WO2018135860A1 - 식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터 - Google Patents

식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터 Download PDF

Info

Publication number
WO2018135860A1
WO2018135860A1 PCT/KR2018/000807 KR2018000807W WO2018135860A1 WO 2018135860 A1 WO2018135860 A1 WO 2018135860A1 KR 2018000807 W KR2018000807 W KR 2018000807W WO 2018135860 A1 WO2018135860 A1 WO 2018135860A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
domain
target protein
recombinant vector
glycosylation
Prior art date
Application number
PCT/KR2018/000807
Other languages
English (en)
French (fr)
Inventor
황인환
강향주
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to JP2019538440A priority Critical patent/JP6968451B2/ja
Priority to US16/478,592 priority patent/US11279943B2/en
Publication of WO2018135860A1 publication Critical patent/WO2018135860A1/ko
Priority to US17/650,975 priority patent/US11845945B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70589—CD45
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/005—Glycopeptides, glycoproteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
    • C07K2319/91—Fusion polypeptide containing a motif for post-translational modification containing a motif for glycosylation

Definitions

  • the present invention relates to a technique for high expression of a target protein in plant cells using a glycosylation domain, comprising a recombinant vector comprising a fusion protein coding gene of a glycosylation domain and a target protein, a recombinant cell, a transformed plant, and a target protein using the same. Provide the production method.
  • N-glycosyl at i on is the stabilization of protein (stabi 1 i ty) It is well known that it affects. In this case, N-glycans were thought to increase stability because they protect proteins from protase. Another mechanism is known to provide stability by providing additional binding force to the three-dimensional structure of the protein.
  • the present inventors have made diligent efforts to increase the expression level of the target protein in the translation step in producing the target protein in plant cells, and confirmed that the expression level of the protein is increased when the small domains that cause glycation are fused to the target protein.
  • the present invention was completed by demonstrating that the target protein production efficiency in transformed plants can be dramatically increased.
  • the present invention relates to the use of the N-glycosyl at i on domain for use in expressing a desired protein.
  • composition for expressing a target protein comprising at least one selected from the group consisting of a gene encoding an N-glycosylation domain, a recombinant vector comprising the gene, and a recombinant cell comprising the recombinant vector.
  • the target protein expression composition may further comprise a target protein coding gene or a recombinant vector comprising the gene.
  • the target protein coding gene and the N-glycosylation domain coding gene may be included in the form of a gene encoding a fusion protein including the N-glycosylation domain and the target protein or a recombinant vector including the same.
  • the N—glycosylation domain may be an N—glycosylation domain (eg, multiple N-glycosylation domains) comprising one or more, or two or more, N—glycosyl at residues, one embodiment
  • it may be one comprising a CD45 derived M domain, such as a human CD45 derived M domain or part thereof.
  • the target protein expression may be performed in eukaryotic cells (eg, plant cells) or eukaryotic organisms (eg, plants).
  • Another example is a fusion protein comprising an N-glycosylation domain and a target protein.
  • the cell may be a eukaryotic cell, such as a plant cell.
  • Recombinant vector and / or recombinant cells comprising the fusion protein coding gene can be used for the purpose of enhancing the production of the protein of interest. Accordingly, another example provides a composition for producing a target protein or enhancing a target protein production comprising a recombinant vector and / or a recombinant cell comprising a coding gene of a fusion protein comprising an N—glycosylation domain and a target protein.
  • Another example provides a transgenic organism into which a recombinant vector comprising the coding gene of a fusion protein comprising the N-glycosylation domain and the protein of interest is introduced.
  • the transforming organism may be a transforming eukaryotic organism, such as a transforming plant.
  • Another example provides a method for producing a target protein or a method for increasing target protein, comprising introducing the composition for producing a target protein or a composition for increasing production into a cell.
  • the method can increase the expression or production of the target protein as compared to when the target protein coding gene is introduced into the cell alone (ie, via a recombinant vector that does not contain an N—glycosylation domain). It features.
  • the present invention is to solve the above problems, N-glycosylated
  • a target protein for use in expressing a target protein in a plant of a (N-gl ycosyl at i on) domain, more specifically, a gene encoding the target protein, and a C-terminal corresponding region (3 ′ terminus) of the gene, or N- By fusing and expressing a gene encoding an N-glycosylation domain at the terminal corresponding site (5 'terminus).
  • a technique for increasing the expression level of a protein is proposed.
  • One example provides a composition for expressing a target protein comprising at least one selected from the group consisting of a gene encoding an N—glycosylation domain, a recombinant vector comprising the gene, and a recombinant cell comprising the recombinant vector.
  • the target protein expression composition is a target protein coding gene or It may further comprise a recombinant vector comprising the gene.
  • the target protein coding gene and the N-glycosylation domain coding gene may be included in the form of a gene encoding a fusion protein including the N-glycosylation domain and the target protein or a recombinant vector including the same.
  • the N-glycosylation domain may be an N-glycosylation domain comprising one or more, or two or more, N-glycosifiable residues, and in one embodiment, a CD45 derived M domain or part thereof, such as a human CD45 derived M domain or its May include some.
  • the target protein expression may be performed in eukaryotic cells (eg, plant cells) or eukaryotic organisms (eg, plants).
  • Another example provides a recombinant vector comprising a coding gene of a fusion protein comprising an N—glycosylation domain and a protein of interest.
  • the recombinant vector may be for expression in eukaryotic cells, such as plant cells.
  • a recombinant cell comprising a coding gene of a fusion protein comprising said N-glycosylation domain and the protein of interest.
  • the recombinant cell may be a recombinant vector comprising a coding gene of the fusion protein containing the N-glycosylation domain and the target protein is introduced into the cell.
  • the cell may be a eukaryotic cell, such as a plant cell.
  • transgenic organism comprising a fusion protein and a coding gene comprising the N-glycosylation domain and the protein of interest.
  • the transforming organism may be introduced into a recombinant vector comprising a coding gene of the fusion protein comprising the N-glycosylation domain and the protein of interest.
  • the transgenic organism may be a transgenic eukaryotic organism, such as a transgenic plant.
  • the transforming organism may be a eukaryotic organism (eg, plant 1) comprising the recombinant cells described above.
  • Recombinant vectors and / or recombinant cells and / or transgenic organisms comprising the fusion protein coding gene may be used for the production of the protein of interest or for the purpose of enhancing the production of the protein of interest.
  • another example is a coding gene of a fusion protein comprising an N-glycosylation domain and a target protein, a recombinant vector comprising the gene, a recombinant cell comprising the recombinant vector, and a transformation comprising the recombinant vector It provides a composition for producing a target protein or enhancing the production of the target protein comprising one or more selected from the group consisting of organisms.
  • Another example provides a method for producing a target protein or a method for increasing target protein production comprising culturing a recombinant cell comprising a coding gene of a fusion protein comprising an N-glycosylation domain and the target protein.
  • the recombinant cell may be a recombinant vector comprising a coding gene of the fusion protein containing the N-glycosylation domain and the target protein is introduced into the cell.
  • the cell may be a eukaryotic cell, such as a plant cell.
  • the method may further comprise introducing into the cell a recombinant vector comprising a coding gene of a fusion protein comprising an N—glycosylation domain and a protein of interest prior to the culturing step.
  • the method further comprises, after the culturing, separating (or extracting) and / or purifying the desired protein from the cultured cells (cells, cell lysates, or cell lysates) and / or culture medium. It
  • Another example provides a method for producing a target protein or a method for increasing target protein production, comprising the step of growing a transforming organism comprising a coding gene of a fusion protein comprising an N-glycosylation domain and a target protein.
  • the organism may be a eukaryotic organism such as a plant.
  • the method may further comprise introducing into the organism a recombinant vector comprising a coding gene of a fusion protein comprising an N—glycosylation domain and a protein of interest prior to the growing step.
  • the method further comprises, after the growing step, separating the target protein from the eukaryotic organism (eg, a plant) or cells of the eukaryotic organism (cell, cell lysate, cell lysate, or culture of the cell) ( Or extracting) and / or purifying.
  • eukaryotic organism eg, a plant
  • cells of the eukaryotic organism cell, cell lysate, cell lysate, or culture of the cell
  • the method is used when the target protein coding gene is introduced into a cell or organism alone (ie, when introduced through a recombinant vector containing no N-glycosylation domain), and the target protein is used in fusion with the 0-glycosylation domain. And / or the amount of expression of the target protein as compared to the case where the separate N-glycosylation domain is not fused and the target protein inherently contains an N-glycosylation residue. It is characterized by the fact that the output can be increased.
  • the N-glycosylation domain comprises one or more or two or more N-glycosylation residues (amino acids from which N-glycosylation occurs; asparagine (Asn)), for example one, two, three, four. And polypeptides comprising 5, 6, 7, 8, 9, or 10, with a total amino acid number of 10 to 100 or 20 to 80.
  • the N-glycosylation domain is a contiguous 10 to 100 or 20 to at least a human CD45 derived M domain (M doma in; including four N-glycosylation residues) or portions thereof in human CD45 It may be a polypeptide comprising 80 amino acids.
  • the human CD45 protein may be represented by the amino acid sequence of SEQ ID NO: 5 (UniProt no. P08575)
  • the human CD45 derived M domain is from Al a 231 residue of the human CD45 protein (SEQ ID NO: 5) from 290 Polythird (60aa; ANITVDYLYN ET LFTA L VNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD; SEQ ID NO: 2; underlined and bold letters represent N ′ glycosylation residues) up to the first residue, Asp.
  • the gene encoding the human CD45 derived M domain may be one comprising the nucleic acid sequence of SEQ ID NO: 1.
  • a portion of the human CD45-derived M domain may include N-glycosylation residues (eg, N (Asn) at position 2 of SEQ ID NO: 2, N (Asn) at position 30, N at position 40) Asn), and at least 46 (N (Asn)) at position 46) at least 10, at least 15, or at least 20 consecutive, including at least one, at least two, at least three, or at least four; More than one amino acid . It may be a polypeptide fragment comprising.
  • said polypeptide fragment comprises at least 10 contiguous, at least 15 or at least 20 contiguous residues comprising at least one amino acid residue selected from N at position 40 and N at position 46 in the amino acid sequence of SEQ ID NO: 2
  • It may be a polypeptide including the above amino acids, and may be, for example, "LTECKNASVS ISHNSCTAPD (SEQ ID NO: 6)" or "NVNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD (SEQ ID NO: 7)"), but is not limited thereto.
  • the N- glycosylation domains "From CD45 protein (SEQ ID NO: 5) in, ⁇ domain (SEQ ID NO: 2) or the ⁇ domain (SEQ ID NO: 2) continuous 10 or more, 15 or more or that of 20 Part of the ⁇ domain containing Polypeptides comprising consecutive 10 to 100 or 20 to 80 amino acids comprising (eg, SEQ ID NOs: 6, 7, or 8).
  • the gene encoding the M domain may have a nucleic acid sequence represented by SEQ ID NO: 1.
  • the recombinant vector may further include one or more selected from the group consisting of transcription regulators, markers that can confirm the translation regulator gene expression.
  • the transcriptional regulator may be one or more selected from all transcription factors commonly used for transcriptional regulation in cells, such as plant cells, for example, cauliflower mosaic virus 35S RNA.
  • cauliflower mosaic virus 35S RNA (Caul if lower Mosai c Virus 35S RNA) promoter, cauliflower mosaic virus 19S RNA (Cauul if lower Mosai c Virus 35S RNA) promoter peak water mosaic virus (Figwort Mosai c Vi rus) -derived full-length transcription promoter and tobacco mosaic virus (Tobacco Mosai c Vi rus) may be one or more selected from the group consisting of coat protein promoters, but is not limited thereto.
  • the translational regulator may be one or more selected from all translational regulators commonly used for translational regulation in cells, such as plant cells, for example, M17, but is not limited thereto.
  • the M17 factor may be represented by the nucleic acid sequence of SEQ ID NO: 3.
  • the recombinant vector may further comprise a signal sequence for targeting (moving and / or retent ions) to specific intracellular organelles.
  • the recombinant vector may be designed to be targeted to the endoplasmic reticulum (ER), and for this purpose, a vesicle (eg, cell membrane surface) migration signal (eg, BiP (chaperone binding protein) coding gene, etc.) and / or endoplasmic reticulum Retention signal (eg, HDEL (Hi s-Asp-Glu-Leu) peptide coding gene) may be further included.
  • a vesicle eg, cell membrane surface
  • migration signal eg, BiP (chaperone binding protein) coding gene, etc.
  • endoplasmic reticulum Retention signal eg, HDEL (Hi s-Asp-Glu-Leu) peptide coding gene
  • the intracellular organelle (eg endoplasmic reticulum) targeting signal sequence may be N-terminus (5 'terminus of fusion protein coding gene) or C-terminus (3' terminus of fusion protein coding gene) of a fusion protein, e.g., N-terminal ( May be linked to the 5 'end of the fusion protein coding gene) have.
  • the recombinant vector can be targeted to intracellular organelle endoplasmic reticulum (eg, inside the endoplasmic reticulum), thereby further increasing protein expression levels (see FIG. 3).
  • N—glycosylation of the fusion protein may occur inside the endoplasmic reticulum.
  • the BiP (chaperone binding protein) may be represented by the nucleic acid sequence of SEQ ID NO.
  • the target protein coding gene a human CD45-derived M domain coding gene, a transcriptional regulator, an M17 factor operably linked to the transcriptional regulator, and chaperone binding protein (BiP) and / or HDEL ( Hi s-Asp-Glu-Leu)
  • a recombinant vector for plant transformation for increasing the level of protein expression of interest comprising the gene encoding the peptide.
  • the recombinant vector may further comprise a marker to confirm gene expression.
  • the HA epitope sequence was used to confirm expression in Western blot, but is not limited thereto.
  • the eukaryotic cells described herein may be one or more selected from the group consisting of fungi, animal cells and plant cells, for example plant cells.
  • Eukaryotic organisms may be one or more selected from the group consisting of all eukaryotic single cell organisms and eukaryotic multicellular organisms (plants or animals), for example plants.
  • the plants described herein may be one or more plants selected from all algae, monocotyledonous and dicotyledonous plants, or cells thereof, eg, Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish , Dicotyledonous plants selected from the group consisting of cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot and celery; Or a monocotyledonous plant selected from the group consisting of rice, barley, wheat rye, corn sugar cane, oats and onions, or cells thereof, but is not limited thereto.
  • a eukaryotic organism eg plant
  • eukaryotic cell eg plant cell
  • Agrobacter ium sp.-mediated method particle gun One selected from the group consisting of particle gun bombardment, sii icon carbide whiskers, sonication, electroporat ion and polyethylenglycol-mediated transformation methods
  • particle gun One selected from the group consisting of particle gun bombardment, sii icon carbide whiskers, sonication, electroporat ion and polyethylenglycol-mediated transformation methods
  • particle gun One selected from the group consisting of particle gun bombardment, sii icon carbide whiskers, sonication, electroporat ion and polyethylenglycol-mediated transformation methods
  • particle gun One selected from the group consisting of particle gun bombardment, sii icon carbide whiskers, sonication, electroporat ion and polyethylenglycol-mediated transformation methods
  • electroporat ion and polyethylenglycol-mediated transformation methods
  • N-glycosylation refers to a series of processes that bind glycan, a sugar molecule, to a nitrogen atom of an amino acid of a protein, the glycan of the amino acid residue of the protein. It is distinguished from 0-glycosylation, which binds a sugar molecule to an atom, where N-glycosylation may be that which occurs in the endoplasmic reticulum (eg, inside the endoplasmic reticulum).
  • N-glycosylation domain is a polypeptide comprising an N-glycosylation site (amino acid residue), which is artificially (non-natural ly occurring) chemically or recombinantly synthesized or naturally derived.
  • a recombinant vector comprising a gene encoding a fusion protein fused to a carboxy terminus (C—terminal) of the target protein of the M domain of human CD45 was prepared and tested, but is not limited thereto. May be fused to (N-terminal).
  • Fusion proteins comprising the target protein and the N-glycosylation domain may be a linker (eg, 1-50 aa, 1-30 aa, 1-20 aa, 2-50aa, 2-) between the target protein and the N-glycosylation domain. 30 aa, or 2-20 aa peptide linker).
  • the peptide linker may be a sequence in which glycine-serine is repeated, but is not limited thereto.
  • amino acid sequences and nucleic acid sequences described herein are provided in accordance with the sequences provided.
  • sequence homology can be confirmed by comparing the comparison region with two optimally arranged sequences, and the polynucleotide in the comparison region Some of the sequences may include additions or deletions (ie gaps) relative to the reference sequence (not including additions or deletions) for the optimal alignment of the two sequences.
  • a “recombinant vector or recombinant cell” refers to a protein in which a cell replicates a heterologous nucleic acid (polynucleotide), expresses the nucleic acid, or is encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. It may mean a vector or a cell expressing. Recombinant cells may express genes or gene fragments not found in the natural form of the cell in one of the sense and / or antisense forms. Also, recombinant cells may express genes found in natural cells. Genes are modified and reintroduced into cells by artificial means.
  • the "recombinant vector” is selected from the group consisting of all plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses, and other mediators known in the art into which gene sequences or base sequences can be inserted or introduced. It can be one or more, and in general, any plasmid and vector can be used without particular limitation as long as it can replicate and stabilize in a plant cell or plant host. In one embodiment, the recombinant vector can be used for transformation of a plant or plant cell. According to the present invention, said gene sequence or nucleotide sequence may be operably linked to an expression control factor, and said operably linked gene sequence and expression control factor may be selected markers and replication. One that contains the replication origin It can be included in the expression vector.
  • vectors examples include pBI121, pHellsgatee, pROKII, pBI76, pET21, pSK (+), pLSAGPT, pUC, and pGEM.
  • the vector expressed in plants, including the CMV35s promoter is for example the pCAMBIA series (PCAMBIA1200, 1201, 1281, 1291, 1300, 1301, 1302, 1303, 1304, 1380, 1381, 2200, 2201, 2300, 2301, 3200, 3201, 3300), pMDC32, and pC-TAPapYL436 can be used.
  • the term “operably linked” in the present invention may be linked genes and expression regulators in such a way as to enable gene expression when the appropriate molecule is bound to expression regulators.
  • expression regulator refers to a DNA sequence that controls the expression of a polynucleotide sequence operably linked in a particular host cell.
  • regulatory factors include transcriptional regulators, including promoters for carrying out transcription and any operator sequences, sequences encoding appropriate mRNA ribosomal binding sites, and sequences regulating protein synthesis, termination of transcription and translation. Includes sequences that control termination.
  • the transcriptional regulator is a cauliflower mosaic virus
  • 35S RNA (Caul if lower Mosaic Virus 35S RNA) promoter, Cauli flower Mosaic Virus 19S RNA promoter, full-length transcription promoter derived from Figwort Mosaic Virus, and Tobacco Mosaic Virus ) Coat protein promoter, but is not limited thereto.
  • the translational regulator may be M17 sequence, which serves to increase the amount of the protein of interest in the plant.
  • the M17 sequence may be represented by SEQ ID NO: 3.
  • the recombinant vector of the present invention may further include a nucleic acid encoding a chaperone binding protein (BiP) or a His-Asp-Glu-Leu (HDEL) peptide, which may be operably linked to the transcriptional regulator.
  • a chaperone binding protein BiP
  • a His-Asp-Glu-Leu HDEL
  • BiP is a luminal binding protein, identified as an immunoglobulin heavy chain binding protein and a glucose regulated protein, and is a member of the HSP70 saperon family located in the endoplasmic reticulum. As a kind, it temporarily binds to a newly synthesized protein in the endoplasmic reticulum.
  • the N-terminus of the BiP protein contains a signal sequence that determines targeting to the endoplasmic reticulum, which serves to target the target proteins to the endoplasmic reticulum.
  • the BiP encoding nucleic acid may have a nucleic acid sequence represented by SEQ ID NO: 4.
  • the recombinant vector for plant transformation may include a nucleotide sequence encoding an ER retent ion signal peptide, such as HDEL, in the case of HDEL signal peptide molecule by allowing the target protein to remain in the endoplasmic reticulum The folding and assembly by chaperone is increased, resulting in further minimization of protein degradation.
  • the yield of the target protein has been known to increase by about 10-100 times.
  • Chaperone binding protein operably linked to the transcriptional regulator and HDEL Provides a recombinant vector for plant transformation for increasing the desired protein expression level comprising a nucleic acid encoding a peptide.
  • Recombinant vector as described herein may further include a "number of markers which identify the gene expression.
  • the HA epitope sequence was used to confirm expression in Western blot, but is not limited thereto.
  • target protein refers to a protein or fragment thereof to be produced, and is not limited to a specific protein.
  • the target protein may be an antigen antibody, an antibody fragment, a structural protein, a regulatory protein, a transcription factor, a toxin protein, a hormone, a hormone analog, a cytokine, an enzyme, an enzyme inhibitor, a transport protein, a receptor (eg, a tyrosine kinase receptor, etc.), a receptor. May be at least one selected from the group consisting of fragments, bioprotective inducers, storage proteins, movement proteins, exploit proteins, reporter proteins, and the like.
  • the present invention also provides a plant transformed with the recombinant vector.
  • the transgenic plant comprises an M domain sequence and is designed to be operably linked to and controlled by transcriptional and translational regulators.
  • the transgenic plants described herein may be whole plants, plant cells (eg, cells such as leaves, stems, roots, etc.), or plant tissues (eg, leaves, stems, roots, etc.). Plant tissue may comprise plant seeds.
  • the plant may be a herbaceous or textbook plant, and may be a dicotyledonous or monocotyledonous plant.
  • the dicotyledonous plant may be Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish, cabbage, lettuce, It can be selected from the group consisting of peach, pear, strawberry, watermelon, melon, cucumber, carrot and celery, and the monocotyledonous plant selected from the group consisting of rice, barley, wheat, rye, corn, sugar cane, oats and onions It may be, but is not limited to such.
  • the recombinant vector of the present invention is introduced into a plant by the method of Agrobacterium sp. _ Mediation, part ic le gun bombardment, Si li con carbide whi skers ), Sonication (soni cat ion), electroporation (el ect roporat i on) or PEG (Polyethylenglycol))-mediated transformation security, but is not limited thereto.
  • the transformed plant may be obtained through a sexual propagation method or an asexual propagation method which is a conventional method in the art. More specifically, the plant of the present invention may be obtained through oily breeding, which is a process of producing seeds from the pollination process of flowers and breeding from the seeds. In addition, after transforming a plant with a recombinant vector according to the present invention can be obtained through a method of asexual propagation, which is a process of induction of callus, rooting and soil purification according to a conventional method.
  • the fragments of the plant transformed with the recombinant vector according to the present invention are inoculated in a suitable medium known in the art, and then cultured under appropriate conditions to induce the formation of callus, and when the shoot is formed, transfer to a hormone-free medium to culture. do. After about 2 weeks, the shoots are transferred to rooting medium to induce roots.
  • the plant according to the invention can be obtained by inducing roots and then transplanting them into the soil to purify them. have.
  • Plants transformed in the present invention may include tissues, cells or seeds obtainable therefrom.
  • the step of preparing the recombinant vector for the plant transformation step of introducing the recombinant vector to the plant to prepare a transformed plant, culturing the transformed plant and from the transformed plant or culture medium It provides a method for producing a target protein comprising the step of separating and purifying the target protein.
  • the plant expression vector is introduced into plant cells or plants by Agrobacterium sp. Mediation, particle gun bombardment, Si 1 icon carbide whiskers, ultrasound
  • One or more selected from the group consisting of sonication, electroporat ion, and PEG-mediated transformation method can be used. In one embodiment of the present invention, a PEG-mediated transformation method was used.
  • the recombinant vector for plant transformation according to the present invention improves the expression level of the target protein in plant cells, thereby overcoming the difficulty of obtaining a high-expressing transformant, which was the biggest problem in protein production using conventional plant transformation. It is expected to be of great help in producing useful proteins using plants.
  • FIG. 1 is a schematic diagram showing a connection form including a P35S-M17: Bi p: Lept i n: M: HA: HDEL portion in a recombinant vector for plant transformation according to an embodiment.
  • Figure 2a is a recombinant vector for plant transformation prepared according to one embodiment
  • P35S-M17 B ip: Lep tin: HA: HDEL
  • p35S-M17 Bip: Lept in: M: HA: HDEL
  • P35S-M17 B ip: Lept in: M1234: HA: HDEL
  • Figure 2b shows the amount of protein expression according to the N-glycosylation of the M domain The electrophoresis results (top) and their quantitative results (bottom) confirmed by the blot method are shown.
  • Figure 3 is a schematic diagram (top) of the recombinant vector for testing the difference in protein expression according to the target plant cell organelles, and the result of electrophoresis (interrupted) and quantitative results (bottom) confirmed the protein expression level by Western blot Shows.
  • Figure 4 shows the electrophoresis results (top) and quantitative results (bottom) of the expression pattern over time of the fusion protein fused with the M domain through Western blot.
  • 5 is a result of confirming the expression level of the fusion protein in which the M domain is fused with Exendin4 or GLP-1, respectively, by Western blot.
  • Figure 6a is a schematic diagram of the recombinant vector in order for expression of a fusion protein fused to the "Various target protein domain and M in accordance with one embodiment various orders.
  • Figure 6b is a result of confirming the expression level of the fusion protein M domain fused with l ept in (Lep), aprot ni n (Apr), or GFP (Gfp) in various orders through Western blot. ,
  • FIG. 7 is a graph showing the expression level of a fusion protein in which a mutant M domain and Lept i n are fused with various combinations of N ′ glycosylation sites of the M domain.
  • FIG. 9 is a result of confirming the protein expression level according to whether or not fusion with the M domain of the target protein having an N ⁇ glycosylation position through Western blot.
  • Figure 10 is a result of confirming the protein expression level of the fusion protein fused to a portion or extension of various M domains and the target protein through Western blot.
  • 11 is a graph showing the results of confirming the transcription level according to the fusion of the M domain or various M domain variants by quantitative RT-PCR.
  • Arabidopsis (Arabidopsis thai i ana ecotype, Co 1-0) plants were grown on B5 plates in growth chambers with a 16 hour / 8 hour contrast cycle and a temperature of 20 ° C. to 22 ° C. Leaf tissues of plants grown for 2 weeks was used for protoplast separation.
  • the mature peptide region of mouse leptin 00 ( ⁇ —008493.3) was used.
  • DNA fragments encoding the M domain (SEQ ID NO: 1) were synthesized by repeated PCR performance, and mutations in the N-glycosylation site (Asn-Gln substitution) were PCR-based site-directed mutations. mutagenesis).
  • DNA fragments encoding the aprotinin (SEQ ID NO: 11) were prepared by chemical synthesis (Bioneer, Daejeon, Korea).
  • Entero kinase and furin cleavage sites were included in the primers used for leptin amplification (5′-GGATCCAAGATGATGATGATAAGGTGCCTATCCAGAAAGTCCAGGAT-3 (SEQ ID NO: 18).
  • HA epitopes and ER retention signal HDEL used primers used for amplifying the M domains.
  • PCR conditions were as follows: 94 ° C. 5 minutes, (94 ° C. 30 seconds, 52t 1 minute, 72 ° C. 30 seconds), 30 repetitions, 72 ° C. 7 minutes. Table 1 summarizes:
  • leptin-furin-Spel-R ACTAGTTCGCCTGACACGGCATTCAGGGCTAACATCCA
  • AtACT2-3 'TGGAACAAGACTTCTGGGCAT 48 leptin- F-qRTl-F TCGGTATCCGCCAAGCAGTGCCTATCCAGAAAGTCCA 49 leptin- R-qRTl- GGTGAAGCCCAGGAATGAAGGCATOAGGGCTAACATC 50
  • the plasmid prepared in Reference Example 2 is polyethylene glycol
  • Anti-HA antibody (Roche Diagnostics, Indianapolis, IN), anti-actin antibody (MP Biomedicals, Solon, OH), anti-GFP antibody (Bio-Application, Pohang, Korea) or anti-BiP antibody Western blotting analysis was performed. Protein blots were developed with an ECL kit (Amersham Pharmacia Biotech, Piscataway, NJ) and images were obtained using LAS4000 image an lyzer (Fujifilm, Tokyo, Japan).
  • PCR conditions were as follows: initial denaturation at 95 ° C for 10 min, followed by 40 cycles of 95 ° C for 15 s and 60 ° C for 1 min.
  • a recombinant vector for plant transformation comprising a gene encoding a fusion protein in which the M domain of human CD45 was fused to the target protein was prepared.
  • Leptin hereinafter referred to as "eLepf"
  • eLepf Leptin
  • the recombinant vector is The CaMV 35S promoter was used in the pCAMBIA1300 vector, which is a commonly used vector, and an M17 sequence (SEQ ID NO: 3) was added to increase the amount of protein synthesis, which corresponds to a signal peptide of a Chaperone binding protein (BiP) protein.
  • the genomic DNA sequence (SEQ ID NO: 4) was used to transfer the target protein to the endoplasmic reticulum.
  • HDEL His-Asp-Glu-Leu
  • the HA epitope was used to confirm the expression of the fusion protein through Western blot.
  • a schematic diagram of the recombinant vector prepared in this example is shown in Figure 1 (M: M domain).
  • Nucleic acid sequence of the recombinant vector for expression of a Leptin-M domain fusion protein (SEQ ID NO: 10)
  • Example 1 In the recombinant vector prepared in Example 1 (EeLepfM; FIG. 1), the N-glycosylation site (Asn) of four of the M domains (EeLepf) and M domains (see FIG. A vector (EeLepfM1234) in which ion; Asn was substituted with Gin) was prepared (see Reference Example 1). These three vectors (see FIG. 2A) were transformed into plant cells (see Reference Example 1) isolated from the leaves of Arabidopsis irabidopsis thai i ana via polyethylene glycol (PEG), and the effects of N-glycosylation were examined. To confirm, after the transformation was treated with tunicamycin (tuni camycin) that inhibits N-glycosylation.
  • tunicamycin tunicamycin
  • the target protein (eLepf) without the M domain and the protein fused with the M domain (eLepfM) are respectively endoplasmic reticulum, chloroplast, Recombinant vectors were constructed that were targeted to mitochondria.
  • BiP SEQ ID NO: 4
  • Cab trans it pept ide SEQ ID NO: 12
  • Fl-ATPase gamma subuni t presequence SEQ ID NO: 13
  • the recombinant vector was prepared by fusing at the terminal and fusion with the M domain encoding nucleic acid sequence (SEQ ID NO: 1) at the carboxy terminal of the target protein.
  • SEQ ID NO: 1 M domain encoding nucleic acid sequence
  • Each recombinant vector is transferred to plant cells in the same manner as described above. After introduction, the cells were cultured to express the fusion protein. The amount of protein expression was confirmed by Western blot.
  • the expression rate of the M domain fusion protein was confirmed to understand the mechanism of protein expression increase by N-glycosylation.
  • the recombinant vector EeLepfM fused with the M domain and EeLepfM1234 mutated with the N-glycosylation site of the M domain were transformed into plant cells, respectively, and after 12 hours, cycloheximide or DMSO (dimethyl sulfoxide) to prevent the synthesis of the protein. ), The protein was extracted every 12 hours and confirmed by Western blot.
  • top Western blotting results
  • EeLepfM1234 Although there is little difference in the amount of expression of EeLepfM1234, it can be seen that the difference becomes larger as time goes by. From this, the expression rate of EeLepfM is much faster than that of EeLepfM1234. Can know. However, when treated with cycloheximide to prevent protein synthesis, EeLepfM disappears gradually in plant cells, while EeLepfM1234 lasts up to 48 hours. The stability in the endoplasmic reticulum of the protein produced by ensuring that it remained
  • EeLepfM1234 is higher. This result means that the translation speed of N-glycosylated protein is faster than N-glycosylated protein.
  • Another target protein is a fusion of an M domain coding gene (SEQ ID NO: 1) to an Exendin4 (SEQ ID NO: 51) coding gene or a GLP-1 (SEQ ID NO: 52) coding gene, and a G domain as a translation enhancer domain.
  • the recombinant vector was fused to prepare a recombinant vector (see FIG. 1), and each recombinant vector was transformed into plant cells (Reference Example 1), and the protein expression level was confirmed by Western blot. The results are shown in FIG. 5. As shown in FIG. 6, it was confirmed that the expression level of protein was significantly increased when N-glycosylation occurred because the tunicamycin was not treated with tunicamycin that prevented N1 glycosylation.
  • Example 5 Fusion of Various Proteins and M Domains in Various Sequences leptin (Lep), aprotinin (Apr; SEQ ID NO: 11), or GFP (Gfp; sequence) at the Xxx position of the recombinant vector shown schematically in FIG. 6A.
  • Recombinant vector containing the number 15) was prepared ("(G4S) 2": linker (GGGGSGGGGS)), and transformed into plant cells, the protein expression was confirmed by Western blot. The obtained result is shown in FIG. 6B. As shown in FIG.
  • Example 6 Target protein expression test according to combination of N— glycosylation site of M domain
  • Mutants incorporating Asn-Gln substitution mutations at various combinations of four N—glycosylation sites in the M domain were measured using a recombinant vector comprising a gene encoding one of the N-glycosylation sites, two mutations, three mutations, and all four mutations (FIG. 7). .
  • the recombinant vector was transformed into plant cell protoplasts, the protein was extracted, and the obtained protein extract was analyzed by Western blotting using an anti-HA antibody.
  • the signal intensity of the band obtained as a result of the Western blotting was quantified using the software provided with the LAS4000 image analyzer, and the result is shown in FIG.
  • the target protein expression level with each mutant is shown as a relative value of the expression level (1) of EeLepfM, an ER-targeted wild type protein (wild type M domain and target protein fusion).
  • Example 7 Test of the relationship between low expression level of unglycosylated protein and ER-related degradation
  • the low expression level of unglycosylated protein was tested to determine whether it was associated with ER-associated degradation. In conclusion It was confirmed that the low expression level of unglycosylated protein was not due to ER-associated degradation.
  • EeLepfM vector expression of the fusion protein of Leptin and wild type M domain
  • EeLepfM1234 vector expression of the fusion protein of variant M domain in which all four glycosylation sites with Leptin are mutated (substituted by Gin) are transformed into plant protoplasts, respectively.
  • MG132 IUPAC name: Benzyl N-[(2S) -4-methyl-l-[[(2S) -4-methyl-l-[[(), which is an inhibitor of 26S proteasome-mediated degradation at 18 or 21 hours later.
  • Rbcs [T4,7A]: GFP are transformed with Rbcs [T4,7A]: GFP, then treated with MG132 at 18 hours and incubated for an additional 6 hours.
  • Rbcs [T4,7A]: GFP is a GFP fusion that expresses a mutant form of RbcS delivery peptide that is defective in protein entry into chloroplasts and is ubiquitated and degraded by the 26S proteasome in the cytoplasm.
  • Proteins were extracted from the transformed protoplasts 24 hours after transformation and Western blotting using anti-HA antibodies or anti-GFP antibodies to analyze the protein extracts.
  • FIG. 8 The obtained Western blotting results are shown in FIG. 8.
  • the expression level of RbcS [T4,7A]: GFP was higher at the time of treatment, compared to the no treatment of MG132, which resulted in 26S proteasome with MG132 under the test conditions of this Example. It also shows that it inhibits protein-dependent protein degradation.
  • EeLepfM and EeLepfM1234 protein expression levels were independent of MG132 treatment. There was no difference, indicating that ER-associated degradat ion did not play a role in protein expression of N-glycosylated EeLepfM and unglycosylated EeLepfM1234.
  • the expression level of the target protein is increased even when the target protein itself is N-glycosylated without fusion with the M domain.
  • LIF Leukemia inhibitory factor
  • SEQ ID NO: 17 coding nucleic acid sequence: SEQ ID NO: 16; EeLiff; implicitly has six N-glycosylation sites
  • Recombinant vectors expressing LIF (EeLiff) fused or unfused with M domains were constructed, transformed to plant protoplasts, and proteins were extracted 24 hours later and subjected to western blotting to measure protein expression levels.
  • the obtained protein expression level is shown in FIG. 9. As shown in FIG. 9, it can be seen that the expression level of EeLiffM fused with M domain is much higher than that of EeLiff without M domain fused (RbcL: loading control). These results indicate that the N-glycosylat ion at the N-glycosylation position inherent in the target protein does not affect the expression level of the target protein, whereas the N—glycosylat ion of the M domain, a fusion partner that is fused with the target protein, Play an important role in expression levels.
  • fusion protein (EeLepfM20; fusion of a target protein and a 20 amino acid length fragment (SEQ ID NO: 6) at position 41 ′ 60 of the M domain (SEQ ID NO 2; total 60aa)); N—fusion protein with one glycosylation position (including N4: Asn at position 46), 40 amino acid length fragments at positions 21-60 (SEQ ID NO: 7) (EeLepfM40; N- glycosylation position M domain 3 (N2: Asn 30 in the second position; ⁇ 3 ⁇ 'in the 40th position Asn; and N4: including Asn) in the 46th position), M domain (SEQ ID NO: 2) and For fused fusion proteins (EeLepfM60), and CD45 (SEQ ID NO: 5), a total of 10 amino acids each extending toward the
  • a fusion protein (EeLepfMSO) fused with a fragment of 80 amino acids in length (SEQ ID NO: 8) was introduced into the protoplasts of plant cells and expressed, respectively, and then the protein was extracted and the expression was measured by Western blotting. The expression level of EeLepf without M domain fusion was also measured.
  • Plant cells (Reference Example 1) were each transformed with a recombinant vector containing coding genes of a fusion protein fused with various M domain variants and leptin, each of which was wild-type (unmutated) M domain or N ′ glycosylation site, respectively. After 1 day, whole RA was extracted and quantitative RT—PCR was performed. The specific method is described in Reference Example 4.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

당화 도메인을 이용하여 식물 세포에서 목적 단백질을 고발현시키는 기술과 관련된 것으로, 당화 도메인과 목적 단백질의 융합 단백질 코딩 유전자를 포함하는 재조합 벡터, 재조합 세포, 형질전환 식물, 및 이들을 이용한 목적 단백질 생산 방법이 제공된다.

Description

【명세서】
【발명의 명칭】
식물 세포에서의 목적 단백질 발현을 위한 재조합 백터
【기술분야】
본 발명은 당화 도메인을 이용하여 식물 세포에서 목적 단백질을 고발현시키는 기술과 관련된 것으로, 당화 도메인과 목적 단백질의 융합 단백질 코딩 유전자를 포함하는 재조합 백터, 재조합 세포, 형질전환 식물, 및 이들을 이용한 목적 단백질 생산 방법을 제공한다.
【발명의 배경이 되는 기술】
분자생물학과 유전공학 기술의 눈부신 발달은 식물분야에도 적용되어 식물체로부터 유용 생리활성 물질을 생산하려는 노력들이 꾸준히 이어지고 있다. 식물에서 유용 물질을 생산하는 경우, 생산 단가를 파격적으로 줄일 수 있고 종래의 동물세포나 미생물에서 합성하여 단백질을 분리 정제하는 방법에서 발생할 수 있는 바이러스, 암 유전자, 장 독소와 같은 여러 가지 오염원을 원천 배제할 수 있으며, 상품화 단계에서도 동물세포나 미생물과는 달리 종자로 장기 보관 및 관리가 가능하다는 이점을 갖는다. 또한, 해당 유용 물질의 수요가 급증할 경우 대량생산에 필요한 설비 기술이나 비용 면에서 기존의 동물세포 시스템에 비해 절대적으로 유리하기 때문에 최단 기간에 높아진 수요에 따른 공급이 가능하다는 것도 장점이다. .
하지만 이와 같은 장점에도 불구하고 식물세포에서 단백질을 생산함에 있어서 동물세포를 포함하는 다른 숙주들에 비해 상대적으로 낮은 단백질 발현수준이 가장 큰 단점이 되고 있다. 이에 많은 연구들이 진행되고 있으며 다양한 방법으로 식물세포에서 단백질 발현량을 증가시키려는 시도가 있었다.
이전까지 식물세포에서 목적 단백질의 발현량을 증가시키기 위한 연구들은 대부분 단백질 발현과정 중 mR A로부터 단백질이 만들어지는 번역 ( trans l at ion) 단계 이전인 전사 ( transcr ipt ion) 단계에 집중되어 있었고， mRNA로부터 단백질이 번역될 때 단백질의 발현량을 증가시킬 수 있는 방법에 관한 연구는 많이 이루어지지 않았다.
한편 종래 N-당화 (N-glycosyl at i on)가 단백질의 안정성 ( stabi 1 i ty)에 영향을 미친다는 것은 잘 알려져 있다. 이 경우에는 N-글리칸 (N-glycan)들이 프로테아제 (prot ease)로부터 단백질을 보호해 주기 때문에 안정성을 높인다고 생각되었다. 또한 다른 기작으로 단백질의 3차원 구조에 추가적인 결합력을 제공하여 안정성을 제공해 준다고 알려져 있다.
본 발명자들은 식물세포에서 목적 단백질을 생산함에 있어서 번역 단계에서 목적 단백질의 발현 수준을 높이기 위해 예의 노력한 결과, 당화를 일으키는 작은 도메인을 목적 단백질에 융합하였을 때 단백질의 발현 수준이 높아지는 것을 확인하고 , 이를 이용하여 형질전환 식물체에서 목적 단백질 생산 효율을 획기적으로 높일 수 있다는 점을 입증함으로써 본 발명을 완성하였다.
[발명의 내용】
【해결하고자 하는 과제】
본 발명은 N-당화 (N-glycosyl at i on) 도메인의 목적 단백질 발현에 사용하기 용도와 관련된 것이다.
일 예는 N-당화 도메인을 코딩하는 유전자, 상기 유전자를 포함하는 재조합 백터, 및 상기 재조합 백터를 포함하는 재조합 세포로 이루어진 군에서 선택된 1종 이상을 포함하는 목적 단백질 발현용 조성물을 제공한다.
상기 목적 단백질 발현용 조성물은 목적 단백질 코딩 유전자 또는 상기 유전자를 포함하는 재조합 백터를 추가로 포함할 수 있다. 이 때, 상기 목적 단백질 코딩 유전자와 N-당화 도메인 코딩 유전자는 N-당화 도메인과 목적 단백질을 포함하는 융합 단백질을 코딩하는 유전자 또는 이를 포함하는 재조합 백터의 형태로 포함될 수 있다.
상기 N—당화 도메인은 N—당화 가능한 잔기 (N-glycosyl at i on s i te)를 하나 이상, 또는 2개 이상 포함하는 N—당화 도메인 (예컨대, 다중 N-당화 도메인)일 수 있으며 , 일 구체예에서 , CD45유래 M도메인 , 예컨대 인간 CD45 유래 M 도메인 또는 그 일부를 포함하는 것일 수 있다. 상기 목적 단백질 발현은 진핵 세포 (예컨대， 식물 세포) 또는 진핵 유기체 (예컨대， 식물체) 내에서 수행되는 것일 수 있다.
다른 예는 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터를 제공한다ᅳ
다른 예는 상기 재조합 백터가 도입된 재조합 세포를 제공한다. 상기 세포는 진핵세포, 예컨대, 식물 세포일 수 있다.
상기 융합 단백질 코딩 유전자를 포함하는 재조합 백터 및 /또는 재조합 세포는 목적 단백질의 생산을 증진시키는 용도로 사용될 수 있다. 따라서 , 다른 예는 N—당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터 및 /또는 재조합 세포를 포함하는 목적 단백질 생산용 또는 목적 단백질 생산 증진용 조성물을 제공한다.
다른 예는 상기 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터가 도입된 형질전환 유기체를 제공한다. 상기 형질전환 유기체는 형질전환 진핵 유기체， 예컨대, 형질전환 식물체일 수 있다.
다른 예는 상기 목적 단백질 생산용 조성물 또는 생산 증가용 조성물을 세포에 도입시키는 단계를 포함하는 목적 단백질 생산 방법 또는 목적 단백질 생산 증가 방법을 제공한다. 상기 방법은 목적 단백질 코딩 유전자를 세포에 단독 도입시킨 경우 (즉， N—당화 도메인을 포함하지 않은 재조합 백터를 통하여 도입시킨 경우)와 비교하여， 목적 단백질의 발현량 또는 생산량을 증가시킬 수 있는 것을 특징으로 한다.
【과제의 해결 수단】 .
본 발명은 상술한 문제점을 해결하기 위한 것으로， N-당화
(N-gl ycosyl at i on) 도메인의 식물체 내 목적 단백질 발현에 사용하기 용도, 보다 구체적으로, 목적 단백질을 코딩하는 유전자, 및 상기 유전자의 C-말단 해당 부위 (3 ' 말단) , 또는 N-말단 해당 부위 (5 ' 말단)에 N-당화 (N— glycosyl at i on) 도메인을 코딩하는 유전자를 융합하여 발현시킴으로써, 목적. 단백질의 발현 수준을 증가시키는 기술을 제안한다. . 일 예는 N—당화 도메인을 코딩하는 유전자, 상기 유전자를 포함하는 재조합 백터， 및 상기 재조합 백터를 포함하는 재조합 세포로 이루어진 군에서 선택된 1종 이상을 포함하는 목적 단백질 발현용 조성물을 제공한다. .
상기 목적 단백질 발현용 조성물은 목적 단백질 코딩 유전자 또는 상기 유전자를 포함하는 재조합 백터를 추가로 포함할 수 있다. 이 때, 상기 목적 단백질 코딩 유전자와 N-당화 도메인 코딩 유전자는 N-당화 도메인과 목적 단백질을 포함하는 융합 단백질을 코딩하는 유전자 또는 이를 포함하는 재조합 백터의 형태로 포함될 수 있다.
상기 N-당화 도메인은 N-당화 가능한 잔기를 하나 이상, 또는 2개 이상 포함하는 N-당화 도메인일 수 있으며, 일 구체예에서, CD45 유래 M 도메인 또는 그 일부, 예컨대 인간 CD45 유래 M 도메인 또는 그 일부를 포함할 수 있다. 상기 목적 단백질 발현은 진핵 세포, (예컨대, 식물 세포) 또는 진핵 유기체, (예컨대, 식물체) 내에서 수행되는 것일 수 있다.
다른 예는 N—당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터를 제공한다. 상기 재조합 백터는 진핵 세포， 예컨대， 식물 세포에서 발현을 위한 것일 수 있다.
다른 예는 상기 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 세포를 제공한다. 상기 재조합 세포는 세포에 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터가 도입된 것일 수 있다. 상기 세포는 진핵 세포, 예컨대, 식물 세포일 수 있다.
다른 예는 상기 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질와 코딩 유전자를 포함하는 형질전환 유기체를 제공한다. 상기 형질 전환 유기체는 유기체에 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터가 도입된 것일 수 있다. 상기 상기 형질전환 유기체는 형질전환 진핵 유기체， 예컨대, 형질전환 식물체일 수 있다. 상기 형질전환 유기체는 앞서 설명한 재조합 세포를 포함하는 진핵 유기체 (예컨대， 식물처 1 )일 수 있다.
상기 융합 단백질 코딩 유전자를 포함하는 재조합 벡터 및 /또는 재조합 세포 및 /또는 형질전환 유기체는 목적 단백질의 생산용 또는 목적 단백질의 생산을 증진시키는 용도로 사용될 수 있다.
따라서， 다른 예는 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자, 상기 유전자를 포함하는 재조합 백터， 상기 재조합 백터를 포함하는 재조합 세포, 및 상기 재조합 백터를 포함하는 형질전환 유기체로 이루어진 군에서 선택된 1종 이상올 포함하는 목적 단백질 생산용 또는 목적 단백질 생산 증진용 조성물을 제공한다.
다른 예는 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 세포를 배양하는 단계를 포함하는 목적 단백질 생산 방법 또는 목적 단백질 생산 증가 방법을 제공한다. 상기 재조합 세포는 세포에 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터가 도입된 것일 수 있다. 상기 세포는 진핵 세포, 예컨대, 식물세포일 수 있다. 상기 방법은, 상기 배양하는 단계 이전에 , N—당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터를 세포에 도입시키는 단계를 추가로 포함할 수 있다. 상기 방법은, 상기 상기 배양하는 단계 이후에， 상기 배양된 세포 (세포, 세포 파쇄물， 또는 세포 용해물) 및 /또는 배양 배지로부터 목적 단백질을 분리 (또는 추출) 및 /또는 정제하는 단계를 추가로 포함할 수 있다.
다른 예는 N-당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 형질전환 유기체를 성장시키는 .단계를 포함하는 목적 단백질 생산 방법 또는 목적 단백질 생산 증가 방법을 제공한다. 상기 유기체는 진핵 유기체, 예컨대, 식물일 수 있다. 상기 방법은 상기 성장시키는 단계 이전에 , N—당화 도메인 및 목적 단백질을 포함하는 융합 단백질의 코딩 유전자를 포함하는 재조합 백터를 유기체에 도입시키는 단계를 추가로 포함할 수 있다. 상기 방법은， 상기 상기 성장시키는 단계 이후에, 상기 진핵 유기체 (예컨대, 식물)， 또는 상기 진핵 유기체의 세포 (세포， 세포 파쇄물， 세포 용해물, 또는 상기 세포의 배양물)로부터 목적 단백질을 분리 (또는 추출) 및 /또는 정제하는 단계를 추가로 포함할 수 있다.
상기 방법은， 목적 단백질 코딩 유전자를 세포 또는 유기체에 단독 도입시킨 경우 (즉, N-당화 도메인을 포함하지 않은 재조합 백터를 통하여 도입시킨 경우) , 목적 단백질을 0-당화 도메인와 융합시켜 사용하는 경우, 및 /또는 별개의 N-당화 도메인이 융합되지 않고 목적 단백질이 내재적으로 N-당화 잔기를 포함하는 경우와 비교하여, 목적 단백질의 발현량 또는 생산량올 증가시킬 수 있는 것을 특징으로 한다 .
일 실시예에 있어서， 상기 N—당화 도메인은 N-당화 잔기 (N-당화가 일어나는 아미노산; 아스파라긴 (Asn) )를 1개 이상 또는 2개 이상, 예컨대, 1개, 2개, 3개, 4개， 5개, 6개, 7개, 8개， 9개, 또는 10개 포함하고, 총 아미노산 개수가 10 내지 100개 또는 20개 내지 80개인 폴리펩타이드일 수 있다. 일 구체예에서， 상기 N-당화 도메인은 사람 CD45 내의 적어도 사람 CD45 유래 M 도메인 (M doma in ; 4개의 N-당화 잔기를 포함) 또는 그 일부를 포함하는 연속하는 10내지 100개 또는 20개 내지 80개 아미노산을 포함하는 폴리펩타이드일 수 있다. 예컨대, 상기 사람 CD45 단백질은 서열번호 5(UniProt no . P08575)의 아미노산 서열로 표현되는 것일 수 있다,상기 사람 CD45 유래 M 도메인은 사람 CD45 단백질 (서열번호 5)의 231 번째 잔기인 Al a부터 290번째 잔기인 Asp까지의 총 60개의 아미노산으로 이루어진 폴리 ¾타이드 (60aa ; ANITVDYLYN ET LFTA L VNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD ; 서열번호 2 ; 밑줄 및 굵은 글씨체는 Nᅳ당화 잔기를 나타냄)일 수 있다. 일 구체예에서, 상기 사람 CD45 유래 M 도메인을 암호화하는 유전자는 서열번호 1의 핵산 서열을 포함하는 것일 수 있다. 상기 사람 CD45 유래 M도메인의 일부는 상기 CD45 유래 M도메인 중 N—당화 잔기 (예컨대， 서열번호 2 중 2번째 위치의 N(Asn) , 30번째 위치의 N(Asn) , 40번째 위치의 N(Asn) , 및 46번째 위치의 N(Asn) 중에서 선택됨)를 1개 이상 또는 2개 이상 예컨대, 1개， 2개, 3개, 또는 4개 포함하는 연속하는 10개 이상, 15개 이상 또는 20개 이상의 아미노산을. 포함하는 폴리펩타이드 단편일 수 있다. 상기 폴리펩타이드 단편은， 서열번호 2의 아미노산 서열에 있어서， 적어도 40번째 위치의 N 및 46번째 위치의 N 중에서 선택된 하나 이상의 아미노산 잔기를 포함하는 연속하는 연속하는 10개 이상, 15개 이상 또는 20개 이상의 아미노산을 포함하는 폴리펩타이드일 수 있으며， 예컨대 "LTECKNASVS ISHNSCTAPD (서열번호 6) " 또는 "NVNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD (서열번호 7) " ) 일 수 있으나, 이에 제한되는 것은 아니다. 일 예에서, 상기 N-당화 도메인은, '사람 CD45 단백질 (서열번호 5) 중의 , Μ도메인 (서열번호 2 )또는 상기 Μ도메인 (서열번호 2)중의 연속하는 10개 이상, 15개 이상 또는 20개의 아미노산을 포함하는 Μ 도메인 일부를 포함하는 연속하는 10 내지 100개 또는 20개 내지 80개 아미노산을 포함하는 폴리펩타이드 (예컨대, 서열번호 6 , 7 , 또는 8)일 수 있다. 일 실시예에 있어서, 상기 M 도메인을 코딩하는 유전자는 서열번호 1로 표시되는 핵산 서열을 갖는 것일 수 있다.
일 실시예에 있어서，상기 재조합 백터는 전사조절인자, 번역조절인자 유전자 발현을 확인할 수 있는 마커 등으로 이루어진 군에서 선택된 1종 이상을 추가로 포함할 수 있다.
일 실시예에 있어서, 상기 전사조절인자는, 세포, 예컨대, 식물 세포에서의 전사조절을 위하여 통상적으로 사용되는 모든 전사인자들 중에서 선택된 1종 이상일 수 있으며, 예를 들어, 컬리플라워 모자이크 바이러스 35S RNA(Caul i f lower Mosai c Vi rus 35S RNA) 프로모터， 컬리플라워 모자이크 바이러스 19S RNA(Caul i f lower Mosai c Vi rus 19S RNA) 프로모터 피크워트 모자이크 바이러스 (Figwort Mosai c Vi rus)유래 전장 전사 프로모터 및 담배 모자이크 바이러스 (Tobacco Mosai c Vi rus) 코트 단백질 프로모터로 이루어진 군으로부터 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.
상기 번역조절인자는 세포， 예컨대, 식물 세포에서 번역조절을 위하여 통상적으로 사용되는 모든 번역조절인자들 중에서 선택된 1종 이상일 수 있으며 , 예를 들어, M17인자일 수 있으나, 이에 제한되는 것은 아니다. 상기 M17 인자는 서열번호 3의 핵산 서열로 표시되는 것일 수 있다.
또 다른 실시예에 있어서, 상기 재조합 백터는 특정 세포내 소기관으로의 타겟팅 (이동 및 /또는 체류 (retent ion) )을 위하여 신호 서열을 추가로 포함할 수 있다. 일 예에서， 상기 재조합 백터는 소포체 (ER)에 타겟팅되도톡 설계된 것일 수 있으며, 이를 위하여 소포체 (예컨대, 세포체 막 표면) 이동 신호 (예컨대, BiP(chaperone binding protein) 코딩 유전자 등) 및 /또는 소포체 체류 신호 (예컨대, HDEL(Hi s-Asp-Glu-Leu) 펩타이드 코딩 유전자)를 를 추가로 포함할 수 있다. 상기 세포내 소기관 (예컨대, 소포체) 타겟팅 신호 서열은 융합 단백질의 N—말단 (융합 단백질 코딩 유전자의 5 ' 말단) 또는 C—말단 (융합 단백질 코딩 유전자의 3 ' 말단)， 예컨대， N-말단 (융합 단백질 코딩 유전자의 5 ' 말단)에 연결된 것일 수 있다. 이와 같이, 재조합 백터가 세포내 소기관 증 소포체 (예컨대, 소포체 내부)에 타겟팅됨으로써, 단백질 발현 수준을 보다 증가시킬 수 있다 (도 3 참조) . 일 예에서, 상기 융합 단백질의 N—당화는 소포체 내부에서 일어날 수 있다.
상기 BiP(chaperone binding protein)은 서열번호 4의 핵산 서열로 표시되는 것일 수 있다.
일 구체예에서， 목적 단백질 코딩 유전자, 사람 CD45유래 M도메인 (M domain) 코딩 유전자, 전사조절인자, 상기 전사조절인자와 작동 가능하게 연결된 M17 인자, 및 BiP(chaperone binding protein) 및 /또는 HDEL(Hi s-Asp-Glu-Leu) 펩타이드를 코딩하는 유전자를 포함하는 목적 단백질 발현 수준을 증가시키기 위한 식물 형질전환용 재조합 백터를 제공한다. 일 실시예에 있어서, 상기 재조합 백터는 유전자 발현을 확인할 수 있는 마커를 추가로 포함할 수 있다. 본 발명의 일실시예에서는 웨스턴 블럿에서 발현 여부를 확인하기 위해 HA 에피토프 서열을 사용하였으나, 이에 제한되는 것은 아니다.
본 명세서에 기재된 진핵 세포는 진균, 동물 세포 및 식물 세포로 이루어진 군에서 선택된 1종 이상일 수 있으며, 예컨대, 식물 세포일 수 있다. 진핵 유기체는 모든 진핵 단세포 생물 및 진핵 다세포 생물 (식물 또는 동물)로 이루어진 군에서 선택된 1종 이상일 수 있으며， 예컨대， 식물일 수 있다. 본 명세서에 기재된 식물은 모든 조류, 단자엽 식물 및 쌍자엽 식물중에서 선택된 1종 이상의 식물, 또는 이들의 세포일 수 있으며, 예컨대, 는 애기장대, 대두, 담배，가지,고추， 감자,토마토, 배추,무， 양배추, 상추,복숭아, 배, 딸기,수박, 참외,오이,당근 및 샐러리로 이루어진 군에서 선택되는 쌍자엽 식물; 또는 벼， 보리, 밀 호밀, 옥수수 사탕수수, 귀리 및 양파로 이루어진 군에서 선택되는 단자엽 식물， 또는 이들의 세포일 수 있으나, 이에 제한되는 것은 아니다.
상기 재조합 백터를 진핵 유기체 (예컨대, 식물체) 또는 진핵 세포 (예컨대, 식물 세포)에 도입시키는 단계는
통상적인 형질도입 방법에 의하여 수행 가능하며, 예컨대, 아그로박테리움 (Agrobacter ium sp . )-매개에 의한 방법, 입자총 충격법 (particle gun bombardment), 실리콘 탄화물 위스커법 (sii icon carbide whiskers) , 초음파 처리법 (sonication)， 전기천공법 (electroporat ion) 및 PEG(polyethylenglycol)-매개성 형질전환 방법으로 이루어진 군에서 선택되는 하나 이상을 사용할 수 있으나 이에 제한되는 것은 아니다.
상술한 바와 같이
본 명세서에서 사용된 바로서, "N-당화 (N— Glycosylation)은 단백질의 아미노산의 질소 원자에 당분자 을리고사카라이드인 글리칸을 결합시키는 일련의 과정을 의미하는 것으로, 단백질의 아미노산 잔기의 산소원자에 당분자를 결합시키는 0-당화 (0-glycosylation)과 구별된다. 본 명세서에서, N-당화는 소포체 (예컨대， 소포체 내부)에서 일어나는 것일 수 있다.
상기 "N-당화 도메인 "은 N—당화되는 위치 (N-Glycosylation site; 아미노산 잔기)를 포함하는 폴리펩타이드로서， 인위적으로 (non-natural ly occurring) 화학적 또는 재조합적으로 합성되거나， 천연 유래의 것일 수 있다
일 실시예에서는 사람 CD45의 M 도메인올 목적 단백질의 카르복시 말단 (C— terminal)에 융합시킨 융합 단백질을 암호화하는 유전자를 포함하는 재조합 백터를 제조하여 실험하였으나, 이에 한정되지 않고, 목적 단백질의 아미노 말단 (N-terminal)에 융합될 수도 있다.
상기 목적 단백질과 N-당화 도메인을 포함하는 융합 단백질은 상기 목적 단백질과 N-당화 도메인 사이에 적절한 링커 (예컨대, 1-50 aa, 1-30 aa, 1-20 aa, 2-50aa, 2-30 aa, 또는 2-20 aa의 펩타이드 링커)를 포함할 수 있다. 상기 펩타이드 링커는 글리신 -세린 (glycine-serine)이 반복되는 서열일 수 있으나， 이에 제한되는 것은 아니다.
본 명세서에 기재된 아미노산 서열 및 핵산 서열은 제공된 서열과
70%이상, 75%이상, 80%이상, 85%이상， 90%이상， 91%이상， 92%이상, 93% 이상, 94% 이상, 95% 이상， 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성을 갖는 서열까지 확장되어 해석될 수 있다.
상기 "서열 상동성의 는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인할 수 있으며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열 (추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제 (즉, 갭)를 포함할수 있다.
본 명세서에서 사용되는 바로서， "재조합 백터 또는 재조합 세포"은 세포가 이종의 핵산 (폴리뉴클레오타이드)을 복제하거나, 상기 핵산을 발현하거나, 또는 펩타이드, 이종의 펩타이드 또는 이종의 핵산에 의해 암호화된 단백질을 발현하는 백터 또는 세포를 의미하는 것일 수 있다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을 센스 및 /또는 안티센스 형태 중 하나로 발현할 수 있다ᅳ 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
상기 "재조합 백터' '는 유전자 서열 또는 염기 서열이 삽입 또는 도입될 수 있는 당분야에 공지된 모든 플라스미드, 파아지， 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 및 기타 매개체들로 이루어진 군에서 선택된 1종 이상일 수 있으며, 대체로， 임의의 플라스미드 및 백터는 식물세포 또는 식물체 숙주 내에서 복제 및 안정화할 수 있다면 특별한 제한 없이 사용될 수 있다ᅳ 일 예에서， 상기 재조합 백터는 식물체 또는 식물 세포의 형질전환에 사용하기 위한 것일 수 있다. 본 발명에 따른 ᅵ 상기 유전자 서열 또는 염기 서열은 발현 조절 인자에 작동 가능하게 연결될 수 있으며， 상기 작동 가능하게 연결된 (operably linked) 유전자 서열과 발현 조절 인자는 선택 마커 및 복제 개시점 (replication origin)을 같이 포함하고 있는 하나의 발현 백터 내에 포함될 수 있다.
공지된 백터의 예는 pBI121, pHellsgatee, pROKII, pBI76, pET21, pSK(+), pLSAGPT, pUC, 및 pGEM을 포함한다. 또한， CMV35s 프로모터를 포함하는, 식물체에서 발현되는 백터는 예를 들어 pCAMBIA 시리즈 (PCAMBIA1200, 1201, 1281, 1291， 1300, 1301, 1302, 1303， 1304, 1380, 1381, 2200, 2201, 2300, 2301, 3200, 3201, 3300)， pMDC32, 및 pC-TAPapYL436와 같은 것이 사용될 수 있다. 그러나 이에 제한되지 않는다. 본 발명의 용어 "작동 가능하게 연결"된다는 것은 적절한 분자가 발현 조절 인자에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 발현 조절 인자일 수 있다.
본 발명의 상기 용어 "발현 조절 인자"는 특정한 숙주 세포에서 작동 가능하게 연결된 폴리뉴클레오티드 서열의 발현을 조절하는 DNA 서열을 의미한다. 그러한 조절 인자는 전사를 실시하기 위한 프로모터 및 임의의 오퍼레이터 서열을 포함하는 전사조절인자, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 단백질 합성을 조절하는 서열을 포함하는 번역조절인자， 전사 및 번역의 종결을 종결을 조절하는 서열을 포함한다.
본 발명에서， 상기 전사조절인자는 컬리플라워 모자이크 바이러스
35S RNA(Caul if lower Mosaic Virus 35S RNA) 프로모터, 컬리플라워 모자이크 바이러스 19S RNA(Cauli flower Mosaic Virus 19S RNA) 프로모터， 피크워트 모자이크 바이러스 (Figwort Mosaic Virus) 유래 전장 전사프로모터 및 담배 모자이크 바이러스 (Tobacco Mosaic Virus) 코트 단백질 프로모터로 이루어진 군으로부터 선택된 것일 수 있으나, 이에 한정되지 않는다.
본 발명에서 상기 번역조절인자는 M17서열일 수 있으며 , 이는 식물체 내에서 목적 단백질의 합성량을 증가시키는 역할을 한다. 본 발명에서 바람직하게 상기 M17 서열은 서열번호 3으로 표시되는 것일 수 있다.
본 발명의 재조합 백터는 BiP(chaperone binding protein) 또는 HDEL(His-Asp-Glu-Leu) 펩타이드를 코딩하는 핵산을 더 포함할 수 있으며, 이는 상기 전사조절인자와 작동 가능하게 연결될 수 있다.
상기 BiP는 루미날 결합 단백질 (luminal binding protein)로서， 면역글로불린 중사슬 결합 단백질 (immunoglobulin heavy chain binding protein)과 글루코스 조절 단백질 (glucose regulated protein)로 동정되었으며, 소포체에 위치해 있는 HSP70 사페론 패밀리의 한 종류로서 소포체에서 새로이 합성된 단백질에 일시적으로 결합한다. 또한 BiP 단백질의 N—말단에는 소포체로의 타겟팅을 결정하는 신호 서열을 함유하고 있어 목적 단백질들을 소포체로 타켓팅 시키는 역할을 한다. 예컨대， 상기 BiP 코딩 핵산은 서열번호 4로 표시되는 핵산 서열을 갖는 것일 수 있다. 또한, 상기 식물형질전환용 재조합 백터는 HDEL과 같은 소포체 저장 신호 펩타이드 (ER retent ion signal pept ide)를 코딩하는 염기서열을 포함할 수 있으며 , HDEL신호 펩타이드의 경우 목적 단백질을 소포체 내에 머물도록 함으로써 분자 샤페론에 의한 폴딩 ( folding)과 조합 (assembly)이 증가되어 결과적으로 단백질의 분해를 더욱 최소화하기 위함이다. 이러한 예로서， 목적 단백질을 분비 경로로 보냈을 때 보다 소포체에 유지 (retent ion)시킨 경우, 목적 단백질의 수율이 10-100배 정도 증가된다고 알려진 바 있다. 또한， 일 구체예는, 목적 단백질， 사람 CD45유래 M도메인 (M domain) 또는 이의 일부를 코딩하는 유전자, 전사조절인자, 상기 전사조절인자와 작동 가능하게 연결된 M17 , BiP.Cchaperone binding protein) 및 HDEL(Hi s-Asp-Gl u-Leu) 펩타이드를 코딩하는 핵산을 포함하는 목적 단백질 발현 수준을 증가시키기 위한 식물 형질전환용 재조합 백터를 제공한다. 본 명세서에 기재된 재조합 백터는 유전자 발현을 확인할 '수 있는 마커를 추가로 포함할 수 있다. 일 구체예에서는 웨스턴 블럿에서 발현 여부를 확인하기 위해 HA 에피토프 서열을 사용하였으나, 이에 한정되지 않는다.
용어 "목적 단백질 "은 생산하고자 하는 단백질 또는 그 단편을 의미하는 것으로서, 특정 단백질로 한정되지는 않는다. 구체적으로 목적 단백질은 항원 항체, 항체 단편, 구조 단백질, 조절단백질, 전사인자, 독소 단백질, 호르몬, 호르몬 유사체, 사이토카인, 효소， 효소 저해제， 수송단백질, 리셉터 (예컨대, 티로신 키나아제 수용체 등)， 리셉터의 단편, 생체방어 유도물질, 저장단백질, 이동단백질 (movement protein) , 익스플로이티브 프로틴 (exploi t ive protein) , 리포터단백질 등으로 구성되는 군으로부터 선택되는 어느 하나 이상일 수 있다.
일 실시예에서는 상기 목적 단백질로 렙틴 ( lept in) , GLP-1 , Exendin-4 , aprot inin , GFP (green f luorescent protein) 등을 예入 1적으로 사용하였으나, 이는 본 명세서에서 제공되는 단백질 생산 증가 효과를 예시적으로 보여주기 위한 것일 뿐이며， 목적 단백질이 상기 단백질들에 제한되는 것은 아니다. 본 발명은 또한, 상기 재조합 백터로 형질전환된 식물올 제공한다. 상기 형질전환 식물은 M 도메인 서열을 포함하고 이는 전사 및 번역조절인자와 작동 가능하게 연결되고 이의 의해 제어되도록 고안되어 있다. 본 발명에서 설명된 형질전환 식물은 식물 전체， 식물 세포 (예컨대, 잎， 줄기, 뿌리 등의 세포) , 또는 식물 조직 (예컨대, 잎, 줄기, 뿌리 등)일 수 있다. 식물 조직은 식물 종자를 포함할 수 있다. 상기 식물은 초본 또는 교본 식물일 수 있고, 쌍자엽 식물 또는 단자엽 식물일 수 있으며， 구체적으로 상기 쌍자엽 식물로는 애기장대, 대두, 담배, 가지， 고추, 감자, 토마토， 배추, 무， 양배추, 상추， 복숭아, 배， 딸기， 수박, 참외, 오이， 당근 및 샐러리로 이루어진 군에서 선택될 수 있고, 상기 단자엽 식물로는 벼， 보리， 밀, 호밀, 옥수수, 사탕수수， 귀리 및 양파로 이루어진 군에서 선택될 수 있으나 이에 한정되지 않는다.
본 발명의 재조합 백터를 식물체에 도입하는 방법은 아그로박테리움 (Agrobacter ium sp . )_매개에 의한 방법， 입자 총 충격법 (part i c le gun bombardment ) , 실리콘 탄화물 위스커법 (Si l i con carbide whi skers) , 초음파 처리법 (soni cat ion) , 전기천공법 (el ect roporat i on) 또는 PEG(Polyethylenglycol ) )-매개성 형질전환 방범 중에서 선택할 수 있으나, 이에 제한되지 않는다.
상기 형질전환된 식물은 당업계의 통상적인 방법인 유성번식 방법 또는 무성번식 방법을 통해 수득할 수 있다. 보다 구체적으로 본 발명의 식물은 꽃의 수분과정을 통하여 종자를 생산하고 상기 종자로부터 번식하는 과정인 유성번식을 통해 수득할 수 있다. 또한, 본 발명에 따른 재조합 백터로 식물체를 형질전환한 다음 통상적인 방법에 따라 캘러스의 유도， 발근 및 토양 순화의 과정인 무성번식 방법을 통해 수득할 수 있다. 즉， 본 발명에 따른 재조합 백터로 형질전환된 식물의 절편체를 당업계에 공지된 적합한 배지에 치상한 다음 적정 조건으로 배양하여 캘러스의 형성을 유도하고, 신초가 형성되면 호르몬 무첨가 배지로 옮겨 배양한다. 약 2주 후 상기 신초를 발근용 배지에 옮겨서 뿌리를 유도한다. 뿌리가 유도된 다음 이를 토양에 이식하여 순화시킴으로써 본 발명에 따른 식물을 수득할 수 있다. 본 발명에서 형질전환된 식물체는 그로부터 수득될 수 있는 조직, 세포 또는 종자를 포함할 수 있다.
또한 본 발명은, 상기 식물 형질전환용 재조합 백터를 제조하는 단계 상기 재조합 백터를 식물체에 도입하여 형질전환 식물체를 제조하는 단계, 상기 형질전환된 식물체를 배양하는 단계 및 상기 형질전환된 식물체 또는 배양액으로부터 목적 단백질을 분리 정제하는 단계를 포함하는 목적 단백질의 제조방법을 제공한다.
상기 식물 발현 백터의 식물세포 또는 식물체로의 도입은 아그로박테리움 (Agrobacterium sp.)_매개에 의한 방법, 입자 총 층격법 (particle gun bombardment), 실리콘 탄화물 위스커법 (si 1 icon carbide whiskers) , 초음파 처리법 (sonication) , 전기천공법 (electroporat ion) 및 PEG(polyethylenglycol)-매개성 형질전환 방법으로 이루어진 군에서 하나 이상을 선택하여 사용할 수 있다. 본 발명 의 일실시예에서는 PEG-매개성 형질전환 방법을 사용하였다.
【발명의 효과】
본 발명에 따른 식물 형질전환용 재조합 백터는 식물 세포 내에서 목적 단백질의 발현 수준을 향상시킴으로써 기존의 식물 형질전환을 이용한 단백질 생산에서 가장 큰 문제였던 고발현 형질전환체 획득의 어려움을 극복하였으며, 이를 통해 식물을 이용한 유용 단백질 생산에 큰 도움이 될 것으로 기대된다.
【도면의 간단한 설명】
도 1은 일 실시예에 따라 제작한 식물 형질전환용 재조합 백터에서 P35S-M17： Bi p： Lept i n： M： HA： HDEL 부분을 포함하는 연결형태를 나타낸 모식도이다.
도 2a는 일 실시예에 따라 제작한 식물 형질전환용 재조합 백터에서
P35S-M17： B i p： Lep t i n： HA： HDEL , p35S-M17:Bip:Lept in:M:HA:HDEL, 및 P35S-M17： B i p： Lept i n： M1234： HA： HDEL 부분을 포함하는 연결형태를 나타낸 모식도이다 (M1234: M 도메인의 N-glycosylation site Nl, N2, N3, 및 N4가 변형 (Asn→Gln)된 M 도메인 변이체).
도 2b는 M 도메인의 N-당화 여부 에 따른 단백질 발현량을 웨스턴 블럿 방법으로 확인한 전기영동 결과 (상단) 및 이의 정량 결과 (하단)를 보여준다.
도 3은 타겟팅되는 식물 세포 소기관에 따른 단백질 발현량 차이를 시험하기 위한 재조합 백터의 모식도 (상단) , 및 단백질 발현 수준을 웨스턴블럿으로 확인한 전기영동 결과 (중단) 및 이를 정량한 결과 (하단)을 보여준다.
도 4는 M 도메인과 융합된 융합 단백질의 시간에 따른 발현 양상을 웨스턴블럿을 통해 확인한 전기영동 결과 (상단) 및 이의 정량 결과 (하단)을 보여준다.
도 5은 M도메인이 Exendin4또는 GLP-1와 각각 융합된 융합 단백질의 발현 수준을 웨스턴블럿을 통해 확인한 결과이다.
도 6a는 '일 실시예에 따른 M 도메인과 다양한 목적 단백질이 다양한 순서로 융합된 융합 단백질의 발현을 위하 재조합 백터의 모식도이다.
도 6b는 M도메인이 l ept in (Lep) , aprot i ni n (Apr ) , 또는 GFP (Gfp)와 다양한 순서로 융합된 융합 단백질의 발현 수준을 웨스턴블럿을 통해 확인한 결과이다. ,
도 7은 M 도메인의 Nᅳ당화 위치가 다양한 조합으로 변이된 변이 M 도메인과 Lept i n이 융합된 융합 단백질의 발현 수준을 보여주는 그래프이다.
도 8은 ERᅳ assoc i at ed degradat i on억제 여부에 따른 야생형 M도메인 또는 변이형 M 도메인이 융합된 융합 단백질의 발현 수준을 웨스턴블럿을 통해 확인한 결과이다.
도 9는 내재적으로 Nᅳ당화 위치를 갖는 목적 단백질의 M 도메인과 융합 여부에 따른 .단백질 발현 수준을 웨스턴블럿을 통해 확인한 결과이다. 도 10은 다양한 M 도메인 일부 또는 연장부와 목적 단백질이 융합된 융합 단백질의 단백질 발현 수준을 웨스턴블럿을 통해 확인한 결과이다. 도 11은 M 도메인 또는 다양한 M 도메인 변이체의 융합에 따른 전사 수준을 정량적 RT-PCR로 확인한 결과를 보여주는 그래프이다.
【발명을 실시하기 위한 구체적인 내용】
이하， 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서， 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
참고예 1: 식물 재료 준비
Arabidopsis (Arabidopsis thai i ana ecotype, Co 1-0)식물을 16시간 /8 시간 명암 주기 및 20°C 내지 22°C 온도 조건의 성장 챔버의 B5 플레이트 상에서 성장시켰다ᅳ 2주 성장시킨 식물의 잎 조직을 원형질체 분리에 사용했다..
참고예 2: 플라스미드 구축
마우스 leptin 00 (匪—008493.3)의 mature peptide region을 사용하였다. M 도메인을 코딩하는 DNA 단편 (서열번호 1)을 반복적인 PCR 수행에 의하여 합성하였으며, N-당화 부위의 돌연변이 (Asn-Gln 치환)은 PCR-기반 부위-특이적 돌연변이 (PCR-based site-directed mutagenesis)에 의해 생성하였다. 화학 합성에 의해 aprotinin을 암호화하는 DNA 단편 (서열번호 11)을 제작하였다 (Bioneer, 대전， 한국). 엔테로 키나아제 및 푸린 (funn) 절단 부위를 렙틴 증폭에 사용된 프라이머에 포함시켰다 ( 5 ' -GGATCCAAGATGATGATGATAAGGTGCCTATCCAGAAAGTCCAGGAT-3 (서열번호 18 ) . HA 에피토프 및 ER retention signal HDEL은 상기 M 도메인 증폭에 사용된 프라이머를 사용하여 도입시켰다. PCR조건은 다음과 같다: 94°C 5분， (94°C 30초, 52t 1분, 72°C 30초) 30회 반복, 72°C 7분. 사용된 프라이머 서열을 하기의 표 1에 정리하였다:
【표 1】
Primer Name Sequence (5' to 3' ) 서열번호
BamHI-Ek-lept in-F GGATCCAAGATGATGATGATAAGGTGCCTATCCAGAAA
18
GTCCAGGAT
leptin-furin-Spel-R ACTAGTTCGCCTGACACGGCATTCAGGGCTAACATCCA
19
ACTG
hspt-R GMTTCCTTATCTTTAATCATATT 20
M-3-HAᅳ HDEL-F TCATAATTCATGTACTGCTCCTGATTACCCATACGATG
21
TTCCAGA CGCTTCCCACGATGAGCTCTAGCTCGAG ATATGAAGATGAAGATGAAATAH
M-2-F AATGTGGAAACAATAOTGCACAMCAATGAGGTGCAT
AACCmCAGAATGTAAAAATGCGTCTGITTCCATATC 22 TCATAATTCATGTACTGCTCCTGA
Spel-M-l-F ACTAGTGCAAACATCACTGTGGATTACTTATATAACAA
GGAAACTAAATTATTTACAGCAAAGCTAAATGnAATG 23 , AGAATGTGGAATGTGGAAACAATAOTGCACAA
Spel-HA-F ACTAGTTACCCATACGATG TCCAGATTAC 24
Xbal-Cab-F TCTAGAATGGCGTCGAACTCGCTTATGAGC 25
Cab-BamHI-R GGATCCTCTCTGACTCTTTGTA 26
Xbal-Fl-F TCTAGAATGGCAATGGCTGTTTTCCGTCGC 27
Fl-BamHI-R GGATCCTCTGAACTGCTCTAAGOTGGAAG 28
Spel-M-F ACTAGTGCAAACATCACTGTGGAT 29
Spel-M— N2Q-F ACTAGTGCACAAATCACTGTGGAT 30
M-N30Q-F GTGGAATGTGGACAAAATACTTGCACA 31
M-N30Q-R TGTGCMGTATTTTGTCCACATTCCAC 32
M-N40Q-F AATGAGGTGCATCAACTTACAGAATGT 33
M-N40Q-R ACATTCTGTAAGTTGATGCACCTCATT 34
M-N46Q-F ACAGAATGTAAACAAGCGTCTGITTCC , . 35
M-N46Q-R GGAMCAGACGCTTGri ACATTCTGT 36
M-N40.46Q-F AACAATGAGGTGCATCAACTTACAGAATGTAAACAAGC
37 GTCTGTTTCCATA
M-N40 , 46Q-R TATGGA CAGACGCTTGmACATTCTGTAAGTTGAT
38 GCACCTCATTGTT
BamHI-M-F GGATCCCGATGGCAAACATCACTGTGGATTAOTA 39
M-GS2-SpeI-R ACTAGTTGATCCACCACCAGACCCACCTCCACCATCAG
40 GAGCAGTACATGAATTAT
BamHI-Ek-Apro GGATCCCGGATGACGACGATAAGCGACCGGAC 41
BamHI-ek-Apr-F GGATCCAAGATGATGATGATAAGCGACCGGAC 42 Apr-fu-Spel-R ACTAGTOGCCTGACACGGGCACCGCCGCAGG CTCA
43
TACA
GFP-HDEL-stop-XhoI- CTCGAGCTAGAGCTCATCGTGCTTGTACAGCTCGTCCA
44
R TGCCGAG
GFP-fu-Spel-R ACTAGTTCGCCTGACACGCTTGTACAGCTCGTCCATGC
45
CGAG
Spel-ek-GFP-F ACTAGTGATGACGACGATAGGTGAGCAAG 46
AtAGT2-5' TATGAATTACCCGATGGGCAAG 47
AtACT2-3' TGGAACAAGACTTCTGGGCAT 48 leptin- F-qRTl-F TCGGTATCCGCCAAGCAGTGCCTATCCAGAAAGTCCA 49 leptin- R-qRTl- GGTGAAGCCCAGGAATGAAGGCATOAGGGCTAACATC 50
CA
Leptin의 mature region과， M도메인 혹은 Asn-t으 Gin치환 돌연변。 M 도메인을 백터 BiP:HA:CBD:HDEL에 연속적으로 연결시켰다.
엽록체 및 미토콘드리아로 융합단백질을 축적시키기 위하여, Cab transit peptide또는 Fl-ATPase gamma subunit presequence를 PCR로 증폭하고, EeLepf 및 EeLepfM 백터 내의 BiP로 치환시켰다 (Lee, D. W. et al . , Arabidopsis nuclear-encoded plast id transit peptides contain multiple sequence subgroups with distinctive chloroplast-target ing sequence motifs. Plant Cell 20, 1603-1622 (2008)； Lee, S. et al. , Mitochondrial targeting of the Arabidopsis Fl-ATPase gamma-subunit via multiple compensatory and synergistic presequence motifs. Plant Cell 24, 5037-5057 (2012) 참조). 상기 구조체들은 모두 동일한 백터로부터 제작되었고， 따라서,동일한 5'-UTRs을 갖는다. 모든 PCR 산물의 핵산 서열은 nucleotide sequencing에 의하여 확인하였다.
참고예 3: 발현， 화합물 처리， 및 웨스턴블랏 분석
상기 참고예 2에서 제작된 플라스미드는 폴리에틸렌글리콜
(PEG)-매개 형질전환에 의하여, 참고예 1에서 준비된 식물 세포의 원형질체 내로 도입시켰다. 형질 전환 후， 24 시간 또는 정해진 시점에서 단백질을 추출하여 단백질 추출물을 준비하였다. 형질 전환 직후, 원형질체에 투니카마이신 (tu camycin, lO^g/mL； Sigma-Aldrich, St. Louis, MO)을 처리하고， 형질전환 12시간 후에 Cycloheximide (50/ig/mL; Sigma-Aldrich, St. Louis, MO)을 처리하였다. 단백질 추출물에 대하여 항— HA 항체 (Roche Diagnostics, Indianapolis, IN) ,항一 actin항체 (MP Biomedicals , Solon, OH), 항 -GFP항체 (Bio-Application,포항, 대한민국)또는 항 BiP항체를 사용하여 Western blotting analysis를 수행하였다. 단백질 블롯을 ECL kit (Amersham Pharmacia Biotech, Piscataway, NJ)로 전개하고 LAS4000 image an lyzer (Fujifilm, Tokyo, Japan)를 사용하여 이미지를 얻었다.
참고예 4: 전체 RNA분리 및 전사 수준의 정량적 RT-PCR분석
PEG-매개 형질전환 후의 식물세포 원형질체로부터 Ambion
Phenol-free total RNA isolation kit를 이용하여 전체 RNA를 추출하고， TURBO DNase (Ambion)를 처리하였다. high-capacity cDNA reverse transcription kit (Applied Biosystems)를 사용하여 상기 추출된 전체 RNA로부터 cDNA를 합성 하였다. Power SYBR Green PCR Master Mix (Applied Biosystems)를 사용하여 전사 수준 (transcript level)을 검출하였다. ACTIN2는 내재적 대조군 (endogenous control)으로 사용하였다. PCR 흔합물 (20/£)은 template 50ng, forward 및 reverse primer 0.5 mM, 및 lxSYBR Mix를 포함하였다.
PCR 조건은 다음과 같다: initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min.
특이적인 증폭을 확인하기 위하여， 95°C에서 15초간 가열 한 후， 60'C에서 1분간. 가열 한 다음, 95°C까지 매 15초마다 0.3°C씩 온도를 상승시키면서 융해곡선을 얻었다.
실시예 1. M도메인 (M domain) 융합용 재조합 백터의 제작
식물체에서 목적 단백질을 고발현 시킬 수 있도록， 목적 단백질에 사람 CD45의 M 도메인 (M domain)이 융합된 융합 단백질을 코딩하는 유전자를 포함하는 식물 형질전환용 재조합 백터를 제작하였다. 목적 단백질로 엔테로키나아제 절단 부위 (enterokinase cleavage site)와 퓨린 절단 부위 (furin cleavage site)가 각각 아미노 말단과 카르복시 말단에 융합된 렙틴 (Leptin) (이하 "eLepf "이라 함)을 사용하였다. 상기 재조합 백터는 통상적으로 사용하는 백터인 pCAMBIA1300 백터에 CaMV 35S 프로모터를 사용하고, 단백질 합성량의 증가를 위하여 M17 서열 (서열번호 3)을 추가하였으며, BiP(chaperone binding protein) 단백질의 신호 펩타이드 (signal peptide)에 해당하는 게놈 DNA 서열 (서열번호 4)을 이용하여 목적 단백질을 소포체로 이동시킬 수 있도록 하였고, 최종 목적 단백질이 . 소포체에 축적될 수 있도록 카르복실 말단에 HDEL(His-Asp-Glu-Leu)을 부여하여 소포체에 보존 (retention)시켰다. 또한 웨스턴 블럿을 통해 융합 단백질의 발현 여부를 확인하기 위해 HA 에피토프를 사용하였다. 본 실시예에서 제작한 재조합 백터의 모식도를 도 1에 나타내었다 (M: M 도메인).
도 1에 보여진 재조합 백터의 핵산 서열 (서열번호 10)을 다음의 표 2에 정리하였다:
【표 2】
Leptin-M domain 융합 단백질 발현용 재조합 백터의 핵산 서열 (서열번호 10)
핵산 서열 (5'→3')
Xbal tctaga
(Restrict i
on enzyme
site)
M17 ggcgtgtgtgtgtgttaaaga (서열번호 3) ,
BiP at ggctcgctcgtttggagctaacagtaccgttgtgt tggcgatcatcttctt
cggtgagtgattttccgatcttcttctccgatttagatctcctctacattgtt gcttaatctcagaaccttttttcgttgttcctggatctgaatgtgtttgtttg caatttcacgatct taaaaggttagat ctcgattggt at tgacgattggaatc tttacgatttcaggatgtttatttgcgttgtcctctgcaatagaagaggctac gaagttaa (서열번호 4)
Enk ggatccaagat gat gat gat aag
(Enterokin
ase cleavge 09 U"
ZH IN
N033AN3NANT V丄 3 13 ^Ί人 QAIINV o I
Figure imgf000023_0001
/13d 098SfI/8lOZ OAV 상기 실시예 1에서 제작한 M 도메인이 포함된 재조합 백터에 의해 만들어진 융합 단백질 eLepfM의 발현량올 비교하기 위하여, 아래와 같이 재조합 백터를 제작하였다.
상기 실시예 1에서 제조한 재조합 백터 (EeLepfM ; 도 1)에서 M 도메인을 제거한 백터 (EeLepf ) 및 M 도메인 중 4개 (실시예 1의 그림 참조)의 N—당화 부위 (Asn)가 돌연변이 (mutat ion ; Asn을 Gin로 치환)된 백터 (EeLepfM1234)를 제작하였다 (참고예 1 참조) . 이 세 가지 백터 (도 2a 참조)를 애기장대 irabidopsis thai i ana) 잎으로부터 분리한 식물세포 (참고예 1 참조)에 폴리에틸렌글리콜 (polyethylene glycol ; PEG)을 통해 형질전환시켰고, N-당화의 효과를 확인하기 위해 형질전환 후 N—당화를 저해하는 튜니카마이신 (tuni camycin)을 처리하였다. 24시간 후 웨스턴블럿을 통해 단백질의 발현량을 확인하였다. . 상기 얻어진 단백질 발현량 결과를 도 2b에 나타내었다 (상단: 웨스턴블럿 결과; 하단: 웨스턴블¾ 결과 얻어진 단백질 발현량을 LAS4000 image analyzer로 정량하여 나타낸 그래프 (Error bars , standard devi at i on (n = 3)； * , p < 0.05 (Student ' s t一 test ) ) ) .
도 2b에 나타낸 것과 같이, Nᅳ당화가 일어나지 않아도 M 도메인이 융합되었을 때 단백질 발현량이 증가하기는 하지만 (EeLepfM + tuni camycin) , M 도메인이 있는 재조합 백터에서 류니카마이신을 첨가하지. 않았을 때 (EeLepfM - tuni camycin) N—당화가 일어나면서 목적 단백질의 발현량이 최대로 증가하였다.
M 도메인의 융합으로 단백질 발현량이 증가되는 것이 N—당화에 의한 것인지를 좀 더 명확하게 하기 위해， M도메인이 없는 목적 단백질 (eLepf )및 M 도메인이 융합된 단백질 (eLepfM)이 각각 소포체， 엽록체， 미토콘드리아로 타켓팅되도록 하는 재조합 백터를 제작하였다. 융합 단백질을 소포체, 엽록체, 미토콘드리아로 타겟팅 시키기 위해 각각， BiP (서열번호 4) , Cab trans i t pept ide (서열번호 12) , 또는 Fl-ATPase gamma subuni t presequence (서열번호 13)를 목적 단백질의 아미노 말단에 융합하고， M 도메인 코딩 핵산서열 (서열번호 1)을 목적 단백질의 카복시 말단에 융합하여 재조합 백터를 제작하였다. 각각의 재조합 백터를 상기와 같은 방법으로 식물세포에 도입한 후 배양하여 융합 단백질을 발현시켰다. 웨스턴블럿을 통해 단백질 발현량을 확인하였다.
상기 얻어진 단백질 발현량 결과를 도 3에 나타내었다 (상단: 발현백터 모식도; 중간: 웨스턴블럿 결과; 하단: 웨스턴블럿 결과 얻어진 단백질 발현량을 LAS4000 image analyzer로 정량하여 나타낸 그래프 (Error bars , standard deviation (n = 3)； * , p < 0.05 (Student's t-test))) . .
. 도 3에 나타낸 것과 같이 , M도메인이 없는 eLepf은 세포 내 소기관별 단백질 양에 차이가 없는 반면, M 도메인이 융합된 eLepfM의 경우 N—당화가 일어나는 소포체 (ER)로 타겟팅 시킨 EeLepfM만이 단백질 발현량이 증가한 것을 확인할 수 있었다.
도 2b와 도 3의 결과를 종합하였을 때, M 도메인 융합에 의한 목적 단백질의 발현 증가는 N-당화에 의한 것이라는 것을 알 수 있었다.
실시예 3. M도메인 융합 단백질의 발현 속도
상기 실시예 2에서 확인한 바와 같이 N-당화에 의한 단백질 발현 증가의 기작을 이해하기 위해 M 도메인 융합 단백질의 발현 속도를 확인하였다. 상기 M 도메인이 융합된 재조합 백터 EeLepfM과 M 도메인의 N-당화 부위가 돌연변이화 된 EeLepfM1234를 각각 식물세포에 형질전환 시키고, 12시간 후에 단백질의 합성을 막는 시클로핵사미드 (cycloheximide) 또는 DMSO (dimethyl sulfoxide)를 처리한 후 12시간 간격으로 단백질을 추출하여 웨스턴 블럿으로 확인하였다.
상기 얻어진 결과를 도 4에 나타내었다 (상단: 웨스턴블럿 결과; 하단: 웨스턴블럿 결과 얻어진 단백질 발현량을 LAS4000 image analyzer로 정량하여 나타낸 그래프 (X축， 시간; Error bars, SD (n = 3)； *, p < 0.05； ***, p < 0.001))).
그 결과， 도 4에 나타낸 것과 같이 초기 (12 시간)에는 EeLepfM과
EeLepfM1234의 발현량 차이가 거의 없으나, 시간이 지날수록 그 차이가 점점 커지는 것을 알 수 있었고， 이로부터 EeLepfM의 발현 속도가 EeLepfM1234에 비해 월등히 빠르다는 것을 . 알 수 있었다. 하지만 시클로핵사미드 (cycloheximide)를 처리하여 단백질 합성을 막았을 때 식물 세포 내에서 EeLepfM은 조금씩 사라지지만, EeLepfM1234는 48시간까지 그대로 유지된 것을 확인함으로써 만들어진 단백질의 소포체 내 안정성은
EeLepfM1234가 더 높은 것을 알 수 있었다. 이 결과는 N-당화가 일어나는 단백질의 번역 속도가 N—당화가 일어나지 않는 단백질에 비해 빠르다는 것을 의미한다.
실시예 4. 다양한 단백질과 M도메인 융합
M 도메인에 의한 발현 증가 효과가 위의 실시예에서 사용한 목적 단백질 (eLepf) 이외의 단백질에도 적용이 되는지 확인하기 위해，
또 다른 목적 단백질로서 Exendin4 (서열번호 51) 코딩 유전자 또는 GLP-1 (서열번호 52) 코딩 유전자에 M 도메인 코딩 유전자 (서열번호 1)을 융합하고, 번역 증폭 도메인 (translation enhancer domain)으로서 G도메인을 융합하여 재조합 백터를 제조하고 (도 1 참조), 각각의 재조합 백터를 식물세포 (참고예 1)에 형질전환 시킨 후, 단백질 발현량을 웨스턴 블럿으로 확인하였다. 상기 결과를 도 5에 나타내었다. 도 6에 나타난 바와 같이, N一당화를 막는 튜니카마이신 (tunicamycin)을 처리하였을 때 보다 튜니마마이신을 처리하지 않아 N-당화가 일어났을 때 단백질 발현 정도가 월등히 증가하는 것을 확인하였다.
실시예 5. 다양한 단백질과 M도메인의 다양한 순서로의 융합 또한, 도 6a에 모식적으로 나타낸 재조합 백터의 Xxx 위치에 leptin (Lep), aprotinin (Apr; 서열번호 11)， 또는 GFP (Gfp; 서열번호 15)를 포함하는 재조합 백터를 준비하고 ("(G4S)2": 링커 (GGGGSGGGGS)), 이를 식물세포에 형질전환한 후， 단백질 발현량을 웨스턴블럿으로 확인하였다. 상기 얻어진 결과를 도 6b에 나타내었다. 도 6b에 나타난 바와 같이 목적 단백질과 M도메인의 융합 단백질을 코딩하는유전자를 발현시킨 경우, 목적 단백질 종류， M 도메인과의 연결 순서, 및 링커의 유무와 무관하게, M 도메인과 융합되지 않은 경우와 비교하여， 목적 단백질의 발현량이 현저하게 증가함을 확인할 수 있다.
실시예 6: M 도메인의 N— glycosylation site의 조합에 따른 목적 단백질 발현 시험
M 도메인의 4개의 N— glycosylation site (실시예 1의 그림 참조)의 다양한 조합에 Asn-Gln 치환 돌연변이를 도입한 돌연변이체 (4개의 N-glycosylation site중 하나씩 변이， 2개씩 변이, 3개씩 변이, 및 4개 모두 변이)를 암호화하는 유전자를 포함하는 재조합 백터를 사용하여， 목적 단백질 (Leptin)의 발현 수준을 측정하였다 (도 7). 상기 재조합 백터를 식물세포 원형질체에 형질전환시킨 후, 단백질을 추출하고， 상기 얻어진 단백질 추출물을 항 -HA 항체를 이용한 웨스턴블랏팅으로 분석하였다. 상기 웨스턴블랏팅 결과 얻어진 밴드의 신호 강도를 LAS4000 이미지 분석기와 함께 제공된 소프트웨어를 사용하여 정량화하여, 그 결과를 도 7에 나타내었다 (X축의 EeLepfM 뒤에 기재된 숫자는 Asn-to-Gln 변이된 N-glycosylation site를 의미함). 도 7에서, 각 돌연변이체를 사용한 경우의 목적 단백질 발현 수준을 ER-표적화된 야생형 단백질 (야생형 M 도메인과 목적 단백질 융합)인 EeLepfM의 발현수준 (1)에 대한 상대값으로 나타내었다. 도 7에서, (a)는 단일 Asn-Gln 돌연변이체를 사용한 경우의 목적' 단백질이 상대적 발현 수준을, (b)는 이중 Asn-Gln 돌연변이체를 사용하는 경우의 목적 단백질이 상대적 발현 수준을, (c)는 트리플 Asn-Gln 돌연변이체를 사용한 경우의 목적 단백질이 상대적 발현 수준을 각각 나타낸다 (Error bars, SD (n = 4)).
도 7에 나타난 바와 같이， M 도메인의 N-glycosylation site 증 1-3개의 위치에 돌연변이가 발생하는 경우에 야생형보다 목적 단백질의 발현 수준이 낮아지지만， Nᅳ glycosylation site 4개가 모두 돌연변이된 경우보다는 모두 높은 수준의 목적 단백질 발현을 보였다. M 도메인의 4개의 N-glycosylation site가 모두 돌연변이된 돌연변이체를 사용한 경우라도, 목적 단백질을 단독 발현시키는 .경우와 비교하여 , 목적 단백질의 발현 수준이 증가하는 것을 고려할 때 (도 2b 참조), 야생형 M 도메인뿐 아니라 4개의 N-glycosylation site 중 1—4개의 위치에 돌연변이가 발생한 변이 M 도메인을 사용한 경우라도, 융합 발현된 목적 단백질의 발현 수준올 증가시키는데 기여한다고 볼 수 있다.
실시예 7: 비당화 단백질 (unglycosylated protein)의 낮은 발현수준과 ER-관련 분해와의 관련성 시험
비당화 단백질 (unglycosylated protein)의 발현수준이 낮은 것이 ER-associated degradation과 관련 있는지 여부를 시험하였다. 결론적으로 비당화 단백질의 낮은 발현 수준은 ER-associated degradation에 기인하는 것이 아님을 확인하였다.
보다 구체적으로 EeLepfM 백터 (Leptin과 야생형 M 도메인의 융합 단백질 발현) 및 EeLepfM1234 백터 (Leptin과 4개의 당화 위치가 모두 변이 (Gin으로 치환)된 변이 M 도메인의 융합 단백질 발현)을 각각 식물 원형질체에 형질전환 후， 18시간 또는 21 시간에 26S proteasome-mediated degradation의 억제제인 MG132 (IUPAC name: Benzyl N-[(2S)-4-methyl-l-[[(2S)-4-methyl-l-[[(2S)-4-methyl-l-oxopentan-2-yl] am i no ] - 1-oxopen t an-2-y 1 ] am i no ] - 1-oxopen t an-2-y 1 ] c ar bama t e ) 20 μ M을 원형질 배양 배지에 첨가하고, 원형질체를 각각 6 또는 3 시간 더 배양하였다.
[시험 디자인 개략도]
Figure imgf000028_0001
(HAT: hours after trans format ion)
비교를 위하여 (양성 대조군), 원형질체를 Rbcs[T4,7A]:GFP로 형질전환킨 후, 18 시간에 MG132로 처리하고 추가로 6 시간동안 배양하였다. Rbcs[T4,7A]:GFP는 GFP 융합체로서, 엽록체로의 단백질 도입에 결함이 있는 RbcS 전달 펩타이드의 돌연변이 형태를 발현하고, 세포질 내 26S 프로테아좀에 의해 유비퀴틴화되고 분해된다.
형질전환 후 24시간째에 형질전환된 원형질체로부터 단백질을 추출하고, 항 -HA 항체 또는 항 -GFP 항체를 이용한 Western blotting을 수행하여 상기 단백질 추출물을 분석하였다.
상기 얻어진 Western blotting 결과를 도 8에 나타내었다. 도 8에 나타난 바와 같이, RbcS[T4,7A]:GFP의 발현 수준은, MG132의 미처리시와 비교하여, 처리시에 더 높았으며， 이러한 결과는 본 실시예의 시험 조건 하에서 MG132가 26S 프로테아좀ᅳ의존성 단백질 분해를 억제함을 보여준다. 그러나 EeLepfM과 EeLepfM1234 단백질 발현 수준은 MG132 처리에 관계없이 차이가 없었으며， 이는 ER-associated degradat ion이 N—당화된 EeLepfM과 비당화된 EeLepfM1234의 단백질 발현에 역할을 하지 않음을 보여준다.
실시예 8: 목적 단백질 자체의 N-glycosylation과 M 도메인의 N-glycosylation이 목적 단백질 발현에 미치는 효과 시험
목적 단백질이 N-glycosylation site을 내재적으로 포함하여 그 자체로 N— glycosylation 가능한 경우, M 도메인과 융합되지 않고 목적 단백질 자체의 N-glycosylation되는 경우에도 목적 단백질의 발현 수준이 증가되는지 확인하였다.
이를 위하여, 앞선 실시예들을 참조하여， Leptin 단백질을 대신하여 LIF (Leukemia inhibitory factor; 서열번호 17; 코딩 핵산 서열: 서열번호 16； EeLiff; 내재적으로 6개의 N-glycosylation site가 있음)를 사용하여, M domain이 융합되거나 융합되지 않은 LIF (EeLiff)을 발현하는 재조합 백터를 구축하고, 식물 원형질체에 형질전환시키고, 24시간 후에 단백질을 추출하여 웨스턴블랏팅을 수행하여 단백질 발현 수준을 측청하였다.
상기 얻어진 단백질 발현 수준을 도 9에 나타내었다. 도 9에 나타난바와 같이， M domain이 융합되지 않은 EeLiff와 비교하여， M domain이 융합된 EeLiffM의 발현 수준이 월등히 높은 것을 알 수 있다 (RbcL: loading control). 이러한 결과는 목적 단백질에 내재하는 N-glycosylation 위치에서의 N-glycosylat ion은 목적 단백질의 발현 수준에 영향을 미치자 않는 반면, 목적 단백질과 융합되는 융합 파트너인 M domain의 N— glycosylat ion이 목적 단백질의 발현수준에 중요한 역할을 하는 것임을 보여준다.
실시예 9: M 도메인의 일부 또는 M 도메인의 연장부와 융합된 융합 단백질의 발현 수준
목적 단백질 (Leptin)이 M 도메인의 일부 또는 연장부와 융합된 융합 단백질의 발현 수준을 시험하였다. 이를 위하여, 실시예 2의 방법올 참조하여, 목적단백질과 M 도메인 (서열번호 2; 총 60aa)의 41ᅳ 60 위치의 20개 아미노산 길이의 단편 (서열번호 6)이 융합된 융합 단백질 (EeLepfM20; N—당화 위치 1개 (N4: 46번째 위치의 Asn) 포함), 21-60 위치의 40개 아미노산 길이의 단편 (서열번호 7)이 융합된 융합 단백질 (EeLepfM40; M 도메인의 N-당화 위치 3개 (N2: 30번째 위치의 Asn; Ν3·' 40번째 위치의 Asn; 및 N4: 46번째 위치의 Asn)포함), M도메인 (서열번호 2)과 융합된 융합 단백질 (EeLepfM60), 및 CD45 (서열번호 5)에 있어서, 서열번호 2의 M 도메인의 N 말단쪽 및 C 말단쪽으로 각각 10개 아미노산만큼 연장된 총. 80개 아미노산 길이의 단편 (서열번호 8)이 융합된 융합 단백질 (EeLepfMSO)을 식물 세포의 원형질체에 도입하여 각각 발현시킨 후, 단백질을 추출하여 웨스턴블랏팅으로 발현량을 측정하였다ᅳ 비교를 위하여, M domain이 융합되지 않은 EeLepf의 발현 수준도 하게 측정하였다.
상기 얻어진 단백질 발현 수준을 도 10에 나타내었다. 도 10에 나타난 바와 같이 , EeLepf M20, EeLepfM40, EeLepfM60, 및 EeLepfM80는 모두 EeLepf보다 높은 발현 수준을 나타내었다 (EeLepf « EeLepfM20 < EeLepf M40 = EeLepf M = EeLepfM80).
실시예 10: M 도메인 또는 다양한 M 도메인 변이체의 융합에 따른 전사수준 시험
식물 세포 (참조예 1)를 야생형 (변이되지 않은) M 도메인 또는 Nᅳ당화부위가 각각 변이된 다양한 M 도메인 변이체와 leptin이 각각 융합된 융합 단백질의 코딩 유전자를 포함하는 재조합 백터로 각각 형질전환시키고, 1일 후에 전체 R A를 추출하여 정량적 RT— PCR을 수행하였다. 구체적 방법은 참고예 4에 기재하였다.
상기와 같이 얻어진 RNA수준을 도 11에 나타내었다. 도 11은 야생형 (변이되지 않은) M 도메인 (i.e. , fully glycosylated)과 leptin 융합된 경우의 mRNA 양 (=1)에 대한 각각의 M 도메인 변이체가 융합된 경우의 mRNA양^ 상대치의 평균을 나타낸 것이다 (Error bar, SD (n=3 for M to 14； n=2 for 23 to 1234)). Student's t-test 결과, p 값이 0.05이상으로 M 도메인 융합된 leptin과 변이된 M 도메인이 융합된 leptin들간의 mRNA양의 차이는 없었다. 이 결과는 M 도메인의 융합에 의한 발현증가가 전사 (transcription) 증가에 의한 mRNA 양의 증가에 기인하는 것이 아님을 의미하며, mRNA로부터 단백질로의 번역 (translation)의 촉진에 기인하는 것임을 제안한다.

Claims

【청구범위】
【청구항 1】
목적 단백질 및 상기 목적 단백질의 C-말단 또는 N—말단에 융합된 N-당화 (N-g lycosyl at i on) 도메인을 포함하는 융합 단백질을 코딩하는 유전자를 포함하는 재조합 백터,
상기 재조합 백터를 포함하는 재조합 세포, 및
상기 재조합 세포를 포함하는 형질전환 유기체
로 이루어진 군에서 선택된 1종 이상을 포함하는， 목적 단백질 생산용 조성물.
【청구항 2】
제 1항에 있어서，
상기 N-당화 도메인은 서열번호 2의 사람 CD45 유래 M 도메인 (M doma in) 또는 상기 M 도메인의 일부를 포함하는, 서열번호 1의 인간 CD45 단백질 내의 연속하는 10 내지 100개 아미노산 길이의 폴리펩타이드이고， 상기 M 도메인의, 일부는 서열번호 2의 2번째 위치의 Asn , 30번째 위치의 Asn , 40번째 위치의 Asn , 및 46번째 위치의 Asn 중에서 선택된 하나 이상의 N-당화 위치를 포함하는 10개 이상의 아미노산을 포함하는 폴리펩타이드 단편인
목적 단백질 생산용 조성물.
【청구항 3】
제 2항에 있어서， 상기 M 도메인의 일부는 "LTECKNASVS ISHNSCTAPD (서열번호 6) " 또는 "NVNENVECGN NTCTN EVHN LTECKNASVS ISHNSCTAPD (서열번호 7) " )를 포함하는, 서열번호 2 내의 연속하는 10개 이상의 아미노산 길이의 폴리펩타이드 단편인, 목적 단백질 생산용 조성물.
【청구항 4】
제 2항에 있어서, 상기 M 도메인의 일부는 "NVNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD (서열번호 7Γ )를 포함하는, 서열번호 2 내의 연속하는 20개 이상의 아미노산 길이의 폴리펩타이드 단편인, 목적 단백질 생산용 조성물.
【청구항 5】 제 1항 내지 제 4항 중 어느 한 항에 있어서,
상기 융합 단백질은 목적 단백질과 Nᅳ당화 도메인 사이에 펩타이드 링커를 추가로 포함하는 것인, 목적 단백질 생산용 조성물.
【청구항 6]
제 1항 내지 제 4항 중 어느 한 항에 있어서,
상기 융합 단백질은 소포체로 표적화되는 것인， 목적 단백질 생산용 조성물.
【청구항 7】
제 1항 내지 제 4항 중 어느 한 항에 있어서,
상기 재조합 백터는 BiP(chaperone binding protein) 코딩 유전자,
HDEL(Hi s-Asp-Gl u-Leu) 펩타이드 코딩 유전자, 또는 이들 모두를 추가로 포함하는 것인, 목적 단백질 생산용 조성물.
【청구항 8】
제 1항 내지 제 4항 중 어느 한 항에 있어서,
상기 세포는 식물 세포이고, 상기 유기체는 식물인, 목적 단백질 생산용 조성물.
【청구항 9]
목적 단백질 및 상기 목적 단백질의 C-말단 또는 N-말단에 융합된 N-당화 (N-glycosyl at ion) 도메인을 포함하는 융합 단백질을 코딩하는 유전자를 포함하는, 목적 단백질 발현용 재조합 백터.
【청구항 10】
제 9항에 있어서，
상기 융합 단백질은 목적 단백질과 N-당화 도메인 사이에 펩타이드 링커를 추가로 포함하는 것인， 목적 단백질 발현용 재조합 백터.
【청구항 11】
제 9항에 있어서，
상기 융합 단백질은 소포체로 표적화되는 것인, 목적 단백질 발현용 재조합 백터.
【청구항 12】
제 9항에 있어서, BiP(chaperone bindi ng prot e i n)코딩 유전자, HDEL (H i s-Asp-G 1 u~Leu ) 펩타이드 코딩 유전자, 또는 이들 모두를 추가로 포함하는, 목적 단백질 발현용 재조합 백터.
【청구항 13]
제 9항 내지 제 12항 중 어느 한 항에 있어서,
식물 세포에서의 발현에 사용하기 위한 것인, 식물 세포 발현용 재조합 백터.
【청구항 14】
제 9항 내지 제 12항 중 어느 한 항의 재조합 백터를 포함하는， 재조합 세포.
【청구항 15】
제 14항의 재조합 세포를 포함하는 형질전환 유기체.
【청구항 16]
제 14항의 재조합 세포를 배양하는 단계를 포함하는,
목적 단백질의 생산방법 .
【청구항 17】
제 15항의 형질전환 유기체를 성장시키는 단계를 포함하는， 목적 단백질의생산 방법 .
【청구항 18】
N-당화 도메인을 코딩하는 유전자 또는 상기 유전자를 포함하는 재조합 백터를 포함하고,
상기 N-당화 도메인은 서열번호 2의 사람 CD45 유래 M 도메인 (M doma in) 또는 상기 M 도메인의 일부를 포함하는， 서열번호 1의 인간 CD45 단백질 내의 연속하는 10 내지 100개 아미노산 길이의 폴리펩타이드이고， 상기 M 도메인의 일부는 서열번호 2의 2번째 위치의 Asn , 30번째 위치의 Asn , 40번째 위치의 Asn , 및 46번째 위치의 Asn 중에서 선택된 하나 이상의 N-당화 위치를 포함하는 10개 이상의 아미노산을 포함하는 폴리펩타이드 단편인,
단백질 발현용 조성물.
PCT/KR2018/000807 2017-01-17 2018-01-17 식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터 WO2018135860A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2019538440A JP6968451B2 (ja) 2017-01-17 2018-01-17 植物細胞における目的タンパク質の発現のための組換えベクター
US16/478,592 US11279943B2 (en) 2017-01-17 2018-01-17 Recombinant vector for expressing target protein in plant cell
US17/650,975 US11845945B2 (en) 2017-01-17 2022-02-14 Recombinant vector for expressing target protein in plant cell

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170008160 2017-01-17
KR10-2017-0008160 2017-01-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/478,592 A-371-Of-International US11279943B2 (en) 2017-01-17 2018-01-17 Recombinant vector for expressing target protein in plant cell
US17/650,975 Division US11845945B2 (en) 2017-01-17 2022-02-14 Recombinant vector for expressing target protein in plant cell

Publications (1)

Publication Number Publication Date
WO2018135860A1 true WO2018135860A1 (ko) 2018-07-26

Family

ID=62909295

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/000807 WO2018135860A1 (ko) 2017-01-17 2018-01-17 식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터

Country Status (4)

Country Link
US (2) US11279943B2 (ko)
JP (1) JP6968451B2 (ko)
KR (1) KR102022662B1 (ko)
WO (1) WO2018135860A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113490508A (zh) * 2019-04-16 2021-10-08 巴伊沃爱普有限公司 猪流行性腹泻(ped)病毒疫苗组合物及其制备方法

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102138272B1 (ko) 2018-09-19 2020-07-28 주식회사 바이오앱 BiP 단편을 포함하는 재조합 벡터 및 상기 벡터를 이용한 재조합 단백질의 제조 방법
WO2020101187A1 (ko) 2018-11-15 2020-05-22 주식회사 바이오앱 식물체에서 바이러스-유사 입자를 발현하는 재조합 벡터 및 이를 이용한 써코바이러스-유사 입자를 포함하는 백신 조성물의 제조방법
KR102288367B1 (ko) 2018-11-15 2021-08-11 주식회사 바이오앱 식물체에서 바이러스-유사 입자를 발현하는 재조합 벡터 및 이를 이용한 써코바이러스-유사 입자를 포함하는 백신 조성물의 제조방법
KR102250576B1 (ko) 2018-11-15 2021-05-12 주식회사 바이오앱 식물 발현 시스템에서 캡시드 단백질의 발현을 증가시키는 재조합 벡터 및 이를 이용한 바이러스-유사 입자의 제조방법
KR102077772B1 (ko) * 2018-11-29 2020-02-17 주식회사 바이오앱 광견병 예방용 백신 조성물 및 이의 제조 방법
US20200354726A1 (en) * 2019-03-22 2020-11-12 Biocompanion Inc. Method of mass-producing carbonic anhydrase in plant
KR102209198B1 (ko) * 2019-04-02 2021-02-02 주식회사 바이오앱 식물에서의 발현이 최적화된 재조합 이리신 유전자 및 이를 이용한 재조합 이리신 단백질의 생산 방법
WO2020256374A1 (ko) * 2019-06-17 2020-12-24 주식회사 바이오앱 아프리카 돼지열병의 예방을 위한 항원 생산용 재조합 벡터 및 이의 용도
KR102643810B1 (ko) * 2020-03-20 2024-03-06 포항공과대학교 산학협력단 식물에서 목적 단백질을 대량생산하는 방법
KR102508238B1 (ko) * 2020-04-02 2023-03-09 조선대학교산학협력단 코로나바이러스 감염증­１９의 치료제로서 ａｃｅ２의 용도
KR20230067302A (ko) * 2021-11-09 2023-05-16 포항공과대학교 산학협력단 식물에서 재조합 단백질 발현의 증진에 있어서 gb1 도메인 융합의 효과

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101449155B1 (ko) * 2012-12-06 2014-10-13 주식회사 바이오앱 식물체에서 목적 단백질의 번역 효율을 증진시키기 위한 염기서열

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070161087A1 (en) * 2003-05-29 2007-07-12 Wolfgang Glaesner Glp-1 fusion proteins
JP4872327B2 (ja) 2004-11-26 2012-02-08 東レ株式会社 改質されたインターロイキン−１１とその製造方法
CA2628928A1 (en) 2005-11-10 2007-05-24 Receptor Biologix, Inc. Hepatocyte growth factor intron fusion proteins
US20200354726A1 (en) * 2019-03-22 2020-11-12 Biocompanion Inc. Method of mass-producing carbonic anhydrase in plant

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101449155B1 (ko) * 2012-12-06 2014-10-13 주식회사 바이오앱 식물체에서 목적 단백질의 번역 효율을 증진시키기 위한 염기서열

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CASTILHO, A. ET AL.: "N-glycosylation Engineering of Plants for the Biosynthesis of Glycoproteins with Bisected and Branched Complex N-glycans", GLYCOBIOLOGY, vol. 21, no. 6, June 2011 (2011-06-01), pages 813 - 823, XP055295324 *
DATABASE Protein [O] 26 July 2016 (2016-07-26), "CD45, partial [Homo sapiens]", XP055519371, retrieved from NCBI Database accession no. AAS46946.1 *
LEE, G. ET AL.: "Oral Immunization of Haemaggulutinin H5 Expressed in Plant Endoplasmic Reticulum with Adjuvant Saponin Protects Mice against Highly Pathogenic Avian Influenza A Virus Infection", PLANT BIOTECHNOLOGY JOURNAL, vol. 13, no. 1, 2015, pages 62 - 72, XP055505228 *
OKAMOTO, M. ET AL.: "Enhanced Expression of an Antimicrobial Peptide Sarcotoxin IA by GUS Fusion in Transgenic Tobacco Plants", PLANT AND CELL PHYSIOLOGY, vol. 39, no. 1, 1998, pages 57 - 63, XP000917897 *
SAGT, C. M. J. ET AL.: "Introduction of an N-glycosylation Site Increases Secretion of Heterologous Proteins in Yeasts", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 66, no. 11, November 2000 (2000-11-01), pages 4940 - 4944, XP002254355 *
SYMONS, A. ET AL.: "Domain Organization of the Extracellular Region of CD 45", PROTEIN ENGINEERING, vol. 12, no. 10, 1999, pages 885 - 892, XP055505233 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113490508A (zh) * 2019-04-16 2021-10-08 巴伊沃爱普有限公司 猪流行性腹泻(ped)病毒疫苗组合物及其制备方法
JP2022522743A (ja) * 2019-04-16 2022-04-20 バイオアプリケーションズ インコーポレイテッド 豚流行性下痢ウイルスワクチン組成物およびその製造方法
EP3957323A4 (en) * 2019-04-16 2023-02-15 Bioapplications Inc. VACCINE COMPOSITION AGAINST PORCINE EPIDEMIC DIARRHEA (PED) VIRUS AND METHOD OF PRODUCTION THEREOF
JP7291973B2 (ja) 2019-04-16 2023-06-16 バイオアプリケーションズ インコーポレイテッド 豚流行性下痢ウイルスワクチン組成物およびその製造方法
CN113490508B (zh) * 2019-04-16 2023-09-01 巴伊沃爱普有限公司 猪流行性腹泻(ped)病毒疫苗组合物及其制备方法

Also Published As

Publication number Publication date
JP6968451B2 (ja) 2021-11-17
KR20180084680A (ko) 2018-07-25
KR102022662B1 (ko) 2019-09-18
US20220235366A1 (en) 2022-07-28
JP2020503884A (ja) 2020-02-06
US11279943B2 (en) 2022-03-22
US11845945B2 (en) 2023-12-19
US20200354737A1 (en) 2020-11-12

Similar Documents

Publication Publication Date Title
WO2018135860A1 (ko) 식물 세포에서의 목적 단백질 발현을 위한 재조합 벡터
CN110885834B (zh) 编码调节生物碱合成之转录因子的核酸序列及其在改良植物代谢中的应用
US8461419B2 (en) Plant height regulatory gene and uses thereof
KR101161622B1 (ko) 번역 효율 증진용 ｄｎａ 단편 및 이를 포함하는 재조합 벡터
US20200071715A1 (en) Transformed plant and method for producing exudate containing sugar using transformed plant
JPH09327293A (ja) アブラナ科植物ａｆｔタンパク及びその使用
CN108866084A (zh) 一个大豆E3泛素连接酶家族基因GmRNF1a的应用
KR101812409B1 (ko) 식물의 바이오매스 증가를 촉진시키는 LeBZR1 또는 LeBZR2 돌연변이 유전자 및 이의 용도
CN111607598B (zh) 大豆DDT结构域基因GmDDT1的应用
KR20190044866A (ko) 벼 흰잎마름병균에 의한 프로모터 인식부위 및 이의 용도
JP7304559B2 (ja) 成長が増強された形質転換植物及びその製造方法
EP2128251A1 (en) Genes having activity of promoting endoreduplication
KR20130055036A (ko) 덴드로비움 속 난초의 ｄｆｒ 유전자 프로모터
CN113913439B (zh) 一种水稻基因OsAL11应用及其方法
KR102348638B1 (ko) 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도
KR20110085732A (ko) 당의 액포 내 수송에 관여하는 벼 유래의 ＯｓＴＭＴ2 유전자
CN106011168B (zh) 来自水稻条纹病毒的一段提高蛋白表达水平的核苷酸序列
JP2022117105A (ja) 核酸を植物細胞のゲノムへ導入する方法
US20160319292A1 (en) Transformed plant and method for producing exudate containing sugar using transformed plant
KR20170100161A (ko) 식물 세포의 소포체 바디의 크기 및 개수를 증가시키기 위한 재조합 벡터 및 이를 이용한 목적 단백질의 대량생산방법
JP2005224120A (ja) 構成的発現プロモーター
JP2007282542A (ja) 低温ストレス耐性を有するトランスジェニック植物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18741487

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019538440

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18741487

Country of ref document: EP

Kind code of ref document: A1