WO2018230953A1 - 글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법 - Google Patents

글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법 Download PDF

Info

Publication number
WO2018230953A1
WO2018230953A1 PCT/KR2018/006678 KR2018006678W WO2018230953A1 WO 2018230953 A1 WO2018230953 A1 WO 2018230953A1 KR 2018006678 W KR2018006678 W KR 2018006678W WO 2018230953 A1 WO2018230953 A1 WO 2018230953A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
polypeptide
glucosylglycerol
acid sequence
seq
Prior art date
Application number
PCT/KR2018/006678
Other languages
English (en)
French (fr)
Inventor
김수진
양성재
이영미
김성보
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2018230953A1 publication Critical patent/WO2018230953A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/12—Disaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01004—Amylosucrase (2.4.1.4)

Definitions

  • the present application provides a polypeptide having glucosylglycerol production activity, a variant polypeptide thereof, a polynucleotide encoding the polypeptide or the variant polypeptide, a vector comprising the polynucleotide, the polynucleotide or a recombinant microorganism comprising the vector, and It relates to a method for preparing glucosylglycerol using the same.
  • Glucosylglycerol has a low level of sweetness of 0.55 compared to sugar, has a poor maillard reaction, and is characterized by high moisturizing property, non-causticity, and low digestibility. By using these properties, it can be applied as a preservative, antibiotic and cancer treatment of food or microorganism or biomolecule. Glucosylglycerols can thus play an important role in the food, cosmetic and pharmaceutical industries.
  • Such glucosylglycerol can be produced by an enzymatic method, and the production of glucosylglycerol by the cyclodextrin glucanotransferase or ⁇ -glucosidase enzyme has been reported (Nakano, H. et al ., (2003). J. Biosci Bioeng , 95, 583-588 .; Takenaka, F., & Uchiyama, H. (2000). Biosci Biotechnol Biochem , 64, 1821-1826.).
  • One object of the present application is to provide a polypeptide having a glucosylglycerol producing activity comprising an amino acid sequence having at least 85% homology with the amino acid sequence of SEQ ID NO: 1.
  • Another object of the present application is a variant polypeptide comprising at least one amino acid variation in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid variation is the 392th glycine (G: 3) from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: Glycine) to provide a variant polypeptide having glucosylglycerol production activity, wherein the amino acid residue is substituted with one or more other amino acids.
  • Another object of the present application is to provide a polynucleotide encoding a polypeptide or variant polypeptide of the present application.
  • Another object of the present application is to provide a vector comprising a polynucleotide of the present application.
  • Another object of the present application is to provide a recombinant microorganism comprising the polynucleotide of the present application or the vector of the present application.
  • Another object of the present application is a composition for producing glucosylglycerol comprising a polypeptide comprising an amino acid sequence having an amino acid sequence of at least 85% homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a culture of the microorganism.
  • Another object of the present application is to provide a polypeptide comprising an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a glycerol and glucose unit in a culture of the microorganism. It provides a method for producing glucosylglycerol, comprising the step of contacting the saccharides containing, to produce glucosylglycerol.
  • Figures 1a, 1b, 1c and 1d is a result confirming the amount of glycerol reduced after the enzyme activity reaction of MRF, MRF + G392T, MRF + G392E and MRF + G392A.
  • Figure 2 shows the results of glucosylglycerol conversion of MRF, MRF + G392T, MRF + G392E and MRF + G392A.
  • 3a, 3b, 3c and 3d are the results of activity evaluation according to the temperature of MRF, MRF + G392T, MRF + G392E and MRF + G392A.
  • Figures 4a, 4b, 4c and 4d is a result of the conversion analysis of the enzyme according to the glycerol concentration of MRF, MRF + G392T, MRF + G392E and MRF + G392A.
  • One aspect of the present application for achieving the object of the present application is to provide a polypeptide having a glucosylglycerol production activity comprising an amino acid sequence having at least 85% homology with the amino acid sequence of SEQ ID NO: 1.
  • the polypeptide of the present application may include, but is not limited to, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 80% homology or identity thereto.
  • the polypeptide may include SEQ ID NO: 1 and polypeptides having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 1.
  • An amino acid sequence having homology or identity may exclude sequences having 100% identity in the above categories or may be sequences having less than 100% identity.
  • polypeptide having an amino acid sequence having such homology or identity and exhibiting an equivalent potency (ie, glucosylglycerol-producing activity) corresponding to the polypeptide a polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted or added.
  • an equivalent potency ie, glucosylglycerol-producing activity
  • polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted or added can also be used as a polypeptide of the present application.
  • variant polypeptide comprising at least one amino acid variation in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid variation is the 392th glycine from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (G: Glycine) It is to provide a variant polypeptide having glucosylglycerol production activity, wherein the amino acid residue is substituted with one or more other amino acids.
  • the variant polypeptide has a glucosylglycerol-producing activity in which the 392th glycine amino acid is substituted with Threonine (T: Threonine), Glutamic acid (E) or Alanine (A: Alanine) in the amino acid sequence of SEQ ID NO: 1. It may be a variant polypeptide having, but is not limited thereto. Such variant polypeptides have enhanced glucosylglycerol production activity as compared to polypeptides consisting of the amino acid sequence of SEQ ID NO: 1.
  • variant polypeptide having glucosylglycerol producing activity refers to a variant polypeptide having an activity of converting sucrose to turanose, a turanose producing variant polypeptide, a variant polypeptide producing turanose, a variant It can be used in combination with the type amylosucrase, amylosucrase variant and the like.
  • the variant polypeptide may be composed of the amino acid sequence of SEQ ID NO: 3, 5 or 7.
  • the variant polypeptide may include, but is not limited to, an amino acid sequence of SEQ ID NO: 3, 5, or 7 or an amino acid sequence having at least 80% homology or identity thereto.
  • the variant polypeptide of the present application is a polypeptide having at least 80%, 85% 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 3, 5 or 7 It may include.
  • polypeptide has an amino acid sequence having such homology or identity and exhibits a potency corresponding to the polypeptide, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the present application. .
  • variant polypeptide refers to a culture or individual that exhibits one stable phenotypic change, genetically or non-genetically, and specifically in the present application, one or more amino acid sequences derived from Corynebacterium glutamicum It refers to a variant polypeptide whose amino acid is mutated and its activity is weakened compared to wild type, so that the carbon flow is efficiently balanced.
  • the variant polypeptide is a polypeptide having an activity of converting sucrose to turanose, a variant polypeptide having activity of converting sucrose to turanose, a variant amylosucrase, amylosucra It can be used interchangeably as the first variant.
  • the 'variant' may be used interchangeably with terms such as variant, mutated protein, and variant polypeptide, and in English, it may be used as variant, modification, modified protein, modified polypeptide, mutant, mutein, divergent, etc. As long as the term is used in a mutated sense, it is not limited thereto.
  • homology refers to the degree of relevance to two given amino acid sequences or base sequences and can be expressed as a percentage. In this specification, homologous sequences thereof having the same or similar activity as a given amino acid sequence or base sequence are designated as "% homology".
  • identity refers to the degree of agreement between amino acid or nucleotide sequences, and in some cases determined by the match between strings of such sequences.
  • sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and the default gap penalty established by the program used may be used together.
  • Substantially, homologous or identical polynucleotides or polypeptides generally have a medium stringency or along at least about 50%, 60%, 70%, 80% or 90% of all or the full-length of the target polynucleotide or polypeptide. Will hybrid at high stringency.
  • polynucleotides containing degenerate codons instead of codons in the hybridizing polynucleotides are also contemplated.
  • any two polynucleotide or polypeptide sequences are at least for example 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 Whether having% or 99% homology or identity is described, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the " FASTA " program using default parameters such as at 2444. Or in the needle-only program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.
  • Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as can be determined, can be determined.
  • GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] 403 (1990); including Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and CARILLO ETA /. (1988) SIAM J Applied Math 48: 1073).
  • homology or identity can be determined using BLAST, or ClustalW, of the National Biotechnology Information Database Center.
  • the homology or identity of a polynucleotide or polypeptide is described, for example, in Smith and Waterman, Adv. Appl. As known in Math (1981) 2: 482, for example, Needleman et al. (1970), J Mol Biol. 48: 443, and can be determined by comparing the sequence information using a GAP computer program.
  • the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similarly arranged symbols (ie, nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) no penalty for the end gap.
  • the term “homology” or “identity” refers to a comparison between polypeptides or polynucleotides.
  • variant polypeptide having a homologous or homologous polypeptide having a amino acid sequence in which the 392th amino acid is replaced with another amino acid from the N-terminus in the amino acid sequence of SEQ ID NO. 1 by codon degeneracy can also be included.
  • probes which can be prepared from known gene sequences, for example, hydride under stringent conditions with complementary sequences for all or part of the nucleotide sequence, wherein the 392th amino acid in the amino acid sequence of SEQ ID NO: 1 is threonine
  • Any polynucleotide sequence encoding a variant polypeptide having the activity of a variant polypeptide consisting of an amino acid sequence selected from the group substituted with (T: Threonine), Glutamic acid (E: Glutamic acid) or Alanine (A: Alanine) May be included.
  • Polypeptides of the present application or variant polypeptides of the present application may have heat resistance.
  • the term "heat resistance” means that the thermal stability of the variant polypeptide is increased. Specifically, by the heat resistance, the enzyme reaction is possible at high temperature, and the solubility of the substrate may be increased in the high temperature reaction process. As the substrate solubility increases, it is possible to use a high concentration of the substrate, and the productivity may be improved by shortening the reaction time by increasing the diffusion rate or the reaction rate of the material. In addition, process contamination due to external microorganisms can be minimized.
  • microorganisms can be used as a sterile microbial cells using heat resistance properties. Specifically, not only can the microorganisms be effectively sterilized by heat treatment at a high temperature, but also if the polypeptide is to be separated and used, the proteins derived from the recombinant microorganism can be selectively denatured and removed, thereby improving the purification process of the polypeptide. There are advantages to it.
  • the polypeptide or variant polypeptide may maintain 60% or more of the activity before the heat treatment when the heat treatment for 0.5 hours to 26 hours at 50 °C to 75 °C. More specifically, the polypeptide is 70% or more of the activity before the heat treatment at 70 ° C. for 0.5 hours to 21 hours, 80% or more of the activity before the heat treatment at 50 ° C. to 60 ° C. for 0.5 hours to 6 hours When heat treatment is performed for 0.5 hours to 3 hours at 70 ° C. to 70 ° C., at least 80% of the activity before the heat treatment may be maintained.
  • the variant polypeptide can maintain at least 70% of the activity before the heat treatment, when heat treatment for 0.5 hours to 9 hours at 50 °C to 70 °C.
  • the variant polypeptide can maintain at least 80% of the activity before the heat treatment at 50 °C to 70 °C heat treatment for 0.5 hours to 3 hours. More specifically, the variant polypeptide wherein the glycine (G) amino acid residue 392 from the N-terminal end of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 mutated to alanine (A) is 0.5 to 6 hours at 50 °C to 70 °C At the time of heat treatment, 80% or more of activity before the heat treatment may be maintained.
  • the polypeptide of the present application is Meiothermus lupus. rufus ) may be derived from, but is not limited thereto.
  • Another aspect of the present application is to provide a polynucleotide encoding the polypeptide or variant polypeptide.
  • polynucleotide is a polymer of nucleotides in which nucleotide monomers are long chained by covalent bonds, and are DNA or RNA strands of a predetermined length or more, and more specifically, the polypeptide or variant. By polynucleotide fragment encoding a polypeptide.
  • Polynucleotides of the present application may include base sequences that encode amino acid sequences of polypeptides or variant polypeptides of the present application due to genetic code degeneracy.
  • the polynucleotide encoding a variant polypeptide having the activity of converting sucrose of the present application to Turanose if the polynucleotide sequence encoding a variant polypeptide having the activity of converting sucrose of the present application to Turanose May be included without limitation.
  • the polynucleotide of the present application may be modified in various ways in the coding region without changing the amino acid sequence of the polypeptide due to the degeneracy of the codon or in consideration of the codon preferred in the organism in which the polypeptide is to be expressed. This can be done.
  • Any amino acid sequence 392 in the amino acid sequence of SEQ ID 1 may be included without limitation as long as it is a polynucleotide sequence encoding a variant polypeptide substituted with another amino acid.
  • a variant polypeptide of the present application may be, but is not limited to, a polynucleotide sequence encoding the variant polypeptide.
  • the polynucleotide of the present application is at least 80%, at least 85%, at least 90% of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, or the nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8 Polynucleotide consisting of a base sequence having at least%, at least 95%, at least 97%, at least 99% homology or identity, but is not limited thereto.
  • a probe can be prepared from a known gene sequence, for example, a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions with complementary sequences to all or part of the nucleotide sequence encoding the polypeptide.
  • Any polypeptide having the activity of converting the cross to turanose can be included without limitation.
  • stringent conditions are meant conditions that enable specific hybridization between polynucleotides. Such conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
  • genes having high homology or identity are specifically genes having at least 90% homology or identity, particularly at least 90%, more specifically at least 95%, more specifically at least 97%, in particular at least 99%.
  • Hybridization requires that two polynucleotides have complementary sequences, although mismatch between bases is possible depending on the stringency of the hybridization.
  • complementary is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated polynucleotide fragments that are complementary to the entire sequence as well as substantially similar polynucleotide sequences.
  • polynucleotides having homology or identity can be detected using hybridization conditions comprising a hybridization step at a Tm value of 55 ° C. and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Polypeptides or variant polypeptides consisting of the amino acid sequence of SEQ ID NO: 1, 3, 5 or 7 of the present application may be encoded by the polynucleotide sequence of SEQ ID NO: 2, 4, 6 or 8, respectively.
  • Another aspect of the present application is to provide a vector comprising a polynucleotide of the present application.
  • the term "vector” refers to a DNA preparation containing a nucleotide sequence of a polynucleotide encoding said target protein operably linked to a suitable regulatory sequence such that the target protein can be expressed in a suitable host.
  • the regulatory sequence may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. After being transformed into a suitable host cell, the vector can be replicated or function independent of the host genome and integrated into the genome itself.
  • the vector used in the present application is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR-based, pUC-based, pBluescriptII-based, etc. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • pDZ pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like
  • the vector usable in the present application is not particularly limited and known expression vectors may be used.
  • a polynucleotide encoding a desired variant polypeptide in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome can be made by any method known in the art, such as, but not limited to, homologous recombination.
  • the method may further include a selection marker for checking whether the chromosome is inserted.
  • the selection marker is for selecting cells transformed with the vector, i.e., confirming the insertion of the nucleic acid molecule of interest, and selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface variant polypeptides.
  • the present application is to provide a microorganism that produces a purine nucleotide comprising the variant polypeptide, or comprising a polynucleotide encoding the variant polypeptide.
  • a microorganism comprising a variant polypeptide and / or a polynucleotide encoding the variant polypeptide may be a microorganism prepared by transformation with a vector comprising a polynucleotide encoding a variant polypeptide, but is not limited thereto. .
  • operably linked means that the polynucleotide sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a target protein of the present application.
  • Operable linkages can be prepared using known genetic recombination techniques, and site-specific DNA cleavage and ligation can be made using, but are not limited to, cleavage and ligation enzymes in the art.
  • Another aspect of the present application is to provide a recombinant microorganism comprising a polynucleotide of the present application or a vector of the present application.
  • the recombination may be achieved by transformation.
  • transformation in the present application means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide in the host cell can be expressed.
  • the transformed polynucleotides may include all of them, as long as they can be expressed in the host cell, either inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be expressed by being introduced into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression.
  • the expression cassette may include a promoter, a transcription termination signal, a ribosomal binding site, and a translation termination signal, which are typically operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell, but is not limited thereto.
  • the transformation method may include any method of introducing a polynucleotide into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca (H 2 PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, Polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method and the like, but is not limited thereto.
  • a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca (H 2 PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, Polyethylene glycol (PEG) method, DEAE-dextran method,
  • the host cell or microorganism of the present application may be any microorganism capable of producing glucosylglycerol including the polynucleotide of the present application or the vector of the present application.
  • the recombinant microorganism of the present application may include all microorganisms capable of expressing a polypeptide or a mutant polypeptide having the glucosylglycerol producing activity of the present application by various known methods, in addition to the introduction of the polynucleotide of the present application or the vector of the present application. have.
  • recombinant microorganisms of the present application are CJ_Mrf_AS (KCCM11939P), E. coli BL21 (DE3) / MRF + G392T (KCCM12113P), E. coli BL21 (DE3) / MRF + G392E (KCCM12112P) and E. coli BL21 (DE3) / MRF + G392A (KCCM12111P)
  • the present application provides a polypeptide comprising an amino acid sequence having at least 85% homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or a glucose comprising a culture of the microorganism. It is to provide a composition for producing silglycerol. Specifically, the composition for producing glucosylglycerol may comprise a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.
  • the present application is a variant polypeptide comprising at least one amino acid variation in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the variant polypeptide, or a glucose comprising a culture of the microorganism
  • a composition for producing silglycerol wherein the amino acid variation comprises glucosylglycerol production, wherein the 392th glycine (G) amino acid residue is substituted with one or more other amino acids from the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1. It is to provide a composition for.
  • the composition is not limited thereto as long as it is involved in glucosylglycerol production.
  • composition may further include a saccharide including glycerol and glucose units, but is not limited thereto.
  • the composition of the present application may further comprise any suitable excipient commonly used in the composition for producing glucosylglycerol.
  • excipients may be, for example, but not limited to, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents.
  • the present application provides a polypeptide comprising an amino acid sequence having at least 85% homology with the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the polypeptide, or glycerol and glucose in a culture of the microorganism. It provides a method for producing glucosylglycerol, comprising the step of contacting a saccharide comprising a glucose unit to produce glucosylglycerol. Specifically, the method for preparing glucosylglycerol may include a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.
  • the present application is a variant polypeptide comprising at least one amino acid variation in the amino acid sequence of SEQ ID NO: 1, a microorganism expressing the variant polypeptide, or glycerol and glucose in the culture of the microorganism
  • the method for preparing glucosylglycerol comprising contacting a saccharide comprising a glucose unit to produce glucosylglycerol, wherein the amino acid variation is the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1
  • the amino acid variation is the N-terminus of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1
  • It provides a method for producing glucosylglycerol, wherein the glycine (G) amino acid residue from No. 392 is substituted with one or more other amino acids.
  • the method is not limited to those involved in the production of glucosylglycerol.
  • the molar ratio of the glycerol and glucose units may be 1: 0.1 to 1: 3, but is not limited thereto. Specifically, the molar ratio of glycerol and glucose units has a glycerol concentration of 1: 0.1 to 1: 3, 1: 0.5 to 1: 3, 1: 1 to 1: 3, 1: 1.5 to 1: 3, or 1 with respect to sucrose. It may be in the range of 1.5 to 1: 2.5, and more specifically in the range of 1: 2, but is not limited thereto.
  • the contact may be performed at pH 4.0 to 9.0 conditions, 40 °C to 80 °C temperature conditions, and / or 1 hour to 48 hours, but is not limited thereto.
  • the contact of the present application is pH 4.0 to pH 9.0, pH 5.0 to pH 9.0, pH 6.0 to pH 9.0, pH 7.0 to pH 9.0, pH 4.0 to pH 8.0, pH 5.0 to pH 8.0, pH 6.0 to pH 8.0 or It may be performed at pH 7.0 to pH 8.0.
  • the contact of the present application is 40 °C to 80 °C, 45 °C to 80 °C, 50 °C to 80 °C, 55 °C to 80 °C, 60 °C to 80 °C, 40 °C to 75 °C, 45 °C to 75 °C, 50 °C to 75 °C, 55 °C to 75 °C, 60 °C to 75 °C, 40 °C to 70 °C, 45 °C to 70 °C, 50 °C to 70 °C, 55 °C to 70 °C, 60 °C to 70 °C, 40 °C to It may be carried out at 65 °C, 45 °C to 65 °C, 50 °C to 65 °C, 55 °C to 65 °C, 40 °C to 60 °C, 45 °C to 60 °C or 50 °C to 60 °C temperature conditions.
  • the culture of the microorganism may be prepared from the step of culturing the microorganism expressing the polypeptide or variant polypeptide of the present application in the medium.
  • the term "culture” means growing the microorganisms under appropriately controlled environmental conditions. Cultivation of the present application can be carried out according to the appropriate medium and culture conditions known in the art. Such culture can be easily adjusted and used by those skilled in the art according to the strain selected. Specifically, the culture of the present application may be carried out by a known batch culture method, continuous culture method, fed-batch culture method, but is not limited thereto.
  • the culture conditions are not particularly limited thereto, but using a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid), an appropriate pH (eg, pH 5 to pH 9, specific) PH 6 to pH 8, most specifically pH 6.8) can be adjusted.
  • a basic compound eg, sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg, phosphoric acid or sulfuric acid
  • pH eg, pH 5 to pH 9, specific
  • PH 6 to pH 8 most specifically pH 6.8
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble formation, and in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas is injected into the culture, or anaerobic and microaerobic conditions are maintained. To maintain, it can be injected with no gas or with nitrogen, hydrogen or carbon dioxide gas.
  • the culture temperature may be maintained at 20 °C to 45 °C, specifically 25 °C to 40 °C, can be incubated for about 0.5 hours to 160 hours, but is not limited thereto.
  • Polypeptides or variant polypeptides of the present application produced by the culture may be secreted into the medium or remain in cells.
  • the culture medium used may include sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), fats and fats (e.g. soybean oil, sunflower seeds) as carbon sources.
  • sugars and carbohydrates e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose
  • fats and fats e.g. soybean oil, sunflower seeds
  • fatty acids e.g. palmitic acid, stearic acid and linoleic acid
  • alcohols e.g. glycerol and ethanol
  • organic acids e.g. acetic acid
  • Nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and Ammonium nitrate) and the like can be used individually or in combination, but is not limited thereto.
  • a source of phosphorus potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and the like may be used individually or in combination, but is not limited thereto.
  • the medium may also contain essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
  • the preparation method of the present application may further comprise the step of separating and / or purifying the prepared glucosylglycerol.
  • the separation and / or purification may use a method commonly used in the art of the present application. Non-limiting examples include dialysis, precipitation, adsorption, electrophoresis, ion exchange chromatography, fractional crystallization, and the like.
  • the purification may be carried out in only one method, or may be performed in combination of two or more methods.
  • the production method of the present application may further comprise the step of performing the decolorization and / or desalting before or after the separation and / or purification step.
  • the preparation method of the present application further comprises crystallizing the glucosylglycerol after the step of converting, separating and / or purifying, or decolorizing and / or desalting the glucosylglycerol of the present application. can do.
  • the crystallization can be carried out using a conventionally used crystallization method.
  • crystallization may be performed using a cooling crystallization method.
  • the preparation method of the present application may further comprise the step of concentrating glucosylglycerol before the step of crystallizing.
  • the concentration can increase the crystallization efficiency.
  • the preparation method of the present application is a microorganism or microorganism expressing the unreacted sucrose polypeptide or variant polypeptide, the polypeptide or variant polypeptide of the present application after the separation and / or purification step of the present application
  • the method may further include contacting the culture of the mother solution, reusing the mother liquor from which the crystals are separated after the crystallization of the present application to the separation and / or purification steps, or a combination thereof.
  • glucosylglycerol can be obtained in higher yield and the amount of discarded sucrose can be reduced, which is an economic advantage.
  • Example One Glucosylglycerol Preparation of Recombinant Vectors and Recombinant Microorganisms for Production of Active Polypeptides and Variant Polypeptides thereof
  • E. coli-expressing vectors and recombinant microorganisms were prepared by obtaining genetic information of a thermophilic microorganism, Meiothermus rufus .
  • genes predicted to have glucosylglycerol production activity were selected from the Mayo Somers lupus gene sequence registered in the National Center for Biotechnology Information (NCBI).
  • the polynucleotide (SEQ ID NO: 2) encoding the polypeptide expressed by the gene (hereinafter referred to as MRF; SEQ ID NO: 1) was prepared by PCR (SEQ ID NOs: 9 and 10, Table 1) using PCR (94 ° C for 5 minutes). After denaturation, 94 ° C. 30 sec. Denaturation, annealing at 60 ° C. 30 sec., followeded by stretching at 72 ° C. for 90 sec. was repeated for 30 times and extension reaction conditions at 72 ° C. for 10 minutes).
  • Recombinant vector pET21a-Mrf was prepared by inserting the amplified polynucleotide into expression vector pET21a_SalI6His (a vector transformed from pET21a restriction enzyme XhoI recognition site CTCGAG into SalI recognition site GTCGAC) using restriction enzymes NdeI and SalI.
  • Recombinant vectors for the expression of variant polypeptides of polypeptides having glucosylglycerol-producing activity include a glycine amino acid residue at position 392 from the N-terminus of SEQ ID NO: 1, Threonine, Glutamic acid or Alanine.
  • Polynucleotides (sequentially SEQ ID NO: 3) encoding polypeptides substituted with (Alanine) (hereinafter sequentially MRF + G392T (SEQ ID NO: 3), MRF + G392E (SEQ ID NO: 5) and MRF + G392A (SEQ ID NO: 7)) 2, 4 and 8) were then inserted into the pET21a_SalI6His vector using restriction enzymes NdeI and SalI to prepare pET21a-Mrf + G392T, pET21a-Mrf + G392E and pET21a-Mrf + G392A.
  • the polynucleotide encoding the variant polypeptide was a reversed PCR-based saturation mutagenesis using pET21a-Mrf as a template (2014. Anal. Biochem . 449: 90-98). PCR was performed at 94 ° C for 2 minutes, 94 ° C for 30 seconds, followed by annealing at 60 ° C for 30 seconds, followed by extension at 72 ° C for 10 minutes, and repeated 30 times at 72 ° C for 60 minutes.
  • the primer was prepared by using a primer of 33bp consisting of the base 15bp of the substitution site, the base 3bp (RMG) of the substitution site, 15bp of the back base of the substitution site, the primer sequence is as described in Table 2 below.
  • Each recombinant vector prepared in Examples 1-1 and 1-2 was transformed into E. coli BL21 (DE3) (invitrogen) by heat shock transformation (Sambrook and Russell: Molecular cloning, 2001) to recombinant microorganisms After the preparation, it was used by storing frozen in 50% glycerol.
  • the recombinant microorganisms are named CJ_Mrf_AS, E. coli BL21 (DE3) / MRF + G392T, E. coli BL21 (DE3) / MRF + G392E, and E. coli BL21 (DE3) / MRF + G392A, respectively, and are under the international treaty of Budapest.
  • KCCM Korean Culture Center of Microorganisms
  • Deposit No. KCCM11939P deposited on November 22, 2016
  • KCCM12113P deposited on September 13, 2017
  • KCCM12112P September 13, 2017
  • Daily deposit KCCM12111P
  • Example 1 Inoculated in the liquid medium and spawn culture until the absorbance at 600 nm was 2.0. After the spawn culture was inoculated into the LB liquid medium, the main culture was carried out, and when the absorbance at 600 nm reached 2.0, 0.5 mM IPTG was added to induce recombinant enzyme and variant expression.
  • the seed culture and the stirring speed of the main culture were 200 rpm, and the incubation temperature was maintained at 37 ° C. After the incubation, the culture medium was recovered by centrifuging the culture solution at 8,000 ⁇ g for 20 minutes at 4 ° C., and the recovered cells were washed twice with 50 mM phosphate buffer (pH 7.5), and then suspended in the same buffer solution. The cells were disrupted using an ultrasonic cell crusher.
  • the cell lysate was centrifuged at 13,000 ⁇ g for 20 minutes at 4 ° C., and then only the supernatant was taken, using His-tag affinity chromatography, purified polypeptides from each recombinant microorganism, MRF and purified variant polypeptides MRF + G392T, MRF + G392E and MRF + G392A were obtained.
  • the purified polypeptides were dialyzed with 50 mM phosphate buffer (pH 7.5) and used for activity analysis.
  • Example 3 of recombinant polypeptides and variant polypeptides Glucosylglycerol Productivity Analysis
  • MRF, MRF + G392T, MRF + G392E and MRF + G392A all have a decrease in glycerol to have glucosylglycerol production activity.
  • MRF 23g / l when reacting with MRF + G392A 32g / l, when reacting with MRF + G392E 28g / l, when reacting with MRF + G392T 29g / l of glycerol was consumed (FIGS. 1A-1D).
  • each polypeptide prepared in Example 2 the residual activity was measured using an enzyme heat-treated for 26 hours at a temperature of 50 °C, 60 °C and 70 °C range. Activity was measured by adding 1 mg / ml of each heat-treated polypeptide to 50 mM potassium phosphate (pH 6.0) buffer containing 0.8 M sugar and 8 M glycerol and reacting at 55 ° C. for 2 hours. In the same way, the amount of glycerol reduction was analyzed by HPLC.
  • MRF is gradually reduced in activity at 50 °C, 60 °C and 70 °C temperature conditions to maintain about 65% of the initial activity after 26 hours (Table 3 and Figure 3a).
  • MRF + G392A, MRF + G392E and MRF + G392T also showed a similar thermal stability to MRF (Table 3 and Figures 3b to 3d).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 글루코실글리세롤 생산 활성을 가지는 폴리펩티드, 이의 변이형 폴리펩티드, 상기 폴리펩티드 또는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터, 상기 폴리뉴클레오티드 또는 상기 벡터를 포함하는 재조합 미생물 및 이를 이용한 글루코실글리세롤 제조방법에 관한 것이다.

Description

글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법
본 출원은 글루코실글리세롤 생산 활성을 가지는 폴리펩티드, 이의 변이형 폴리펩티드, 상기 폴리펩티드 또는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터, 상기 폴리뉴클레오티드 또는 상기 벡터를 포함하는 재조합 미생물 및 이를 이용한 글루코실글리세롤 제조방법에 관한 것이다.
글루코실글리세롤는 설탕 대비 0.55 수준의 낮은 감미도를 가지고 있고, 마이야르(maillard) 반응이 잘 일어나지 않으며 높은 보습성, 비충치유발성, 낮은 화성(low digestibility)을 갖는 특징이 있다. 이러한 특성을 이용하여 식품이나 미생물 또는 생체분자의 보존제, 항생균제 및 암치료제로서 적용이 가능하다. 따라서 글루코실글리세롤은 식품, 화장품 및 의약학 산업계에서 중요한 역할을 수행할 수 있다.
이러한 글루코실글리세롤은 효소적 방법으로 생산이 가능하며, 종래 사이클로덱스트린 글루카노트랜스퍼라제 또는 α-글루코시다제 효소에 의한 글루코실글리세롤 생성이 보고된 바 있다(Nakano, H. et al., (2003). J Biosci Bioeng, 95, 583-588.; Takenaka, F., & Uchiyama, H. (2000). Biosci Biotechnol Biochem, 64, 1821-1826.).
그러나 아직까지 글루코실글리세롤을 높은 수율로 산업 수준에서 제조할 수 있는 기술이 필요한 상태이다.
본 발명자는 글루코실글리세롤을 보다 효율적으로 생산하기 위하여 연구 노력한 결과, 본 출원의 폴리펩티드가 내열성을 가지면서 글루코실글리세롤을 좋은 효율로 생산하며, 이에 더하여 글루코실글리세롤 생성능이 더욱 향상된 변이형 폴리펩티드를 확보함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 글루코실글리세롤 생산 활성을 가지는, 폴리펩티드를 제공하는 것이다.
본 출원의 다른 목적은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드로서, 상기 아미노산 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번째 글리신(G: Glycine) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것을 포함하는, 글루코실글리세롤 생산 활성을 가지는 변이형 폴리펩티드 를 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리펩티드 또는 변이형 폴리펩티드를 암호화하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 재조합 미생물을 제공하는 것이다.
본 출원의 또 다른 목적은 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물을 포함하는 글루코실글리세롤 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 서열번호 1의 아미노산 서열과 85% 이상의 동일성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물에 글리세롤 및 글루코스 단위(glucose unit)를 포함하는 당류를 접촉시켜, 글루코실글리세롤을 생산하는 단계를 포함하는, 글루코실글리세롤 제조방법을 제공하는 것이다.
본 출원에서 글루코실글리세롤 생산 활성을 가지는 내열성 폴리펩티드 및이의 변이형 폴리펩티드를 새롭게 제안함으로써, 글루코실글리세롤의 산업적 제조를 가능하게 한 이점이 있다.
도 1a, 1b, 1c 및 1d는 MRF, MRF+G392T, MRF+G392E 및 MRF+G392A의 효소활성 반응 후 감소한 글리세롤의 양을 확인한 결과이다.
도 2는 MRF, MRF+G392T, MRF+G392E 및 MRF+G392A의 글루코실글리세롤 전환율 분석 결과이다.
도 3a, 3b, 3c 및 3d는 MRF, MRF+G392T, MRF+G392E 및 MRF+G392A의 온도에 따른 활성 평가 결과이다.
도 4a, 4b, 4c 및 4d는 MRF, MRF+G392T, MRF+G392E 및 MRF+G392A의 글리세롤 농도에 따른 효소의 전환율 분석 결과이다.
이하에서는, 본 출원을 더욱 상세히 설명한다.
한편, 본 출원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 할 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 목적을 달성하기 위한 본 출원의 하나의 양태는, 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 글루코실글리세롤 생산 활성을 가지는, 폴리펩티드를 제공하는 것이다.
본 출원의 폴리펩티드는, 서열번호 1의 아미노산 서열 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 상기 폴리펩티드는 서열번호 1 및 상기 서열번호 1과 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 상동성 또는 동일성을 갖는 아미노산 서열은 상기 범주 중 100% 동일성을 갖는 서열은 제외되거나, 100% 미만의 동일성을 갖는 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 폴리펩티드에 상응하는 효능(즉, 글루코실글리세롤 생산하는 활성)을 나타내는 아미노산 서열을 가지는 폴리펩티드라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 폴리펩티드도 본 출원의 폴리펩티드로 사용될 수 있음은 자명하다.
본 출원의 다른 하나의 양태는, 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드로서, 상기 아미노산 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번째 글리신(G: Glycine) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것을 포함하는, 글루코실글리세롤 생산 활성을 가지는 변이형 폴리펩티드를 제공하는 것이다.
상기 변이형 폴리펩티드는 서열번호 1의 아미노산 서열에서 상기 392번째 글리신 아미노산이 쓰레오닌(T: Threonine), 글루타민산(E: Glutamic acid) 또는 알라닌(A: Alanine)으로 치환된, 글루코실글리세롤 생산 활성을 가지는 변이형 폴리펩티드일 수 있으나, 이에 제한되는 것은 아니다. 이와 같은 변이형 폴리펩티드는 상기 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드에 비해 글루코실글리세롤 생산 활성이 강화된 특징을 갖는다.
본 출원에서 용어, "글루코실글리세롤 생산 활성을 가지는 변이형 폴리펩티드"는 수크로스를 투라노스로 전환시키는 활성을 가지는 변이형 폴리펩티드, 투라노스 생산 변이형 폴리펩티드, 투라노스를 생산하는 변이형 폴리펩티드, 변이형 아밀로수크라제, 아밀로수크라제 변이체 등과 혼용되어 사용될 수 있다.
구체적으로, 상기 변이형 폴리펩티드는, 서열번호 3, 5 또는 7의 아미노산 서열로 이루어진 것일 수 있다. 또한, 상기 변이형 폴리펩티드는 서열번호 3, 5 또는 7의 아미노산 서열 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 본 출원의 상기 변이형 폴리펩티드는 서열번호 3, 5 또는 7 과 적어도 80%, 85% 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 폴리펩티드에 상응하는 효능을 나타내는 아미노산 서열을 가지는 폴리펩티드라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 용어, "변이형 폴리펩티드"는 유전적 또는 비유전적으로 하나의 안정적인 표현형적 변화를 나타내는 배양물이나 개체를 뜻하며, 구체적으로 본 출원에서는 코리네박테리움 글루타미쿰 유래의 아미노산 서열상에서 하나 이상의 아미노산이 변이되어 그 활성이 야생형과 비교하여 약화되어 탄소흐름이 효율적으로 균형을 이루는 변이형 폴리펩티드를 의미한다. 본 출원의 목적상 상기 변이형 폴리펩티드는 수크로스를 투라노스로 전환시키는 활성을 가지는 폴리펩티드, 수크로스를 투라노스로 전환시키는 활성을 가지는 변이형 폴리펩티드, 변이형 아미로수크라제, 아밀로수크라제 변이체로 혼용되어 사용될 수 있다.
또한, 상기 '변이형'은 변이체, 변이된 단백질, 변이형 폴리펩티드 등의 용어로 혼용될 수 있으며, 영문 표현으로는 variant, modification, modified protein, modified polypeptide, mutant, mutein, divergent 등으로 사용될 수 있으나, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
또한, 본 출원에서 '특정 서열번호의 아미노산 서열로 이루어진 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면 특정 활성을 부여하는 상기 특정 392번째 변이 이외에 해당 서열번호의 아미노산 서열 앞뒤의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본원의 범위 내에 속하는 것이 자명하다.
상기 "상동성"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련성 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 염기 서열과 동일하거나 유사한 활성을 가지는 그의 상동성 서열이 "% 상동성"으로 표시된다.
또한, 상기 "동일성"은 아미노산 또는 뉴클레오티드 서열 사이의 일치하는 정도를 의미하며, 경우에 따라서는 그러한 서열의 스트링 사이의 일치에 의해 결정된다.
용어 "상동성" 및 "동일성"은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성 또는 동일성이 있는 폴리뉴클레오티드 또는 폴리펩티드는 일반적으로 모두 또는 타겟 폴리뉴클레오티드 또는 폴리펩티드의 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 엄격도 또는 높은 엄격도에서 하이브리드할 것이다. 하이브리드하는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 적어도 예를 들어, 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(바람직하게는, 버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 폴리펩티드 또는 폴리뉴클레오티드 사이의 비교를 나타낸다.
또한, 코돈 축퇴성 (codon degeneracy)에 의해 상기 서열번호 1의 아미노산 서열에서 N-말단으로부터 392번째 아미노산이 다른 아미노산으로 치환된 아미노산 서열로 이루어진 변이형 폴리펩티드 또는 이와 상동성 또는 동일성을 가지는 변이형 폴리펩티드로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 아미노산 서열에서 392번째 아미노산이 쓰레오닌(T: Threonine), 글루타민산(E: Glutamic acid) 또는 알라닌(A: Alanine)으로 치환된 군에서 선택되는 아미노산 서열로 이루어진 변이형 폴리펩티드의 활성을 가지는 변이형 폴리펩티드를 암호화하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다.
본 출원의 폴리펩티드 또는 본 출원의 변이형 폴리펩티드는 내열성을 가질수 있다.
본 출원에서 사용된 용어 "내열성"은 변이형 폴리펩티드의 열안정성이 증가된 것을 의미한다. 구체적으로 상기 내열성에 의하여 고온에서 효소반응이 가능하며, 고온의 반응 공정에서 기질의 용해도를 증가시킬 수 있다. 기질 용해도가 증가함에 따라 고농도의 기질 사용이 가능하며, 물질의 확산 속도 또는 반응속도가 증가되어 반응시간이 단축됨으로써 생산성이 향상될 수 있다. 또한, 외부 미생물로 인한 공정오염을 최소화할 수 있다.
또한, GRAS(generally recognized as safety) 미생물들에서 상기 폴리펩티드를 대량 발현 시킨 후 내열성 특성을 이용하면 사균화 균체로 이용가능하다. 구체적으로, 고온에서 열처리하는 방법으로 효과적으로 재조합 미생물들을 사균화 가능할 뿐만 아니라, 상기 폴리펩티드를 분리하여 이용하고자 할 경우에도 재조합 미생물 유래의 단백질들을 선택적으로 변성시키고 제거 할 수 있어 폴리펩티드의 정제공정을 효율화 할 수 있는 장점이 있다.
구체적으로, 상기 폴리펩티드 또는 변이형 폴리펩티드는 50℃ 내지 75℃에서 0.5시간 내지 26시간 열처리 시, 상기 열처리 전의 활성의 60% 이상의 활성을 유지할 수 있다. 보다 구체적으로, 상기 폴리펩티드는 70℃에서 0.5시간 내지 21시간 열처리 시 상기 열처리 전의 활성의 70% 이상, 50℃ 내지 60℃에서 0.5시간 내지 6시간 열처리 시 상기 열처리 전의 활성의 80% 이상, 또는 50℃ 내지 70℃에서 0.5시간 내지 3시간 열처리 시 상기 열처리 전의 활성의 80% 이상의 활성을 유지할 수 있다. 또한, 상기 변이형 폴리펩티드는 50℃ 내지 70℃에서 0.5시간 내지 9시간 열처리 시, 상기 열처리 전의 활성의 70% 이상의 활성을 유지할 수 있다. 구체적으로, 상기 변이형 폴리펩티드는 50℃ 내지 70℃에서 0.5시간 내지 3시간 열처리 시 상기 열처리 전의 활성의 80% 이상의 활성을 유지할 수 있다. 보다 구체적으로, 상기 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드의 N-말단으로부터 392번 글리신(G) 아미노산 잔기가 알라닌(A)으로 돌연변이된 변이형 폴리펩티드는 50℃ 내지 70℃에서 0.5시간 내지 6시간 열처리 시 상기 열처리 전의 활성의 80% 이상의 활성을 유지할 수 있다.
본 출원의 폴리펩티드는 메이오써머스 루퍼스(Meiothermus rufus) 유래일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 상기 폴리펩티드 또는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 폴리펩티드 또는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 폴리뉴클레오티드는 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 본 출원의 폴리펩티드 또는 변이형 폴리펩티드의 아미노산 서열을 코딩하는 염기 서열을 포함할 수 있다.
또한, 본 출원의 수크로스를 투라노스로 전환시키는 활성을 가지는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드는, 본 출원의 수크로스를 투라노스로 전환시키는 활성을 가지는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드서열이라면 제한없이 포함될 수 있다. 구체적으로 본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 서열번호 1의 아미노산 서열에서 392번째 아미노산이 다른 아미노산으로 치환된 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다. 예를 들어, 본 출원의 변이형 폴리펩티드는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 아미노산 서열에서 392번째 아미노산이 다른 아미노산으로 치환된 변이형 폴리펩티드의 활성을 가지는 단백질을 코딩하는 서열이라면 제한없이 포함될 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2, 4, 6 또는 8의 염기 서열로 이루어진 폴리뉴클레오티드, 또는 서열번호 2, 4, 6 또는 8의 염기서열과 적어도 80% 이상, 85% 이상, 90% 이상, 95% 이상, 97% 이상, 99% 이상의 상동성 또는 동일성을 가지는 염기 서열로 이루어진 폴리뉴클레오티드일 수 있으나, 이에 제한되지 않는다.
또한, 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리펩티드를 코딩하는 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하는 폴리뉴클레오티드에 의해 코딩되는 폴리펩티드로서, 수크로스를 투라노스로 전환시키는 활성을 가지는 폴리펩티드라면 제한없이 포함될 수 있다. 상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 유전자끼리, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1 X SSC, 0.1% SDS, 구체적으로는 60℃, 0.1 X SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1 X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원의 서열번호 1, 3, 5 또는 7의 아미노산 서열로 이루어진 폴리펩티드 또는 변이형 폴리펩티드는 각각 서열번호 2, 4, 6 또는 8의 폴리뉴클레오티드 서열에 의하여 코딩된 것일 수 있다.
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다. 본 출원에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 변이형 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다. 본 출원의 또 하나의 양태로서, 본 출원은 상기 변이형 폴리펩티드를 포함하거나, 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하여, 퓨린 뉴클레오티드를 생산하는 미생물을 제공하는 것이다. 구체적으로 변이형 폴리펩티드 및/또는 상기 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 미생물은 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환에 의해 제조되는 미생물일 수 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 재조합 미생물을 제공하는 것이다.
본 출원의 재조합 미생물에 있어서 상기 재조합은 형질 전환에 의해 이루어질 수 있다. 본 출원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다. 상기 형질전환 하는 방법은 폴리뉴클레오티드를 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(Ca(H2PO4)2, CaHPO4, 또는 Ca3(PO4)2) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 숙주세포 또는 미생물은 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하여 글루코실글리세롤을 생산할 수 있는 미생물이라면 모두 가능하다. 구체적 예로, 에스케리키아(Escherichia) 속, 세라티아(Serratia) 속, 어위니아(Erwinia) 속, 엔테로박테리아(Enterobacteria) 속, 프로비덴시아(Providencia) 속, 살모넬라(Salmonella) 속, 스트렙토마이세스(Streptomyces) 속, 슈도모나스(Pseudomonas) 속, 브레비박테리움(Brevibacterium) 속 또는 코리네박테리움(Corynebacterium) 속 등의 미생물 균주가 포함될 수 있으며, 구체적으로 에스케리키아(Escherichia) 속 또는 코리네박테리움(Corynebacterium) 속 미생물일 수 있고, 보다 구체적인 예로는 에스케리키아 콜라이(Escherichia coli) 또는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나 이에 한정되지 않는다. 본 출원의 재조합 미생물은 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터 도입 이외에도 다양한 공지의 방법에 의해 본 출원의 글루코실글리세롤 생산 활성을 가지는 폴리펩티드 또는 변이형 폴리펩티드를 발현할 수 있는 미생물을 모두 포함할 수 있다. 일 구현예로, 본 출원의 재조합 미생물은 CJ_Mrf_AS(KCCM11939P), E. coli BL21(DE3)/MRF+G392T(KCCM12113P), E. coli BL21(DE3)/MRF+G392E(KCCM12112P) 및 E. coli BL21(DE3)/MRF+G392A(KCCM12111P)일 수 있다
본 출원의 또 하나의 양태로서, 본 출원은 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물을 포함하는 글루코실글리세롤 생산용 조성물을 제공하는 것이다. 구체적으로, 상기 글루코실글리세롤 생산용 조성물은 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드를 포함하는 것일 수 있다.
본 출원의 또 다른 하나의 양태로서, 본 출원은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드, 상기 변이형 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물을 포함하는 글루코실글리세롤 생산용 조성물로서, 상기 아미노산 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번째 글리신(G) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것을 포함하는, 글루코실글리세롤 생산용 조성물을 제공하는 것이다. 상기 조성물은 글루코실글리세롤 생산에 관여하는 것이라면 이에 제한되지 않는다.
또한, 상기 조성물은 글리세롤(glycerol) 및 글루코스 단위(glucose unit)를 포함하는 당류를 추가로 포함할 수 있으나, 이에 제한되지 않는다. 본 출원의 조성물은 당해 글루코실글리세롤 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있다. 이러한 부형제로는, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 또 하나의 양태로서, 본 출원은 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물에 글리세롤 및 글루코스 단위(glucose unit)를 포함하는 당류를 접촉시켜, 글루코실글리세롤을 생산하는 단계를 포함하는, 글루코실글리세롤 제조방법을 제공하는 것이다. 구체적으로, 상기 글루코실글리세롤 제조방법은 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드를 포함하는 것일 수 있다.
본 출원의 또 다른 하나의 양태로서, 본 출원은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드, 상기 변이형 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물에 글리세롤 및 글루코스 단위(glucose unit)를 포함하는 당류를 접촉시켜, 글루코실글리세롤을 생산하는 단계를 포함하는 글루코실글리세롤 제조방법에 있어서, 상기 아미노산의 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번 글리신(G) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것인, 글루코실글리세롤 제조방법을 제공하는 것이다. 상기 방법은 글루코실글리세롤 제조에 관여하는 것이라면 이에 제한되지 않는다.
상기 글리세롤 및 글루코스 단위의 몰 비율은 1:0.1 내지 1:3인 것 일 수있으나, 이에 제한되지 않는다. 구체적으로 상기 글리세롤 및 글루코스 단위의 몰 비율은 수크로즈 대비 글리세롤 농도가 1:0.1 내지 1:3, 1:0.5 내지 1:3, 1:1 내지 1:3, 1:1.5 내지 1:3 또는 1:1.5 내지 1:2.5 범위 일 수 있으며, 더욱 구체적으로는 1:2 범위일 수 있으나 이에 제한되지 않는다.
또한, 상기 접촉은 pH 4.0 내지 9.0 조건에서, 40℃ 내지 80℃ 온도 조건에서, 및/또는 1시간 내지 48시간 동안 수행하는 것일 수 있으나, 이에 제한되지 않는다. 구체적으로, 본 출원의 접촉은 pH 4.0 내지 pH 9.0, pH 5.0 내지 pH 9.0,pH 6.0 내지 pH 9.0, pH 7.0 내지 pH 9.0, pH 4.0 내지 pH 8.0,pH 5.0 내지 pH 8.0, pH 6.0 내지 pH 8.0 또는 pH 7.0 내지 pH 8.0에서 수행할 수 있다. 또한, 본 출원의 접촉은 40℃ 내지 80℃, 45℃ 내지 80℃, 50℃ 내지 80℃, 55℃ 내지 80℃, 60℃ 내지 80℃, 40℃ 내지 75℃, 45℃ 내지 75℃, 50℃ 내지 75℃, 55℃ 내지 75℃, 60℃ 내지 75℃, 40℃ 내지 70℃, 45℃ 내지 70℃, 50℃ 내지 70℃, 55℃ 내지 70℃, 60℃ 내지 70℃, 40℃ 내지 65℃, 45℃ 내지 65℃, 50℃ 내지 65℃, 55℃ 내지 65℃, 40℃ 내지 60℃, 45℃ 내지 60℃ 또는 50℃ 내지 60℃ 온도 조건에서 수행할 수 있다. 더불어, 본 출원의 접촉은 1 시간 내지 48시간 동안, 1시간 내지 36시간 동안, 1시간 내지 24시간 동안, 1시간 내지 12시간 동안, 1시간 내지 6시간 동안, 3시간 내지 48시간 동안, 3시간 내지 24시간 동안, 3시간 내지 12시간 동안, 3시간 내지 6시간 동안, 6시간 내지 48시간 동안, 6시간 내지 36시간 동안, 6시간 내지 24시간 동안 수행할 수 있다.
상기 조성물 또는 상기 방법에 있어서, 상기 미생물의 배양물은 본 출원의 폴리펩티드 또는 변이형 폴리펩티드를 발현하는 미생물을 배지에서 배양하는 단계로부터 제조될 수 있다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양은 당업계에 알려진 적당한 배지와 배양 조건에 따라 수행될 수 있다. 이러한 배양은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로, 본 출원의 배양은 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있으나, 이에 제한되지 않는다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 pH 9, 구체적으로는 pH 6 내지 pH 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있고, 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다. 배양온도는 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃를 유지할 수 있고, 약 0.5시간 내지 160시간 동안 배양할 수 있으나, 이에 제한 되는 것은 아니다. 상기 배양에 의하여 생산된 본 출원의 폴리펩티드 또는 변이형 폴리펩티드는 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물(예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방(예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산(예: 팔미트산, 스테아르산 및 리놀레산), 알코올(예: 글리세롤 및 에탄올) 및 유기산(예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물(예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물(예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염(예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
본 출원의 제조방법은 제조된 글루코실글리세롤을 분리 및/또는 정제하는 단계를 추가로 포함할 수 있다. 상기 분리 및/또는 정제는 본 출원의 기술 분야에서 통상적으로 사용하는 방법을 사용할 수 있으며. 비제한적인 예로, 투석, 침전, 흡착, 전기영동, 이온교환 크로마토그래피 및 분별 결정 등을 사용할 수 있다. 상기 정제는 하나의 방법만 실시될 수도 있으며, 두 가지 이상의 방법을 함께 실시할 수도 있다.
또한, 본 출원의 제조방법은 상기 분리 및/또는 정제하는 단계 이전 또는 이후에 탈색 및/또는 탈염을 수행하는 단계를 추가로 포함할 수 있다. 상기 탈색 및/또는 탈염을 실시함으로써, 보다 품질이 우수한 글루코실글리세롤을 얻을 수 있다.
다른 구현예로, 본 출원의 제조방법은 본 출원의 글루코실글리세롤로 전환하는 단계, 분리 및/또는 정제하는 단계, 또는 탈색 및/또는 탈염하는 단계 이후 글루코실글리세롤을 결정화하는 단계를 추가로 포함할 수 있다. 상기 결정화는 통상적으로 사용하는 결정화 방법을 사용하여 수행할 수 있다. 예를 들어, 냉각결정화 방법을 사용하여 결정화를 수행할 수 있다.
다른 구현예로, 본 출원의 제조방법은 상기 결정화하는 단계 이전에 글루코실글리세롤을 농축하는 단계를 추가로 포함할 수 있다. 상기 농축은 결정화 효율을 높일 수 있다.
다른 구현예로, 본 출원의 제조방법은 본 출원의 분리 및/또는 정제하는 단계 이후 미반응된 수크로스를 본 출원의 폴리펩티드 또는 변이형 폴리펩티드, 상기 폴리펩티드 또는 변이형 폴리펩티드를 발현하는 미생물 또는 상기 미생물의 배양물과 접촉시키는 단계, 본 출원의 결정화하는 단계 이후 결정이 분리된 모액을 상기 분리 및/또는 정제 단계에 재사용하는 단계, 또는 이의 조합을 추가로 포함할 수 있다. 상기 추가 단계를 통해 글루코실글리세롤을 더욱 고수율로 수득할 수 있으며 버려지는 수크로스의 양을 절감할 수 있어 경제적 이점이 있다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니며, 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예 1: 글루코실글리세롤 활성을 갖는 폴리펩티드 및 이의 변이형 폴리펩티드 생산을 위한 재조합 벡터 및 재조합 미생물의 제조
1-1. 글루코실글리세롤 생산 활성을 갖는 폴리펩티드 생산을 위한 벡터 제조
내열성을 가지면서 글루코실글리세롤 생산 활성을 가지는 폴리펩티드를 발굴하기 위해 호열성 미생물인 메이오써머스 루퍼스(Meiothermus rufus)의 유전자 정보를 확보하여 대장균 발현 가능 벡터 및 재조합 미생물을 제조하였다.
구체적으로, NCBI(National Center for Biotechnology Information)에 등록된 메이오써머스 루퍼스 유전자 서열에서 글루코실글리세롤 생산 활성을 가질 것으로 예상되는 유전자를 선발하였다. 상기 유전자가 발현하는 폴리펩티드(이하, MRF로 기재; 서열번호 1)를 암호화하는 폴리뉴클레오티드(서열번호 2)를 합성 프라이머(서열번호 9 및 10, 표 1)를 이용하여 PCR(94℃에서 5분간 변성, 94℃ 30초 변성 후 60℃ 30초 어닐링한 다음 72℃ 90초 신장하는 것을 30회 반복, 72℃에서 10분간 신장반응 조건)을 통해 증폭하였다. 상기 증폭된 폴리뉴클레오티드를 제한효소 NdeⅠ 및 SalⅠ을 사용하여 발현벡터인 pET21a_SalI6His(pET21a의 제한효소 XhoI 인식부위 CTCGAG를 SalI 인식부위 GTCGAC로 변형한 벡터)에 삽입하여 재조합 벡터 pET21a-Mrf를 제조하였다.
서열번호 프라이머 서열(5'-3')
9 정방향 GGGCATATGATGGATGTTGCTGCCTTCCTGAA
10 역방향 CCGTCAGCTAGCTTGCCCTCGAGGGGAG
1-2. 변이형 폴리펩티드 생산을 위한 재조합 벡터 제조
글루코실글리세롤 생산 활성을 갖는 폴리펩티드의 변이형 폴리펩티드 발현을 위한 재조합 벡터는 서열번호 1의 N-말단으로부터 392번 위치 글리신(Glycin) 아미노산 잔기를 쓰레오닌(Threonine), 글루타민산(Glutamic acid) 또는 알라닌(Alanine)으로 치환한 폴리펩티드[이하, 순차적으로 MRF+G392T(서열번호 3), MRF+G392E(서열번호 5) 및 MRF+G392A(서열번호 7)]를 암호화하는 폴리뉴클레오티드(순차적으로, 서열번호 2, 4 및 8)를 제조한 후, 제한효소 NdeⅠ 및 SalⅠ을 사용하여 pET21a_SalI6His 벡터에 삽입하여 pET21a-Mrf+G392T, pET21a-Mrf+G392E 및 pET21a-Mrf+G392A를 제조하였다. 상기 변이형 폴리펩티드를 암호화하는 폴리뉴클레오티드는 pET21a-Mrf를 주형(template)으로 하여 역방향(inversed) PCR 기반 포화 돌연변이법을 사용하였다(2014. Anal. Biochem. 449:90-98). PCR은 94℃에서 2분간 변성, 94℃ 30초 변성한 후 60℃ 30초 어닐링한 다음 72℃ 10분 신장하는 것을 30회 반복 및 72℃에서 60분간 신장반응 조건으로 수행하였다. 프라이머는 치환 부위의 앞쪽 염기 15bp와 치환 부위의 염기 3bp(RMG), 치환 부위의 뒤쪽 염기 15bp로 이루어진 33bp의 프라이머를 제작하여 이용하였으며, 프라이머 서열은 하기 표 2에 기재한 바와 같다.
서열번호 프라이머 서열(5'-3')
11 정방향 TGCCACGACGACATCRMGTGGGCCATCTCCGAC
12 역방향 GTCGGAGATGGCCCACKYGATGTCGTCGTGGCA
1-3. 재조합 미생물 제조
상기 실시예 1-1 및 1-2에서 제조한 각 재조합 벡터는 열 충격(heat shock transformation, Sambrook and Russell: Molecular cloning, 2001)에 의하여 대장균 BL21(DE3)(invitrogen)에 형질전환하여 재조합 미생물을 제조한 후, 50% 글리세롤에 냉동 보관하여 사용하였다. 상기 재조합 미생물을 각각 CJ_Mrf_AS, E. coli BL21(DE3)/MRF+G392T, E. coli BL21(DE3)/MRF+G392E 및 E. coli BL21(DE3)/MRF+G392A로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 기탁하여, 기탁번호 KCCM11939P(2016년 11월 22일 기탁), KCCM12113P(2017년 9월 13일 기탁), KCCM12112P(2017년 9월 13일 기탁) 및 KCCM12111P(2017년 9월 13일 기탁)를 부여 받았다.
실시예 2: 재조합 폴리펩티드 및 변이형 폴리펩티드 제조
실시예 1에서 제조한 재조합 미생물 CJ_Mrf_AS, E. coli BL21(DE3)/MRF+G392T, E. coli BL21(DE3)/MRF+G392E 및 E. coli BL21(DE3)/MRF+G392A를 각각 5 ml LB 액체배지에 접종하고, 600 nm에서의 흡광도가 2.0이 될 때까지 종균 배양하였다. 종균 배양 후의 배양액을 LB 액체배지에 접종하여 본 배양을 진행하고, 600 nm에서의 흡광도가 2.0이 될 때 0.5 mM IPTG를 첨가하여 재조합 효소 및 변이체 발현을 유도하였다. 종균 배양 및 본 배양의 교반 속도는 200 rpm이며, 배양 온도는 37℃가 유지되도록 하였다. 본 배양 후, 배양액을 8,000×g로 4℃에서 20분 동안 원심분리하여 균체를 회수하고, 회수된 균체를 50 mM 인산염 완충용액(pH 7.5)으로 2회 세척한 후, 동일한 완충용액으로 현탁 후 초음파 세포파쇄기를 이용하여 파쇄하였다. 세포 파쇄물을 13,000×g로 4℃에서 20분 동안 원심분리 후 상등액만을 취하고, His-tag 친화 크로마토그래피를 사용하여 각각의 재조합 미생물에서 정제된 폴리펩티드인 MRF 및 정제된 변이형 폴리펩티드인 MRF+G392T, MRF+G392E 및 MRF+G392A를 수득하였다. 상기 정제 폴리펩티드들을 50 mM 인산염 완충용액(pH 7.5)으로 투석 후, 활성 분석을 위해 사용하였다.
실시예 3: 재조합 폴리펩티드 및 변이형 폴리펩티드의 글루코실글리세롤 생산성 분석
실시예 2에서 제조한 각 폴리펩티드 별로 글루코실글리세롤 생산 활성을 비교하기 위해, 공지된 방법(Nakano, H. et al., (2003). J Biosci Bioeng, 95, 583-588)을 이용하여 글루코실글리세롤 생산성을 측정하였다. 구체적으로, 0.8M 설탕 및 1.6 M 글리세롤이 포함된 50mM 인산칼륨(pH 6.0)에 정제된 각 폴리펩티드를 1 mg/ml 첨가하여 55℃에서 16시간 동안 반응시킨 후 감소한 글리세롤의 양을 HPLC로 분석하여 측정하였다. HPLC 분석은 SUGAR SP0810(Shodex) 컬럼을 사용하여 80℃에서, 이동상으로 물을 0.6 ml/분 유속으로 흘려 주면서 수행하였으며, 시차 굴절률 검출기(Refractive Index Detector)로 글루코실글리세롤을 검출하였다.
그 결과, MRF, MRF+G392T, MRF+G392E 및 MRF+G392A 모두 글리세롤이 감소하여 글루코실글리세롤 생성 활성을 가짐을 확인하였다. 구체적으로, MRF를 사용하여 반응시킨 경우 23g/l, MRF+G392A를 사용하여 반응시킨 경우 32g/l, MRF+G392E를 사용하여 반응시킨 경우 28g/l, MRF+G392T를 사용하여 반응시킨 경우 29g/l의 글리세롤를 소비하였다(도 1a 내지 1d). 전환율(반응 후 감소한 글리세롤 양/반응 전 글리세롤 양 * 100)을 비교한 결과, MRF는 32%, MRF+G392A는 54%, MRF+G392E는 53%, MRF+G392T는 47%로, 변이형 폴리펩티드의 전환율이 MRF 보다 15% 이상 높아 글루코실글리세롤 생산성이 우수함을 확인할 수 있었다(도 2).
실시예 4: 열안정성 분석
실시예 2에서 제조한 각 폴리펩티드의 열안전성을 확인하기 위해, 온도 50℃, 60℃ 및 70℃까지의 범위에서 26시간 동안 열처리한 효소를 이용하여 잔여 활성을 측정하였다. 활성은 0.8 M 설탕 및 8 M 글리세롤이 포함된 50 mM 인산칼륨(potassium phosphate, pH 6.0) 완충용액에 열처리된 폴리펩티드 각각을 1 mg/ml 첨가하여 55℃에서 2 시간 동안 반응시킨 후 실시예 3과 동일한 방법으로 HPLC로 글리세롤 감소량을 분석하여 측정하였다.
그 결과, MRF는 50℃, 60℃ 및 70℃ 온도 조건에서 서서히 활성이 감소하여 26시간 경과시 초기 활성의 약 65% 정도를 유지하는 것을 확인하였다(표 3 및 도 3a). 또한, MRF+G392A, MRF+G392E 및 MRF+G392T도 MRF와 유사한 열안전성을 나타냄을 확인하였다(표 3 및 도 3b 내지 3d).
상대 전환율(%)
MRF MRF+G392A MRF+G392E MRF+G392T
50°C 60°C 70°C 50°C 60°C 70°C 50°C 60°C 70°C 50°C 60°C 70°C
0 h 100 100 100 100 100 100 100 100 100 100 100 100
3 h 84 83 83 84 84 83 86 95 84 82 82 82
6 h 80 81 79 85 84 80 83 79 80 79 79 72
9 h 69 70 79 70 70 80 71 71 80 70 70 72
21 h 68 68 70 73 68 66 71 70 65 65 62 63
26 h 65 65 64 74 74 64 70 69 66 64 68 62
실시예 5: 글리세롤 농도 별 글루코실글리세롤 생산 활성 분석
실시예 2에서 제조한 각 폴리펩티드의 글리세롤 농도에 따른 글루코실글리세롤 생산 활성을 확인하기 위해, 0.5 mg/ml 정제된 각각의 폴리펩티드와 0.8 M 설탕이 포함된 50 mM 인산칼륨(pH 6.0) 용액에 0.08, 0.4, 0.8, 1.6 및 2.4 M 글리세롤(설탕 몰 농도 비로 1:0.1, 1:0.5, 1:1, 1:2, 1:3)를 각각 첨가하여 55℃에서 16시간 동안 반응을 시킨 후, 효소반응 후 실시예 3과 동일한 방법으로 HPLC로 글리세롤 감소량을 분석하여 측정하였다.
그 결과, 모든 폴리펩티드를 이용한 반응에서 글리세롤 농도가 낮을수록 높은 전환율을 나타내었다. 또한, 글리세롤이 1.6 M일 때 글리세롤을 가장 많이 소비한바, 설탕과 글리세롤의 몰 비가 1:2인 경우 글루코실글리세롤 생산 활성이 가장 높음을 확인 할 수 있었다(도 4a 내지 4d).
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2018006678-appb-I000001
Figure PCTKR2018006678-appb-I000002
Figure PCTKR2018006678-appb-I000003
Figure PCTKR2018006678-appb-I000004

Claims (16)

  1. 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 글루코실글리세롤 생산 활성을 가지는, 폴리펩티드.
  2. 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드로서,
    상기 아미노산 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번째 글리신(G: Glycine) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것을 포함하는, 글루코실글리세롤 생산 활성을 가지는 변이형 폴리펩티드.
  3. 제2항에 있어서, 상기 다른 아미노산은 쓰레오닌(T: Threonine), 글루타민산(E: Glutamic acid) 또는 알라닌(A: Alanine)인 것인, 변이형 폴리펩티드.
  4. 제2항에 있어서, 상기 변이형 폴리펩티드는 서열번호 3, 5 또는 7의 아미노산 서열로 이루어진, 변이형 폴리펩티드.
  5. 제1항의 폴리펩티드, 또는 제2항 내지 제4항 중 어느 한 항의 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드.
  6. 제5항의 폴리뉴클레오티드를 포함하는 벡터.
  7. 제5항의 폴리뉴클레오티드를 포함하는 재조합 미생물.
  8. 제6항의 벡터를 포함하는 재조합 미생물.
  9. 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물을 포함하는 글루코실글리세롤 생산용 조성물.
  10. 제9항에 있어서,
    상기 폴리펩티드는 서열번호 1의 아미노산 서열로 이루어진 것인, 글루코실글리세롤 생산용 조성물.
  11. 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드, 상기 변이형 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물을 포함하는 글루코실글리세롤 생산용 조성물로서,
    상기 아미노산 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번째 글리신(G) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것을 포함하는, 글루코실글리세롤 생산용 조성물.
  12. 제9항 또는 제11항에 있어서, 상기 조성물은 글리세롤(glycerol) 및 글루코스 단위(glucose unit)를 포함하는 당류를 추가로 포함하는, 글루코실글리세롤 생산용 조성물.
  13. 서열번호 1의 아미노산 서열과 85% 이상의 상동성을 가지는 아미노산 서열을 포함하는 폴리펩티드, 상기 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물에 글리세롤 및 글루코스 단위(glucose unit)를 포함하는 당류를 접촉시켜, 글루코실글리세롤을 생산하는 단계를 포함하는, 글루코실글리세롤 제조방법.
  14. 제13항에 있어서,
    상기 폴리펩티드는 서열번호 1의 아미노산 서열로 이루어진 것인, 글루코실글리세롤 제조방법.
  15. 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 변이형 폴리펩티드, 상기 변이형 폴리펩티드를 발현하는 미생물, 또는 상기 미생물의 배양물에 글리세롤 및 글루코스 단위(glucose unit)를 포함하는 당류를 접촉시켜, 글루코실글리세롤을 생산하는 단계를 포함하는 글루코실글리세롤 제조방법에 있어서,
    상기 아미노산의 변이는 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드의 N-말단으로부터 392번 글리신(G) 아미노산 잔기가 하나 이상의 다른 아미노산으로 치환된 것인, 글루코실글리세롤 제조방법.
  16. 제13항 또는 제15항에 있어서, 상기 글리세롤 및 글루코스 단위의 몰 비율은 1:0.1 내지 1:3인, 글루코실글리세롤 제조방법.
PCT/KR2018/006678 2017-06-12 2018-06-12 글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법 WO2018230953A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170073233 2017-06-12
KR10-2017-0073233 2017-06-12
KR20180004547 2018-01-12
KR10-2018-0004547 2018-01-12

Publications (1)

Publication Number Publication Date
WO2018230953A1 true WO2018230953A1 (ko) 2018-12-20

Family

ID=64660349

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/006678 WO2018230953A1 (ko) 2017-06-12 2018-06-12 글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법

Country Status (2)

Country Link
KR (1) KR102232837B1 (ko)
WO (1) WO2018230953A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102571308B1 (ko) 2021-02-24 2023-08-28 중앙대학교 산학협력단 신규한 하이포피키야 부토니 kjj43 균주 및 이의 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060001498A (ko) * 2004-06-30 2006-01-06 학교법인 포항공과대학교 초고온성 미생물을 이용한 알파글루코실글리세롤의 생산방법
CN104651287A (zh) * 2013-11-22 2015-05-27 中国科学院青岛生物能源与过程研究所 一种用于合成甘油葡糖苷的工程菌和应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AT504347B8 (de) 2006-09-21 2008-09-15 Univ Graz Tech Verfahren zur herstellung von glucosederivaten

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060001498A (ko) * 2004-06-30 2006-01-06 학교법인 포항공과대학교 초고온성 미생물을 이용한 알파글루코실글리세롤의 생산방법
CN104651287A (zh) * 2013-11-22 2015-05-27 中国科学院青岛生物能源与过程研究所 一种用于合成甘油葡糖苷的工程菌和应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 12 June 2014 (2014-06-12), Database accession no. WP_027883290.1 *
JEONG, JIN-WOO: "Biosynthesis of glucosyl glycerol, a compatible solute, using intermolecular transglycosylation activity of amylosucrase from Methylobacillus flagellatus KT.", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 173, no. 4, 15 April 2014 (2014-04-15), pages 904 - 917, XP055239720, DOI: 10.1007/s12010-014-0889-z *
LULEY-GOEDL, C. ET AL.: "Biocatalytic Process for Production of a-Glucosylglycerol Using Sucrose Phosphorylase", FOOD TECHNOLOGY AND BIOTECHNOLOGY, vol. 48, no. 3, 2010, pages 276 - 283, XP055647497, ISSN: 1330-9862 *

Also Published As

Publication number Publication date
KR20180135425A (ko) 2018-12-20
KR102232837B1 (ko) 2021-03-29

Similar Documents

Publication Publication Date Title
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2018182345A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2020022547A1 (ko) 신규 5'-이노신산 디하이드로게나아제 및 이를 이용한 5'-이노신산 제조방법
WO2020111436A1 (ko) Camp 수용 단백질 변이체 및 이를 이용한 l-아미노산 제조방법
WO2019027173A2 (ko) 신규한 싸이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2020111438A1 (ko) Camp 수용 단백질 변이체 및 이를 이용한 l-아미노산 제조방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2020111437A1 (ko) Camp 수용 단백질 변이체 및 이를 이용한 l-아미노산 제조방법
WO2020067649A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2019112368A1 (ko) 신규한 사이코스-6-인산 탈인산효소, 상기 효소를 포함하는 사이코스 생산용 조성물, 상기 효소를 이용하여 사이코스를 제조하는 방법
WO2022225322A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 알파 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022005225A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2018230953A1 (ko) 글루코실글리세롤 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 글루코실글리세롤 제조방법
WO2017065529A1 (ko) O-아세틸호모세린 설피드릴라제 변이체 및 이를 이용한 l-메치오닌 제조 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225321A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 감마 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2018230952A1 (ko) 투라노스 생산 활성을 가지는 신규한 폴리펩티드 및 이를 이용한 투라노스 제조방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231371A1 (ko) 신규한 5-(카르복시아미노)이미다졸리보뉴클레오티드합성효소 변이체 및 이를 이용한 imp 생산 방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2020067786A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2021029688A1 (ko) 신규 과당-4-에피머화 효소 및 이를 이용한 타가토스의 제조 방법
WO2018230946A1 (ko) 신규 내열성 아밀로수크라제 효소 및 이를 이용한 아밀로스의 효소적 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18817769

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM1205A DATED 20/03/2020)

122 Ep: pct application non-entry in european phase

Ref document number: 18817769

Country of ref document: EP

Kind code of ref document: A1