WO2012030130A2 - 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법 - Google Patents

수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법 Download PDF

Info

Publication number
WO2012030130A2
WO2012030130A2 PCT/KR2011/006382 KR2011006382W WO2012030130A2 WO 2012030130 A2 WO2012030130 A2 WO 2012030130A2 KR 2011006382 W KR2011006382 W KR 2011006382W WO 2012030130 A2 WO2012030130 A2 WO 2012030130A2
Authority
WO
WIPO (PCT)
Prior art keywords
succinic acid
glycerol
sucrose
producing
mutant
Prior art date
Application number
PCT/KR2011/006382
Other languages
English (en)
French (fr)
Other versions
WO2012030130A3 (ko
Inventor
이상엽
이정욱
최솔
이종호
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Priority to MYPI2013000662A priority Critical patent/MY183660A/en
Priority to ES11822105.0T priority patent/ES2602780T3/es
Priority to JP2013527009A priority patent/JP5805768B2/ja
Priority to MX2013002394A priority patent/MX344549B/es
Priority to US13/819,339 priority patent/US8691516B2/en
Priority to AU2011296791A priority patent/AU2011296791B2/en
Priority to DK11822105.0T priority patent/DK2612905T3/en
Priority to CN201180051937.6A priority patent/CN103249832B/zh
Priority to EP11822105.0A priority patent/EP2612905B1/en
Priority to RU2013109055/10A priority patent/RU2537003C2/ru
Priority to NZ607585A priority patent/NZ607585A/en
Priority to CA2809942A priority patent/CA2809942C/en
Priority to BR112013004652-0A priority patent/BR112013004652B1/pt
Publication of WO2012030130A2 publication Critical patent/WO2012030130A2/ko
Publication of WO2012030130A3 publication Critical patent/WO2012030130A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to a succinic acid-producing mutant microorganism which can simultaneously use sucrose and glycerol as a carbon source. More particularly, the present invention relates to succinic acid-producing microorganisms. It relates to a mutant microorganism that can be used simultaneously with and glycerol.
  • Succinic acid is a 4-carbon dicarboxylic acid with various industrial applications.
  • Succinic acid is adipic acid, 1, 4-butanediol, ethylene diamine disuccinate, itaconic acid, gamma butyrolactone ⁇ -aminobutyric acid, and tetrahydrofuran are used as precursors for industrially important chemicals, and the market size of succinic acid is known to be around $ 15 billion (McKinlay). etal. , Appl. Microbiol. Biotechnol., 76: 727, 2007) . In recent decades, bio-based succinic acid production has been Global studies have been conducted (McKinlay et al. , Appl. Microbiol.).
  • Sucrose is equivalent to one-quarter of the glucose price normally used for succinic acid production through microbial fermentation, and glycerol is a by-product, accompanied by the rapid growth of the global biodiesel production industry, resulting in lower prices and proper disposal due to oversupply.
  • the development of the method is required and, therefore, its price is very low and it is continuously decreasing (Miller-Klein Associates, Oct. 2006).
  • microorganisms selectively utilize preferred carbon sources from mixtures of various kinds of carbon sources.
  • most microorganisms have a catabolite repression mechanism that inhibits the use of non-preferred carbon sources when there is a preferred carbon source (Gorke et al. , Nature Reviews, 6: 613,2008).
  • Selective use of carbon sources by the dihydrate inhibition mechanism is best known in the case of coexistence of glucose and lactose in E. coli, discovered by Monod in 1942, in the second stage (diauxie) growth.
  • the preferred carbon source is glucose, and thus lactose, a non-preferred carbon source, shows a growth curve that begins to be consumed after a slight delay after all of the glucose is consumed.
  • glycerol is used as a carbon source, due to the high reduced degree of glycerol, it is twice as high as the sugars such as glucose, xylose, and sucrose to produce phosphoenolpyruvate (PEP), an intermediate of glycolysis. It produces a number of reducing equivalents (NADH, NADPH, FADH 2, etc.), making it a particularly popular carbon source for the production of reducing chemicals (Yazdani et al. , Curr.
  • glycerol can be used faster than glycerol, and saccharides such as sucrose can be used to increase cell growth at higher and faster rates, glycerol can also be used. It can be used as an effective production strategy in the production of reducing chemicals, especially in the production of succinic acid, by rapidly growing the cell while taking advantage of the excellent reducing power.
  • the present inventors have made efforts to develop a method of producing high-purity succinic acid with high efficiency while simultaneously using low-cost sucrose and glycerol, resulting in deletion of a gene encoding fructose phosphotransferase in succinic acid-producing microorganisms.
  • the mechanism of inhibiting catabolism is weakened, so that succinic acid can be produced by using sucrose and glycerol simultaneously, while minimizing by-products and producing pure succinic acid with high efficiency.
  • the present invention was confirmed to be close to the world's highest level.
  • An object of the present invention is to develop a strain that can be used at the same time sucrose and glycerol, while maximizing the yield of succinic acid to the theoretical level, while simultaneously minimizing the production of other by-products, the production of pure succinic acid, the catabolism inhibition mechanism Attenuated mutations provide for microorganisms.
  • Another object of the present invention is to provide a method for producing succinic acid purely without producing by-products other than succinic acid by using sucrose and glycerol as carbon sources under the anaerobic conditions.
  • the present invention in the succinic acid-producing microorganisms, attenuates the mechanism of inhibiting catabolic products of glycerol by sucrose, thereby providing a mutant microorganism which can simultaneously use sucrose and glycerol for succinic acid production.
  • the present invention also provides a method for producing mutant microorganisms in which succinic acid-producing microorganisms attenuate the mechanism of inhibiting catabolic products of glycerol by sucrose to simultaneously use sucrose and glycerol for succinic acid production.
  • the present invention also provides a method for producing succinic acid comprising culturing the succinic acid-producing mutant microorganisms under anaerobic conditions and recovering succinic acid from the culture solution.
  • Figure 1 illustrates the sucrose and glycerol metabolic pathways and catabolic inhibition mechanism in the strains of Maniaia.
  • Figure 1A shows the metabolic pathways of sucrose and glycerol and the metabolic inhibitory mechanism between them, and Figure 1B shows which part of A can be attenuated by metabolic engineering. .
  • GLY glycerol; G3P, glycerol 3-phosphate
  • SCR sucrose
  • G6P glucose 6-phosphate
  • FRU fructose
  • F1P fructose 1-phosphate
  • FBP fructose 1,6-bisphosphate
  • PEP phosphoenolpyruvate
  • SUC succinic acid
  • PYR pyruvic acid
  • IIBCF fructose PTS IIBC unit
  • IIBCS sucrose PTS IIBC unit
  • EI enzyme I
  • HPr histidine protein
  • IIA PTS enzyme IIA
  • Fpr bifunctional fructose-specific IIA / HPr protein
  • AC adenylate cyclase
  • cAMP cyclic AMP
  • CRP cAMP receptor protein
  • M.succiniciproducens PALK (A)
  • B a fed-batch culture growth and metabolite production curve of M.succiniciproducens PALFK
  • C M. succiniciproducens PALKG
  • Figure 3 is a growth and metabolite production curve of fed- batch culture with increased inoculation of M. succiniciproducens PALFK strain.
  • Figure 4A is a schematic diagram showing the MCRB culture method, the solid line represents the flow of liquids (medium, medium containing cells, the medium containing metabolites, etc.), the dotted line indicates the flow of gas (carbon dioxide) It is.
  • B shows growth and metabolite production curves when M. succiniciproducens PALFK strains were cultured using the MCRB culture method.
  • the present invention relates to a mutant microorganism in which succinic acid-producing microorganisms attenuate the mechanism of inhibiting catabolic product of glycerol by sucrose and simultaneously use sucrose and glycerol for succinic acid production.
  • catabolic product inhibition mechanism when microorganisms are cultivated in a medium in which various kinds of carbon sources are present, selectively utilizes a preferred carbon source, and in order to enable this, most microorganisms have a preferred carbon source. In addition, it has a mechanism of inhibiting the use of non-preferred carbon sources, and this is called a metabolite inhibition mechanism (Gorke et al. , Nature Reviews, 6: 613,2008).
  • sucrose and glycerol could not be used simultaneously for succinic acid production due to the mechanism of inhibiting dihydrate.
  • sucrose which is a preferred carbon source
  • glycerol is consumed later.
  • sucrose is preferred, so if sucrose and glycerol are present at the same time, sucrose is metabolized at a higher rate.
  • Allosteric inhibition refers to the deactivation of fructose 1,6-bisphosphate (FBP) or EIIA by binding to glycerol kinase, which plays a key role in glycerol metabolism.
  • FBP fructose 1,6-bisphosphate
  • EIIA glycerol kinase
  • Figure 1 illustrates the sucrose and glycerol metabolic pathways and catabolic inhibition mechanism in the strains of Maniaia.
  • Figure 1A shows the metabolic pathways of sucrose and glycerol and the metabolic inhibitory mechanism between them, and Figure 1B shows which part of A can be attenuated by metabolic engineering.
  • Solid arrows indicate the metabolic pathway of sucrose or glycerol, and the thickness indicates the relative metabolic rate.
  • the dashed arrows represent the continuous delivery of the phosphoryl group from PEP to the PTS IIBC unit, and the thick dotted arrows represent the various pathways that can induce the expression of glp operon.
  • the mechanism of inhibiting catabolism between sucrose and glycerol is largely composed of transcriptional inhibition by GlpR and allosteric inhibition by FBP and EIIA.
  • Fig. 1B there are various methods such as inducing the generation of various activators to overcome transcriptional inhibition and alleviating allosteric inhibition against GlpK by lowering the concentration of FBP or IIA.
  • the phosphorylated IIA is increased relatively to induce the expression of AC, thereby generating more cAMP, thereby increasing the production of CRP-cAMP.
  • the G3P produced by the expressed GlpK further reduces the transcriptional factor GlpR from the binding sites of the glp regulator (glpABC, glpF, glpK, etc.) DNA to facilitate the transcription of the genes of the glp regulator.
  • the relatively unphosphorylated IIA concentration is kept low, and as the overall metabolism of sucrose decreases due to the elimination of IIBCF, the FBP concentration is relatively decreased, thereby alleviating allosteric inhibition. According to the simultaneous effect of urea, the overall increase in glycerol metabolism.
  • the phosphorylated IIA concentration is increased in (2) of FIG. 1B to induce the expression of AC, thereby producing more cAMP, thereby increasing the production of CRP-cAMP, and thus inducing the expression of glp operon.
  • the G3P produced by the expressed GlpK additionally lowers the transcription inhibitor GlpR from the binding site of the glp regulatory DNA, thereby facilitating the transcription of the genes of the glp regulatory gene, thereby improving overall glycerol metabolism. How to import.
  • G3P produced by the expressed GlpK additionally drops GlpR, which is a transcriptional inhibitor, from the binding sites of the glp regulatory DNA, thereby facilitating the transcription of the genes of the glp regulatory gene, resulting in an overall increase in glycerol metabolism. to be.
  • G3P produced by the expressed GlpK additionally drops GlpR, which is a transcriptional inhibitor, from the binding sites of the glp regulatory DNA, thereby facilitating the transcription of the genes of the glp regulatory gene, leading to an overall increase in glycerol metabolism. Way.
  • GlpK overexpression is induced to increase the production of G3P, which causes GlpR, a transcription inhibitory element, to be dropped from the binding sites of glp regulatory DNA. There is a way to more smoothly and eventually increase the overall glycerol metabolism.
  • a method of blocking the inhibition by GlpR is introduced by introducing an overexpression promoter that does not have a position to which GlpR can bind to a promoter site for expression of each transcription unit of glp regulator on a chromosome.
  • an overexpression promoter that does not have a position to which GlpR can bind to a promoter site for expression of each transcription unit of glp regulator on a chromosome.
  • glycerol kinases from heterologous strains designed to be relatively less susceptible to or less resistant to allosteric inhibition.
  • overexpressing there may be a method of bringing the overall increase of glycerol metabolism, and other methods other than the above-mentioned method may be a method for active metabolism of glycerol by attenuating the metabolism inhibition mechanism.
  • succinic acid is a representative example of such a reducing chemical, a C4 chemical having two carboxyl groups having PEP (phosphoenolpyruvate) as an intermediate precursor.
  • succinic acid-producing microorganisms are microorganisms that produce succinic acid in excess of other metabolites, and mean microorganisms that can be industrially used for succinic acid production by fermentation.
  • Representative succinic acid-producing microorganisms include lumen bacteria, which include Actinobacillus genus, Anaerobiospirillum genus, and Mannheimia genus (including Basfia rates.
  • Basfia genus was originally named Mannheimia genus when isolated, but later separated into Bafia genus.
  • 16S rRNA sequences are also very similar strains, such as 99.8% match, and so including all of them in the genus Mannheimia , Scholten et al., WO2009 / 024294A1; Kuhnert et al., Int. J. Syst. Evol. Microbiol., 60 (44) is known.
  • the succinic acid-producing microorganisms may be characterized in that the lumen bacteria, the lumen bacteria are genus Mannheimia sp . , Actinobacillus sp . Actinobacillus sp . And un-aerobiopyrilium ( Anaerobiospirillum sp . It may be characterized in that selected from the group consisting of.
  • the Mannheimia succiniciproducens PALK (KCTC10973BP) to said Mannheimia spp.
  • the weakening of the catabolic inhibitory mechanism may be performed by deleting a gene encoding fructose phosphotransferase, and the mutant microorganism may be characterized by Mannheimia succiniciproducens PALFK (KCTC11694BP). have.
  • the weakening of the catabolic inhibitory mechanism may be performed by introducing a gene encoding a glycerol kinase, and may be characterized in that the succinic acid-producing mutant microorganism Mannheimia succiniciproducens PALFK (KCTC11694BP).
  • a succinic acid-producing mutant microorganism is produced which does not produce any other organic acid while maximizing the yield of succinic acid through genetic manipulation of lumen bacteria, succinic acid producing microorganisms.
  • Mannheimiasucciniciproducens PALK sikimeuroseo deletions of genomic DNA fructose fructose phosphorylation transferase gene (fruA) encoding the cyclase in (KCTC10973BP), a strain that has the capability to and at the same time metabolic sucrose metabolism glycerol M
  • succiniciproducens PALFK KCTC11694BP
  • the deletion of each gene was used to inactivate the gene using the homologous recombination method, but if the genetic modification method that can modify or remove the gene so that the enzyme encoded by the gene is not produced Can be used without limitation.
  • Cultivation of succinic acid-producing mutant microorganisms and obtaining succinic acid according to the present invention can be carried out using a culture method and a separate purification method of succinic acid conventionally known in the conventional fermentation process.
  • M. succiniciproducens PALFK KCTC11694BP
  • the mutant strain used for this is M. succiniciproducens PALK (KCTC10973BP).
  • M. succiniciproducens PALK (KCTC10973BP) is a gene encoding lactic dehydrogenase ( ldhA ), a gene encoding phosphotransacetylase ( pta ), and a gene encoding acetic kinase ( ackA ) in the genome of the genus Mannheimia .
  • a mutant microorganism that has been deleted is a parental strain that does not have the gene ( fruA ) encoding the fructose phosphotransferase in M. succiniciproducens PALFK (KCTC11694BP), which is the mutant microorganism according to the present invention.
  • the succinic acid-producing mutant microorganism M. succiniciproducens PALFK (KCTC11694BP) according to the present invention minimizes the production of by-products such as lactic acid, pyruvic acid, acetic acid and formic acid, compared to M. succiniciproducens PALK (KCTC10973BP), a mutant strain used for succinic acid production.
  • the yield of succinic acid is almost increased to the theoretical yield level (1.71 to 1.86 mol / mol), which is an excellent characteristic of the succinic acid producing strain.
  • the present invention relates to a method for producing a mutant microorganism in which succinic acid-producing microorganisms attenuate the mechanism of inhibiting catabolic products of glycerol by sucrose and simultaneously use sucrose and glycerol for succinic acid production.
  • KCTC10973BP Mannheimiasucciniciproducens PALK
  • M. succiniciproducens PALKG a strain having the ability to metabolize glycerol while simultaneously metabolizing sucrose.
  • Succinic acid producing mutant microorganism M. succiniciproducens PALKG (KCTC11693BP) according to the present invention was also compared in the same manner.
  • the present invention relates to a method for producing succinic acid, comprising culturing the succinic acid-producing mutant microorganism under anaerobic conditions and recovering succinic acid from the culture medium.
  • the culture may be characterized in that it is carried out in a medium containing sucrose and glycerol at the same time, the production amount of the other organic acid as the by-product may be characterized in that less than 1% of the succinic acid production weight.
  • the present invention (a) attenuates the succinic acid-producing mutant microorganism having high yield and low by-product generation or the catabolic inhibition mechanism of glycerol by the sucrose, thereby simultaneously sucrose and glycerol in succinic acid production. Culturing the available variant microorganisms under anaerobic conditions; (b) concentrating the cell concentration in the culture solution at a high concentration; (c) culturing the high concentration of cells; And (d) recovering succinic acid from the culture solution.
  • the step (b) concentrating the cell concentration in the culture medium to a high concentration may be carried out by the inoculation method (hereinafter referred to as 'inoculum method') or membrane cell recycling bioreactor (MCRB) method (injecting a high concentration of production strain at inoculation)
  • 'inoculum method' the inoculation method
  • MCRB membrane cell recycling bioreactor
  • succinic acid using mutant microorganisms which can simultaneously use sucrose and glycerol to produce succinic acid according to the present invention, it is possible to produce succinic acid with high purity without any by-products, and the yield of succinic acid is close to theoretical yield. It can be produced in yield.
  • sucrose is equivalent to one-quarter of the glucose price normally used for succinic acid production through microbial fermentation, and glycerol is generated as a by-product, along with the rapid growth of the global biodiesel production industry, resulting in lower prices and adequate supply. Development of treatment methods is required, and therefore their prices are very low and they are steadily decreasing (Miller-Klein Associates, Oct. 2006).
  • a gene exchange vector was constructed as follows. First, the genomic DNA of M. succiniciproducens MBEL55E (KCTC0769BP) was used as a template, and the primers of SEQ ID NOS: 1 and 2, SEQ ID NOs: 3 and 4, and SEQ ID NOs: 5 and 6 were used to determine the fruA left homology region (HL) and chloramphenicol (Cm). PCR fragments containing resistance genes, and PCR fragments of each of the fruA right homology regions (HR) were obtained.
  • M. succiniciproducens MBEL55E KCTC0769BP
  • the mutant strain was prepared by deleting fruA in the genome of M. succiniciproducens PALK (KCTC10973BP) using the fruA gene removal vector pSacHR06fruA prepared in Example 1.
  • M. succiniciproducens PALK (KCTC10973BP) was plated in a BHI (Brain-Heart Infusion) solid medium, incubated at 39 ° C. for 36 hours, and colonies were inoculated in 10 mL of BHI liquid medium and incubated for 12 hours. The fully grown cell culture solution was inoculated again with 100 mL of BHI liquid medium and incubated in a 39 ° C. stationary incubator.
  • the bacterial culture solution is placed at 0-4 ° C. for 20 minutes to prevent the cell growth from further progressing, which is 4 ° C. and 4,500 rpm.
  • Cells were obtained by centrifugation for 15 minutes at. Then, the cells were resuspended with 200 mL of 10% glycerol solution at 4 ° C., and then centrifuged again under the same conditions. The resuspension and centrifugation were performed three times while reducing the 10% glycerol solution in half. The final cell obtained was resuspended in an equal volume of 10% glycerol solution, aliquoted and stored at -80 ° C.
  • the obtained cell concentrate was mixed with the gene removal vector pSacHR06fruA prepared in Example 1 and subjected to electroporation under conditions of 2.5 kV, 25 ⁇ F, and 200 ohms to transform M. succiniciproducens PALK (KCTC10973BP) with the vector. Tried.
  • the electroporated cells were then incubated for 1 hour in a 39 ° C. stationary incubator by adding BHI liquid medium, and then the cultures were plated in a BHI solid medium containing 6.8 ⁇ g / mL of antibiotic chloramphenicol, and then in a 39 ° C. incubator. Incubated for at least 48 hours.
  • the mutant strains formed in the medium were cultured in BHI liquid medium containing antibiotics, and genomic DNA of the culture strain was isolated by Rochelle et al. (Rochelle et al. , FEMS Microbiol. Lett. , 100: 59, 1992). PCR was performed using the genomic DNA of the isolated mutant strain as a template, followed by electrophoresis of the obtained PCR product to confirm the deletion of the fruA gene of the genomic DNA. Deletion of the fruA gene was confirmed by performing two PCRs as follows. First, the genomic DNA of the mutant strain was used as a template, and PCR was performed using primers of SEQ ID NOs: 7 and 8 and SEQ ID NOs: 9 and 10, respectively.
  • KCTC11694BP M. succiniciproducens PALFK
  • Example 3 Construction of pME18glpK22 vector and preparation of M. succiniciproducens PALKG strain
  • Genomic DNA of Escherichia coli K-12 MG1655 was used as a template to obtain a DNA containing a gene encoding a Escherichia coli glycerol kinase ( glpK22 ), SEQ ID NOs: 11 and 12, PCR was performed using primers of SEQ ID NOs: 13 and 14 and SEQ ID NOs: 15 and 16, respectively.
  • the three PCR products thus obtained were subjected to PCR again as a template to obtain a PCR product.
  • the 913th base pair of the coding sequence was the guanine, which was originally contained in the glpK gene of E.
  • glpK22 coli K-12 MG1655, to adenosine.
  • the converted glpK22 gene is included, and the glycerol kinase expressed from this gene is known to be less susceptible to allosteric inhibition by FBP and IIA than glpK before the mutation (Pettigrew et al. , J. Bacteriol., 178). : 2846,1996).
  • SEQ ID NO: 13 5'-TTTATACTTTCTACCCAAAAAGCTTCGCTGTAATATG
  • SEQ ID NO: 16 5'-ACCTGCGAGCTCATTATTGATGTGTGCGGGGT
  • the PCR product thus obtained was cloned into the Eco RI and Sac I sites in pME18 (Jang et al. , Appl. Environ. Microbiol. , 73: 5411, 2007) to complete the pME18glpK22 vector.
  • Solgent Solgent, Korea
  • SEQ ID NO: 17 5'-TAGCTATGTGTTAAAGCCTT
  • SEQ ID NO: 19 5'-CCGATTACACCAACGCCTCT
  • SEQ ID NO: 20 5'-ATGTGGTTCCGGCATTTACC
  • the cell suspension was prepared in the same manner as in the preparation method and the electroporation method of Example 2, and instead of the antibiotic chloramphenicol, it was plated on BHI solid medium containing 25 ⁇ g / mL of ampicillin, followed by 48 hours in a 39 ° C. incubator. Incubated. After 8 hours of incubation in BHI liquid medium from pure colonies, the glycerol solution was mixed to a final concentration of 15% (w / v) and stored at -80 ° C until use.
  • Example 4 M.succiniciproducens PALFK strain and the single acid production using a strain PALKG
  • M. succiniciproducens PALFK (KCTC11694BP) or PALKG (KCTC11693BP) strains prepared in Examples 2 and 3 were prepared in 10 mL of MH5 medium containing 10 g / L sucrose (per liter, 2.5 g yeast extract, 2.5 g polypeptone, 1 g NaCl, 0.02 g CaCl 2 ⁇ 2 H 2 O, 0.2 g MgCl 2 ⁇ 6 H 2 O, 8.7 gK 2 HPO 4 , and 10.0 g NaHCO 3 ) incubated for 8 hours at 39 °C under anaerobic conditions, and then again the same medium Transfer to 300 mL and incubated.
  • sucrose per liter, 2.5 g yeast extract, 2.5 g polypeptone, 1 g NaCl, 0.02 g CaCl 2 ⁇ 2 H 2 O, 0.2 g MgCl 2 ⁇ 6 H 2 O, 8.7 gK 2 HPO 4 , and 10.0 g NaHCO
  • the fermentation was carried out with 2.5L of synthetic medium (per liter, 1g NaCl, 2g (NH 4 ) 2 HPO 4 , 0.02gCaCl 2 ⁇ 2H 2 O, 0.2gMgCl 2 ⁇ 6H 2 O, 8.709gK 2 HPO 4 , 0.5gcysteine a reactor containing a microorganism, 0.5gmethionine, 0.5galanine, 0.5gasparagine, 0.5gasparticacid , 2.46gproline, 0.5gserine, 0.005gnicotinicacid, 0.005gCa-pantothenate, 0.005gpyridoxine ⁇ HCl, 0.005g thiamine, 0.005g ascorbic acid and biotin 0.005g) (Bioflo 3000, New Brunswick Scientific Co., Edison, NJ, USA) and inoculated with fermentation conditions of 22.25 g / L (65 mM) initial sucrose concentration, 4.6 g /
  • PALK succiniciproducens PALK (KCTC10973BP), a mutant strain for succinic acid production, was cultured for comparison with the performance of the PALFK strain.
  • the cell concentration in the culture was measured using a spectrophotometer, and the cell concentration was calculated using the absorbance of the previously measured spectrophotometer and the weight verification line of the dry cells. Samples were periodically taken from the bioreactor during the fermentation process. The samples were centrifuged at 13,000 rpm for 10 minutes, and then the concentrations of various metabolites, succinic acid, sucrose and glycerol in the supernatant were analyzed by liquid chromatography (HPLC). ).
  • M.succiniciproducens PALFK (KCTC11694BP) is compared with M. succiniciproducens PALK (KCTC10973BP) strain, it showed a more excellent acid production yields, and not at all produce by-product pure It can be seen that only succinic acid is produced.
  • the amount of glycerol that is reduced to about the same amount as succinic acid increased by 7 times, which is relatively low because it does not mediate pyruvate production, which is directly related to by-product production, unlike when sucrose is used for uptake of glycerol. It is directly related to the production of by-products.
  • the increased glycerol uptake also allows for the use of relatively small amounts of sucrose, yielding higher yields of succinic acid by producing only a single succinic acid with a lower carbon source.
  • M. succiniciproducens PALKG shows a slightly different pattern from PALFK strain, which maintains pyruvate accumulation at PALK levels by increasing glycerol utilization within the range that does not inhibit sucrose availability and cell growth. Is that. Nevertheless, it shows more than twice the glycerol capacity compared to the PALK strain, resulting in succinic acid yield in 1.39 mol / mol, yielding higher yield of succinic acid than 1.24 mol / mol of PALK.
  • PALFK strain reaches the maximum productivity after 13-15 hours after inoculation, it can be seen that the highest cell concentration at this time. Therefore, we first looked at the change in productivity when cell concentration was higher than the current level to maximize productivity.
  • a microbial incubator Bioflo 3000
  • PALFK was fermented and the cell concentration reached an OD 600 value of about 4.6.
  • the culture was terminated, and the cell pellet was obtained by centrifuging the culture solution at 6000 rpm for 10 minutes at room temperature.
  • the obtained cell pellet was again resuspended in 300 mL of MH5 medium to obtain a high concentration of inoculum.
  • succinic acid productivity was 6.03 g / L / h (maximum interval productivity 10.69 g / L / h) at the original fermentation conditions. It can be seen that it increased more than two times, and the degree of byproduct formation and yield were almost similar.
  • MCRB membrane cell recycling bioreactor
  • the MCRB system used a hollow fiber membrane unit (CellFlo Plus Module; Spectrum Laboratories Inc., Collinso Dominguez, CA, USA) connected to a Bioflo 110 reactor (New Brunswick Scientific Co.) for cell circulation. Volume) was maintained at 0.4 L. The stirring speed in the incubator was maintained at 100 rpm, the speed of the diaphragm pump for cell recycling was maintained at 150 mL / min.
  • CellFlo Plus Module Spectrum Laboratories Inc., Collinso Dominguez, CA, USA
  • Bioflo 110 reactor New Brunswick Scientific Co.
  • the composition of the synthetic medium was the same as that used in Example 4, and 0.5 g / L was added only for proline.
  • the initial sucrose concentration in the incubator was 22.25 g / L and the initial glycerol concentration was 4.6 g / L.
  • the feed tank 30 g / L sucrose and 21 g / L glycerol were used.
  • the dilution rate (D) for the MCRB operation was maintained at 1.027 h ⁇ 1 and the cell bleeding rate, which determined growth at steady state, was maintained at 0.015 h ⁇ 1 .
  • steady state means the minimum turnover time (the time it takes to fill the operation volume once when the culture is in progress, depending on the dilution rate.
  • the productivity was increased to 10 times or more (29.73 g / L / h) of the parent strain.
  • the yield of succinic acid was maintained as it is, the degree of by-products were also slightly higher than in the case of Example 4, it was found to maintain a low level.
  • the succinic acid is produced in high productivity (29.73 g / L / h) with high efficiency (1.54 mol / mol) close to the theoretical yield as a strategy for increasing productivity after maximizing production yield and byproduct reduction. Succeeded.
  • the succinic acid productivity presented in this example is more significant because it is ultra high productivity, which has not been achieved by any method before, and moreover was achieved while achieving a yield close to the theoretical value of 1.54 mol / mol.
  • succinic acid-producing mutant microorganism By culturing the succinic acid-producing mutant microorganism according to the present invention, by using both sucrose and glycerol at the same time, it can be produced while maximizing the conventional fermentation yield near the theoretical yield and minimizing the by-products in succinic acid production. In addition, according to the present invention, it is possible to more effectively produce various kinds of reduced chemicals (reduced chemicals), which have conventionally had low production yields.

Landscapes

  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 탄소원으로 수크로오스와 글리세롤을 동시에 이용가능한 숙신산 생산 변이미생물에 관한 것으로, 더욱 자세하게는 숙신산 생성 미생물에 있어서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물에 관한 것이다. 본 발명에 따른 숙신산 생성 변이미생물을 배양하면, 수크로오스와 글리세롤을 동시에 이용하여, 숙신산 생산에 있어 종래의 발효 수율을 이론수율 근방으로 최대화하고 부산물을 최소화 하면서 높은 생산성으로 숙신산을 생산할 수 있다.

Description

수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
본 발명은 탄소원으로 수크로오스와 글리세롤을 동시에 이용가능한 숙신산 생산 변이미생물에 관한 것으로, 더욱 자세하게는 숙신산 생성 미생물에 있어서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물에 관한 것이다.
숙신산은 4개의 탄소로 이루어진 다이카르복실산으로서 다양한 산업적 응용 가능성을 가지고 있다. 숙신산은 아디프산 (adipic acid), 1, 4-부탄디올 (1, 4-butanediol), 에틸렌 다이아민 디서시네이트 (ethylene diamine disuccinate), 이타콘산 (itaconic acid), 감마 부티로락톤 (γ-butyrolactone), 감마 아미노부티르산 (γ-aminobutyric acid), 및 테트라히드로퓨란 (tetrahydrofuran) 등 산업적으로 중요한 화학물질의 전구체로 활용되며, 숙신산 시장규모는 전구체들을 포함하면 약 150억 달러에 이르는 것으로 알려져 있다 (McKinlay etal.,Appl.Microbiol.Biotechnol.,76:727,2007).최근의 환경변화에 따른 지속가능한 개발에 대한 관심과 점점 줄어드는 원유 매장량과 이에 따른 가격변동 등의 이유로 지난 십 수년간 바이오기반 숙신산 생산에 대한 전세계적인 연구가 진행되었다 (McKinlay etal.,Appl.Microbiol.Biotechnol.76:727,2007;Songetal.,EnzymeMicrobialTechnol.,39:352,2006;Jantamaetal.,Biotechnol.Bioeng.,99:1140,2008).하지만, 현재까지 개발된 어떠한 종류의 균주도 부산물 생산을 최소화하면서, 생산성과 수율을 동시에 극대화 할 수는 없었다. 생산성이 높은 경우에는 그 효율이 낮고, 반대로 효율이 높은 경우에는 생산성이 낮았으며, 또한 생산성이 높은 경우에는 많은 부산물들을 같이 생산하는 등, 숙신산만을 단독으로 생산하면서 생산성과 수율을 동시에 높일 수 있는 이상적인 균주의 개발은 현재까지 이루어지지 않은 실정이다 (Jantama etal.,Biotechnol.Bioeng.,99:1140,2008).
수크로오스는 통상적으로 미생물 발효를 통한 숙신산 생산에 사용되는 포도당 가격의 1/4에 해당하고, 글리세롤은 전 세계적인 바이오디젤 생산 산업의 급격한 성장과 함께, 부산물로 발생되어 공급과잉으로 인한 가격하락과 적절한 처리방법의 개발이 요구되며, 따라서 그 가격이 매우 저렴하며, 지속적으로 감소추세에 있다 (Miller-Klein Associates, Oct. 2006).
한편, 대부분의 미생물은 다양한 종류의 탄소원의 혼합물로부터 선호되는 탄소원부터 선택적으로 활용한다. 이를 가능하게 하기위해 대부분의 미생물은 선호되는 탄소원이있을 때, 비선호 탄소원의 이용을 저해하는 이화물저해기작 (catabolite repression mechanism)을 가지고 있다 (Gorke etal.,NatureReviews,6:613,2008).대표적인 이화물저해기작에 의한 탄소원의 선택적이용 현상으로는 1942년 Monod등이 발견한 대장균에서 글루코즈와 락토즈가 동시에 존재할 때, 2단계(diauxie) 성장을 보이는 현상이 가장 잘 알려져 있다. 이때 선호되는 탄소원은 글루코오스이며, 따라서 비선호 탄소원인 락토즈의 경우는 글루코즈가 모두 소모되고 난 후부터 약간의 지연기 후에 소모하기 시작하는 성장곡선을 보이는데 이를 2단계(diauxie) 성장이라 부른다. 일반적인 맨하이미아 균주에 있어서도, 수크로오즈와 글리세롤을 동시에 활용하는 것은 이러한 이화물저해기작 때문에 많은 어려움이 따른다. 그럼에도 불구하고 글리세롤을 탄소원으로 활용하는 것은 많은 이점이 따른다. 글리세롤을 탄소원으로 활용할 경우 글리세롤의 환원된 정도가 높은 특성 때문에, 해당과정의 중간체인 포스포에놀피루베이트 (phosphoenolpyruvate, PEP) 를 생산하는데 있어 글루코스, 자일로스, 및 수크로스 같은 당류에 비해 두 배 많은 환원 등가물 (reducing equivalents, NADH, NADPH, FADH2등)을 생성해 냄으로서, 특히 환원화학물질의 생산에 있어서 각광 받는 탄소원이다 (Yazdani etal.,Curr.Opin.Biotechnol.,18:213,2007).하지만 혐기조건의 많은 경우에 있어서 글리세롤을 이용한 성장속도는 다른 당류의 이용보다 느리기 때문에 글리세롤만을 단독 탄소원으로 활용할 경우에는 환원력제공에 있어서는 우수하지만, 성장자체가 느려 목적 바이오생산품의 생산성을 높이는데 한계를 가지고 있다.
이러한 한계를 극복하기위해 글리세롤보다 이용속도가 높고, 셀의 성장을 더 높은 수준으로 그리고 빠른속도로 가능하게하는 수크로오즈와 같은 당류를 활용하면서, 글리세롤의 활용속도도 증가시킬 수 있다면, 글리세롤의 우수한 환원력제공의 장점을 활용하면서 빠른속도로 셀을 성장시켜 결국 환원화학물질의 생산에 있어서, 특히 숙신산 생산에 있어서, 효과적인 생산전략으로 활용될 수 있다.
이에, 본 발명자들은 저렴한 가격의 수크로오스와 글리세롤을 동시에 이용하면서 고효율로 고순수 숙신산을 생산하는 방법을 개발하고자 예의 노력한 결과, 숙신산 생성 미생물에서, 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자를 결실시키거나 글리세롤 키나제를 코딩하는 유전자를 도입시킨 미생물을 배양하는 경우, 이화산물저해기작이 약화되어, 수크로오스와 글리세롤을 동시에 사용하여 숙신산을 생산할 수 있고, 부산물을 최소화 하고 순수하게 숙신산만을 고효율로 생산하면서, 생산성도 세계최고 수준에 근접할 수 있음을 확인하고 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 수크로오스와 글리세롤을 동시에 이용가능한 균주를 개발하여, 숙신산 생산 수율이 이론수준에 근접하도록 최대화 하면서, 동시에 다른 부산물들의 생산을 극도로 최소화 하여 순수하게 숙신산만을 생산하는 이화산물저해기작이 약화된 변이 미생물을 제공하는데 있다.
본 발명의 다른 목적은 상기 변이 미생물을 혐기조건하에서 수크로오즈 및 글리세롤을 탄소원으로 사용하여 숙신산 이외의 다른 부산물을 생성하지 않고 순수하게 숙신산을 제조하는 방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 숙신산 생성 미생물에 있어서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물을 제공한다.
본 발명은 또한, 숙신산 생성 미생물에서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법을 제공한다.
본 발명은 또한, 상기 숙신산 생성 변이미생물을 혐기적 조건에서 배양하는 단계 및 상기 배양액으로부터 숙신산을 회수하는 단계를 포함하는 숙신산의 제조방법을 제공한다.
도 1은 맨하이미아 균주에서 수크로오스 및 글리세롤 대사 경로와 이화산물저해기작을 도식화 한 것이다. 도 1의 A는 일반적인 수크로오스 및 글리세롤의 대사경로와 이들 간의 이화산물저해기작을 나타낸 것이고, 도1의 B는 A의 어떠한 부분을 대사공학적으로 개량했을때 이화산물저해기작을 약화시킬 수 있는지 나타낸 것이다. (GLY, glycerol; G3P, glycerol 3-phosphate; SCR, sucrose; G6P, glucose 6-phosphate; FRU, fructose; F1P, fructose 1-phosphate; FBP, fructose 1,6-bisphosphate; PEP, phosphoenolpyruvate; SUC, succinic acid; PYR, pyruvic acid; IIBCF, fructose PTS IIBC unit; IIBCS, sucrose PTS IIBC unit; EI, enzyme I; HPr, histidine protein; IIA, PTS enzyme IIA; Fpr, bifunctional fructose-specific IIA/HPr protein; AC, adenylate cyclase; cAMP, cyclic AMP; CRP, cAMP receptor protein)
도 2는 M.succiniciproducensPALK(A),M.succiniciproducensPALFK (B)와 M. succiniciproducens PALKG (C)의 유가식 배양의 성장 및 대사산물 생산 곡선이다.
도 3은 M.succiniciproducensPALFK균주의 접종량을 증가시킨 유가식 배양의 성장 및 대사산물 생산 곡선이다.
도 4의 A는 MCRB 배양방법을 나타낸 모식도이고, 실선은 액체류 (배지, 세포가 포함된 배지, 대사산물이 포함된 배지 등)의 흐름을 표현한 것이고, 점선은 기체 (이산화탄소)의 흐름을 표시한 것이다. B는 MCRB 배양방법을 이용하여 M. succiniciproducens PALFK 균주를 배양하였을 때 성장 및 대사산물 생산 곡선을 나타낸 것이다.
발명의 상세한 설명 및 구체적인 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
일 관점에서, 본 발명은 숙신산 생성 미생물에 있어서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물에 관한 것이다.
본 발명에서 "이화산물 저해기작"이란, 다양한 종류의 탄소원이 존재하는 배지에서 미생물이 배양될 때, 선호되는 탄소원부터 선택적으로 활용하며, 이를 가능하게 하기위해 대부분의 미생물은 선호되는 탄소원이있을 때, 비선호 탄소원의 이용을 저해하는 기작을 가지고 있고, 이를 이화산물 저해기작이라 한다(Gorke etal.,NatureReviews,6:613,2008).
숙신산 생산균주인 맨하이미아 균주에 있어서도, 이화물저해기작으로 인하여, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 활용할 수 없었다.
일반적으로 수크로오스와 글리세롤이 동시에 존재하는 경우에는 선호되는 탄소원인 수크로오스를 먼저 소모하고, 글리세롤을 나중에 소모한다. 맨하이미아에서도 마찬가지로 수크로스를 선호하여 수크로오스와 글리세롤이 동시에 존재하는 경우에는 수크로오스를 더 빠른 속도로 대사하게 된다.
본 발명에서는 이러한, 이화산물 저해기작을 인위적으로 약화하고자 하였다.
이화산물 저해기작의 메카니즘을 자세히 살펴보면 크게는 전사수준의 저해와 알로스테릭 저해 둘로 나뉠 수 있다 (Deutscher etal.,Microbiol.Mol.Biol.Rev.,70:939,2006;Gorkeetal.,Naturereviews,6:613,2008;Pettigrewetal.,J.Bacteriol.,178:2846,1996;Zwaigetal.,J.Bacteriol.,102:753,1970).먼저 전사수준에서는 GlpR regulator의 작용으로 글리세롤을 세포내로 수송하고, 이용하는데 사용되는 유전자들의 전사(transcription)이 저해된다. 알로스테릭 저해는 글리세롤대사에서 핵심적인 기능을 담당하는 글리세롤 키나아제에 fructose 1,6-bisphosphate (FBP) 나 EIIA 등이 결합하여 그 활성을 떨어뜨리는 것을 말한다. 수크로오스와 글리세롤이 동시에 있는 환경에서는 GlpR regulator에 의한 전사수준의 저해와 FBP와 EIIA에 의한 알로스테릭 저해가 동시에 일어나서 글리세롤 대사가 전반적으로 저해된다. 때문에 이러한 이화산물 저해기작을 약화할 수 있는 전략은 GlpR에 의한 전사수준의 저해를 약화하고, FBP나 EIIA에 의한 allosteric 저해를 받지 않게 하는 것이다.
도 1은 맨하이미아 균주에서 수크로오스 및 글리세롤 대사 경로와 이화산물저해기작을 도식화 한 것이다. 도 1의 A는 일반적인 수크로오스 및 글리세롤의 대사경로와 이들 간의 이화산물저해기작을 나타낸 것이고, 도1의 B는 A의 어떠한 부분을 대사공학적으로 개량했을때 이화산물저해기작을 약화시킬 수 있는지 나타낸 것이다. 실선으로된 화살표는 수크로오스나 글리세롤의 대사경로를 나타내고, 그 두께는 상대적인 대사속도를 나타낸다. 가는점선으로 된 화살표는 PEP에서부터 PTS IIBC unit 까지의 인산화기 (phosphoryl group)의 연속적 전달 과정을 나타내며, 굵은 점선으로된 화살표는 glp 오페론의 발현을 유도할 수 있는 다양한 경로를 모식화한 것으로, 인산화된 (phosphorylated) IIA로부터 시작되는 경로, adenylate cyclase (AC) 로부터 시작되는 경로, CRP-cAMP로부터 시작되는 경로, G3P-GlpR 로부터 유도되는 경로 등 다양한 경로가 존재한다. 굵은색 점선으로된 끝이 T자 형으로 막힌 선은 glp 오페론에서 핵심적인 역할을 수행하는 glycerol kinase (GlpK)에 가해지는 인산화 되지 않은 (non-phosphorylated) IIA 및/또는 fructose 1,6-bisphosphate (FBP)에 의한 알로스테릭 저해와 그 정도를 상대적으로 나타낸다.
도 1A에 나타난 바와 같이, 수크로오스와 글리세롤간의 이화산물저해기작은 크게 GlpR등의 의한 전사적 저해 및 FBP 및 EIIA에 의한 알로스테릭 저해로 이루어진다. 이를 극복하기위해서는 그림 1B에 나타난바와 같이 다양한 activator들의 생성을 유도하여 전사적 저해를 극복하고, FBP나 IIA의 농도를 낮춤으로서 GlpK 대한 알로스테릭 저해를 완화하는 등 여러 가지 방법이 있다.
예를 들면, 도 1 B의 (1)에서 IIBCF를 제거함으로서 인산화된 IIA를 의 농도를 상대적으로 높여 AC의 발현을 유도하고, 이를 통해 cAMP가 더많이 생성하게 됨으로서, CRP-cAMP의 생성이 증가하게 되어, 결국 glp 오페론의 발현을 유도하는 방법이 있다. 이렇게 발현된 GlpK에 의해 생성된 G3P는 추가적으로 전사억제 요소인 GlpR을 glp 레귤론 (glpABC, glpF, glpK 등) DNA의 binding site 들로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 한다. 이때 상대적으로 인산화되지 않은 IIA의 농도는 낮게 유지되고, IIBCF의 제거에 따른 전체적인 수크로오스의 대사성능이 떨어짐에 따라 FBP 농도가 상대적으로 줄어들게 되어, 알로스테릭 저해를 완화시키는 것도 가능해지며, 이와같은 2 요소의 동시효과에 따라 글리세롤 대사의 전반적인 증대를 가져오는 방법이다.
다른 예로, 도 1 B의 (2)에서 인산화된 IIA농도를 높여, AC의 발현을 유도하고 이를 통해 cAMP가 더 많이 생성되어, CRP-cAMP의 생성이 증가하게 되고, 결국 glp 오페론의 발현을 유도하는 방법이 있다. 이렇게 발현된 GlpK에 의해 생성된 G3P는 추가적으로 전사억제 요소인 GlpR을 glp 레귤론 DNA의 결합부위(binding site)로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 하여 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이다.
또 다른 예로, 도 1 B의 (3)에서 AC의 과발현을 유도하여, cAMP를 더 많이 합성하게하고, CRP-cAMP의 생성을 증가시켜, 결국 glp 오페론의 발현을 유도하는 방법이 있다. 이렇게 발현된 GlpK에 의해 생성된 G3P는 추가적으로 전사억제 요소인 GlpR을 glp 레귤론 DNA의 결합부위들로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 하여 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이다.
또 다른 예로, 도 1 B의 (4)에서 CRP의 과발현과 (3)에서의 AC의 과발현을 동시에 유도함으로서 CRP-cAMP의 생성을 증가시키고, 결국 glp 오페론의 발현을 유도하는 방법이 있다. 이렇게 발현된 GlpK에 의해 생성된 G3P는 추가적으로 전사억제 요소인 GlpR을 glp 레귤론 DNA의 binding site 들로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 하여 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이다.
또 다른 예로, 도 1 B의 (4)에서 CRP의 과발현을 유도하여, CRP-cAMP의 생성을 증가시켜, 결국 glp 오페론의 발현을 유도하는 방법이 있다. 이렇게 발현된 GlpK에 의해 생성된 G3P는 추가적으로 전사억제 요소인 GlpR을 glp 레귤론 DNA의 결합부위들로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 하여, 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이다.
또 다른 예로, 도 1 B의 (5)에서 GlpK의 과발현을 유도하여, G3P의 생성을 증가시켜, 전사억제 요소인 GlpR을 glp 레귤론 DNA의 binding site 들로부터 떨어뜨려 glp 레귤론의 유전자들의 전사를 더욱 원활하게 하여 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이 있다.
또 다른 예로, glp 레귤론에 포함되는 유전자 전체를 과발현하거나, 각각을 다양한 조합으로 과발현 하여 글리세롤 대사의 증대를 가져오는 방법이 있으며,
또 다른 예로, (5)에서 염색체 상의 glp 레귤론 각 전사단위의 발현을 위한 프로모터 자리에 GlpR이 결합할 수 있는 자리를 가지고 있지 않은 과발현 프로모터를 도입함으로서 GlpR에 의한 저해를 원천적으로 차단하는 방법에 의해 glp 레귤론을 과발현 시키는 방법에 의해 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이 있다.
또한, GlpR을 제거함으로서 glp 레귤론의 발현저해를 약화시켜 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이 있고, 또 다른 예로, 도 1 B의 (6) 및 (7)에서 IIA 및/또는 FBP의 농도를 낮춤으로서 GlpK에 알로스테릭 저해정도를 낮추는 방법에 의한 글리세롤 대사를 증가시키는 방법에 의해 결국 글리세롤 대사의 전반적인 증대를 가져오는 방법이 있다.
또한, 앞서 열거한 방법이외에도, 상기 방법들의 조합으로서 가능한 방법과 이들로부터 자명하게 유추할 수 있는 방법, 예를 들면, 알로스테릭저해를 상대적으로 덜받게 설계되거나 혹은 덜 받는 이종균주 유래의 글리세롤 키나아제를 과발현함으로서 글리세롤 대사의 전반적인 증대를 가져오는 방법이 있을 수 있으며, 앞서 열거한 방법이외의 이화산물저해기작을 약화시켜 글리세롤 대사를 활발하게 할 수 있는 방법 등이 가능하다.
한편, 숙신산은 이러한 환원화학물질의 대표적인 예로서, PEP (phosphoenolpyruvate)를 중간전구체로 가지는 카르복실기가 두 개 있는 C4 화학물질이다. 또한, 숙신산 생성 미생물은 다른 대사산물에 비하여 숙신산을 과량으로 생산하는 미생물로서, 발효에 의한 숙신산 생산에 산업적으로 사용될 수 있는 미생물을 의미한다. 대표적인 숙신산 생성 미생물로는 루멘 박테리아를 들 수 있으며, 루멘 박테리아에는 Actinobacillus 속,Anaerobiospirillum속, 및 Mannheimia 속 (Basfia속도 포함하여 통칭함. Basfia속은 원래 isolation 될 때 Mannheimia 속으로 명명되었으나 후에 Bafia 속으로 분리 되었고, 16S rRNA 서열도 99.8% 일치하는 등의 매우 유사한 균주이므로 여기서는 이를 모두 포함하여 Mannheimia 속으로 통칭함, Scholten etal.,WO2009/024294A1;Kuhnertetal.,Int.J.Syst.Evol.Microbiol.,60:44)등이 알려져 있다. 최근까지 알려진 숙신산을 생산하는 다양한 루멘 박테리아들의 부분적인 유전정보 (16s rRNA), 효소분석 및 발효결과를 살펴보면, 이들 루멘 박테리아의 숙신산 생산을 위한 탄소원의 주요 생합성 경로가 루멘박테리아의 일종인 Mannheimia 속의 숙신산 생산 생합성 경로와 거의 동일 하다는 사실을 알 수 있다. 특히 숙신산 생성에 관여하는 모든 루멘 박테리아는 숙신산 생성시 이산화탄소 고정화 효소들을 이용하여 C3 화학물질인 포스포에놀피루베이트 (phosphoenolpyruvate)와 피루베이트 (pyruvate)를 C4 화학물질인 옥살로아세테이트 (oxaloacetate)와 말레이트 (malate)로 전환한 후 최종적으로 퓨마레이트 (fumarate)를 거쳐 숙신산을 생산한다 (Zeikus etal.,Appl.Microbiol.Biotechnol.,51:545,1999;Leeetal.,Appl.Environ.Microbiol.,72:1939,2006).즉, Mannheimia속을 포함하는 모든 루멘 박테리아가 동일한 숙신산 생합성 경로를 가지므로, 당업자에게 있어서 본 발명의 유전적 변이를 본 실시예에서 보인 M. succiniciproducens 이외의 루멘 박테리아 유래의 숙신산 생산균주에 적용가능함을 예측할 수 있음은 자명하다 하겠다.
본 발명에 있어서, 상기 숙신산 생성 미생물은 루멘박테리아인 것을 특징으로 할 수 있고, 상기 루멘박테리아는 맨하이미아 속 (Mannheimiasp.),액티노바실러스 속 (Actinobacillussp.)및 언에어로바이오스피리륨 (Anaerobiospirillumsp.)으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 Mannheimia 속균주는Mannheimia succiniciproducens PALK (KCTC10973BP)인 것을 특징으로 할 수 있다.
본 발명에 있어서, 이화산물 저해기작의 약화는 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자가 결실시켜 수행하는 것을 특징으로 할 수 있고, 상기 변이미생물은 Mannheimia succiniciproducens PALFK (KCTC11694BP)인 것을 특징으로 할 수 있다.
본 발명에 있어서, 이화산물 저해기작의 약화는 글리세롤 키나제를 코딩하는 유전자를 도입하여 수행되는 것을 특징으로 할 수 있으며, 상기 숙신산 생성 변이미생물 Mannheimia succiniciproducens PALFK (KCTC11694BP)인 것을 특징으로 할 수 있다.
본 발명에서는 숙신산 생산 미생물인 루멘 박테리아의 유전자 조작을 통해 숙신산 생산 수율 최대화 하면서 다른 유기산을 전혀 생산하지 않는 숙신산 생산 변이 미생물을 제작하였다.
본 발명의 일실시예에서, MannheimiasucciniciproducensPALK(KCTC10973BP)의 게놈 DNA에서 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자 (fruA)를 결실시킴으로서, 수크로오스를 대사함과 동시에 글리세롤을 대사하는 능력을 가진 균주인 M. succiniciproducens PALFK (KCTC11694BP)를 제작함으로서, 부산물을 전혀 생산하지 않으면서, 숙신산의 생산성과 수율이 동시에 높은 수준을 유지하는 균주를 제작하였다.
본 발명에서 상기 각 유전자의 결실은 상동성 재조합 방법을 이용하여 해당 유전자의 불활성화시키는 방법을 사용하였으나, 해당유전자에 의해 코딩되는 효소가 생성되지 못하도록 해당유전자를 변형 또는 제거시킬 수 있는 유전자 조작 방법이라면 제한없이 사용가능하다.
본 발명에 따른 숙신산 생성 변이 미생물의 배양 및 숙신산의 수득과정은 종래 발효공정에서 통상적으로 알려진 배양방법 및 숙신산의 분리정제 방법을 사용하여 수행할 수 있다.
본 발명에서 M. succiniciproducens PALFK (KCTC11694BP)의 숙신산 수율과 부산물 생성정도 및 탄소원 대사능력을 기존의 변이균주와 비교하였다. 이를 위해 사용한 변이균주는 M. succiniciproducens PALK (KCTC10973BP)이다. M.succiniciproducensPALK(KCTC10973BP)는 Mannheimia 속 균주의 게놈에서 젖산 탈 수소화효소를 코딩하는 유전자 (ldhA),포스포트랜스아세틸화 효소를 코딩하는 유전자 (pta)및 아세트산키나제를 코딩하는 유전자 (ackA)가 결실 되어 있는 변이 미생물로서, 본 발명에 따른 변이 미생물인 M. succiniciproducens PALFK (KCTC11694BP)에서 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자 (fruA)가 결실 되지 않은 모 균주이다.
본 발명에 따른 숙신산 생성 변이 미생물 M. succiniciproducens PALFK (KCTC11694BP)는 숙신산 생산에 사용되는 변이균주인 M. succiniciproducens PALK (KCTC10973BP)과 비교하여, 젖산, 피루브산, 초산, 개미산 등의 부산물 생산을 최소화 하였고, 숙신산 생산수율을 거의 이론수율 수준 (1.71~1.86 mol/mol)으로 높여, 숙신산 생산균주로서 뛰어난 특징을 나타낸다.
또 다른 관점에서, 본 발명은 숙신산 생성 미생물에서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법에 관한 것이다.
본 발명의 일실시예에서, MannheimiasucciniciproducensPALK(KCTC10973BP)의 게놈 DNA에 대장균의 글리세롤 키나제를 코딩하는 유전자를 도입시킴으로서, 수크로오스를 대사함과 동시에 글리세롤을을 대사하는 능력을 가진 균주인 M. succiniciproducens PALKG (KCTC11693BP)를 제작함으로서, 부산물을 전혀 생산하지 않으면서, 숙신산의 생산성과 수율이 동시에 높은 수준을 유지하는 균주를 제작하였다.
본 발명에 따른 숙신산 생성 변이 미생물 M. succiniciproducens PALKG (KCTC11693BP)도 상기와 같은 방식으로 비교하였다.
또 다른 관점에서, 본 발명은 상기 숙신산 생성 변이미생물을 혐기적 조건에서 배양하는 단계 및 상기 배양액으로부터 숙신산을 회수하는 단계를 포함하는 숙신산의 제조방법에 관한 것이다.
본 발명에 있어서, 상기 배양은 수크로오스와 글리세롤이 동시에 함유된 배지에서 수행되는 것을 특징으로 할 수 있고, 상기 부산물로서 다른 유기산의 생성량은 숙신산 생성 중량의 1% 이하인 것을 특징으로 할 수 있다.
또 다른 관점에서, 본 발명은 (a) 높은수율을 가지며 부산물 생성이 낮은 숙신산 생산 변이미생물 또는 상기 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물을 혐기적 조건에서 배양하는 단계; (b) 상기 배양액 내의 세포농도를 고농도로 농축시키는 단계; (c) 상기 고농도의 세포를 배양하는 단계; 및 (d) 상기 배양액으로부터 숙신산을 회수하는 단계.를 포함하는 숙신산 생성능이 향상된 숙신산의 제조방법에 관한 것이다.
본 발명에 있어서, 상기 (b) 배양액 내의 세포농도를 고농도로 농축시키는 단계는 접종시 고농도의 생산균주를 주입하는 이노큘럼 법 (이하 '이노큘럼 법') 또는 membrane cell recycling bioreactor (MCRB) 방법 (이하 'MCRB 법') 으로 수행되는 방법을 포함하는 것을 특징으로 할 수 있다.
본 발명에 따른 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물을 이용한 숙신산의 생산방법에 의하면 부산물이 전혀 없이 고순도로 숙신산을 생산가능하며, 이때 숙신산 생산 수율은 이론수율에 근접하는 초 고수율로 생산가능하다. 또한 수크로오스는 통상적으로 미생물 발효를 통한 숙신산 생산에 사용되는 포도당 가격의 1/4에 해당하고, 글리세롤은 전 세계적인 바이오디젤 생산 산업의 급격한 성장과 함께, 부산물로 발생되어 공급과잉으로 인한 가격하락과 적절한 처리방법의 개발이 요구되며, 따라서 그 가격이 매우 저렴하며, 지속적으로 감소추세에 있다 (Miller-Klein Associates, Oct. 2006). 이는 원료물질로서 막대한 원료비용의 절감을 통하여 현재 화학합성법에 의하여 생산되고 있는 숙신산을 미생물 발효를 통하여 저렴하게 생산할 수 있게 한다는 측면, 그리고 숙신산 생산 수율을 이론수율에 근접하는 초 고효율로 생산한다는 측면, 또한 분리 정제에 드는 비용을 최소화 할 수 있도록 초 고순도로 생산가능하다는 측면에서 그 가치가 매우 높다고 할 수 있다.
본 발명에 따른 PALFK 균주를 이용하면, 부산물을 거의 완벽히 제거시키면서 단일 숙신산만 생산할 수 있으며, 이때 숙신산 생산 수율 (yield)은 거의 이론 수율 (1.71~1.86 mol/mol)에 근접한 매우 높은 수율을 얻을 수 있다. 생산성 (productivity), 수율 (yield), 부산물정도 (byproducts/succinic acid 비율)의 세 요소는 숙신산 생산공정의 산업화에 있어 가장 핵심적인 요소로서, 생산성 공장규모와 연계되어 초기공장설립비용 (capital cost) 및 에너지 비용 (energy cost)과 관계있고, 수율은 원료물질을 얼마나 효과적으로 사용하는가에 관한 척도로 바이오공정에서 상당부분을 차지하는 원료비용 (raw material cost)과 관계가 있으며, 부산물정도의 바이오공정 전체비용의 절반이상을 차지하는 분리정제비용 (separation and purification cost)과 관계가 있다.
따라서 본 발명의 일 실시예에서는 PALFK균주를 이용하여 수율을 최대화하고 부산물 생산정도를 최소화함으로서, 앞서 언급한 세가지 핵심요소 중 두 가지(수율 및 부산물 정도)를 달성가능한 극단적인 수준으로 향상시켰으므로, 생산성을 향상시키기 위한 방법을 찾기 위하여 예의 노력하였으며, 그 결과 이노큘럼법 및 MCRB 법을 활용하는 등의 배양액 내의 세포농도를 증가시키는 것에 의해서 모균주에 비하여 각각 2배 및 10배 이상으로 생산성 향상되는 것을 확인하였다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
특히, 하기 실시예에서는 본 발명에 따른 유전자를 제거하기 위하여 특정 벡터와 숙주세포로 숙신산 생성 미생물인 맨하이미아 속 미생물 만을 예시하였으나, 다른 종류의 숙신산 생성 미생물들을 사용하여도 순수 숙신산 생성 변이 미생물을 수득할 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 자명한 사항이라 할 것이다.
실시예 1: fruA결실벡터 (pSacHR06fruA)의 제작
숙신산 생성 미생물의 게놈으로부터 fruA유전자(프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자)를 상동성 재조합 방법으로 제거하기 위하여, 유전자 교환벡터를 다음과 같이 제작하였다. 먼저 M. succiniciproducens MBEL55E (KCTC0769BP)의 게놈 DNA를 주형으로 하고, 서열번호 1과 2, 서열번호 3과 4, 서열번호 5와 6의 프라이머를 사용하여 fruA 왼쪽 상동성 부위 (HL), 클로람페니콜 (Cm) 을 저항성 유전자 포함하는 PCR 절편, 및 fruA 오른쪽 상동성 부위 (HR) 각각의 PCR 절편을 수득하였다. 그런다음 서열번호 1과 6의 프라이머를 사용하고 앞선 세 PCR 절편들을 주형으로 하여 overlapping PCR을 수행하고 이렇게 얻어진 DNA 조각을 SacI과 PstI으로 절단하고, 이를 pSacHR06벡터에 도입하여 pSacHR06fruA 벡터를 완성하였다.
서열번호 1: 5'-ATCGCGGATCCGGTGGAAACCCTCGGTTTATT
서열번호 2: 5'-AATCTGCTCTGATGCGCAGCTAAAACCTGGTGCAATA
서열번호 3: 5'-CCAGGTTTTAGCTGCGCATCAGAGCAGATTGTACTGAGAG
서열번호 4: 5'-AATTACACTTGAAACCCTGATTCTGTGGATAACCGTATTAC
서열번호 5: 5'-ATCCACAGAATCAGGGTTTCAAGTGTAATTGGCGGAG
서열번호 6: 5'-TCGACGCGTCGACTTCATCTAACCCCAACGCTTG
실시예 2: M.succiniciproducensPALFK균주의 제작
실시예 1에서 제작된 fruA 유전자 제거용벡터 pSacHR06fruA를 이용하여 M. succiniciproducens PALK (KCTC10973BP)의 게놈에서 fruA를결실시켜변이균주를제작하였다.
즉, M.succiniciproducensPALK(KCTC10973BP)를 BHI(Brain-Heart Infusion) 고체배지에 도말하여, 36시간동안 39℃에서 배양한 후, 콜로니를 BHI 액체배지 10 mL에 접종하여, 12시간 배양하였다. 충분히 자란 세포배양액을 다시 BHI 액체배지 100 mL 1% 접종하여 39℃ 정치 배양기에서 배양하였다.
약 4-5시간 후, 세포성장이 OD600기준으로 0.3~0.5 정도가 되었을 때, 상기세균배양액을 0~4℃에 20분간 두어 세포성장이 더 이상 진행되지 않도록 막고, 이를 4℃, 4,500 rpm에서 15분간 원심분리하여 세포를 수득하였다. 그런 다음 4℃의 10% 글리세롤 용액 200mL로 셀을 재현탁 한 후, 다시 상기와 같은 조건에서 원심분리하였으며, 이러한 재현탁과 원심분리를 10% 글리세롤 용액을 반으로 줄여가면서 총 3회 수행하였다. 최종 얻어진 셀은 같은 부피의 10% 글리세롤 용액으로 재현탁하고 분주하여 -80℃에 보관하였다.
상기 수득된 세포 농축현탁액과 실시예 1에서 제작한 유전자 제거벡터 pSacHR06fruA를 혼합하여, 2.5kV, 25ㅅF, 200ohms의 조건으로 electroporation을 수행하여 상기 벡터로 M. succiniciproducens PALK (KCTC10973BP)의 형질전환을 시도하였다. 이렇게 electroporation 된 셀들은 BHI 액체배지를 가하여, 39℃ 정치뱅양기에서 1시간 동안 회복배양한 후, 배양액을 모두 항생제 클로람페니콜 6.8 ㅅg/mL를 함유하는 BHI 고체배지에 도말하여, 39℃ 정치 배양기에서 48시간 이상 배양하였다. 이중교차 (double crossover)가 일어난 콜로니를 선별하기 위하여, 형성된 콜로니를 클로람페니콜 (6.8 ㅅg/mL)과 100 g/L의 수크로스를 함유한 BHI 고체배지에 도말한 다음, 24시간 동안 배양한 후 형성된 콜로니를 동일한 고체배지에 다시도말하였다.
상기 배지에서 형성된 변이주를 항생제가 함유된 BHI 액체배지에서 배양하고, Rochelle 등의 방법 (Rochelle etal.,FEMSMicrobiol.Lett.,100:59,1992)을 응용하여 배양균주의 게놈 DNA를 분리하였다. 상기분리된 변이주의 게놈 DNA를 주형으로 하여 PCR을 수행한 다음, 수득된 PCR 산물을 전기영동함으로서, 게놈 DNA의 fruA 유전자 결실여부를 확인하였다. fruA유전자의 결실여부는 하기와 같이 2번의 PCR을 수행하여 확인하였다. 먼저, 상기 변이주의 게놈 DNA를 주형으로 하고, 서열번호 7과 8번 그리고 서열번호 9와 10번의 프라이머를 이용하여 PCR을 각각 수행하였다. 상기 두차례의 PCR 반응에서 얻어진 PCR 단편을 전기영동하여 PCR 단편의 크기를 확인하여 최종 fruA의결실여부를확인하고, 최종적으로는 M. succiniciproducens PALFK (KCTC11694BP)를 제작하고, 상기 균주를 한국생명공학연구원에 기탁하였다(KCTC11694BP).
서열번호 7: 5'-CTATGATTTGGTCGGGCGTTT
서열번호 8: 5'-TGAATGGCAGAAATTCGAAA
서열번호 9: 5'-TGATCTTCCGTCACAGGTAT
서열번호 10: 5''TTGACCGCACTTTGCACATC
실시예 3: pME18glpK22 vector의 제작 및 이를 도입한 M. succiniciproducens PALKG 균주의 제작
대장균 유래 글리세롤 키나아제를 코딩하는 유전자 (glpK22)를 포함하는 DNA를 수득하기 위해 Escherichia coli K-12 MG1655(ATCC47076;AmericanTypeCultureCollection,Manassas,VA,USA)의 게놈 DNA를 주형으로 하고, 서열번호 11과 12, 서열번호 13과 14, 서열번호 15와 16의 프라이머들을 사용하여 각각 PCR을 수행하였다. 이렇게 얻어진 세 개의 PCR 산물을 주형으로 다시 PCR을 수행함으로서 하나의 PCR 산물을 수득하였고 이 PCR 산물에는 코딩서열의 913번째 염기쌍이 원래 E. coli K-12 MG1655의 glpK 유전자가 가지고 있던 구아닌이 아데노신으로 전환되어있는 glpK22 유전자가 포함되어 있는데 본 유전자로부터 발현되는 glycerol kinase는 변이 전의 glpK에비해 FBP와 IIA에 의한 알로스테릭 저해를 상대적으로 덜 받는 것으로 알려져 있다 (Pettigrew etal.,J.Bacteriol.,178:2846,1996).
서열번호 11: 5'-ACTCCGGAATTCAACGCACTGACAATCTCACTT
서열번호 12: 5'-CAGCGAAGCTTTTTGGGTAGAAAGTATAAAGACAGAATCACA
서열번호 13: 5'-TTTATACTTTCTACCCAAAAAGCTTCGCTGTAATATG
서열번호 14: 5'-CCATAAACACCGCACTTTCCAACGCATAGTTCACTTC
서열번호 15: 5'-AACTATGCGTTGGAAAGTGCGGTGTTTATGGCAGG
서열번호 16: 5'-ACCTGCGAGCTCATTATTGATGTGTGCGGGGT
이렇게 얻어진 PCR 산물을 pME18 (Jang etal.,Appl.Environ.Microbiol.,73:5411,2007)에 EcoRI 과 SacI 부위에 클로닝하여 pME18glpK22 벡터를 완성하였다. 또한, 하기 서열번호 17 내지 21의 프라이머들을 이용하여 솔젠트(Solgent, Korea)에 시퀀싱을 의뢰하여 염기서열의 일치여부를 확인하였다.
서열번호 17: 5'-TAGCTATGTGTTAAAGCCTT
서열번호 18: 5'-ACCAGGGCACCACCAGCTCC
서열번호 19: 5'-CCGATTACACCAACGCCTCT
서열번호 20: 5'-ATGTGGTTCCGGCATTTACC
서열번호 21: 5'-TTATGCCGCATCCGGTAGTCCC
상기와 같이 제작된 pME18glpK22를 M. succiniciproducens PALK (KCTC10973BP)에 도입함으로서 최종적으로 M. succiniciproducens PALKG (KCTC11693BP) 균주를 완성하였다. 본 발현 벡터 도입을 위해서는 실시예 2의 세포 농축현탁액 제조방법과 electroporation 방법과 같이 진행하였으며, 항생제 클로람페니콜 대신 암피실린 25 ㅅg/mL를 함유하는 BHI 고체배지에 도말하여, 39℃ 정치 배양기에서 48시간 이상 배양하였다. 순수 콜로니로부터 BHI 액체배지에서 8시간 배양한 후 최종농도가 15 % (w/v)되게 글리세롤 용액을 혼합한 후 -80℃에 사용시까지 보관하였다.
실시예 4: M.succiniciproducensPALFK균주 및 PALKG 균주를 이용한 단일 숙신산 생산
상기 실시예 2 및 3에서 제작된 M. succiniciproducens PALFK (KCTC11694BP) 또는 PALKG (KCTC11693BP) 균주를 10 g/L 수크로오즈를 포함한 10 mL의 MH5 배지 (리터당, 2.5 g yeast extract, 2.5 g polypeptone, 1 g NaCl, 0.02 g CaCl2ㅇ2H2O,0.2gMgCl2ㅇ6H2O,8.7gK2HPO4,및 10.0 g NaHCO3)에 접종하여 혐기조건으로 39℃에서 8시간 배양한 후, 이를 다시 같은 배지 300 mL로 옮겨서 배양하였다. 발효는 상기의 배양액을 2.5L 의 합성배지 (리터당, 1g NaCl, 2g (NH4)2HPO4,0.02gCaCl2·2H2O,0.2gMgCl2·6H2O,8.709gK2HPO4,0.5gcysteine,0.5gmethionine,0.5galanine,0.5gasparagine,0.5gasparticacid,2.46gproline,0.5gserine,0.005gnicotinicacid,0.005gCa-pantothenate,0.005gpyridoxine·HCl, 0.005g thiamine, 0.005g ascorbic acid 및 0.005g biotin)를 함유한 미생물 반응기 (Bioflo 3000, New Brunswick Scientific Co., Edison, NJ, USA)에 접종하여 수행하였으며, 발효 조건은 22.25 g/L (65mM) 초기 수크로오즈 농도, 4.6 g/L (50mM) 초기 글리세롤 농도로, 온도 39℃ 200 rpm 조건에서 0.2 vvm (이산화탄소부피/배양기내 조업부피(working volume)/분) 속도로 순수 이산화탄소를 공급해 주면서 발효시켰다. 발효 중 pH는 암모니아수를 사용하여 6.5로 조정하였으며, 항생제는 PALK의 경우 스펙티노마이신 50㎍/mL, PALFK의 경우 클로람페니콜 6.8㎍/mL, PALKG의 경우 암피실린 25㎍/mL를 각각 첨가하였다. 고농도의 숙신산 생산을 위하여 탄소원이 완전히 소모되었을 경우에는, 필요시 700 g/L의 수크로오즈 및 글리세롤 용액을 반연속적으로 첨가하였다. 상기와 동일한 방법으로 숙신산 생산용 변이균주인 M. succiniciproducens PALK (KCTC10973BP)를 PALFK 균주의 성능과 비교를 위해 배양하였다. 배양액내의 세포농도는 분광광도계를 이용하여 측정하였으며, 미리 측정한 분광광도계의 흡광도와 건조세포의 중량 검증선을 이용하여 세포농도를 계산하였다. 발효과정 중 생물반응기로부터 주기적으로 샘플을 채취하였으며, 채취된 시료는 13,000 rpm에서 10분 동안 원심분리한 후, 상층액의 각종 대사산물 및 숙신산 농도, 수크로오즈와 글리세롤 농도를 액체크로마토그래피(HPLC)로 분석하였다.
그 결과, 도 2 및 표 1에 나타낸 바와 같이, M.succiniciproducensPALFK(KCTC11694BP)는 M. succiniciproducens PALK (KCTC10973BP) 균주와 비교하였을 때, 보다 우수한 숙신산 생산수율을 보이며, 부산물을 전혀 생산하지 않으면서 순수하게 숙신산만을 생산함을 알 수 있다. 또한, 숙신산과 환원된 정도가 같은 글리세롤의 사용량이 7배가량 늘어났고, 이는 글리세롤의 uptake 시 수크로오즈를 사용했을 때와는 다르게 부산물 생산과 직결되는 피루베이트 생산이 매개되지 않음으로 상대적으로 적은 부산물의 생산과 직결된다. 또한 늘어난 글리세롤 uptake 양은 상대적으로 적은 양의 수크로스를 사용하게 함으로서, 적은양의 탄소원으로 단일 숙신산만을 생산함으로서 보다 높은 숙신산 생산 수율 (yield)을 보인다.
또한 M. succiniciproducens PALKG (KCTC11693BP)의 경우에는 PALFK 균주와는 약간 다른 패턴을 보이는데, 그것은 수크로오즈 이용능과 세포 성장을 저해하지 않은 범위 내에서 글리세롤 이용을 증가시킴으로서 피루베이트 축적이 PALK 수준으로 유지된다는 점이다. 그럼에도 불구하고 PALK균주와 비교해서는 2배 이상 높은 글리세롤 이용능력을 보이며, 결과적으로 1.39 mol/mol의 수율로 숙신산을 생산하며, PALK의 1.24 mol/mol 보다 높은 숙신산 생산 수율 (yield)을 보여준다.
표 1
Figure PCTKR2011006382-appb-T000001
* sucrose 및 glycerol의 경우 uptake 량, succinic, pyruvic, 및 acetic acid의 경우는 생산된량. yield 는 sucrose 및 glycerol을 glucose 등가치로 계산한 값.
** 세 경우 모두, 세 번 반복실험한 결과의 평균값을 표시함.
실시예 5: 고수율 단일 숙신산 생산균주인 M. succiniciproducens PALFK 균주를 이용한 생산성 향상
본 실시예에서는 고수율 단일 숙신산 생산균주인 M. succiniciproducens PALFK의 생산성 향상방법을 확인하였다.
도 2의 B에서 알 수 있듯이 PALFK 균주는 접종 후 13~15 시간이 지난 후 최대 생산성에 도달하고 있으며, 이때의 세포농도가 가장 높은 것을 알 수 있다. 따라서 생산성을 최대화시키기 위해 현재 수준보다 세포농도를 더 높였을 때 생산성의 변화가 어떠한지 먼저 살펴보았다.
실시예 4에서와 같은 배양조건에서 PALFK 초기세포농도를 OD600=9.03수준으로 높였을 때, 숙신산 생산성은 어떻게 변화하는지 살펴보고자, 실시예 4에서와 같이 MH5 배지에 22.25 g/L 수크로오즈와 10 g/L 글리세롤을 포함한 5 L 배지조건으로 미생물배양기(Bioflo 3000)에서 온도 39℃, 200 rpm 조건에서 0.2 vvm (이산화탄소부피/배양기내 조업부피(working volume)/분) 속도로 순수 이산화탄소를 공급해 주면서 발효시켰다. 발효 중 pH는 암모니아수를 사용하여 6.5로 조정하였으며, 항생제는 클로람페니콜 6.8㎍/mL를 첨가하였다. PALFK를 발효시켜 세포농도가 OD600값이 4.6 근방에 다다랐을 때, 배양을 끝내고, 배양액을 상온에서 6000 rpm, 10분간 원심분리 함으로서 세포 펠렛을 수득하였다. 수득한 세포 펠렛을 다시 MH5 배지 300mL에 재현탁하여, 고농도의 inoculum을 얻을 수 있었다. 이를 접종하여 실시예 4의 조건으로 합성배지에서 배양한 결과 도 3 및 표 2에 나타난바와 같이, 숙신산 생산성이 6.03 g/L/h로 (최대 구간생산성 10.69 g/L/h) 원래 발효조건에 비해 2배 이상 증가했음을 알 수 있었으며, 부산물 생성정도와 수율을 거의 유사함을 알 수 있었다.
따라서 이러한 결과를 토대로, 세포농도를 인위적으로 보다 증가시키 위하여, membrane cell recycling bioreactor (MCRB) 시스템을 사용하였다(도 4A).
MCRB 시스템은 세포순환을 위해서 hollow fiber membrane unit (CellFlo Plus Module; Spectrum Laboratories Inc., Rancho Dominguez, CA, USA)을 Bioflo 110 리엑터 (New Brunswick Scientific Co.)에 연결하여 사용하였으며, 이때 working volume (조업부피)는 0.4L로 유지시켰다. 배양기내의 교반속도는 100 rpm으로 유지시켰으며, 세포재순환을 위한 diaphragm 펌프의 속도는 150 mL/min으로 유지시켰다.
합성배지 조성은 실시예 4에서 사용한 것과 동일하며, proline경우만 0.5 g/L 가 첨가되었다. 배양기 내의 초기 수크로오즈 농도는 22.25 g/L 및 초기 글리세롤 농도는 4.6 g/L 였으며, feed tank 내에서는 30 g/L 수크로오즈와 21 g/L 글리세롤이 사용되었다. MCRB 조업을 위한 희석속도(dilution rate, D)는 1.027 h-1로 유지되었으며, 정상상태에서의 성장을 결정하는 cell bleeding 속도는 0.015 h-1로 유지되었다. MCRB 조업에서 정상상태는 최소 턴오버(turnover)시간 (희석속도에 따라 배양이 진행되었을 때, 조업부피를 한번 채우는데 걸리는 시간을 의미, D=1 또는 2이면 조업부피를 채우는데는 1 h 및 0.2 h가 걸림) 이상의 간격으로 5회 이상 시료를 분석하여 세포농도, 대사산물의 생성정도, 탄소원의 소모량 등을 측정하여 이들이 일정하게 유지되었을 때로 정하였다.
이에 따라 MCRB 배양을 진행한 결과, 도 4B 및 표 2에 나타난 바와 같이 생산성이 모균주의 10배 이상 (29.73 g/L/h)으로 증가하였다. 또한 숙신산 생산 수율은 그대로 유지되었으며, 부산물의 정도 또한 실시예 4의 경우에서보다는 약간 높지만, 낮은 수준을 유지하는 것을 알 수 있었다. 결국 결론적으로 본 실시예에서 보인바와 같이 생산수율 및 부산물 감소정도를 최대화 한 후에 생산성을 높이는 전략으로 이론수율에 근접한 고효율 (1.54 mol/mol)로 숙신산을 초고생산성으로 29.73 g/L/h 생산하는데 성공하였다. 본 실시예에서 제시한 숙신산 생산성은 이전에 어떠한 방법으로도 달성된 적이 없는 초 고생산성이며, 더욱이 1.54 mol/mol의 이론값에 근접한 수율을 달성하면서 이뤄졌다는 점에 그 의의가 더 크다.
표 2
Figure PCTKR2011006382-appb-T000002
* Fed- -batch'은 fed-batch시 고농도의 셀 (초기 접종직후 OD600=9.03)을 접종한 fed-batch를 나타낸다.
** Fed-batch 결과는 세 번 반복한 실험결과의 평균치 값이며, MCRB의 경우 정상상태 도달했을때의 연속 5번 채취한 시료의 평균값이다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
수탁번호
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC11693BP
수탁일자 : 20100510
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC11694BP
수탁일자 : 20100510
본 발명에 따른 숙신산 생성 변이미생물을 배양하면, 수크로오스와 글리세롤을 동시에 이용하여, 숙신산 생산에 있어 종래의 발효 수율을 이론수율 근방으로 최대화하고 부산물을 최소화 하면서 생산할 수 있다. 또한 본 발명에 따르면 종래에 생산 수율이 낮았던 다양한 종류의 환원 화학물질 (reduced chemical)을 보다 효과적으로 생산할 수 있다.
전자파일 첨부하였음.

Claims (19)

  1. 숙신산 생성 미생물에 있어서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  2. 제1항에 있어서, 숙신산 생성 미생물은 루멘박테리아인 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  3. 제2항에 있어서, 상기 루멘박테리아는 맨하이미아 속 (Mannheimiasp.),액티노바실러스 속 (Actinobacillussp.)및 언에어로바이오스피리륨 (Anaerobiospirillumsp.)으로 구성된 군에서 선택되는 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  4. 제3항에 있어서, 상기 맨하이미아 속 (Mannheimia sp.) 균주는 Mannheimia succiniciproducens PALK (KCTC10973BP)인 것을 특징으로 하는 수크로오즈와 글리세롤을 동시에 이용가능한 변이미생물.
  5. 제1항에 있어서, 숙신산 생성 미생물에 있어서, 이화산물 저해기작의 약화는 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자를 결실시켜 수행하는 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  6. 제4항에 있어서, Mannheimia succiniciproducens PALFK (KCTC11694BP)인 것을 특징으로 하는 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  7. 제1항에 있어서, 이화산물 저해기작의 약화는 글리세롤키나제를 코딩하는 유전자를 도입하여 수행하는 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 숙신산 생성 변이미생물.
  8. 제7항에 있어서, MannheimiasucciniciproducensPALKG(KCTC11693BP)인 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물.
  9. 숙신산 생성 미생물에서, 수크로오즈에 의한 글리세롤의 이화산물 저해기작을 약화시켜, 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법.
  10. 제9항에 있어서, 숙신산 생성 미생물은 루멘박테리아인 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법.
  11. 제10항에 있어서, 상기 루멘박테리아는 맨하이미아 속 (Mannheimiasp.),액티노바실러스 속 (Actinobacillussp.)및 언에어로바이오스피리륨 (Anaerobiospirillumsp.)으로 구성된 군에서 선택되는 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법.
  12. 제11항에 있어서, 상기 맨하이미아 속 (Mannheimiasp.)균주는 Mannheimia succiniciproducens PALK (KCTC10973BP)인 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법.
  13. 제9항에 있어서, 이화산물 저해기작의 약화는 프룩토즈 포스포트랜스퍼라제를 코딩하는 유전자를 결실시켜 수행하는 것을 특징으로 하는 숙숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 변이 미생물의 제조방법.
  14. 제9항에 있어서, 이화산물 저해기작의 약화는 글리세롤키나제를 코딩하는 유전자를 도입시켜 수행하는 것을 특징으로 하는 숙신산 생산에 수크로오즈와 글리세롤을 동시에 이용가능한 숙신산 생성 변이미생물의 제조방법.
  15. 제1항 내지 제8항 중 어느 한 항의 변이미생물을 혐기적 조건에서 배양하는 단계 및 상기 배양액으로부터 숙신산을 회수하는 단계를 포함하는 숙신산의 제조방법.
  16. 제15항에 있어서, 상기 배양은 수크로오스와 글리세롤이 동시에 함유된 배지에서 수행되는 것을 특징으로 하는 숙신산의 제조방법.
  17. 제15항에 있어서 부산물로서 다른 유기산의 생성량은 숙신산 생성 중량의 1% 이하인 것을 특징으로 하는 방법.
  18. 다음 단계를 포함하는 숙신산 생성능이 향상된 숙신산의 제조방법:
    (a) 높은수율을 가지며 부산물 생성이 낮은 숙신산 생산 변이미생물 또는 제1항 내지 제8항 중 어느 한 항의 변이미생물을 혐기적 조건에서 배양하는 단계;
    (b) 상기 배양액 내의 세포농도를 고농도로 농축시키는 단계;
    (c) 상기 고농도의 세포를 배양하는 단계; 및(d) 상기 배양액으로부터 숙신산을 회수하는 단계.
  19. 제18항에 있어서, (b) 배양액 내의 세포농도를 고농도로 농축시키는 단계는 이노큘럼 법 또는 MCRB법을 포함하여 수행되는 것을 특징으로 하는 방법.
    Figure PCTKR2011006382-appb-I000001
    Figure PCTKR2011006382-appb-I000002
PCT/KR2011/006382 2010-08-30 2011-08-30 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법 WO2012030130A2 (ko)

Priority Applications (13)

Application Number Priority Date Filing Date Title
MYPI2013000662A MY183660A (en) 2010-08-30 2011-08-30 Novel mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
ES11822105.0T ES2602780T3 (es) 2010-08-30 2011-08-30 Nuevo microorganismo mutante productor de acido succínico que utiliza sacarosa y glicerol simultáneamente, y método para producir acido succínico utilizando el mismo
JP2013527009A JP5805768B2 (ja) 2010-08-30 2011-08-30 スクロースとグリセロールとを同時に利用する新規コハク酸生成変異微生物及びこれを利用したコハク酸製造方法
MX2013002394A MX344549B (es) 2010-08-30 2011-08-30 Nuevo microorganismo mutante productor de acido succinico que utiliza sacarosa y glicerol simultaneamente, y metodo para producir acido succinico utilizando el mismo.
US13/819,339 US8691516B2 (en) 2010-08-30 2011-08-30 Mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
AU2011296791A AU2011296791B2 (en) 2010-08-30 2011-08-30 Novel mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
DK11822105.0T DK2612905T3 (en) 2010-08-30 2011-08-30 NEW MUTANT MICRO ORGANISM PRODUCING succinic SIMULTANEOUSLY USING SUCROSE AND GLYCEROL, AND METHOD OF PRODUCING succinic USING THIS
CN201180051937.6A CN103249832B (zh) 2010-08-30 2011-08-30 同时利用蔗糖和甘油的新的产琥珀酸突变微生物和利用其生产琥珀酸的方法
EP11822105.0A EP2612905B1 (en) 2010-08-30 2011-08-30 Novel mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
RU2013109055/10A RU2537003C2 (ru) 2010-08-30 2011-08-30 Мутантный микроорганизм, продуцирующий янтарную кислоту, способ его получения и способ получения янтарной кислоты (варианты).
NZ607585A NZ607585A (en) 2010-08-30 2011-08-30 Novel mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
CA2809942A CA2809942C (en) 2010-08-30 2011-08-30 Novel succinic acid-producing mutant microorganism that utilizes sucrose and glycerol simultaneously and method for producing succinic acid using the same
BR112013004652-0A BR112013004652B1 (pt) 2010-08-30 2011-08-30 micro-organismo mutante que utiliza sacarose e glicerol simultaneamente, método para preparação do mesmo e método para produção de ácido succínico utilizando o mesmo

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020100084327A KR101221557B1 (ko) 2010-08-30 2010-08-30 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
KR10-2010-0084327 2010-08-30

Publications (2)

Publication Number Publication Date
WO2012030130A2 true WO2012030130A2 (ko) 2012-03-08
WO2012030130A3 WO2012030130A3 (ko) 2012-06-28

Family

ID=45773370

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/006382 WO2012030130A2 (ko) 2010-08-30 2011-08-30 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법

Country Status (15)

Country Link
US (1) US8691516B2 (ko)
EP (2) EP2612905B1 (ko)
JP (1) JP5805768B2 (ko)
KR (1) KR101221557B1 (ko)
CN (2) CN105154381A (ko)
AU (1) AU2011296791B2 (ko)
BR (1) BR112013004652B1 (ko)
CA (1) CA2809942C (ko)
DK (1) DK2612905T3 (ko)
ES (2) ES2602780T3 (ko)
MX (1) MX344549B (ko)
MY (1) MY183660A (ko)
NZ (1) NZ607585A (ko)
RU (1) RU2537003C2 (ko)
WO (1) WO2012030130A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106164249A (zh) * 2014-02-07 2016-11-23 巴斯夫欧洲公司 用于基于蔗糖的改善精细化学品产生的修饰微生物
WO2020075943A1 (ko) 2018-10-10 2020-04-16 한국과학기술원 고활성의 말산 탈수소효소가 도입된 숙신산 생성용 변이 미생물 및 이를 이용한 숙신산 제조방법

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100780324B1 (ko) 2006-07-28 2007-11-29 한국과학기술원 신규 순수 숙신산 생성 변이 미생물 및 이를 이용한 숙신산제조방법
US9657316B2 (en) 2012-08-27 2017-05-23 Genomatica, Inc. Microorganisms and methods for enhancing the availability of reducing equivalents in the presence of methanol, and for producing 1,4-butanediol related thereto
US11753663B2 (en) 2012-12-17 2023-09-12 Genomatica, Inc. Microorganisms and methods for enhancing the availability of reducing equivalents in the presence of methanol, and for producing adipate, 6-aminocaproate, hexamethylenediamine or caprolactam related thereto
KR20160134760A (ko) * 2014-03-19 2016-11-23 바스프 에스이 발효를 위한 탄수화물의 제한적 공급을 사용하는 글리세롤의 용도
WO2015169919A1 (en) * 2014-05-08 2015-11-12 Basf Se Improved microorganism for succinic acid production
CN110747147B (zh) * 2019-11-29 2021-05-28 江南大学 一株衣康酸胁迫抗性提高的大肠杆菌

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009024294A1 (en) 2007-08-17 2009-02-26 Basf Se Microbial succinic acid producer mannheimia succini producens ddl

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6159738A (en) 1998-04-28 2000-12-12 University Of Chicago Method for construction of bacterial strains with increased succinic acid production
KR100372218B1 (ko) * 2000-06-29 2003-02-14 바이오인포메틱스 주식회사 유기산을 생산하는 균주 및 이를 이용한 유기산의 생산방법
EP1692271B2 (en) * 2003-11-27 2022-08-03 Korea Advanced Institute of Science and Technology Novel rumen bacteria variants and process for preparing succinic acid employing the same
JPWO2007013695A1 (ja) * 2005-07-29 2009-02-12 株式会社日本触媒 細菌にグリセリン資化能を付与する方法
DE102005047596A1 (de) * 2005-10-05 2007-04-12 Degussa Ag Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
KR100780324B1 (ko) * 2006-07-28 2007-11-29 한국과학기술원 신규 순수 숙신산 생성 변이 미생물 및 이를 이용한 숙신산제조방법
CN101688176B (zh) * 2007-04-17 2013-11-06 味之素株式会社 具有羧基的酸性物质的生产方法
WO2009048202A1 (en) * 2007-10-09 2009-04-16 Korea Advanced Institute Of Science And Technology Method for preparing succinic acid using glycerol as carbon source
US8691552B2 (en) * 2008-10-28 2014-04-08 William Marsh Rice University Microaerobic cultures for converting glycerol to chemicals
KR101093199B1 (ko) * 2009-02-12 2011-12-12 한국과학기술원 글리세롤 대사능력 및 숙신산 생산능력이 향상된 재조합 미생물 및 이를 이용한 숙신산의 제조방법
MY161185A (en) * 2009-02-16 2017-04-14 Basf Se Novel microbial succinic acid producers and purification of succinic acid
WO2012082720A2 (en) * 2010-12-13 2012-06-21 Myriant Corporation Method of producing succinic acid and other chemicals using sucrose-containing feedstock
CA2841461C (en) * 2011-07-22 2020-05-26 Myriant Corporation Fermentation of glycerol to succinic acid by recombinant e. coli

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009024294A1 (en) 2007-08-17 2009-02-26 Basf Se Microbial succinic acid producer mannheimia succini producens ddl

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
DEUTSCHER ET AL., MICROBIOL. MOL. BIOL. REV., vol. 70, 2006, pages 939
GORKE ET AL., NATURE REVIEWS, vol. 6, 2008, pages 613
JANG ET AL., APPL. ENVIRON. MICROBIOL., vol. 73, 2007, pages 5411
JANTAMA ET AL., BIOTECHNOL. BIOENG., vol. 99, 2008, pages 1140
KUHNERT ET AL., INT. J. SYST. EVOL. MICROBIOL., vol. 60, pages 44
LEE ET AL., APPL. ENVIRON. MICROBIOL., vol. 72, 2006, pages 1939
MCKINLAY ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 76, 2007, pages 727
PETTIGREW ET AL., J. BACTERIOL., vol. 178, 1996, pages 2846
ROCHELLE ET AL., FEMS MICROBIOL. LETT., vol. 100, 1992, pages 59
See also references of EP2612905A2
SONG ET AL., ENZYME MICROBIAL TECHNOL., vol. 39, 2006, pages 352
YAZDANI ET AL., CURR. OPIN. BIOTECHNOL., vol. 18, 2007, pages 213
ZEIKUS ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 51, 1999, pages 545
ZWAIG ET AL., J. BACTERIOL., vol. 102, 1970, pages 753

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106164249A (zh) * 2014-02-07 2016-11-23 巴斯夫欧洲公司 用于基于蔗糖的改善精细化学品产生的修饰微生物
US9850506B2 (en) 2014-02-07 2017-12-26 Basf Se Modified microorganism for improved production of fine chemicals on sucrose
WO2020075943A1 (ko) 2018-10-10 2020-04-16 한국과학기술원 고활성의 말산 탈수소효소가 도입된 숙신산 생성용 변이 미생물 및 이를 이용한 숙신산 제조방법
US11655462B2 (en) 2018-10-10 2023-05-23 Korea Advanced Institute Of Science And Technology Mutant microorganism introduced with highly active malate dehydrogenase for producing succinic acid and method of producing succinic acid using the same

Also Published As

Publication number Publication date
MY183660A (en) 2021-03-05
EP2612905A2 (en) 2013-07-10
US20130217087A1 (en) 2013-08-22
NZ607585A (en) 2014-08-29
EP2993225A2 (en) 2016-03-09
ES2654512T3 (es) 2018-02-14
CN103249832B (zh) 2016-09-21
AU2011296791A1 (en) 2013-04-11
BR112013004652B1 (pt) 2021-05-18
RU2537003C2 (ru) 2014-12-27
JP5805768B2 (ja) 2015-11-10
EP2993225A3 (en) 2016-04-20
AU2011296791B2 (en) 2015-05-21
DK2612905T3 (en) 2016-12-12
CA2809942C (en) 2016-04-12
MX344549B (es) 2016-12-20
KR20120020614A (ko) 2012-03-08
WO2012030130A3 (ko) 2012-06-28
EP2612905A4 (en) 2014-12-17
EP2612905B1 (en) 2016-10-05
US8691516B2 (en) 2014-04-08
JP2013539368A (ja) 2013-10-24
CN105154381A (zh) 2015-12-16
RU2013109055A (ru) 2014-09-10
CA2809942A1 (en) 2012-03-08
ES2602780T3 (es) 2017-02-22
CN103249832A (zh) 2013-08-14
EP2993225B1 (en) 2017-11-29
BR112013004652A2 (pt) 2016-07-05
KR101221557B1 (ko) 2013-01-14
MX2013002394A (es) 2013-12-16

Similar Documents

Publication Publication Date Title
WO2012030130A2 (ko) 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
KR100838038B1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
WO2010093182A2 (ko) Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
US20130078673A1 (en) Recombinant microorganism having an ability of using sucrose as a carbon source
KR101695605B1 (ko) 유기산들을 생산하는 대장균의 대사적 진화
WO2012099396A2 (en) A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
CN105452445B (zh) 利用用于糖输入的易化扩散生产琥珀酸和其它化学品的方法
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2014003439A1 (ko) 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2014148754A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법
WO2014175663A1 (ko) L-아르기닌 생산능이 향상된 코리네박테리움속 미생물 및 이를 이용한 l-아르기닌의 생산 방법
WO2015199406A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
KR100630819B1 (ko) 신규 루멘 박테리아 변이균주 및 이를 이용한 숙신산의제조방법
WO2010093150A2 (ko) 글리세롤 대사능력 및 숙신산 생산능력이 향상된 재조합 미생물 및 이를 이용한 숙신산의 제조방법
WO2015186958A1 (ko) O-숙시닐호모세린 또는 숙신산의 생산능을 갖는 미생물 및 이를 이용한 숙신산 또는 o-숙시닐호모세린의 생산 방법
WO2015194900A1 (ko) 젖산 분해 경로가 봉쇄된 클루이베로마이세스 막시아누스 및 이의 용도
WO2019143089A1 (ko) 1,3-프로판디올 생성능을 가지는 변이미생물 및 이를 이용한 1,3-pdo의 제조방법
WO2015046978A1 (ko) 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11822105

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 12013500378

Country of ref document: PH

ENP Entry into the national phase

Ref document number: 2013527009

Country of ref document: JP

Kind code of ref document: A

Ref document number: 2809942

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011822105

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013109055

Country of ref document: RU

Ref document number: MX/A/2013/002394

Country of ref document: MX

Ref document number: 2011822105

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13819339

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2011296791

Country of ref document: AU

Date of ref document: 20110830

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013004652

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013004652

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130227

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112013004652

Country of ref document: BR

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112013004652

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130227