WO2017142305A1 - 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 - Google Patents

발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2017142305A1
WO2017142305A1 PCT/KR2017/001650 KR2017001650W WO2017142305A1 WO 2017142305 A1 WO2017142305 A1 WO 2017142305A1 KR 2017001650 W KR2017001650 W KR 2017001650W WO 2017142305 A1 WO2017142305 A1 WO 2017142305A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
seq
expression
hair
hair growth
Prior art date
Application number
PCT/KR2017/001650
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to US15/999,760 priority Critical patent/US10508140B2/en
Priority to JP2018560421A priority patent/JP6581735B2/ja
Priority to CN201780011256.4A priority patent/CN108633279B/zh
Priority to ES17753466T priority patent/ES2980830T3/es
Priority to EP17753466.6A priority patent/EP3418293B1/en
Publication of WO2017142305A1 publication Critical patent/WO2017142305A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00—Preparations for affecting hair growth
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids

Definitions

  • the present invention is a peptide that exhibits hair growth promoting activity and / or melanin production promoting activity, hair loss prevention and / or improvement composition comprising the peptide as an active ingredient, hair growth and / or hair growth promoting composition comprising the peptide as an active ingredient , Preventing and / or improving hair loss of the peptide, promoting hair growth and / or hair growth of the peptide, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and the peptide as an active ingredient.
  • the present invention relates to a composition for preventing and / or improving melanin hypopigmentation, comprising: and preventing, improving and / or treating melanin hypopigmentation of the peptide.
  • Hair follicles are unique organs of mammalian skin, with the lower part of the primitive epidermis growing into the deeper skin layers.
  • a plug of cells known as follicular or dermal papilla cells (Stenn and Paus, Physiol . Rev., 81: 449 (2002)), and the papilla is the normal circulation of the hair follicle (Oliver, Embryol . Exp . Morph. 15 : 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) and hair shaft growth.
  • the hair shaft is a tread-shaped structure made of tightly adherent epithelial cells filled with keratin filaments and filament aggregate proteins.
  • hair loss spreads.
  • different disease states such as scar alopecia, scarring conditions associated with burn injuries or compression injuries
  • various substances have been used as a medicine until now, but the price is too expensive and various side effects are caused.
  • the raw materials used in cosmetics have the advantage of low price, but since the composition is composed of plant-derived ingredients, the effect is not so great. Therefore, there is a need in the art for a new effective ingredient that is both economical and cost effective.
  • dihydrotestosterone is added by adding a composition containing extracts such as red ginseng, red pepper, sugar, lettuce, red pepper, lettuce, ginseng, licorice, peony, turmeric, fennel, cornus and garlic, and a composition containing xanthine and growth hormone.
  • a composition containing extracts such as red ginseng, red pepper, sugar, lettuce, red pepper, lettuce, ginseng, licorice, peony, turmeric, fennel, cornus and garlic
  • a composition containing xanthine and growth hormone In order to improve the inhibition of cellular metabolism due to the excessive amount of growth hormone, growth hormone promotes hair growth, prevents hair loss and regenerates hair, and promotes hair growth, minerals, vitamins, and green tea to promote hair growth.
  • Skin cells produce melanin in the melanocytes of the melanocytes (melanocytes) in the epidermal basement layer as a protective mechanism against stimulation of ultraviolet rays, environmental pollution and other external factors. Melanin is an important factor in determining the color of skin, eyes and hair in animals. Hypopigmentation is also known as a risk factor for skin cancer.
  • Asians are sensitive to the excessive production of melanin, so a lot of research related to whitening that suppresses melanin production has been conducted.
  • the demand for vitiligo, which is suppressed by melanin production is also increasing, and research on this is being conducted.
  • Vitiligo is an acquired depigmentation disease in which white patches of various sizes and shapes appear on the skin due to the death or necrosis of melanocytes. It is a relatively common disease in about 1% of the world's population, with no differences in race or location. The incidence is most common at 10-30 years, 95% of patients develop before 40 years of age, and 30% of patients have a family history.
  • vitiligo The cause of vitiligo has not been elucidated yet, but many theories have been suggested, including autoimmune theory, neuronal fluidism, and melanocyte self-destruction. Autoimmune theories suggest that expression of autoantibodies against melanocyte antigens results in the destruction or dysfunction of melanocytes or the destruction of melanocytes in lymphokines secreted by cytotoxic lymphocytes or activated lymphocytes.
  • Neuronal fluid is a disorder of catecholamine biosynthesis and an increase in monoamine oxidase, which leads to stress-related hydrogen peroxide, which causes melanocytes to be destroyed, and vitiligo may occur along the ganglion or after nerve damage or stress.
  • the melanin self-destruction theory suggests that phenol complexes, which are intermediate metabolites or final metabolites, generated during melanin formation accumulate in melanocytes and destroy cells.
  • various factors such as inherent cellular defects, genetic factors, apoptosis and abnormal calcium metabolism have been suggested.
  • Melanin is synthesized from melanocytes and plays an important role in protecting the skin by UV irradiation or by absorbing toxic and chemicals. Therefore, in people whose melanin synthesis does not occur normally, there is an external problem that all skin becomes partially white and stained rather than white, and more sensitive to external stimuli.
  • Tyrosinase tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2), which are important enzymes for melanin synthesis, catalyze oxidative reactions (Pigment Cell Res. 14 ( 6): 43744).
  • Tyrosinase oxidizes tyrosine to DOPA (L-3,4-dihydroxyphenylalanine) and DOPA to DOPA quinone, and TRP-1 is dihydroxyindole carboxylic acid.
  • DOPA L-3,4-dihydroxyphenylalanine
  • DOPA DOPA to DOPA quinone
  • TRP-1 is dihydroxyindole carboxylic acid.
  • TRP-1 stabilizes tyrosinase and regulates activity.
  • TRP-2 is a DOPA chromium tautomerase, which is a eumelanon and a peomelanone that form melanocytes by converting DOPA chromium into DHICA. (pheomelanon) forms and their proportions determine the color of the skin, hair, and eyes.
  • ⁇ -MSH ⁇ -melanocyte stimulating hormone
  • ⁇ -MSH acts on melanocyte-producing melanocytes by paracrine to regulate the activity of the microphthalmia-associated transcription factor (MITF), a tyrosinase that plays an important role in melanin synthesis. It modulates the activity of TRP-1 (DHICA oxidase), TRP-2 (DOPAchrome tautomerase), etc. (THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July 31, pp. 195609565, 1998).
  • MITF microphthalmia-associated transcription factor
  • peptides having amino acid sequences of SEQ ID NO: 1 or 2 exhibit excellent hair growth and melanin production promoting activity, and they prevent hair loss or
  • the present invention has been completed by finding that it can be usefully used for improvement and prevention and treatment of melanin hypopigmentation.
  • a peptide exhibiting hair growth promoting activity consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Another object of the present invention is to provide a composition for preventing and / or improving hair loss comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • Another object of the present invention to provide a composition for promoting hair growth and / or hair growth comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • Still another object of the present invention is to provide a peptide that exhibits melanogenesis-promoting activity consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Another object of the present invention to provide a pharmaceutical composition for the prevention and / or treatment of melanin hypopigmentation comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • Another object of the present invention to provide a cosmetic composition for the prevention and / or improvement of melanin hypopigmentation comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • the inventors have found that the peptides consisting of the amino acid sequences of SEQ ID NO: 1 or SEQ ID NO: 2 exhibit excellent hair growth efficacy and melanin production promoting activity, and they prevent or improve hair loss and It was found that it can be usefully used for the prevention and treatment of melanin hypopigmentation.
  • the peptides of the present invention are screened peptides having excellent hair growth efficacy through cell proliferation experiments among peptide libraries possessed by the present inventors, and a total of two kinds are provided as peptides of the present invention.
  • One aspect of the invention relates to a peptide exhibiting hair growth promoting activity comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the peptide may include an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, for example, may be a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the peptides of the present invention can induce modifications at the N-terminus or C-terminus to select some sites of the amino acid sequence and increase their activity.
  • the C-terminal modification may be one in which the C-terminal of the peptide is modified with a hydroxyl group (-OH), an amino group (-NH2), an azide (-NHNH2), and the like, but is not limited thereto.
  • the N-terminal modification is 1 wherein the N-terminal of the peptide is selected from the group consisting of acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG)
  • One or more protecting groups may be combined, but is not limited thereto.
  • the protecting group serves to protect the peptide of the present invention from the attack of protein cleavage enzymes in vivo.
  • the N-terminal and / or C-terminal modification of the peptide acts to greatly improve the stability of the peptide.
  • the peptide of the present invention may have a high half-life by increasing the half-life when administered in vivo.
  • the peptide of the present invention promotes hair follicle cell growth, increases the expression of ⁇ -catenin, a hair growth-related factor, and KGF (Keratinocyte growth factor), a hair growth-related growth factor, and VEGF (Vascular endothelial).
  • KGF Keratinocyte growth factor
  • VEGF Vascular endothelial
  • PI3K Phosphoinositide 3-kinase
  • ERK extracellular signal-regulated kinase
  • MSX2, Ha3-II hair growth related factors
  • the peptides of the present invention have very good efficacy against hair growth. Therefore, the peptide of the present invention can be used for preventing or improving hair loss, promoting hair growth and improving hair growth.
  • compositions for preventing or improving hair loss comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • the peptide of the present invention induces the proliferation of cells in the hair follicle of the skin tissue, which enables the production of hair roots, thereby allowing the production of new hair follicles. Furthermore, it activates the beta-catenin signal to express hair growth promoting genes and increases the expression of growth factors involved in hair growth.
  • Peptides of the present invention serves to promote the growth stage of the hair growth and growth period, due to various environmental factors to show the hair loss inhibitory effect by maintaining the cycle of the hair to the stage of growth, hair in normal hair Nourishes your hair to keep it healthy. Therefore, the composition of the present invention is very effective in preventing and / or improving hair loss.
  • composition of the present invention includes the above-described peptide of the present invention as an active ingredient, the common content between the two is omitted in order to avoid excessive complexity of the present specification.
  • compositions for promoting hair growth and / or hair growth comprising at least one peptide selected from the group consisting of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • composition of the present invention may be prepared as a cosmetic composition, but is not limited thereto.
  • the cosmetic composition may include a cosmetically effective amount of the above-described peptide of the present invention.
  • the cosmetic composition may further include a cosmetically acceptable carrier, but is not limited thereto.
  • Cosmetic compositions of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and / or sprays, and the like, but are not limited to such as, for example, flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream , Cleansing cream, cleansing foam, cleansing water, pack, spray and / or powder.
  • the carrier component may be animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc and / or zinc oxide. May be used, but is not limited thereto.
  • lactose When the formulation of the cosmetic composition is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate and / or polyamide powder may be used, but is not limited thereto.
  • the formulation of the cosmetic composition when the formulation of the cosmetic composition is a spray, it may additionally include propellants such as chlorofluorohydrocarbon, propane / butane and / or dimethyl ether, but is not limited thereto.
  • propellants such as chlorofluorohydrocarbon, propane / butane and / or dimethyl ether, but is not limited thereto.
  • solvents, solubilizers and / or emulsions may be used as carrier components, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, Benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycols and / or fatty acid esters of sorbitan may be used, but are not limited thereto.
  • liquid diluents such as water, ethanol and / or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and / or polyoxyethylene sorbitan ester
  • Suspending agents microcrystalline cellulose, aluminum metahydroxy, bentonite, agar and / or tracant, etc. may be used, but are not limited thereto.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid.
  • Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives and / or ethoxylated glycerol fatty acid esters and the like may be used, but are not limited thereto.
  • Components included in the cosmetic composition of the present invention may include components commonly used in cosmetic compositions, in addition to peptides and carrier components as an active ingredient, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments And / or conventional adjuvants such as flavorings.
  • Another aspect of the invention relates to the use of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 to prevent hair loss and / or improve.
  • Another aspect of the invention relates to the use for promoting hair growth and / or hair growth of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Another aspect of the invention relates to a peptide showing melanin production promoting activity consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the peptide of the present invention increases melanogenesis in melanogenesis cells, increases the expression of tyrosinase, an enzyme that regulates melanin synthesis, and the factors involved in melanogenesis, MITF, TRP1. Increases expression and increases phosphorylation of CREB.
  • the peptide of the present invention has an effect of relieving melanin hypopigmentation by increasing melanogenesis.
  • the peptides of the present invention can be used for the prevention, improvement and / or treatment of melanin hypopigmentation.
  • the melanin hypopigmentation may be vitiligo, albinism, depigmentation nevus, white nasal mucus, rash, post-inflammatory depigmentation, ecchymoses, partial leukemia, idiopathic hypopigmentation and / or dot leukemia, but is not limited thereto. no.
  • Another aspect of the present invention provides a pharmaceutical composition for the prevention and / or treatment of melanin hypopigmentation comprising at least one peptide selected from the group consisting of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient It is about.
  • composition of the present invention when prepared as a pharmaceutical composition, it may include a pharmaceutically effective amount of the peptide of the present invention described above.
  • the pharmaceutical composition may further include a pharmaceutically acceptable carrier, but is not limited thereto.
  • Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and / or mineral oil, and the like.
  • the present invention is not limited thereto.
  • the pharmaceutical composition of the present invention may further include, but is not limited to, a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • composition of the present invention may be administered parenterally, for example by topical skin administration.
  • Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.001-1000 mg / kg.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation can then be in the form of solutions, suspensions and / or emulsions in oils or aqueous media or in the form of extracts, powders, granules, tablets, capsules and / or gels (eg hydrogels), dispersants and / or stables It may further include a topic, but is not limited thereto.
  • Another aspect of the present invention provides a cosmetic composition for the prevention and / or improvement of melanin hypopigmentation comprising at least one peptide selected from the group consisting of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
  • composition of the present invention when prepared as a cosmetic composition, it may include a cosmetically effective amount of the peptide of the present invention described above.
  • the cosmetic composition may further include a cosmetically acceptable carrier, but is not limited thereto.
  • peptide refers to a linear molecule formed by binding amino acid residues to each other by peptide bonds.
  • the peptides of the present invention may be prepared by chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. Ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Pat. No. 5,516,891).
  • stability herein means not only in vivo stability but also storage stability (eg, room temperature storage stability).
  • hair growth promotion means that the hair is produced, it is used in a broad sense to increase the hair production rate and production amount. In addition, it means that the hair root function is enhanced, or the hair dropping and production cycle is shortened, thereby increasing the number of hairs growing in the hair follicles.
  • hair growth or “hair growth” means that the thickness of the generated hair (hair) is increased or the length affects the growth rate.
  • anti-hair loss means that the phenomenon of hair dropout in hair follicles or scalp is prevented or weakened.
  • cosmetic effective amount means an amount sufficient to achieve the efficacy of the composition of the invention described above.
  • the term “pharmaceutically effective amount” means an amount sufficient to achieve the efficacy or activity of the peptides described above.
  • the present invention is a peptide that exhibits hair growth promoting activity and / or melanin production promoting activity, hair loss prevention and / or improvement composition comprising the peptide as an active ingredient, hair growth and / or hair growth promoting composition comprising the peptide as an active ingredient , Preventing and / or improving hair loss of the peptide, promoting hair growth and / or hair growth of the peptide, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and the peptide as an active ingredient.
  • the present invention relates to a composition for preventing and / or improving melanin hypopigmentation, comprising: and preventing, improving and / or treating melanin hypopigmentation of the peptide.
  • the peptide promotes hair follicle cell growth and exhibits an excellent effect on hair growth by increasing the expression of hair growth-related growth factors and hair growth-related factors.
  • the peptides have an excellent effect on melanin production by increasing the activity and expression of tyrosinase and increasing the expression of factors involved in melanogenesis. Due to the excellent activity and stability of the peptide of the present invention described above, the peptide can be very advantageously applied to medicine, quasi-drugs and cosmetics.
  • 1A is a graph showing the growth promoting effect of human hair follicle dermal papilla cells (HHFDPC) of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • HHFDPC human hair follicle dermal papilla cells
  • Figure 1b is a graph showing the effect of promoting the growth of human hair follicle dermal papilla cells (HHFDPC) of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • HHFDPC human hair follicle dermal papilla cells
  • Figure 2a is a figure showing the results confirmed that the expression of ⁇ -catenin is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 2b is a view showing the results confirmed that the expression of ⁇ -catenin is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention
  • Figure 3a is a view showing the result of confirming the increase in the expression of VEGF by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 3b is a view showing the results of confirming the increase in expression of KGF by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 4a is a view showing the result of confirming the increase in ERK phosphorylation by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 4b is a view showing the results confirming the increase in PI3K expression and ERK phosphorylation by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 5 is a view showing the result of confirming the increase in MSX2 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 6a is a photograph showing the results of confirming the inhibition of TGF- ⁇ 1 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 6b is a photograph showing the results of confirming the inhibition of TGF- ⁇ 1 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 7a is a photograph showing the results of confirming the increase in the expression of Bcl-2 and reduced Bax expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 7b is a photograph showing the results of confirming the increased expression of Bcl-2 and reduced Bax expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 8a is a view showing the results of confirming the increase in the expression of Ha3-II and keratin-14 by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 8b is a view showing the result of confirming the increase in the expression of keratin-14 by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 9a shows the results confirming the mRNA expression of DKK-1, a hair growth delay-related factor increased by DHT treatment in human dermal papilla cells by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention Picture.
  • Figure 9b shows the results confirming the mRNA expression of DKK-1, a hair growth delay related factor increased by DHT treatment in human dermal papilla cells by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention Picture.
  • Figure 10a is a view showing the result of confirming the reduction of DKK-1 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 10b is a view showing the result of confirming the decrease in expression of DKK-1 by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 11a is a view showing the result of confirming the effect of increasing the melanin production by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 11b is a view showing the result of confirming the effect of increasing the melanin production by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 12a is a view showing the results confirmed that the activity of tyrosinase is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • 12B is a diagram showing the result of confirming that the activity of tyrosinase is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 13a is a figure showing the result of confirming that the mRNA expression of MITF, tyrosinase is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 13b is a view showing the results confirmed that the mRNA expression of MITF, tyrosinase, TRP1 by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 14a is a diagram showing the result of confirming that the protein expression of MITF and tyrosinase is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 14b is a view showing the results confirmed that the protein expression of MITF and tyrosinase is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • 15 is a view showing the results of confirming the increase in phosphorylation of CREB by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • the present invention relates to a peptide exhibiting hair growth promoting activity and / or melanogenesis promoting activity consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • chloro trityl chloride resin CTL resin, Nova biochem Cat No. 01-64-0021
  • MC methylene chloride
  • DMF dimethylformamide
  • 10 mL of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-Leu-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added thereto, stirred to dissolve well, and reacted with stirring for 1 hour.
  • Thr (tBu) -Leu-CTL Resin was prepared by the same deprotection reaction twice as the deprotection solution. After sufficient washing with DMF and MC, once again Kaiser test was performed, and the following amino acid attachment experiment was performed as above. Based on selected amino acid sequences, Fmoc-Asp (OtBu) -OH, Fmoc-Ala-OH, Fmoc-Ser (tBu) -OH, Fmoc-Arg (Pbf) -OH, Fmoc-Trp-OH, Fmoc-Lys ( Boc) -OH and Fmoc-Trp-OH were chained in order.
  • the Fmoc-protector was reacted twice with a deprotection solution twice for 10 minutes and then washed well.
  • acetic anhydride, DIEA, and HoBt were added to acetylate for one hour
  • the prepared peptidyl resin was washed three times with DMF, MC, and methanol, and dried slowly by flowing nitrogen air, followed by P 2 O 5
  • 30 ml of fugitive solution Trifluroacetic acid 95%, distilled water 2.5%, Thianisole 2.5%), and then shake at room temperature for 2 hours. Maintained.
  • the resin was filtered off and the resin was washed with a small amount of TFA solution and then combined with the mother liquor.
  • Human hair follicle dermal papilla cells were seeded in 96-well plates at a density of 2 ⁇ 10 3 cells / well and cultured overnight. After changing to serum-free medium, the peptides were treated and incubated for 3 days, and 100 mg of 4 mg / ml MTT solution were treated in wells for 4 hours. After the resulting formazan was dissolved through DMSO treatment, the absorbance at 560 nm was measured using a microplate reader, and the results are shown in FIGS. 1A and 1B.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated and cultured for 15 and 30 minutes, and cells were recovered to separate nuclear and cytoplasmic proteins, respectively. Western blotting was performed using a ⁇ -catenin antibody (santacruz biotechnology, USA) to compare ⁇ -catenin expression patterns, and the results are shown in FIGS. 2A and 2B.
  • ⁇ -catenin a hair growth-related factor in human dermal papilla cells was increased by the peptide sequence of SEQ ID NO: 1 or 2 sequence. Increasing ⁇ -catenin expression and activity increases the expression of hair growth related molecules.
  • RNA samples Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantification of RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and primers of KGF and VEGF, followed by electrophoresis on 5% agarose gel to process each sample. Comparison of the mRNA expression level of the growth factors under the conditions, the results are shown in Figures 3a and 3b.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, the peptide was treated and cultured for 15 and 30 minutes, and the cells were recovered to prepare cell lysates. Western blotting was performed using a PI3K antibody (santacruz biotechnology, USA) and a phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression patterns, and the results are shown in FIGS. 4A and 4B.
  • the peptide treatment consisting of the amino acid sequence of SEQ ID NO: 1 increased the ERK phosphorylation level affecting the growth of human dermal papilla cells.
  • the peptide treatment consisting of the amino acid sequence of SEQ ID NO: 1 increased the expression of MSX2, a factor affecting hair shaft elongation in human dermal papilla cells.
  • RNA samples Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantification of RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and TGF- ⁇ 1 primer, followed by electrophoresis on 5% agarose gel in each sample processing condition. Comparison of the mRNA expression level of the growth factors, the results are shown in Figure 6a and 6b.
  • TGF- ⁇ 1 which is one of hair growth inhibitory factors in human dermal papilla cells by the peptide treatment consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, cultured for 24 hours, and cells were recovered to prepare cell lysates. Western blots were performed using Bcl-2 and Bax antibodies (santacruz biotechnology, USA) to compare protein expression patterns, and the results are shown in FIGS. 7A and 7B.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 5 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After RNA quantification, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and Ha3-, keratin-14 primer, followed by electrophoresis on 5% agarose gel. Comparison of mRNA expression levels of the growth factors in the treatment conditions, the results are shown in Figures 8a and 8b.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 5 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantifying RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), and PCR was performed using PCR premix (Intron, Korea) and DKK-1 primer, followed by electrophoresis on 5% agarose gel under each sample treatment condition. Comparison of the mRNA expression level of the growth factors, the results are shown in Figure 9a and 9b.
  • mRNA expression of DKK-1, a hair growth retardation-related factor increased by DHT treatment in human dermal papilla cells by treatment of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is Reduced.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, the peptide was treated, incubated for 24 hours, and the cells were recovered to prepare cell lysates. Western blot was performed using a DKK-1 antibody (santacruz biotechnology, USA) to compare protein expression patterns, and the results are shown in FIGS. 10A and 10B.
  • melanin production was increased in melanocytes by peptide treatment consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Melanoma cell line (B16F10) cells were cultured in 6-well culture plates for 24 hours and treated with concentration-specific peptides for 72 hours. Place 6-well culture plates on ice, wash with cold PBS, add 300 uL of 0.1 M sodium phosphate buffer (pH 6.8, lysis buffer) containing 1% Triton X-100, and collect the cells in a 1.5 mL tube -270 The cell membranes were destroyed by five times of rapid freezing and thawing. After centrifugation at 13,000 rpm for 20 minutes, the supernatant was collected in another 1.5 mL tube and the proteins of the samples were quantified.
  • 0.1 M sodium phosphate buffer pH 6.8, lysis buffer
  • the tyrosinase activity in melanocytes was increased by the peptide treatment consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the present invention is a peptide that exhibits hair growth promoting activity and / or melanin production promoting activity, hair loss prevention and / or improvement composition comprising the peptide as an active ingredient, hair growth and / or hair growth promoting composition comprising the peptide as an active ingredient , Preventing and / or improving hair loss of the peptide, promoting hair growth and / or hair growth of the peptide, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and the peptide as an active ingredient.
  • the present invention relates to a composition for preventing and / or improving melanin hypopigmentation, comprising: and preventing, improving and / or treating melanin hypopigmentation of the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Birds (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물, 상기 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물, 상기 펩타이드의 탈모 방지 및/또는 개선 용도, 상기 펩타이드의 발모 및/또는 육모 촉진 용도, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화자품 조성물 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.

Description

발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
본 발명은 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물, 상기 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물, 상기 펩타이드의 탈모 방지 및/또는 개선 용도, 상기 펩타이드의 발모 및/또는 육모 촉진 용도, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화자품 조성물 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.
모낭은 포유동물 피부의 독특한 기관으로서 원시 표피의 하부가 성장하여 보다 깊은 피부층으로 신장된 기관이다. 모낭의 기부에는 소낭 또는 진피 유두 세포로서 알려진 세포의 플러그가 존재하며(Stenn and Paus, Physiol . Rev., 81: 449 (2002)) 유두는 모낭의 정상적인 순환(Oliver, Embryol . Exp . Morph. 15: 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) 및 모간의 성장에 필수적이다. 모간은 케라틴 필라멘트와 필라멘트 응집 단백질로 충전된 단단하게 밀착된 상피 세포로 제조된 트레드 형상의 구조이다.
인간의 모발은 주기적으로 생장기, 퇴행기, 휴지기를 반복하며 모발이 빠지고 다시 생성되는 과정을 거치게 된다. 모발 주기의 결정은 호르몬 조절이나 많은 성장인자 등의 조절을 통하여 이루어진다. 한편, 모발은 심한 스트레스나 영양 결핍 등에 의해 일찍 퇴행기를 거쳐 휴지기로 접어들어 심한 탈모가 유발될 수 있다(American Journal of Pathology, 162(3)(2003), (Arck, Petra Clara; Handjiski, Bori)).
남성형 대머리에 있어서 두피의 전면 및 상부의 모낭은 안드로겐에 대해 감수성을 나타낸다. 그래서 남성형 대머리의 경우, 모낭의 파괴보다는 모낭의 소형화에 해당되는데 남성 호르몬인 안드로겐의 과도한 분비가 원인이다. 안드로겐 과다 분비로 인해 5-알파 환원효소가 활성화되어 테스토스테론이 디하이드로테스토스테론(dihydrotestosterone,DHT)으로 변형되며, 이렇게 생성된 디하이드로테스토스테론은 모발이 자라는 기간을 단축시키고, 모낭을 소형화시켜 굵고 튼튼한 성모의 수를 감소시킴으로써 탈모를 유발시킨다.
일반적으로 나이가 들어감에 따라 탈모가 확산된다. 예를 들면, 흉터 탈모증, 화상 또는 압박 상해와 관련된 흉터 형성 상태와 같은 상이한 질환 상태가 현저한 탈모를 일으킬 수 있다. 이런 탈모현상을 치료하기 위해 지금까지는 의약품으로 여러 가지 물질 등이 사용되어 왔으나 가격이 너무 비싸고, 여러 가지 부작용들이 유발된다.
또한, 이런 의약품들은 지속적인 사용을 필요로 하며 사용을 중단하였을 때에는 다시 탈모가 유발되고 효능에 대한 개개인의 차이가 심하며, 부작용도 개개인 마다 차이가 난다는 단점이 있다.
그 외 화장품으로 이용되고 있는 원료들은 가격이 저렴하다는 장점이 있지만, 식물 추출물 유래 성분들로 구성되어 있기 때문에 실제 그 효능은 크지 않다는 단점이 있다. 따라서 효과적이면서 비용적인 측면에서도 보다 경제적인 새로운 유효성분에 대한 요구가 당업계에 대두하고 있다.
지금까지 알려진 2가지 이용 가능한 약물(미녹시딜 및 피나스테라이드)은 추가 탈모를 지연시킬 수는 있지만, 새로운 모낭의 재생을 유도하지는 못했다. 또한, 두발 화장품 중에서 식물 추출물 등을 이용한 탈모방지 제품이 많이 출시되다.
예를 들어, 고삼, 고추, 당약, 상백피, 상엽, 임삼, 감초, 작약, 지황, 회향, 산수유, 마늘등의 추출물을 함유한 제품, 크산틴 및 성장호르몬을 함유하는 조성물을 첨가하여 디하이드로테스토스테론의 과잉에 따른 세포 대사 억제를 개선함과 동시에 성장 호르몬이 모발성장을 촉진함으로써 탈모방지 및 모발을 재생하여 모발성장 촉진 효과를 나타내는 제품, 발모 및 모발의 성장을 촉진하기 위해 미네랄 및 비타민류, 녹차, 로즈마리, 쑥, 감초 추출액을 함유한 제품을 개발하여 두피와 모발에 영양을 공급하며 탈모의 예방 및 모발 성장 촉진에 효과가 있는 발모 촉진용 제품, 비타민 B, 비타민 C, 비타민 D, 비타민 E, 니코틴산, 판토텐산, 비오틴 및 엽산 등의 물질과 식물추출물을 혼합하여 인체 내의 5-알파 환원효소를 억제하여 남성호르몬의 대사과정에서 디하이드로테스토스테론이 형성되지 않도록 하며 머리카락의 신진대사작용을 돕는 남성형 탈모제품들이 개발되었으나 신생모발의 생성까지 영향을 미치는 제품은 찾기 어려웠다.
피부 세포는 자외선이나 환경오염, 그 밖의 외부 요인의 자극에 대해 방어기전으로 표피기저층에 존재하는 멜라닌 세포(melanocyte)의 멜라닌소체(melanosome)에서 멜라닌을 생성한다. 멜라닌은 동물들의 피부, 눈동자, 머리카락의 색을 결정하는 중요한 요인이다. 저색소증은 피부암의 위험인자로도 알려졌다.
동양인들은 멜라닌이 과다로 생성되는 것에 민감하여 멜라닌 생성을 억제하는 미백관련이 연구가 많이 수행되었다. 하지만, 최근에는 멜라닌 생성이 억제되어 나타나는 백반증(Vitiligo)에 대한 요구도 증가하고 있어 이에 대한 연구도 진행되고 있다.
백반증은 멜라닌 세포의 사멸이나 괴사로 인한 여러 가지 크기 및 형태의 백색반이 피부에 나타나는 후천성 탈색소 질환이다. 전 세계적으로 인구의 약 1%에서 나타나는 비교적 흔한 질환으로, 인종이나 지역에 따른 차이는 없다. 발생 연령은 10~30세에 가장 많고, 95%의 경우 40세 이전에 발병하고, 환자의 30%에서 가족력이 있다.
백반증이 생기는 원인에 대해서 아직 정확히 밝혀진 바는 없으나, 자가 면역설, 신경체액설, 멜라닌 세포 자가 파괴설 등 여러 가지 설이 제시되고 있다. 자가 면역설은 멜라닌 세포계 항원에 대한 자가 항체의 발현으로 멜라닌 세포의 파괴 또는 기능 이상이 초래되거나 세포 독성 림프구나 활성화된 림프구가 분비한 림포카인에 멜라닌 세포가 파괴된다는 설이다. 신경체액설은 카테콜아민 생합성의 이상과 모노아민 산화효소의 증가 등으로 인하여 스트레스와 관련된 과산화수소가 만들어지고 이로 인해 멜라닌 세포가 파괴된다는 설로, 백반증이 신경절을 따라 발생하거나 신경 손상이나 스트레스 후에 발병할 수도 있다. 멜라닌 세포 자가 파괴설은 멜라닌 형성 과정에서 생기는 중간대사 물질이나 최종대사 물질인 페놀 복합체가 멜라닌 세포 내에 축척되어 세포를 파괴한다는 설이다. 그 외 고유세포 결손(inherent cellular defect), 유전요인, 세포사멸, 칼슘 대사 이상 등의 다양한 인자들이 제시되고 있다.
멜라닌은 멜라닌 생성세포(melanocytes)로부터 합성되고 자외선 조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 그러므로 멜라닌 합성이 정상적으로 일어나지 않는 사람들에게서는 모든 피부가 백색으로 되기보다는 부분적으로 백색으로 변해 얼룩이 생기는 외형적인 문제점도 있고 외부 자극에 민감해지는 것이 더 문제이다.
멜라닌 합성에 중요한 효소인 티로시나아제(tyrosinase)와 TRP-1(tyrosinase related protein-1), TRP-2(tyrosinase related protein-2)는 산화적 반응에 촉매로 작용한다(Pigment Cell Res. 14 (6): 43744).
티로시나아제는 티로신(tyrosine)을 DOPA(L-3,4-dihydroxyphenylalanine)로, DOPA를 DOPA 퀴논(quinone)으로 산화시키는 작용을 하고, TRP-1은 디히드록시인돌 카복실산 옥시다제(dihydroxyindole carboxylic acid oxidase)로서 5,6-디히드록시인돌-2-카복실산(5,6-dihydroxyindole-2-carboxylic acid; DHICA)를 인돌-5,6-퀴논-2-카복실산(indol-5,6-quinone-2-carboxylic acid)으로 변화시키는데 관여한다.
TRP-1은 티로시나아제를 안정화시키고 활성을 조절하는 역할을 한하며, TRP-2는 DOPA 크롬 타우토머라아제로써 DOPA 크롬을 DHICA로 변화시켜 멜라닌 세포를 이루는 유멜라논(eumelanon)과 페오멜라논(pheomelanon)을 형성하고 이들의 비율에 따라 피부, 머리카락, 눈동자의 색깔 등이 결정된다.
멜라닌 합성은 자외선 조사와 MSH(α-melanocyte stimulating hormone)로 인해 활성화된다. α-MSH는 펩타이드 호르몬으로 자외선에 의해 생성되며 뇌하수체 및 피부를 포함한 여러 세포에서 만들어지는 것으로 알려져 있다.
α-MSH는 측분비(paracrine)에 의해 멜라닌 생성세포의 MCR(melanocortin receptor)에 작용하여 전사인자인 MITF(microphthalmia-associated transcription factor)의 활성을 조절하여 멜라닌 합성에 중요한 역할을 하는 티로시나아제, TRP-1(DHICA oxidase), TRP-2(DOPAchrome tautomerase) 등의 활성을 조절한다(THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July 31, pp. 195609565, 1998).
멜라닌 형성세포가 UV 또는 α-MSH에 의해서 자극이 되면 각각 p38이나 PKA(protein kinase A)에 의해서 티로시나아제가 활성화된다고 보고되었다. 그런데 이 두 가지 경로 중 특히 α-MSH -> cAMP -> PKA 과정이 멜라닌 합성에 중요한 역할을 하는데, cAMP의 증가는 CREB(cAMP-responsive element binding protein) 인산화를 촉진시키고 이것이 전사인자인 MITF의 발현을 증가시키고, 이것은 티로시나아제의 활성을 향상시키며, 티로시나아제 mRNA 발현을 증가시킨다는 보고들이 있다(Nucleic Acids Res. 30 (14): 3096106, Pigment Cell Melanoma Res 21 (6): 66576).
한편, 우리나라를 비롯한 동양인들은 누구나 하얀 피부색을 가지기를 원하기 때문에 멜라닌 생성을 억제하는 미백 성분에 대한 연구를 많이 수행해 왔다. 그러나 멜라닌은 피부의 멜라닌 생성세포로부터 합성되며 자외선조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 멜라닌의 정상적인 합성이 나타나지 않는 경우는 피부가 외부 자극에 민감하고 외형적으로도 비정상적으로 보이므로 멜라닌 합성이 정상화될 수 있도록 치료하는 것이 필요하고 이에 대한 연구도 수행된 것들이 있다. 그러나 아직까지 멜라닌 합성을 촉진시키는 것에 대한 기술 개발이 충분히 수행되지 않았다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 노력한 결과, 서열목록 제1서열 또는 제2서열의 아미노산 서열을 갖는 펩타이드가 우수한 발모 효능 및 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고 이들이 탈모 방지 또는 개선 및 멜라닌 저색소증의 예방 및 치료에 유용하게 사용될 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물을 제공하는 것이다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 노력한 결과, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드가 우수한 발모 효능 및 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고 이들이 탈모 방지 또는 개선 및 멜라닌 저색소증의 예방 및 치료에 유용하게 사용될 수 있음을 규명하였다.
본 발명의 펩타이드는 본 발명자들이 보유하고 있는 펩타이드 라이브러리 가운데 세포 증식 실험을 통해 발모 효능이 우수한 펩타이드를 스크리닝한 것으로써, 총 2종이 본 발명의 펩타이드로 제공된다.
본 발명의 일 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하는 발모 촉진 활성을 나타내는 펩타이드에 관한 것이다.
상기 펩타이드는 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하는 것일 수 있으며, 예를 들어, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드인 것일 수 있다.
본 발명의 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 또는 C-말단에 변형을 유도할 수 있다.
예를 들어, 상기 C-말단 변형은 펩타이드의 C-말단이 히드록시기(-OH), 아미노기(-NH2), 아자이드(-NHNH2) 등으로 변형되는 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 N-말단 변형은 펩타이드의 N-말단이 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 및 폴리에틸렌글리콜(PEG)로 구성된 군으로부터 선택된 1종 이상의 보호기가 결합되는 것일 수 있으나, 이에 한정되는 것은 아니다. 상기 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.
상기 펩타이드의 N-말단 및/또는 C-말단 변형은 펩타이드의 안정성을 크게 개선하는 작용을 하며, 이러한 변형을 통해 본 발명의 펩타이드는 생체 내 투여시의 반감기를 증가시켜 높은 반감기를 가질 수 있다.
본 발명의 일 양태에 따르면, 본 발명의 펩타이드는 모낭 세포 성장을 촉진하며, 모발 성장 관련 인자인 β-카테닌의 발현을 증가시키고, 발모 관련 성장인자인 KGF(Keratinocyte growth factor), VEGF(Vascular endothelial growth factor)의 발현을 증가시키며, 발모 시그널링 분자인 PI3K(Phosphoinositide 3-kinase)의 발현을 증가시키고, ERK(extracellular signal-regulated kinase)의 인산화를 증가시키며, 모발 성장 관련 인자인 MSX2, Ha3-Ⅱ 및 카라틴-14의 발현을 증가시키고, 모발 성장 지연과 관련된 TGF-β1 및 DKK-1의 발현을 감소시키며, 세포 사멸 억제 단백질인 Bcl-2의 발현 증가 및 세포 사멸 관련 단백질인 Bax의 발현 감소를 유도한다.
이러한 결과는 본 발명의 펩타이드가 발모에 대하여 매우 우수한 효능을 가진다는 것을 의미한다. 따라서 본 발명의 펩타이드는 탈모 방지 또는 개선, 발모 촉진 및 모발 성장 개선용도로 이용될 수 있다.
본 발명의 다른 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물에 관한 것이다.
본 발명의 펩타이드는 모근을 생성할 수 있게 하는 피부조직의 머리카락 난포(hair follicle)에 있는 세포의 증식을 유도하여 새로운 모낭이 생성할 수 있게 한다. 더욱이 β-카테닌(beta-catenin)의 시그널을 활성화 시켜 발모 촉진 유전자를 발현시키며, 발모에 관여하는 성장인자들의 발현을 증가시킨다.
본 발명의 펩타이드는 모발이 생성되고 성장되는 시기인 생장기를 촉진시키는 역할을 하며, 여러 가지 환경적인 요인으로 인해 퇴행기로 가는 모발의 주기를 생장기에 유지하도록 함으로써 탈모억제 효과를 나타내고, 정상 모발에서는 모발에 영양분을 공급하여 모발 건강을 유지할 수 있도록 한다. 따라서, 본 발명의 조성물은 탈모 방지 및/또는 개선에 매우 효과적이다.
본 발명의 조성물은 상술한 본 발명의 펩타이드를 유효성분으로 포함하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물에 관한 것이다.
본 발명의 조성물은 화장품 조성물로 제조될 수 있으나, 이에 한정되는 것은아니다.
상기 화장품 조성물은 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount)을 포함하는 것일 수 있다.
또한, 상기 화장품 조성물은 화장품학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및/또는 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니며, 예를 들어, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 및/또는 파우더의 제형으로 제조될 수 있다.
상기 화장품 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 및/또는 산화아연 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 및/또는 폴리아미드 파우더가 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 및/또는 디메틸 에테르와 같은 추진체를 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 및/또는 유탁화제가 이용될 수 있으며, 예를 들어, 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 및/또는 소르비탄의 지방산 에스테르가 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 및/또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및/또는 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 및/또는 트라칸트 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 및/또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 화장품 조성물에 포함되는 성분은 유효성분으로서의 펩타이드류와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및/또는 향료와 같은 통상적인 보조제를 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 일 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 탈모 방지 및/또는 개선 용도에 관한 것이다.
상기 펩타이드는 상술한 펩타이드와 동일하기 때문에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 일 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 발모 및/또는 육모 촉진 용도에 관한 것이다.
상기 펩타이드는 상술한 펩타이드와 동일하기 때문에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 일 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 멜라닌 생성 촉진 활성을 나타내는 펩타이드에 관한 것이다.
본 발명의 일 양태에 따르면, 본 발명의 펩타이드는 멜라닌 형성 세포에서 멜라닌 생성을 증가시키며, 멜라닌 합성을 조절하는 효소인 티로시나아제의 발현을 증가시키고, 멜라닌 형성에 관여하는 인자인 MITF, TRP1의 발현을 증가시키며, CREB의 인산화를 증가시킨다.
이러한 결과는 본 발명의 펩타이드가 멜라닌 생성을 증가시킴으로써 멜라닌 저색소증이 완화되도록 하는 효과를 가진다는 것을 의미한다. 따라서 본 발명의 펩타이드는 멜라닌 저색소증의 예방, 개선 및/또는 치료 용도로 이용될 수 있다.
상기 멜라닌 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 및/또는 점상 백피증인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 치료용 약제학적 조성물에 관한 것이다.
본 발명의 조성물이 약제학적 조성물로 제조될 경우, 상술한 본 발명의 펩타이드의 약제학적 유효량(pharmaceutically effective amount)을 포함하는 것일 수 있다.
또한, 상기 약제학적 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및/또는 미네랄 오일 등을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 비경구로 투여하는 것일 수 있으며, 예를 들어, 피부 국소 투여에 의해 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.001-1000 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 및/또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 및/또는 젤(예들 들어, 하이드로젤) 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 서열번호 1 또는 서열번호 2로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물을 제공한다.
본 발명의 조성물이 화장품 조성물로 제조될 경우, 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount)을 포함하는 것일 수 있다.
또한, 상기 화장품 조성물은 화장품학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 “펩타이드”는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
본 명세서에서 용어 “안정성”은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명에서 “발모 촉진”은 모발이 생성되는 것을 의미하며, 모발 생성 속도 및 생성량을 증가시키는 넓은 의미로 사용된다. 또한, 모근 기능이 강화되거나, 모발의 탈락 및 생성 주기가 짧아져 모낭에서 자라는 모발의 수가 증가되는 것을 의미한다.
본 발명에 있어서, “모발 성장” 또는 “육모”는 생성된 모발(머리카락)의 굵기가 증가되거나 길이 자람 속도에 영향을 미치는 것을 의미한다.
본 발명에 있어서, “탈모 방지”는 모낭 또는 두피에서 모발이 탈락되는 현상이 저지되거나 약화되는 것을 의미한다.
본 명세서에서 용어 “화장품학적 유효량”은 상술한 본 발명의 조성물의 효능을 달성하는 데 충분한 양을 의미한다.
본 명세서에서 용어 “약제학적 유효량”은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.
본 발명은 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물, 상기 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물, 상기 펩타이드의 탈모 방지 및/또는 개선 용도, 상기 펩타이드의 발모 및/또는 육모 촉진 용도, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화자품 조성물 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다. 상기 펩타이드는 모낭 세포 성장을 촉진하며, 발모 관련 성장인자 및 발모 관련 인자들의 발현을 증가시킴으로써 발모에 우수한 효과를 나타낸다. 또한, 상기 펩타이드는 티로시나아제의 활성 및 발현을 증가시키고, 멜라닌 형성에 관여하는 인자들의 발현을 증가시킴으로써 멜라닌 생성에 있어서 우수한 효과를 나타낸다. 상술한 본 발명의 펩타이드의 우수한 활성 및 안정성에 의해 상기 펩타이드는 의약, 의약외품 및 화장품에 매우 유리하게 적용될 수 있다.
도 1a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 1b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 2a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 β-카테닌의 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 2b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의해 β-카테닌의 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다
도 3a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 VEGF의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 3b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 KGF의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 4a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 ERK 인산화 증가를 확인한 결과를 보여주는 그림이다.
도 4b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 PI3K 발현 증가 및 ERK 인산화 증가를 확인한 결과를 보여주는 그림이다.
도 5는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 MSX2 발현 증가를 확인한 결과를 보여주는 그림이다.
도 6a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 TGF-β1 발현 억제를 확인한 결과를 보여주는 사진이다.
도 6b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 TGF-β1 발현 억제를 확인한 결과를 보여주는 사진이다.
도 7a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 Bcl-2의 발현 증가 및 Bax의 발현 감소를 확인한 결과를 보여주는 사진이다.
도 7b는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의한 Bcl-2의 발현 증가 및 Bax의 발현 감소를 확인한 결과를 보여주는 사진이다.
도 8a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 Ha3-Ⅱ 및 케라틴-14의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 8b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 케라틴-14의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 9a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 인간 모유두 세포에서 DHT 처리에 의해 증가된 모발 성장 지연 관련 인자인 DKK-1의 mRNA 발현 감소를 확인한 결과를 보여주는 그림이다.
도 9b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 인간 모유두 세포에서 DHT 처리에 의해 증가된 모발 성장 지연 관련 인자인 DKK-1의 mRNA 발현 감소를 확인한 결과를 보여주는 그림이다.
도 10a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 DKK-1의 발현 감소를 확인한 결과를 보여주는 그림이다.
도 10b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 DKK-1의 발현 감소를 확인한 결과를 보여주는 그림이다.
도 11a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 멜라닌 생성 증가 효과를 확인한 결과를 보여주는 그림이다.
도 11b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 멜라닌 생성 증가 효과를 확인한 결과를 보여주는 그림이다.
도 12a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 티로시나아제의 활성이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 12b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의해 티로시나아제의 활성이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 13a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 MITF, 티로시나아제의 mRNA 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 13b는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 MITF, 티로시나아제, TRP1의 mRNA 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 14a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 MITF 및 티로시나아제의 단백질 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 14b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의해 MITF 및 티로시나아제의 단백질 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 15는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 CREB의 인산화 증가를 확인한 결과를 보여주는 그림이다.
서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드에 관한 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
합성예 1: 펩타이드의 합성
클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTL resin, Nova biochem Cat No. 01-64-0021) 700 mg을 반응용기에 넣고 메틸렌 클로라이드(MC) 10 ㎖를 가하여 3분간 교반하였다. 용액을 제거하고 디메틸포름 아마이드(DMF) 10 ㎖를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 반응기에 10 ㎖의 디클로로메탄용액을 넣고 Fmoc-Leu-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 반응 후 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 용액을 제거하고 디메틸포름 아마이드(DMF)를 10 ㎖ 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 10㎖를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Leu-CTL Resin을 제조하였다. 새로운 반응기에 10 ㎖의 DMF 용액을 넣고 Fmoc-Thr(tBu)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 Bop 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Thr(tBu)-Leu-CTL Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Asp(OtBu)-OH, Fmoc-Ala-OH, Fmoc-Ser(tBu)-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH 및 Fmoc-Trp-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 무수초산과 DIEA, HoBt를 넣어 한 시간 동안 아세틸화를 수행한 뒤 제조된 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 95%, 증류수 2.5%, 티오아니졸(Thioanisole) 2.5%] 30 ㎖을 넣은 후 상온에서 가끔 흔들어주며 2시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 감압을 이용하여 전체 볼륨이 절반 정도 남도록 증류하고 50 ㎖의 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 서열번호 1(Trp-Lys-Trp-Arg-Ser-Ala-Asp-Thr-Leu)의 아미노산으로 이루어진 펩타이드를 0.73 g 합성하였다(수율: 93.1%). 분자량 측정기를 이용하여 측정시 분자량 1162.3 (이론값: 1162.3)를 얻을 수 있었다. 다른 서열번호 2(Lys-Trp-Lys-Arg-Ser-Ala-Asp-Thr-Leu)의 아미노산으로 이루어진 펩타이드도 위와 같은 방법으로 합성을 진행하였다.
서열번호 서열목록 (5'->3') 분석값(질량분석기)
분석치 이론치
1 Trp-Lys-Trp-Arg-Ser-Ala-Asp-Thr-Leu 1162.3 1162.3
2 Lys-Trp-Lys-Arg-Ser-Ala-Asp-Thr-Leu 1104.2 1104.26
실시예 1: DPC 증식 어세이
인간 모유두 세포(Human hair follicle dermal papilla cells)를 2x103 세포/웰의 밀도로 96-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 3일간 배양하고 4 mg/ml MTT 용액을 100 ul씩 웰에 처리하여 4시간 반응시켰다. 생성된 포마잔을 DMSO 처리를 통해 녹여낸 후 마이크로플레이트 리더를 사용하여 560 nm에서의 흡광도를 측정하여, 그 결과를 도 1a 및 도 1b에 나타내었다.
도 1a 및 도 1b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포의 성장이 농도 의존적으로 촉진되는 것을 확인하였다.
실시예 2: β- 카테닌 활성 시험
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 핵과 세포질 단백질을 각각 분리하였다. β-카테닌 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 β-카테닌 발현 양상을 비교하여, 그 결과를 도 2a 및 도 2b에 나타내었다.
도 2a 및 도 2b에서 확인할 수 있듯이, 인간 모유두 세포에서 모발 성장 관련 인자인 β-카테닌의 발현이 서열목록 제1서열 또는 제2서열 펩타이드 처리에 의해 증가되었다. β-카테닌 발현 증가 및 활성은 모발 성장 관련 분자의 발현을 증가시킨다.
실시예 3: KGF, VEGF RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 KGF, VEGF 각각의 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 3a 및 도 3b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
3 KGF_F TCTGTCGAACACAGTGGTACCT
4 KGF_R GTGTGTCCATTTAGCTGATGCAT
5 VEGF_F CCATGAACTTTCTGCTGTCTT
6 VEGF_R TCGATCGTTCTGTATCAGTCT
도 3a에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포의 성장에 영향을 주는 VEGF의 발현이 증가되는 것을 확인하였다.
또한, 도 3b에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포의 성장에 영향을 주는 인자인 KGF의 발현이 증가되는 것을 확인하였다.
실시예 4: PI3K & p-ERK WB
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 세포 용해물을 준비하였다. PI3K 항체(santacruz biotechnology, USA) 및 phospho-ERK 항체(Cell Signaling Technology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 단백질 발현 양상을 비교하여, 그 결과를 도 4a 및 도 4b에 나타내었다.
도 4a에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포의 성장에 영향을 주는 ERK 인산화 레벨이 증가되었다.
또한, 도 4b에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 시그널링 분자인 PI3K의 발현 증가 및 ERK 인산화 레벨 증가가 관찰되었다.
실시예 5: MSX2 RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 MSX2 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 5에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
7 MSX2_F AACACAAGACCAACCGGAAG
8 MSX2_R GCAGCCATTTTCAGCTTTTC
도 5에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모간(hair shaft) 신장(elongation)에 영향을 주는 인자인 MSX2의 발현이 증가되었다.
실시예 6: TGF-β1 RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 TGF-β1 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 6a 및 도 6b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
9 TGF-β1_F GCCCTGGATACCAACTATTGC
10 TGF-β1_R TCAGCACTTGCAGGAGTAGCG
도 6a 및 도 6b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 억제 인자 중 하나인 TGF-β1의 발현이 억제되는 것을 확인하였다.
실시예 7: Bcl -2/ Bax WB
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 배양하고 세포를 회수하여 세포 용해물을 준비하였다. Bcl-2 및 Bax 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯을 수행하여 단백질 발현 양상을 비교하여, 그 결과를 도 7a 및 도 7b에 나타내었다.
도 7a 및 도 7b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 항-세포사멸 단백질인 Bcl-2의 발현이 증가되었고, 세포 사멸 관련 단백질인 Bax의 발현이 감소되었다.
실시예 8: Ha3 - 및 케라틴-14 RT- PCR
인간 모유두 세포를 5x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 Ha3-, 케라틴-14 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 8a 및 도 8b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
11 Ha3-II_F CAGAAGTATAGCAGTAAGACAG
12 Ha3-II_R CAAGAGGAAAGTTTATTAGGC
13 Keratin-14_F CCACCTTTCATCTTCCCAATTCTC
14 Keratin-14_R GTGCGGATCTGGCGGTTG
도 8a에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 관련 인자인 Ha3- 및 케라틴-14의 mRNA 발현이 증가되는 것을 확인하였다.
또한, 도 8b에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 케라틴-14의 mRNA 발현이 증가되는 것을 확인하였다.
실시예 9: DKK-1 RT-PCR
인간 모유두 세포를 5x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 DKK-1 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 9a 및 도 9b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
15 DKK-1_F TGATGAGTACTGCGCTAGTC
16 DKK-1_R CTCCTATGCTTGGTACACAC
도 9a 및 도 9b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 처리에 의해 인간 모유두 세포에서 DHT 처리에 의해 증가된 모발 성장 지연 관련 인자인 DKK-1의 mRNA 발현이 감소되었다.
실시예 10: DKK-1 WB
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 세포 용해물을 준비하였다. DKK-1 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯을 수행하여 단백질 발현 양상을 비교하여, 그 결과를 도 10a 및 도 10b에 나타내었다.
도 10a 및 도 10b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 처리에 의해 인간 모유두 세포에서 DHT 처리에 의해 증가된 모발 성장 지연 관련 인자인 DKK-1의 단백질 발현이 감소되었다.
실시예 11: 멜라닌 측정 어세이
6-웰 배양용 평판에 멜라닌형성 세포(B16F10 cell line)를 37 배양기에서 24시간 배양한 후, 각 판의 배지를 제거하고 새로운 배지로 교체 후 본 펩타이드를 농도 별로 처리하였다. 72시간 동안 배양한 후 배양액을 제거하고 세포를 떼어 낸 뒤 1.5 ml 튜브로 옮겨 13,000rpm에서 3분간 원심분리 하여 상층액을 제거하고, 세포 펠렛을 회수하여 멜라닌을 관찰하였다. 세포 펠렛을 2 M NaOH 150 ul씩 넣어 60에서 30분 동안 세포 내 멜라닌을 용해시켰다. 96-웰 평판 각 웰에 용해시켜 얻은 상층액을 100 ul씩 넣어 490 nm에서 흡광도를 측정하여, 그 결과를 도 11a 및 도 11b에 나타내었다.
도 11a 및 도 11b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 멜라닌 세포에서 멜라닌 생성이 증가되었다.
실시예 12: 티로시나아제 활성 시험
흑색종 세포주(B16F10) 세포를 6-웰 배양용 평판에 24시간 배양하고 농도별 펩타이드를 처리하여 72시간 배양하였다. 얼음 위에 6-웰 배양용 평판을 올리고 차가운 PBS으로 세척한 후 1% Triton X-100이 함유된 0.1 M 인산나트륨 버퍼(pH 6.8, 용해 버퍼)를 300 uL 넣고 세포를 1.5 mL 튜브에 모아 -270에 급속 냉동시킨 후 해동시키는 반응을 5번 반복하여 세포막을 파괴하였다. 13,000 rpm에서 20분간 원심분리 한 후 상층액을 다른 1.5 mL 튜브에 모으고 이 시료들의 단백질을 정량하였다. 시료들의 단백질 농도가 같은 농도가 되게 희석하여 96-웰 배양용 평판에 3개 웰씩 분주하고 10 mM L-dopa 20 uL를 첨가하여 37에서 1시간 배양 후 475 nm에서 흡광도를 측정하여, 그 결과를 도 12a 및 도 12b에 나타내었다.
도 12a 및 도 12b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 멜라닌 세포 내 티로시나아제 활성이 증가되었다.
실시예 13: 멜라닌 생성 관련 유전자 RT-PCR
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 24시간 배양 후 펩타이드를 농도별로 처리하였다. 72시간 동안 배양된 세포의 RNA 추출 후 cDNA를 제작하였다. 멜라닌 형성에 관여하는 인자인 MITF 및 티로시나아제에 대한 각각의 특이적인 프라이머를 이용하여 PCR 하여 각 유전자의 발현 변화를 관찰하여, 그 결과를 도 13a 및 도 13b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
17 MITF_F CCAGCCTGGCGATCATGTCAT
18 MITF_R GGTCTGGACAGGAGTTGCTG
19 tyrosinase_F GGCCAGCTTTCAGGCAGAGG
20 tyrosinase_R TGGTGCTTCATGGGCAAAAT
21 TRP1_F TCTGTGAAGGTGTGCAGGAG
22 TRP1_R CCGAAACAGAGTGGAAGGTT
도 13a에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 멜라닌 세포에 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF 및 효소인 티로시나아제의 mRNA 발현이 증가되었다.
또한, 도 13b에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 멜라닌 세포에 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF 및 효소인 티로시나아제, TRP1의 mRNA 발현이 증가되었다.
실시예 14: 멜라닌 생성 관련 단백질 웨스턴 블롯팅
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 24시간 배양 후, 본 펩타이드를 농도별로 처리하였다. 72시간 동안 배양한 후 세포를 용해하여 멜라닌 형성에 관여하는 인자인 MITF 및 티로시나아제의 발현을 특이적인 항체(2종류 모두 Santacruz biotechnology, USA)를 이용하여 웨스턴 블롯으로 확인하여, 그 결과를 도 14에 나타내었다.
도 14a 및 도 14b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 멜라닌 세포에 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF 및 효소인 티로시나아제의 단백질 발현이 증가되었다.
실시예 15: 멜라닌 생성 관련 단백질 활성 시험
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 24시간 배양 후, 본 펩타이드를 농도별로 처리하였다. 72시간 동안 세포를 배양한 후 세포를 용해하여 멜라닌 형성에 관여하는 신호전달 물질인 CREB의 인산화 정도를 특이적인 항체(cell Signaling Technology, USA)를 이용하여 웨스턴 블롯으로 확인하였다.
도 15에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 멜라닌 세포에 처리 시 멜라닌 형성 과정에 관여하는 인자인 CREB의 인산화 레벨이 증가되었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물, 상기 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물, 상기 펩타이드의 탈모 방지 및/또는 개선 용도, 상기 펩타이드의 발모 및/또는 육모 촉진 용도, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화자품 조성물 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.

Claims (19)

  1. 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드.
  2. 제1항에 있어서, 상기 펩타이드는 모낭 세포 성장을 촉진하는 것을 특징으로 하는 펩타이드.
  3. 제1항에 있어서, 상기 펩타이드는 β-카테닌 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  4. 제1항에 있어서, 상기 펩타이드는 KGF(Keratinocyte Growth Factor) 및 VEGF(Vascular endothelial growth factor)로 이루어진 군으로부터 선택되는 발모 관련 성장인자의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  5. 제1항에 있어서, 상기 펩타이드는 PI3K(Phosphoinositide 3-kinase)의 발현 및 ERK(Extracellular Signal-regulated Kinase) 인산화를 증가시키는 것을 특징으로 하는 펩타이드.
  6. 제1항에 있어서, 상기 펩타이드는 MSX2(Msh homeobox 2), Ha3-(Keratin, type I cuticular Ha3-Ⅱ) 및 케라틴-14로 이루어진 군으로부터 선택되는 발모 관련 인자의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  7. 제1항에 있어서, 상기 펩타이드는 TGF-β1(transforming growth factor beta 1) 및 DKK-1((Dickkopf WNT Signaling Pathway Inhibitor 1)로 이루어진 군으로부터 선택되는 모발 성장 지연 인자의 발현을 감소시키는 것을 특징으로 하는 펩타이드.
  8. 제1항에 있어서, 상기 펩타이드는 Bcl-2(B-cell lymphoma 2)의 발현을 증가시키고 Bax(BCL2-associated X protein)의 발현을 감소시키는 것을 특징으로 하는 펩타이드.
  9. 서열번호 1 또는 서열번호 2의 아미노산으로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물.
  10. 서열번호 1 또는 서열번호 2의 아미노산으로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 발모 또는 육모 촉진용 조성물.
  11. 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 멜라닌 생성 촉진 활성을 나타내는 펩타이드.
  12. 제11항에 있어서, 상기 펩타이드는 티로시나아제(tyrosinase)의 활성을 증가시키는 것을 특징으로 하는 펩타이드.
  13. 제11항에 있어서, 상기 펩타이드는 MITF(Microphthalmia-associated transcription factor) 및 TRP1(Tyrosinase-related protein 1)로 이루어진 군으로부터 선택되는 멜라닌 합성 관련 인자의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  14. 제11항에 있어서, 상기 펩타이드는 티로시나아제의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  15. 제11항에 있어서, 상기 펩타이드는 CREB(cAMP response element-binding protein)의 인산화를 증가시키는 것을 특징으로 하는 펩타이드.
  16. 서열번호 1 또는 서열번호 2로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물.
  17. 제16항에 있어서, 상기 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 또는 점상 백피증인 것을 특징으로 하는 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물.
  18. 서열번호 1 또는 서열번호 2로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 개선용 화장품 조성물.
  19. 제18항에 있어서, 상기 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 또는 점상 백피증인 것을 특징으로 하는 멜라닌 저색소증의 개선용 화장품 조성물.
PCT/KR2017/001650 2016-02-18 2017-02-15 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 WO2017142305A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US15/999,760 US10508140B2 (en) 2016-02-18 2017-02-15 Peptide having hair growth-promoting activity and/or melanin generation-promoting activity, and use thereof
JP2018560421A JP6581735B2 (ja) 2016-02-18 2017-02-15 発毛促進活性及び／又はメラニン生成促進活性を示すペプチド及びその用途
CN201780011256.4A CN108633279B (zh) 2016-02-18 2017-02-15 呈现生发和/或育发促进活性的肽及其的用途
ES17753466T ES2980830T3 (es) 2016-02-18 2017-02-15 Péptido que tiene actividad promotora del crecimiento del cabello y/o actividad promotora de la generación de melanina, y su uso
EP17753466.6A EP3418293B1 (en) 2016-02-18 2017-02-15 Peptide having hair growth-promoting activity and/or melanin generation-promoting activity, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0019322 2016-02-18
KR1020160019322A KR101800877B1 (ko) 2016-02-18 2016-02-18 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2017142305A1 true WO2017142305A1 (ko) 2017-08-24

Family

ID=59625225

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/001650 WO2017142305A1 (ko) 2016-02-18 2017-02-15 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Country Status (7)

Country Link
US (1) US10508140B2 (ko)
EP (1) EP3418293B1 (ko)
JP (1) JP6581735B2 (ko)
KR (1) KR101800877B1 (ko)
CN (1) CN108633279B (ko)
ES (1) ES2980830T3 (ko)
WO (1) WO2017142305A1 (ko)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110151622A (zh) * 2019-05-29 2019-08-23 山东腾贵医药有限公司 一种防脱生发复合制剂及其制备方法
KR102265433B1 (ko) * 2019-08-20 2021-06-15 주식회사 케어젠 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR102265431B1 (ko) * 2019-08-20 2021-06-15 주식회사 케어젠 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR20240050562A (ko) * 2022-10-11 2024-04-19 (주)케어젠 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
KR20240050560A (ko) * 2022-10-11 2024-04-19 (주)케어젠 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
KR20240050561A (ko) * 2022-10-11 2024-04-19 (주)케어젠 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
WO2005082395A1 (ja) * 2004-03-02 2005-09-09 Kyoto University 新規な育毛剤、抗脱毛症剤
JP2008515815A (ja) * 2004-10-08 2008-05-15 クリヌベール、ファーマスーティカルズ、リミテッド 対象者におけるメラニン形成を誘導するための組成物および方法
JP2009126844A (ja) * 2007-11-27 2009-06-11 Lion Corp 発毛活性ペプチド
KR20140107784A (ko) * 2013-02-28 2014-09-05 주식회사 크라운진 탈모 방지 및 모발 성장 촉진용 조성물
KR20150130615A (ko) * 2014-05-13 2015-11-24 (주)케어젠 저색소증 개선 및 지방 형성 억제 효능을 갖는 펩타이드 및 이의 용도

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101163171B1 (ko) * 2009-01-20 2012-07-19 (주)케어젠 노긴?유래 펩타이드 및 그의 용도
KR101198918B1 (ko) * 2009-09-01 2012-11-07 (주)케어젠 Ｗｎｔ１０?유래 펩타이드 및 그의 용도
KR101285259B1 (ko) * 2011-08-04 2013-07-11 (주)케어젠 Ｗｎｔ 계열 유래 펩타이드 및 이의 용도
TWI516272B (zh) * 2013-06-05 2016-01-11 財團法人工業技術研究院 應用於生髮之方法及醫藥組成物
KR101831887B1 (ko) * 2016-03-09 2018-02-27 (주)케어젠 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
WO2005082395A1 (ja) * 2004-03-02 2005-09-09 Kyoto University 新規な育毛剤、抗脱毛症剤
JP2008515815A (ja) * 2004-10-08 2008-05-15 クリヌベール、ファーマスーティカルズ、リミテッド 対象者におけるメラニン形成を誘導するための組成物および方法
JP2009126844A (ja) * 2007-11-27 2009-06-11 Lion Corp 発毛活性ペプチド
KR20140107784A (ko) * 2013-02-28 2014-09-05 주식회사 크라운진 탈모 방지 및 모발 성장 촉진용 조성물
KR20150130615A (ko) * 2014-05-13 2015-11-24 (주)케어젠 저색소증 개선 및 지방 형성 억제 효능을 갖는 펩타이드 및 이의 용도

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
ARCK, PETRA CLARA; HANDJISKI, BORI, AMERICAN JOURNAL OF PATHOLOGY, vol. 162, no. 3, 2003
MERRIFIELD, J. AMER. CHEM. SOC., vol. 85, 1963, pages 2149 - 54
NUCLEIC ACIDS RES., vol. 30, no. 14, pages 3096106
OLIVER, EMBRYOL. EXP. MORPH., vol. 15, 1966, pages 3311
OLIVER, EMBRYOL. EXP. MORPH., vol. 16, 1966, pages 231
PIGMENT CELL MELANOMA RES, vol. 21, no. 6, pages 66576
See also references of EP3418293A4
STENN; PAUS, PHYSIOL. REV., vol. 81, 2002, pages 449
STEWART ET AL.: "Solid Phase Peptide Synthesis", vol. 111, 1984, PIERCE CHEM. CO.
THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 273, no. 31, 31 July 1998 (1998-07-31), pages 195609565

Also Published As

Publication number Publication date
JP2019508489A (ja) 2019-03-28
CN108633279A (zh) 2018-10-09
US10508140B2 (en) 2019-12-17
KR101800877B1 (ko) 2017-11-27
EP3418293A4 (en) 2019-03-20
EP3418293B1 (en) 2024-06-05
ES2980830T3 (es) 2024-10-03
JP6581735B2 (ja) 2019-09-25
US20190071478A1 (en) 2019-03-07
KR20170097834A (ko) 2017-08-29
EP3418293A1 (en) 2018-12-26
CN108633279B (zh) 2021-11-05

Similar Documents

Publication Publication Date Title
WO2017155232A2 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017142305A1 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2019103203A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2017142254A1 (ko) 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017142264A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2016190660A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2016088968A1 (ko) 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2017105161A2 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2019045248A2 (ko) 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
EP2740740B1 (en) Edar ligand-derived peptide and uses thereof
WO2017159922A1 (ko) 피나스테라이드와 펩타이드의 결합체
WO2018034453A1 (ko) 미녹시딜과 펩타이드의 결합체
WO2018199358A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2020180059A1 (ko) 플라즈마 활성 배양액을 포함하는 멜라닌 생산용 조성물 및 이의 용도
WO2018216884A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR101885847B1 (ko) 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018056583A1 (ko) Sh3bp4 억제 물질을 포함하는 피부 미백용 조성물 및 sh3bp4 억제 물질의 스크리닝 방법
KR101966361B1 (ko) 비오틴이 결합된 헥사펩타이드-２ 유도체를 포함하는 지방세포 분화 촉진용 조성물
KR101920052B1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018151352A1 (ko) 살리실산과 펩타이드의 결합체
WO2024143711A1 (ko) 아마씨 유래 고리형 펩타이드를 포함하는 피부 미백용 조성물
WO2024122713A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106809A1 (ko) 발모 촉진 및 손상모 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024210457A1 (ko) 발모 촉진 또는 탈모 억제능을 갖는 펩타이드 및 이의 용도
WO2020235727A1 (ko) 토목향 추출물의 분획물 또는 이로부터 분리한 화합물을 유효성분으로 포함하는 피부 미백용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17753466

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018560421

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2017753466

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017753466

Country of ref document: EP

Effective date: 20180918