나, 이에 제한되지 않는다. 이러한 미생물의 예로는 E. coli BL21(DE3)/CJ_ANT_F4E, E. coli BL21(DE3)/CJ_AB_F4E, E. coli BL21(DE3)/CJ_DT_F4E. E. coli BL21(DE3)/CJ_ANTA_F4E, E. coli BL21(DE3)/CJ_TH_F4E, 또는 E. coli BL21(DE3)/CJ_TAI_F4E 가 있다.
본 출원의 미생물은 상기 핵산 또는 벡터 도입 이외에도 다양한 공지의 방법에 의해 본 출원의 과당-4-에피머화 효소를 발현할 수 있는 미생물을 모두 포함할 수 있다.
본 출원의 미생물의 배양물은 본 출원의 타가토스-6-인산 키나아제를 발현하는 미생물을 배지에서 배양하여 제조된 것일 수 있다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 상기 미생물을 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 7 내지 9)를 조절할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있고, 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양온도는 25 ℃ 내지 40 ℃, 구체적으로는 30℃ 내지 37 ℃를 유지할 수 있으나, 이에 제한되지 않는다. 배양기간은 원하는 유용 물질의 생산량이 수득될 때까지 계속될 수 있으며, 구체적으로는 약 0.5 시간 내지 60 시간 동안 배양할 수 있으나, 이에 제한되지 않는다. 아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
본 출원의 타가토스 생산용 조성물은 추가로 과당을 포함할 수 있다.
본 출원의 타가토스 생산용 조성물은 과당을 직접 타가토스로 전환시키는 과당-4-에피머화 활성을 갖는 타가토스-6-인산 키나아제, 이를 발현하는 미생물 또는 상기 미생물의 배양물을 포함하는 것으로서, 기질인 과당 이외에 다른 효소를 포함하지 않는 것을 특징으로 할 수 있다.
예를 들어 α-글루칸 포스포릴라아제(α-glucan phosphorylase), 전분 포스포릴라아제(starch phosphorylase), 말토덱스트린 포스포릴라아제(maltodextrin phosphorylase) 또는 수크로오스 포스포릴라아제(sucrose phosphorylase), 이를 발현하는 미생물 또는 상기 미생물의 배양물;
포도당 인산화 효소(glucokinase), 이를 발현하는 미생물 또는 상기 미생물의 배양물;
타가토스-6-인산 탈인산화 효소, 이를 발현하는 미생물 또는 상기 미생물의 배양물; 및/또는
α-아밀라아제(α-amylase), 풀루란아제(pullulanase), 글루코아밀라아제(glucoamylase), 수크라아제(sucrase) 또는 이소아밀라아제(isoamylase); 상기 아밀라아제, 풀루란아제, 글루코아밀라아제, 수크라아제 또는 이소아밀라아제를 발현하는 미생물; 또는 상기 아밀라아제, 풀루란아제, 글루코아밀라아제, 수크라아제 또는 이소아밀라아제를 발현하는 미생물의 배양물을 포함하지 않는 것을 특징으로 할 수 있다.
본 출원의 타가토스 생산용 조성물은 당해 타가토스 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있다. 이러한 부형제로는, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 타가토스 생산용 조성물은 금속을 추가로 포함할 수 있다. 일 구현예에서, 본 출원의 금속은 2가 양이온을 포함하는 금속일 수 있다. 구체적으로 본 출원의 금속은 마그네슘, 니켈, 또는 망간(Mn)일 수 있다. 보다 구체적으로, 본 출원의 금속은 금속이온 또는 금속염일 수 있으며, 보다 더 구체적으로 상기 금속염은 MgCl2, MgSO4, NiSO4, NiCl2, MnCl2 또는 MnSO4일 수 있다.
본 출원은 다른 양태로서, 과당(D-fructose)을 본 출원의 과당-4-에피머화 효소, 상기 효소를 발현하는 미생물 또는 상기 미생물의 배양물과 접촉시켜 상기 과당을 타가토스로 전환하는 단계를 포함하는 타가토스 제조방법을 제공한다.
본 출원의 일 구현예로, 상기 접촉은 pH 5.0 내지 pH 9.0, 온도는 30℃ 내지 80℃ 온도 조건에서, 및/또는 0.5시간 내지 48시간 동안 수행할 수 있다.
구체적으로, 본 출원의 접촉은 pH 6.0 내지 pH 9.0 조건 또는 pH 7.0 내지 pH 9.0 조건에서 수행할 수 있다. 또한, 본 출원의 접촉은 35℃ 내지 80℃, 40℃ 내지 80℃, 45℃ 내지 80℃, 50℃ 내지 80℃, 55℃ 내지 80℃, 60℃ 내지 80℃, 30℃ 내지 70℃, 35℃ 내지 70℃, 40℃ 내지 70℃, 45℃ 내지 70℃, 50℃ 내지 70℃, 55℃ 내지 70℃, 60℃ 내지 70℃, 30℃ 내지 65℃, 35℃ 내지 65℃, 40℃ 내지 65℃, 45℃ 내지 65℃, 50℃ 내지 65℃, 55℃ 내지 65℃, 30℃ 내지 60℃, 35℃ 내지 60℃, 40℃ 내지 60℃, 45℃ 내지 60℃, 50℃ 내지 60℃ 또는 55℃ 내지 60℃ 온도 조건에서 수행할 수 있다. 더불어, 본 출원의 접촉은 0.5시간 내지 36시간 동안, 0.5시간 내지 24시간 동안, 0.5시간 내지 12시간 동안, 0.5시간 내지 6시간 동안, 1시간 내지 48시간 동안, 1시간 내지 36시간 동안, 1시간 내지 24시간 동안, 1시간 내지 12시간 동안, 1시간 내지 6시간 동안, 3시간 내지 48시간 동안, 3시간 내지 36시간 동안, 3시간 내지 24시간 동안, 3시간 내지 12시간 동안, 3시간 내지 6시간 동안, 6시간 내지 48시간 동안, 6시간 내지 36시간 동안, 6시간 내지 24시간 동안, 6시간 내지 12시간 동안, 9시간 내지 48시간 동안, 9시간 내지 36시간 동안, 9시간 내지 24시간 동안, 9시간 내지 12시간 동안 수행할 수 있다.
일 구현예로, 본 출원의 접촉은 금속 존재하에서 수행할 수 있다.
본 출원의 타가토스 제조방법에 있어서, 본 출원의 과당-4-에피머화 효소, 상기 효소를 발현하는 미생물, 상기 미생물의 배양물, 금속, 금속이온 및 금속염은 다른 양태에서 전술한 바와 같다.
본 출원의 제조방법은 제조된 타가토스를 분리 및/또는 정제하는 단계를 추가로 포함할 수 있다. 상기 분리 및/또는 정제는 본 출원의 기술 분야에서 통상적으로 사용하는 방법을 사용할 수 있으며 비제한적인 예로, 투석, 침전, 흡착, 전기영동, 이온교환 크로마토그래피 및 분별 결정 등을 사용할 수 있다. 상기 정제는 하나의 방법만 실시될 수도 있으며, 두 가지 이상의 방법을 함께 실시할 수도 있다.
또한, 본 출원의 제조방법은 상기 분리 및/또는 정제하는 단계의 이전 또는 이후에 탈색 및/또는 탈염을 수행하는 단계를 추가로 포함할 수 있다. 상기 탈색 및/또는 탈염을 실시함으로써 보다 품질이 우수한 타가토스를 얻을 수 있다.
다른 구현예로, 본 출원의 제조방법은 본 출원의 타가토스로 전환하는 단계, 분리 및/또는 정제하는 단계, 또는 탈색 및/또는 탈염 단계 이후 타가토스를 결정화하는 단계를 추가로 포함할 수 있다. 상기 결정화는 통상적으로 사용하는 결정화 방법을 사용하여 수행할 수 있다. 예를 들어, 냉각결정화 방법을 사용하여 결정화를 수행할 수 있다.
다른 구현예로, 본 출원의 제조 방법은 상기 결정화하는 단계 이전에 타가토스를 농축하는 단계를 추가로 포함할 수 있다. 상기 농축은 결정화 효율을 높일 수 있다.
다른 구현예로, 본 출원의 제조방법은 본 출원의 분리 및/또는 정제하는 단계 이후 미반응된 과당을 본 출원의 효소, 상기 효소를 발현하는 미생물 또는 상기 미생물의 배양물과 접촉시키는 단계, 본 출원의 결정화하는 단계 이후 결정이 분리된 모액을 상기 분리 및/또는 정제 단계에 재사용하는 단계, 또는 이의 조합을 추가로 포함할 수 있다. 상기 추가 단계를 통해 타가토스를 더욱 고수율로 수득할 수 있으며 버려지는 과당의 양을 절감할 수 있어 경제적 이점이 있다.
본 출원의 과당-4-에피머화 효소는 내열성이 우수하며 산업적으로 타가토스 생산이 가능하고, 보편화된 당인 과당을 타가토스로 높을 수율로 전환하는 바 경제성이 높은 효과가 있다.
도 1은 본 출원의 일 실시예에 따른 형질전환체에서 생성되고 분리된 타가토스-6-인산 키나아제(CJ_ANT_F4E)의 분자량을 단백질 전기영동(SDS-PAGE) 으로 분석한 결과를 나타낸다.
도 2는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 (CJ_ANT_F4E)가 과당-4-에피머화 효소 활성을 가짐을 보여주는 HPLC 크로마토그래피 결과이다.
도 3은 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 (CJ_ANT_F4E)의 과당-4-에피머화 활성에 있어서 온도 변화에 따른 활성 정도를 보여주는 그래프이다.
도 4는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_AB_F4E가 과당-4-에피머화 효소 활성을 가짐을 나타내는 HPLC 크로마토그래피 그래프이다.
도 5는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_AB_F4E의 온도 변화에 따른 과당-4-에피머화 활성을 보여주는 그래프이다.
도 6은 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_AB_F4E의 금속 첨가에 따른 과당-4-에피머화 활성을 보여주는 그래프이다.
도 7은 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_DT_F4E가 과당-4-에피머화 효소 활성을 나타냄을 보여주는 HPLC 크로마토그래피 그래프이다.
도 8은 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_DT_F4E의 온도 변화에 따른 과당-4-에피머화 활성을 보여주는 그래프이다.
도 9는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 효소 CJ_DT_F4E의 금속 첨가에 따른 과당-4-에피머화 활성을 보여주는 그래프이다.
도 10는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 (CJ_ANTA_F4E)가 과당-4-에피머화 효소 활성을 가짐을 보여주는 HPLC 크로마토그래피 결과이다.
도 11는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 (CJ_TH_F4E)가 과당-4-에피머화 효소 활성을 가짐을 보여주는 HPLC 크로마토그래피 결과이다.
도 12는 본 출원의 일 실시예에서 제조된 타가토스-6-인산 키나아제 (CJ_TAI_F4E)가 과당-4-에피머화 효소 활성을 가짐을 보여주는 HPLC 크로마토그래피 결과이다.
이하, 본 출원에 따른 실시예를 기술함으로써 본 출원을 보다 상세히 설명한다. 다만, 하기의 실시예는 본 출원의 일 예시에 불과하며, 본 출원의 내용이 이에 한정되는 것으로 해석되어서는 아니된다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 첨부된 청구항에 제시된 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예 1 : 타가토스-6-인산 키나아제의 제조 및 그 활성 평가
실시예 1-1: 타가토스-6-인산 키나아제 유전자를 포함하는 재조합 발현벡터들 및 형질전환체들의 제조
신규 내열성의 과당-4-에피머화 효소를 제공하기 위해 2종의 아네로리네아 써모필리아 (Anaerolinea thermophile)에서 유래한 타가토스-6-인산 키나아제 유전자 정보를 확보하여 대장균 발현 가능 벡터 및 형질전환 미생물(형질전환체)을 제조하였다.
구체적으로, KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록된 아네로리네아 써모필리아 유전자 서열들을 대상으로 타가토스-6-인산 키나아제 유전자 서열을 선발하였고, 아네로리네아 써모필리아의 아미노산 서열 (서열번호 1)과 염기 서열 (서열번호 2) 및 아미노산 서열 (서열번호 7)과 염기 서열 (서열번호 8)을 바탕으로 대장균 발현 가능 벡터인 pBT7-C-His에 삽입하여 제작된 재조합 발현벡터를 바이오니아에 합성 의뢰하였다. 재조합 발현벡터를 사용하기 위해, 아네로리네아 써모필리아의 Genomic DNA를 이용하여, 프라이머 1: ATATACATATGATGTTCGGCTCGCCTGCTCCCCTGCTG(서열번호 13) 과 프라이머 2: TGGTGCTCGAGCCCGCACGCCGCAGCGTAATCTTCCAG(서열번호 14)를 이용하여, PCR 조건은 94 ℃에서 2분간 변성 후, 94℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 2분 신장을 35회 반복한 후, 72℃에서 5분간 신장반응을 수행하였다.
단백질 발현을 유도하고자 대장균 발현용 균주인 BL21(DE3)에 형질 전환하였고, E. coli BL21(DE3)/CJ_ANT_F4E, E. coli BL21(DE3)/CJ_ANTA_F4E 로 명명하였다. 부다페스트 조약 하에. E. coli BL21(DE3)/CJ_ANT_F4E는 2017년 3월 20일에 기탁번호 KCCM11996P로 기탁되었고, E. coli BL21(DE3)/CJ_ANTA_F4E는 2018년 3월 23일에 기탁번호 KCCM12232P로 기탁되었다.
실시예 1-2 : 재조합 효소의 제조 및 정제
재조합 효소를 제조하기 위해, 상기 실시예 1-1에서 제조된 형질전환체인 E.coli BL21(DE3)/CJ_ANT_F4E, E. coli BL21(DE3)/CJ_ANTA_F4E 를 앰피실린 (ampicillin)이 포함된 LB 액체배지 5ml를 포함하는 배양 튜브에 접종하고, 600nm에서 흡광도가 2.0이 될 때까지 37℃ 진탕 배양기에서 종균 배양을 하였다. 본 종균 배양된 배양액을 LB(Lysogeny broth)와 단백질발현조절인자인 락토스가 함유된 액체배지를 포함하는 배양 플라스크에 접종하여 본 배양을 진행하였다. 상기 배양 과정 중의 교반속도는 180rpm이며, 배양 온도는 37℃가 유지되도록 하였다. 배양액은 8,000rpm으로 4℃에서 20분 동안 원심분리 후 균체를 회수하였다. 회수된 균체는 50 mM Tris-HCl(pH8.0) 완충용액으로 2회 세척하였고, 10mM 이미다졸(imidazole)과 300mM NaCl이 포함되어 있는 50mM NaH2PO4(pH 8.0) 완충용액에 재현탁하였다. 상기 현탁된 균체를 세포파쇄기(sonicator)를 이용하여 파쇄하였으며, 세포 파쇄물은 13,000rpm으로 4℃에서 20분 동안 원심분리 후 상등액만을 취하였다. 상기 상등액은 His-taq 친화 크로마토그래피를 사용하여 정제되었고, 20mM 이미다졸 및 300mM NaCl을 함유하는 50mM NaH2PO4(pH 8.0) 완충용액을 충진제의 10배의 액량으로 흘려주어 비특이적 결합 가능 단백질을 제거하였다. 최종 250mM 이미다졸 및 300mM NaCl을 함유하는 50mM NaH2PO4(pH8.0) 완충용액을 흘려주어 용출 정제하였으며, 50mM Tris-HCl(pH 8.0) 완충용액으로 투석 후 효소 특성 분석을 위한 효소 2종(CJ_ANT_F4E, CJ_ANTA_F4E)을 확보하였다. 그 결과, 정제된 재조합 과당-4-에피머화 효소는 SDS-PAGE분석을 통하여 CJ_ANT_F4E가 약 47kDa인 것을 확인하였다(도 1).
실시예 1-3 : 과당으로부터 타가토스로의 전환 활성 평가
상기 실시예 1-2에서 얻어진 효소들의 활성을 측정하기 위하여, 30 중량% 과당을 사용하였고, 여기에 50mM Tris-HCl (pH 8.0), 1mM CoSO4, 상기 실시예 1-2에서 분리된 20mg/ml 정제효소를 첨가하여 온도 60℃에서 2시간 반응하였다. 과당-4-에피머화 효소 CJ_ANT_F4E, CJ_ANTA_F4E 에 의해 전환된 타가토스의 농도 및 과당으로부터 타가토스로 전환된 전환율을 확인한 결과, CJ_ANT_F4E의 전환율은 16.1 %, CJ_ANTA_F4E의 전환율은 21.9%였다. 상기 전환율은 다음 식으로 산출되었다: 전환율=타가토스 생성량/과당 기질 농도 X 100
또한, 반응 후 잔존하는 과당과 생성물인 타가토스의 경우 HPLC를 이용하여 정량하였다. 사용한 컬럼은 Shodex Sugar SP0810이고, 컬럼 온도를 80℃로 하였으며, 이동상인 물의 유속은 1ml/분으로 흘려주었다. 도 2 및 도 10 에 HPLC 크로마토그래피를 이용하여 과당을 기질로 하는 상기 효소의 반응을 나타내는 피크를 검출 정량하였다.
실시예 1-4 : 과당-4- 에피머화 활성에 대한 온도의 영향
본 출원의 효소의 에피머화 활성에 대한 온도 영향성을 조사하기 위하여 과당을 포함하는 50mM Tris HCl (pH8.0) 완충용액에, 상기 실시예 1-2에서 제조된 1mg/ml 정제효소를 첨가하여 50℃ 내지 80℃에서 3시간 반응하였고, 반응 완료액은 HPLC를 이용하여 타가토스를 정량 분석하였다. 그 결과, 본 출원의 CJ_ANT_F4E 효소는 70℃에서 최대활성을 나타내었다(도 3).
실시예 2 : 타가토스-6-인산 키나아제의 제조 및 그 활성 평가
실시예 2-1: 타가토스-6-인산 키나아제 유전자를 포함하는 재조합 발현벡터들 및 형질전환체들의 제조
본 발명자들은 언에로리네 박테리움(Anaerolineae bacterium) Taxon ID : 2654588098 유래 타가토스-6-인산 키나아제 유전자 정보를 확보하여 대장균 발현 가능 재조합 벡터 및 형질전환 미생물을 제조하였다.
더욱 구체적으로는, KEGG(Kyoto Encyclopedia of Genes and Genomes) 및 ENA(European Nucleotide Archive)에 등록된 언에로리네 박테리움 유전자 서열을 대상으로 타가토스-6-인산 키나아제 유전자 서열을 선발하여, 언에로리네 박테리움 유래 타가토스-6-인산 키나아제 CJ_AB_F4E의 아미노산 서열(서열번호 3) 및 염기 서열(서열번호 4) 정보를 바탕으로 상기 효소의 염기서열을 포함하는 대장균 발현 가능한 재조합 발현벡터 pBT7-C-His-CJ_AB_F4E를 제조하였다(㈜바이오니아, 대한민국).
상기 각각의 재조합 벡터는 열 충격(heat shock transformation, Sambrook and Russell: Molecular cloning, 2001)에 의하여 대장균 BL21(DE3)에 형질전환 한 후, 50% 글리세롤에 냉동 보관하여 사용하였다. 상기 형질전환 균주를 E. coli BL21(DE3)/CJ_AB_F4E 로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국 미생물 보존센터(Korean Culture Center of Microorganisms, KCCM)에 2017년 08월 11일자로 기탁하여 기탁번호 KCCM12093P를 부여받았다.
실시예 2-2 : 재조합 효소의 제조 및 정제
상기 실시예 2-1에 따라 제조한 형질전환 균주 E. coli BL21(DE3)/CJ_AB_F4E 유래의 CJ_AB_F4E로부터 본 출원 재조합 효소를 수득하기 위하여, 상기 각각의 형질전환 미생물을 앰피실린(ampicillin) 항생제가 포함된 LB 액체배지 5 mL를 포함하는 배양 튜브에 접종하고, 600 nm에서 흡광도가 2.0이 될 때까지 37℃ 진탕 배양기에서 종균 배양을 하였다. 본 종균 배양된 배양액을 LB와 단백질 발현조절인자인 유당이 함유된 액체배지를 포함하는 배양 플라스크에 접종하여 본 배양을 진행하였다. 상기 종균 배양 및 본배양은 교반속도 180 rpm 및 37℃ 조건에서 실시하였다. 이어서, 상기 배양액을 8,000 rpm으로 4℃에서 20분 동안 원심분리 후 균체를 회수하였다. 회수된 균체를 50 mM Tris-HCl(pH 8.0) 완충용액으로 2회 세척하고, 10 mM 이미다졸(imidazole)과 300 mM NaCl이 포함되어 있는 50 mM NaH2PO4(pH 8.0) 완충용액에 재현탁하였다. 상기 재현탁된 균체를 세포파쇄기(sonicator)를 이용하여 파쇄하고, 세포 파쇄물을 13,000 rpm으로 4℃에서 20분 동안 원심분리 후 상등액만을 취하였다. 상기 상등액을 His-taq 친화 크로마토그래피를 사용하여 정제한 후, 20 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH 8.0) 완충용액을 충진제의 10배의 액량으로 흘려주어 비특이적 결합 가능 단백질을 제거하였다. 다음, 250 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH8.0) 완충용액을 추가로 흘려주어 용출 정제하였고 50 mM Tris-HCl(pH 8.0)완충용액으로 투석하여 효소 특성 분석을 위한 정제효소 CJ_AB_F4E를 확보하였다.
실시예 2-3 : 재조합 효소의 과당으로부터 타가토스로의 전환 활성 평가
상기 실시예 2-2에서 확보한 본 출원 재조합 효소 CJ_AB_F4E의 활성을 측정하기 위하여, 30 중량% 과당에 50 mM Tris-HCl(pH 8.0), 1 mM NiSO4 , 및 각 20 mg/mL의 CJ_AB_F4E를 첨가하여 60℃에서 10시간 동안 반응시켰다.
반응 후 잔존하는 과당 및 생성물인 타가토스는 HPLC를 이용하여 정량하였다. HPLC 분석은 Shodex Sugar SP0810 컬럼을 이용하였고, 컬럼 온도는 80℃, 이동상인 물의 유속은 1 mL/min으로 흘려주었다(도 4).
실험 결과, 상기 효소에 의하여 과당으로부터 타가토스로 전환된 전환율은 5.1%임을 확인하였다.
실시예 2-4 : 재조합 효소의 온도 변화에 따른 활성 확인
상기 실시예 2-2에서 수득한 재조합 효소 CJ_AB_F4E의 과당-4-에피머화 활성에 대한 온도의 영향력을 조사하기 위하여 10 중량% 과당을 포함하는 50 mM Tris HCl(pH 8.0) 완충용액에 1mg/mL CJ_AB_F4E를 첨가하여 45℃, 50℃, 55℃, 60℃ 및 70℃의 다양한 온도에서 3시간 동안 반응시켰다. 반응이 완료된 후 반응액 내의 타가토스는 HPLC를 이용하여 정량 분석하였다.
실험 결과, CJ_AB_F4E 효소는 65℃에서 최대활성을 나타내었으며, CJ_AB_F4E는 50℃ 내지 70℃에서 최대 활성의 50% 이상을 유지함을 확인할 수 있었다(도 5).
실시예 2- 5 : 금속이온 첨가에 따른 재조합 효소의 활성 확인
종래 공지된 이성화 효소, 예컨대 포도당 이성화 효소 및 아라비노스 이성화 효소 및 에피머효소, 예컨대 사이코스 3-에피머화 효소는 금속이온을 요구하는 것으로 알려져 있다. 따라서 상기 실시예 2-2에서 수득한 본 출원 재조합 효소 CJ_AB_F4E도 금속이온이 과당-4-에피머화 활성에 영향을 미치는지 여부를 확인하였다.
더욱 구체적으로, 10 중량% 과당을 포함하는 50 mM Tris HCl(pH 8.0) 완충용액에, 2 mg/mL의 CJ_AB_F4E를 첨가하고, 다양한 금속이온 NiSO4, CaCl2, ZnSO4, MgSO4, MnSO4, FeSO4, CuSO4, 또는 (NH4)2SO4 을 각 1 mM씩 첨가하여 효소활성을 측정하였다. 금속이온을 처리하지 않은 경우를 대조군으로 설정하였다. 상기 반응이 완료된 후 반응액 내의 타가토스는 HPLC를 이용하여 정량 분석하였다.
실험 결과, CJ_AB_F4E 효소는 MnSO4, 또는 NiSO4 의 첨가에 의하여 활성이 증가하는 것으로 나타나 망간이온이나 니켈이온 등 금속이온의 요구성이 있음을 알 수 있었다. 특히, NiSO4를 첨가한 경우 최대 활성을 보임을 확인하였다(도 6).
실시예 3 : 타가토스-6-인산 키나아제의 제조 및 그 활성 평가
실시예 3-1: 타가토스-6-인산 키나아제 유전자를 포함하는 재조합 발현벡터들 및 형질전환체들의 제조
신규 내열성의 과당-4-에피머화 효소를 발굴하기 위해 딕티오글로무스 써모필움(Dictyoglomus thermophilum) DSM 3960 유래 타가토스-6-인산 키나아제 유전자 정보를 확보하여 대장균 발현 가능 재조합 벡터 및 형질전환된 재조합 미생물을 제조하였다.
구체적으로, KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록된 딕티오글로무스 써모필움 유전자 서열을 대상으로 타가토스-6-인산 키나아제 유전자 서열을 선발하여, 딕티오글로무스 써모필움 유래 타가토스-6-인산 키나아제 CJ_DT_F4E 의 아미노산 서열(서열번호 5) 및 염기서열(서열번호 6) 정보를 바탕으로 상기 효소의 염기서열을 포함하는 대장균 발현 가능한 재조합 발현벡터 pBT7-C-His-CJ_DT_F4E 를 합성하였다(㈜바이오니아,대한민국).
상기 각 재조합 벡터는 열 충격(heat shock transformation, Sambrook and Russell: Molecular cloning, 2001)에 의하여 대장균 BL21(DE3)에 형질전환하여 재조합 미생물을 제조한 후, 50% 글리세롤에 냉동 보관하여 사용하였다. 상기 재조합 미생물을 E. coli BL21(DE3)/CJ_DT_F4E 로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 2017년 9월 13일자로 기탁하여 기탁번호 KCCM12109P 를 부여받았다.
실시예 3-2 : 재조합 효소의 제조 및 정제
상기 실시예 3-1에서 제조한 재조합 미생물 균주 E. coli BL21(DE3)/CJ_DT_F4E로부터 재조합 효소 CJ_DT_F4E 를 제조하기 위하여, 각각의 형질전환 미생물을 앰피실린(ampicillin) 항생제가 포함된 LB 액체배지 5 mL를 포함하는 배양 튜브에 접종하고, 600 nm에서 흡광도가 2.0이 될 때까지 37℃ 진탕 배양기에서 종균 배양을 하였다. 본 종균 배양된 배양액을 LB와 단백질 발현조절인자인 유당이 함유된 액체배지를 포함하는 배양 플라스크에 접종하여 본 배양을 진행하였다. 상기 종균 배양 및 본배양은 교반속도 180 rpm 및 37℃ 조건에서 실시하였다. 이후, 상기 배양액을 8,000 rpm으로 4℃에서 20분 동안 원심분리 후 균체를 회수하였다. 회수된 균체를 50 mM Tris-HCl(pH 8.0) 완충용액으로 2회 세척하고, 10 mM 이미다졸(imidazole)과 300 mM NaCl이 포함되어 있는 50 mM NaH2PO4(pH 8.0) 완충용액에 현탁하였다. 상기 현탁된 균체를 세포파쇄기(sonicator)를 이용하여 파쇄하고, 세포 파쇄물을 13,000 rpm으로 4℃에서 20분 동안 원심분리 후 상등액만을 취하였다. 상기 상등액을 His-taq 친화 크로마토그래피를 사용하여 정제한 후, 20 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH 8.0) 완충용액을 충진제의 10배의 액량으로 흘려주어 비특이적 결합 가능 단백질을 제거하였다. 이후, 250 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH8.0) 완충용액을 추가로 흘려주어 용출 정제하였으며, 50 mM Tris-HCl(pH 8.0)완충용액으로 투석하여 효소 특성 분석을 위한 정제효소 CJ_DT_F4E 를 확보하였다.
실시예 3- 3 :재조합 효소의 과당으로부터 타가토스로의 전환 활성 평가
상기 실시예 3-2에서 확보한 재조합 효소 CJ_DT_F4E 의 활성을 측정하기 위하여, 30 중량% 과당에 50 mM Tris-HCl(pH 8.0), 1 mM MnSO4 및 5 mg/mL의 CJ_DT_F4E 를 첨가하여 60℃에서 10시간 반응시켰다.
반응 후 잔존하는 과당 및 생성물인 타가토스는 HPLC를 이용하여 정량하였다. HPLC 분석은 Shodex Sugar SP0810 컬럼을 이용하였고, 컬럼 온도는 80℃, 이동상인 물의 유속은 1 mL/min으로 흘려주었다(도 7).
그 결과, 재조합 효소 CJ_DT_F4E에 의하여 과당으로부터 타가토스로 전환된 전환율은 2%임을 확인하였다.
실시예 3-4 : 온도에 따른 재조합 효소의 활성 확인
상기 실시예 3-2에서 수득한 재조합 효소 CJ_DT_F4E의 과당-4-에피머화 활성에 대한 온도 영향력을 조사하기 위하여 5 중량% 과당을 포함하는 50 mM Tris HCl(pH 8.0) 완충용액에, 5mg/mL의 CJ_DT_F4E를 첨가하여 40℃, 50℃, 55℃, 60℃ 및 70℃에서 5시간 동안 반응시켰다. 반응 완료액 내의 타가토스는 HPLC를 이용하여 정량 분석하였다.
그 결과, CJ_DT_F4E 는 60℃ 에서 최대활성을 나타내었으며, 50℃ 내지 70℃에서 최대 활성의 80% 이상, 55℃ 내지 70℃에서 최대 활성의 95% 이상의 활성을 유지함을 확인하였다(표 1 및 도 8).
[표 1] 온도별 상대활성(%)
Figure PCTKR2018003769-appb-I000002
실시예 3-5 : 금속 첨가에 따른 재조합 효소의 활성 확인
상기 실시예 3-2에서 수득한 재조합 효소 CJ_DT_F4E의 과당-4-에피머화 활성에 금속이 영향을 미치는지 확인하였다.
구체적으로, 5 중량% 과당을 포함하는 50 mM Tris HCl(pH 8.0) 완충용액에, 5 mg/mL의 CJ_DT_F4E 를 첨가하고, 금속이온 MgSO4, MnSO4 를 1 mM씩 첨가하여 효소 활성을 측정하였다. 금속이온을 처리하지 않은 경우를 대조군(w/o)으로 설정하였다. 상기 반응 완료액 내의 타가토스는 HPLC를 이용하여 정량 분석하였다.
그 결과, CJ_DT_F4E 는 MnSO4 및 MgSO4의 첨가에 의하여 활성이 증가하여 망간 또는 마그네슘 이온(또는, 이의 염)이 CJ_DT_F4E의 과당-4-에피머화 활성을 증가시킬 수 있음을 확인하였다 (도 9). 특히, CJ_DT_F4E는 MnSO4를 첨가한 결과 대조군에 비하여 2.5배 이상의 활성 증가를 확인하였다(도 9).
실시예 4 : 타가토스-6-인산 키나아제의 제조 및 그 활성 평가
실시예 4-1: 타가토스-6-인산 키나아제 유전자를 포함하는 재조합 발현벡터들 및 형질전환체들의 제조
신규 내열성의 과당-4-에피머화 효소를 발굴하기 위해 써모비피다 할로톨레란스(Thermobifida halotolerans) 유래 타가토스-6-인산 키나아제 유전자 정보를 확보하여 대장균 발현 가능 재조합 벡터 및 형질전환된 재조합 미생물을 제조하였다.
구체적으로, KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록된 써모비피다 할로톨레란스 유전자 서열을 대상으로 타가토스-6-인산 키나아제 유전자 서열을 선발하여, 써모비피다 할로톨레란스 유래 타가토스-6-인산 키나아제 CJ_DT_F4E 의 아미노산 서열(서열번호 9) 및 염기서열(서열번호 10) 정보를 바탕으로 상기 효소의 염기서열을 포함하는 대장균 발현 가능한 재조합 발현벡터 pBT7-C-His-CJ_TH_F4E 를 합성하였다(㈜바이오니아,대한민국).
상기 각 재조합 벡터는 열 충격(heat shock transformation, Sambrook and Russell: Molecular cloning, 2001)에 의하여 대장균 BL21(DE3)에 형질전환하여 재조합 미생물을 제조한 후, 50% 글리세롤에 냉동 보관하여 사용하였다. 상기 재조합 미생물을 E. coli BL21(DE3)/CJ_TH_F4E 로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 2018년 3월 23일자로 기탁하여 기탁번호 KCCM12235P 를 부여받았다.
실시예 4-2 : 재조합 효소의 제조 및 정제
상기 실시예 4-1에서 제조한 재조합 미생물 균주 E. coli BL21(DE3)/ CJ_TH_F4E 로부터 재조합 효소 CJ_TH_F4E 를 제조하기 위하여, 각각의 형질전환 미생물을 앰피실린(ampicillin) 항생제가 포함된 LB 액체배지 5 mL를 포함하는 배양 튜브에 접종하고, 600 nm에서 흡광도가 2.0이 될 때까지 37℃ 진탕 배양기에서 종균 배양을 하였다. 본 종균 배양된 배양액을 LB와 단백질 발현조절인자인 유당이 함유된 액체배지를 포함하는 배양 플라스크에 접종하여 본 배양을 진행하였다. 상기 종균 배양 및 본배양은 교반속도 180 rpm 및 37℃ 조건에서 실시하였다. 이후, 상기 배양액을 8,000 rpm으로 4℃에서 20분 동안 원심분리 후 균체를 회수하였다. 회수된 균체를 50 mM Tris-HCl(pH 8.0) 완충용액으로 2회 세척하고, 10 mM 이미다졸(imidazole)과 300 mM NaCl이 포함되어 있는 50 mM NaH2PO4(pH 8.0) 완충용액에 현탁하였다. 상기 현탁된 균체를 세포파쇄기(sonicator)를 이용하여 파쇄하고, 세포 파쇄물을 13,000 rpm으로 4℃에서 20분 동안 원심분리 후 상등액만을 취하였다. 상기 상등액을 His-taq 친화 크로마토그래피를 사용하여 정제한 후, 20 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH 8.0) 완충용액을 충진제의 10배의 액량으로 흘려주어 비특이적 결합 가능 단백질을 제거하였다. 이후, 250 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH8.0) 완충용액을 추가로 흘려주어 용출 정제하였으며, 50 mM Tris-HCl(pH 8.0) 완충용액으로 투석하여 효소 특성 분석을 위한 정제효소 CJ_TH_F4E 를 확보하였다.
실시예 4-3 :재조합 효소의 과당으로부터 타가토스로의 전환 활성 평가
상기 실시예 4-2에서 확보한 재조합 효소 CJ_TH_F4E 의 활성을 측정하기 위하여, 1 중량% 과당에 50 mM Tris-HCl(pH 8.0), 1 mM MnSO4 및 4 mg/mL의 CJ_TH_F4E 를 첨가하여 55℃에서 4시간 반응시켰다.
반응 후 잔존하는 과당 및 생성물인 타가토스는 HPLC를 이용하여 정량하였다. HPLC 분석은 Shodex Sugar SP0810 컬럼을 이용하였고, 컬럼 온도는 80℃, 이동상인 물의 유속은 1 mL/min으로 흘려주었다(도 11).
그 결과, 재조합 효소 CJ_TH_F4E에 의하여 과당으로부터 타가토스로 전환된 전환율은 0.1%임을 확인하였다.
실시예 5 : 타가토스-6-인산 키나아제의 제조 및 그 활성 평가
실시예 5-1: 타가토스-6-인산 키나아제 유전자를 포함하는 재조합 발현벡터들 및 형질전환체들의 제조
신규 내열성의 과당-4-에피머화 효소를 발굴하기 위해 써모언에로박터 인디엔시스(Thermoanaerobacter indiensis) 유래 타가토스-6-인산 키나아제 유전자 정보를 확보하여 대장균 발현 가능 재조합 벡터 및 형질전환된 재조합 미생물을 제조하였다.
구체적으로, KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록된 써모언에로박터 인디엔시스 유전자 서열을 대상으로 타가토스-6-인산 키나아제 유전자 서열을 선발하여, 써모언에로박터 인디엔시스 유래 타가토스-6-인산 키나아제 CJ_TAI_F4E 의 아미노산 서열(서열번호 11) 및 염기서열(서열번호 12) 정보를 바탕으로 상기 효소의 염기서열을 포함하는 대장균 발현 가능한 재조합 발현벡터 pBT7-C-His-CJ_TAI_F4E 를 합성하였다(㈜바이오니아,대한민국).
상기 각 재조합 벡터는 열 충격(heat shock transformation, Sambrook and Russell: Molecular cloning, 2001)에 의하여 대장균 BL21(DE3)에 형질전환하여 재조합 미생물을 제조한 후, 50% 글리세롤에 냉동 보관하여 사용하였다. 상기 재조합 미생물을 E. coli BL21(DE3)/CJ_TAI_F4E 로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 2018년 3월 23일자로 기탁하여 기탁번호 KCCM12236P 를 부여받았다.
실시예 5-2 : 재조합 효소의 제조 및 정제
상기 실시예 5-1에서 제조한 재조합 미생물 균주 E. coli BL21(DE3)/ CJ_TAI_F4E 로부터 재조합 효소 CJ_TAI_F4E 를 제조하기 위하여, 각각의 형질전환 미생물을 앰피실린(ampicillin) 항생제가 포함된 LB 액체배지 5 mL를 포함하는 배양 튜브에 접종하고, 600 nm에서 흡광도가 2.0이 될 때까지 37℃ 진탕 배양기에서 종균 배양을 하였다. 본 종균 배양된 배양액을 LB와 단백질 발현조절인자인 유당이 함유된 액체배지를 포함하는 배양 플라스크에 접종하여 본 배양을 진행하였다. 상기 종균 배양 및 본배양은 교반속도 180 rpm 및 37℃ 조건에서 실시하였다. 이후, 상기 배양액을 8,000 rpm으로 4℃에서 20분 동안 원심분리 후 균체를 회수하였다. 회수된 균체를 50 mM Tris-HCl(pH 8.0) 완충용액으로 2회 세척하고, 10 mM 이미다졸(imidazole)과 300 mM NaCl이 포함되어 있는 50 mM NaH2PO4(pH 8.0) 완충용액에 현탁하였다. 상기 현탁된 균체를 세포파쇄기(sonicator)를 이용하여 파쇄하고, 세포 파쇄물을 13,000 rpm으로 4℃에서 20분 동안 원심분리 후 상등액만을 취하였다. 상기 상등액을 His-taq 친화 크로마토그래피를 사용하여 정제한 후, 20 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH 8.0) 완충용액을 충진제의 10배의 액량으로 흘려주어 비특이적 결합 가능 단백질을 제거하였다. 이후, 250 mM 이미다졸 및 300 mM NaCl을 함유하는 50 mM NaH2PO4(pH8.0) 완충용액을 추가로 흘려주어 용출 정제하였으며, 50 mM Tris-HCl(pH 8.0)완충용액으로 투석하여 효소 특성 분석을 위한 정제효소 CJ_TAI_F4E 를 확보하였다.
실시예 5-3 :재조합 효소의 과당으로부터 타가토스로의 전환 활성 평가
상기 실시예 5-2에서 확보한 재조합 효소 CJ_TAI_F4E 의 활성을 측정하기 위하여, 5중량% 과당에 50 mM Tris-HCl(pH 8.0), 1 mM MnSO4 및 5 mg/mL의 CJ_TAI_F4E 를 첨가하여 55℃에서 10시간 반응시켰다.
반응 후 잔존하는 과당 및 생성물인 타가토스는 HPLC를 이용하여 정량하였다. HPLC 분석은 Shodex Sugar SP0810 컬럼을 이용하였고, 컬럼 온도는 80℃, 이동상인 물의 유속은 1 mL/min으로 흘려주었다(도 12).
그 결과, 재조합 효소 CJ_TAI_F4E 에 의하여 과당으로부터 타가토스로 전환된 전환율은 8.7%임을 확인하였다.
Figure PCTKR2018003769-appb-I000003
Figure PCTKR2018003769-appb-I000004
Figure PCTKR2018003769-appb-I000005
Figure PCTKR2018003769-appb-I000006
Figure PCTKR2018003769-appb-I000007
Figure PCTKR2018003769-appb-I000008

Claims (6)

  1. 타가토스-6-인산 키나아제, 이를 발현하는 미생물 또는 상기 미생물의 배양물을 포함하는 타가토스 생산용 조성물.
  2. 제1항에 있어서, 상기 조성물은 과당을 추가로 포함하는, 타가토스 생산용조성물.
  3. 제1항에 있어서, 상기 조성물은 서열번호 1, 3, 5, 7, 9, 또는 11의 아미노산 서열로 이루어진 타가토스-6-인산 키나아제를 하나 이상 포함하는 것인, 타가토스 생산용 조성물.
  4. 제1항에 있어서, 상기 타가토스-6-인산 키나아제는 언에어로리네 속(Anaerolineae sp.), 써모비피다 속(The genus of Thermobifida), 써모언에로박터 속(The genus of Thermoanaerobacter), 딕티오글로무스 속(The genus of Dictyoglomus) 유래 효소, 또는 그 변이체인, 타가토스 생산용 조성물.
  5. 과당을, 타가토스-6-인산 키나아제, 이를 발현하는 미생물 또는 상기 미생물의 배양물과 접촉시켜, 상기 과당을 타가토스로 전환시키는 단계를 포함하는 타가토스의 제조 방법.
  6. 제5항에 있어서, 상기 접촉은 pH 5.0 내지 pH 9.0 조건에서, 30℃ 내지 80℃ 온도 조건에서, 또는 0.5시간 내지 48시간 동안 수행하는, 타가토스 제조방법.
PCT/KR2018/003769 2017-03-31 2018-03-30 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법 WO2018182355A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2019552866A JP6961713B2 (ja) 2017-03-31 2018-03-30 タガトース生産用組成物及びこれを用いたタガトースの製造方法
BR112019020338-9A BR112019020338B1 (pt) 2017-03-31 2018-03-30 Método de produção de tagatose
CN201880036242.2A CN111133103B (zh) 2017-03-31 2018-03-30 用于制备塔格糖的组合物和利用其制备塔格糖的方法
MX2019011730A MX2019011730A (es) 2017-03-31 2018-03-30 Composicion para producir tagatosa y procedimiento de produccion de tagatosa usando la misma.
EP18777328.8A EP3604516A4 (en) 2017-03-31 2018-03-30 COMPOSITION FOR THE PRODUCTION OF TAGATOSE AND PROCESS FOR THE PRODUCTION OF TAGATOSE USING IT
CA3057595A CA3057595A1 (en) 2017-03-31 2018-03-30 Composition for producing tagatose and method of producing tagatose using the same
US16/582,629 US11408017B2 (en) 2017-03-31 2019-09-25 Composition for producing tagatose and method of producing tagatose using the same

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR10-2017-0042166 2017-03-31
KR20170042166 2017-03-31
KR20170111494 2017-08-31
KR10-2017-0111494 2017-08-31
KR20170158766 2017-11-24
KR10-2017-0158766 2017-11-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/582,629 Continuation-In-Part US11408017B2 (en) 2017-03-31 2019-09-25 Composition for producing tagatose and method of producing tagatose using the same

Publications (1)

Publication Number Publication Date
WO2018182355A1 true WO2018182355A1 (ko) 2018-10-04

Family

ID=63678103

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/003769 WO2018182355A1 (ko) 2017-03-31 2018-03-30 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법

Country Status (10)

Country Link
US (1) US11408017B2 (ko)
EP (1) EP3604516A4 (ko)
JP (1) JP6961713B2 (ko)
KR (1) KR102076288B1 (ko)
CN (1) CN111133103B (ko)
BR (1) BR112019020338B1 (ko)
CA (1) CA3057595A1 (ko)
MX (1) MX2019011730A (ko)
TW (1) TWI704227B (ko)
WO (1) WO2018182355A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021506228A (ja) * 2017-11-02 2021-02-22 中国科学院天津工業生物技術研究所 新規なタガトース６−リン酸４−エピメラーゼ及びその応用
WO2022095684A1 (zh) * 2020-11-05 2022-05-12 中国科学院天津工业生物技术研究所 重组微生物、其制备方法及在生产塔格糖中的应用
US20220372534A1 (en) * 2018-10-19 2022-11-24 Cj Cheiljedang Corporation Novel fructose-4-epimerase and method for preparing tagatose using same

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180111667A (ko) 2017-03-31 2018-10-11 씨제이제일제당 (주) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
KR102219195B1 (ko) * 2019-08-14 2021-02-24 씨제이제일제당 주식회사 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006058092A2 (en) 2004-11-22 2006-06-01 Cargill, Incorporated Monosaccharide production system
KR100744479B1 (ko) 2005-06-01 2007-08-01 씨제이 주식회사 사이코스 에피머화 효소에 의한 사이코스의 생산 방법
KR100964091B1 (ko) 2008-01-28 2010-06-16 씨제이제일제당 (주) 대두 올리고당을 이용한 타가토스의 제조 방법
KR101057873B1 (ko) 2008-05-30 2011-08-19 주식회사 삼양제넥스 알도헥소오스 에피머라아제 및 이를 이용한 알도헥소오스 에피머의 효소적 제조 방법
KR101368731B1 (ko) 2012-01-19 2014-03-06 씨제이제일제당 (주) 유청 막 투과액 또는 유청 막 투과 분말로부터 타가토스의 제조 원료가 되는 갈락토스를 제조하는 방법
KR20140143109A (ko) * 2013-06-05 2014-12-15 씨제이제일제당 (주) 타가토스의 제조방법
KR101480422B1 (ko) * 2013-07-29 2015-01-13 건국대학교 산학협력단 효소조합 반응에 의한 과당으로부터 타가토스 생산 방법 및 그 조성물
CN106399427A (zh) * 2016-11-01 2017-02-15 中国科学院天津工业生物技术研究所 塔格糖的制备方法

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101610911B1 (ko) * 2013-05-09 2016-04-08 주식회사 삼양사 L-리불로스 5-인산 4-에피머화 효소를 이용한 과당에서 타가토스 생산
US9914919B2 (en) * 2013-07-29 2018-03-13 Samyang Corporation Aldolase, aldolase mutant, and method and composition for producing tagatose by using same
KR101620904B1 (ko) * 2013-10-11 2016-05-23 (주)케비젠 기질 및 효소 컴비네이션 반응을 이용한 프럭토스로부터 타가토스 생산용 조성물 및 이의 용도
KR101638024B1 (ko) * 2014-10-22 2016-07-20 씨제이제일제당(주) 타가토스 제조용 조성물 및 과당으로부터 타가토스를 제조하는 방법
CN107208084B (zh) * 2015-10-02 2019-02-15 博努莫斯有限责任公司 D-塔格糖的酶促合成
KR20180111667A (ko) * 2017-03-31 2018-10-11 씨제이제일제당 (주) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
CN109750024B (zh) * 2017-11-02 2021-12-14 中国科学院天津工业生物技术研究所 一种6磷酸塔格糖4位差向异构酶及其应用

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006058092A2 (en) 2004-11-22 2006-06-01 Cargill, Incorporated Monosaccharide production system
KR100744479B1 (ko) 2005-06-01 2007-08-01 씨제이 주식회사 사이코스 에피머화 효소에 의한 사이코스의 생산 방법
KR100964091B1 (ko) 2008-01-28 2010-06-16 씨제이제일제당 (주) 대두 올리고당을 이용한 타가토스의 제조 방법
KR101057873B1 (ko) 2008-05-30 2011-08-19 주식회사 삼양제넥스 알도헥소오스 에피머라아제 및 이를 이용한 알도헥소오스 에피머의 효소적 제조 방법
KR101368731B1 (ko) 2012-01-19 2014-03-06 씨제이제일제당 (주) 유청 막 투과액 또는 유청 막 투과 분말로부터 타가토스의 제조 원료가 되는 갈락토스를 제조하는 방법
KR20140143109A (ko) * 2013-06-05 2014-12-15 씨제이제일제당 (주) 타가토스의 제조방법
KR101550796B1 (ko) 2013-06-05 2015-09-07 씨제이제일제당 (주) 타가토스의 제조방법
KR101480422B1 (ko) * 2013-07-29 2015-01-13 건국대학교 산학협력단 효소조합 반응에 의한 과당으로부터 타가토스 생산 방법 및 그 조성물
CN106399427A (zh) * 2016-11-01 2017-02-15 中国科学院天津工业生物技术研究所 塔格糖的制备方法

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein [O] 25 May 2013 (2013-05-25), "tagatose-6-phosphate kinase [Dictyoglomus turgidum]", XP055560026, retrieved from NCBI Database accession no. WP_012582774.1 *
ITO, SUSUMU: "Catalysis, Structures, and Applications of Carbohydrate Epimerases", JOURNAL OF APPLIED GLYCOSCIENCE, vol. 57, 2010, pages 1 - 6, XP055560010 *
See also references of EP3604516A4
WICHELECKI, D. ET AL.: "ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-altritol and Galactitol Catabolic Pathways in Agrobacterium Tumefaciens C58", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 290, no. 48, 27 November 2015 (2015-11-27), pages 28963 - 28976, XP055560000 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021506228A (ja) * 2017-11-02 2021-02-22 中国科学院天津工業生物技術研究所 新規なタガトース６−リン酸４−エピメラーゼ及びその応用
EP3733843A4 (en) * 2017-11-02 2021-06-23 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences NEW TAGATOSE-6-PHOSPHATE-4-EPIMERASE AND APPLICATION OF IT
JP7266594B2 (ja) 2017-11-02 2023-04-28 中国科学院天津工業生物技術研究所 新規なタガトース６－リン酸４－エピメラーゼ及びその応用
US20220372534A1 (en) * 2018-10-19 2022-11-24 Cj Cheiljedang Corporation Novel fructose-4-epimerase and method for preparing tagatose using same
WO2022095684A1 (zh) * 2020-11-05 2022-05-12 中国科学院天津工业生物技术研究所 重组微生物、其制备方法及在生产塔格糖中的应用

Also Published As

Publication number Publication date
KR20180111679A (ko) 2018-10-11
TWI704227B (zh) 2020-09-11
US20200087689A1 (en) 2020-03-19
CN111133103A (zh) 2020-05-08
TW201842187A (zh) 2018-12-01
US11408017B2 (en) 2022-08-09
CN111133103B (zh) 2024-03-08
BR112019020338A2 (pt) 2020-04-28
EP3604516A1 (en) 2020-02-05
BR112019020338A8 (pt) 2023-04-04
BR112019020338B1 (pt) 2023-05-02
JP2020511974A (ja) 2020-04-23
KR102076288B1 (ko) 2020-02-10
CA3057595A1 (en) 2018-10-04
JP6961713B2 (ja) 2021-11-05
MX2019011730A (es) 2020-12-07
EP3604516A4 (en) 2021-01-20

Similar Documents

Publication Publication Date Title
WO2018182355A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2018182345A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2018182354A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2011040708A2 (en) Immobilization of psicose-epimerase and a method of producing d-psicose using the same
WO2014196811A1 (ko) 타가토스의 제조방법
WO2019117398A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2012030130A2 (ko) 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
WO2019027173A2 (ko) 신규한 싸이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2020067649A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2019112368A1 (ko) 신규한 사이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2019098723A1 (ko) 신규한 d-사이코스 3-에피머화 효소 및 이를 이용한 d-사이코스의 제조 방법
WO2018230953A1 (ko) 글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법
WO2020067786A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2021086035A1 (ko) 프럭토오스 6-포스페이트 4-에피머화 효소 및 이의 용도
WO2021029688A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2021150019A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조 방법
WO2022211288A1 (ko) 과당 제조용 조성물 및 제조 방법
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
WO2024144124A1 (ko) 푸코실락토오스를 생산하는 재조합 미생물 및 이를 이용한 푸코실락토오스 생산방법
WO2018230946A1 (ko) 신규 내열성 아밀로수크라제 효소 및 이를 이용한 아밀로스의 효소적 제조방법
WO2012115390A2 (ko) 셀로비오스 2-에피머레이즈 또는 엔아세틸 글루코사민 2-에피머레이즈를 이용한 유당으로부터 락툴로스의 제조방법
WO2020080658A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2018230952A1 (ko) 투라노스 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 투라노스 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18777328

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3057595

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019552866

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019020338

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018777328

Country of ref document: EP

Effective date: 20191031

ENP Entry into the national phase

Ref document number: 112019020338

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190927