WO2019045248A2 - 주름 개선 활성을 나타내는 펩타이드 및 이의 용도 - Google Patents

주름 개선 활성을 나타내는 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2019045248A2
WO2019045248A2 PCT/KR2018/007515 KR2018007515W WO2019045248A2 WO 2019045248 A2 WO2019045248 A2 WO 2019045248A2 KR 2018007515 W KR2018007515 W KR 2018007515W WO 2019045248 A2 WO2019045248 A2 WO 2019045248A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
skin
amino acid
acid sequence
peptide
Prior art date
Application number
PCT/KR2018/007515
Other languages
English (en)
French (fr)
Other versions
WO2019045248A3 (ko
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202311147173.1A priority Critical patent/CN117186175A/zh
Priority to EP24157582.8A priority patent/EP4349359A2/en
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to EP24157601.6A priority patent/EP4349361A2/en
Priority to BR112020004088-6A priority patent/BR112020004088A2/pt
Priority to CN202311152562.3A priority patent/CN117186180A/zh
Priority to EP18850102.7A priority patent/EP3677590B1/en
Priority to EP24157599.2A priority patent/EP4349360A2/en
Priority to CN202311147533.8A priority patent/CN117186179A/zh
Priority to US16/642,974 priority patent/US11103436B2/en
Priority to JP2020512447A priority patent/JP6944046B2/ja
Priority to CN201880056604.4A priority patent/CN111148751B/zh
Publication of WO2019045248A2 publication Critical patent/WO2019045248A2/ko
Publication of WO2019045248A3 publication Critical patent/WO2019045248A3/ko
Priority to US17/389,731 priority patent/US11672749B2/en
Priority to US18/308,985 priority patent/US20230285264A1/en
Priority to US18/308,908 priority patent/US20230285263A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10—Tetrapeptides
    • C07K5/1002—Tetrapeptides with the first amino acid being neutral
    • C07K5/1005—Tetrapeptides with the first amino acid being neutral and aliphatic
    • C07K5/1008—Tetrapeptides with the first amino acid being neutral and aliphatic the side chain containing 0 or 1 carbon atoms, i.e. Gly, Ala
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases containing the peptide, a cosmetic composition for improving skin condition comprising the peptide, A method for preventing or treating skin diseases using the peptide, and a method for preventing, treating or improving a skin disease of the peptide.
  • the human skin constantly undergoes changes, the most typical of which is degradation of the skin caused by aging and a reduction in the visual beauty.
  • Skin aging is largely divided into endogenous aging by genetic factors and exogenous aging by external environmental factors such as sunlight.
  • Aging forms wrinkles of the skin, and examples of typical wrinkle formation include reduction of active oxygen, ultraviolet rays, and biosynthesis of collagen.
  • active oxygen ultraviolet rays
  • biosynthesis of collagen In the case of endogenous aging of skin, it is impossible to control artificially, but in the case of extrinsic aging, aging can be prevented, treated or delayed by removing active oxygen, promoting fibroblast proliferation and promoting biosynthesis of collagen.
  • peptides containing the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 can be usefully used for improving skin wrinkles, .
  • an object of the present invention is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating skin diseases comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.
  • Another object of the present invention is to provide a cosmetic composition for improving skin condition comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • Yet another object of the present invention is to provide a food composition for improving skin condition comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • Another object of the present invention is to provide a method for preventing or treating skin diseases using a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2.
  • Another object of the present invention relates to a skin condition improving use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • Another object of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 for the prevention or treatment of skin diseases.
  • the present invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases containing the peptide, a cosmetic composition for improving skin condition comprising the peptide, A method for preventing or treating skin diseases using the peptide, and a method for preventing, treating or improving a skin disease of the peptide.
  • a representative feature of the skin wrinkles is collagen, elastin, and fibronectin level inhibition, extracellular matrix proteins (ECM) that constitute the dermis.
  • ECM extracellular matrix proteins
  • One aspect of the invention relates to a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • the peptide may be one in which an N-terminal and / or C-terminal modification is induced to select a portion of the amino acid sequence and increase its activity.
  • N-terminal and / or C-terminal modifications can significantly improve the stability of the peptide of the present invention, for example, increase the half-life in vivo administration of the peptide.
  • the N-terminal modification may be carried out at the N-terminus of the peptide using an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, ), A stearyl group, and a polyethylene glycol (PEG).
  • the C-terminal modification may be a combination of a hydroxyl group (-OH), an amino group (-NH 2), an azide (-NHNH 2), or the like at the C-terminal of the peptide, but not limited thereto .
  • the protecting group acts to protect the peptide of the present invention against attack of a protein cleaving enzyme in vivo.
  • Another embodiment of the present invention relates to a pharmaceutical composition for preventing or treating skin diseases comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.
  • the skin disease may be psoriasis, atopic dermatitis, non-allergic dermatitis, and dry skin, but is not limited thereto.
  • the pharmaceutical composition may comprise a pharmaceutically effective amount of at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carriers are those conventionally used in the formulation and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, But are not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention may further include, but is not limited to, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, etc. in addition to the above components.
  • the pharmaceutical composition may be administered orally or parenterally, preferably parenterally.
  • parenteral administration the pharmaceutical composition may be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration or the like , But is not limited thereto.
  • the dosage of the pharmaceutical composition may be from 0.0001 to 1000 ug per day (microgram, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug, but not limited to, , The mode of administration, the age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate, and responsiveness of the patient.
  • the pharmaceutical composition may be prepared in the form of a unit dose by formulating it with a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs. Into a multi-dose container.
  • the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing agents and / or stabilizers.
  • Another aspect of the present invention relates to a food composition for improving skin condition comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 as an active ingredient.
  • the skin condition improvement may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration or skin whitening, but is not limited thereto.
  • the food may be various foods, beverages, food additives, and the like.
  • the content of the peptide as an active ingredient contained in the food composition is not particularly limited depending on the form of the food and the intended use, and may be, for example, 0.01 to 15% by weight of the total food, Can be added at a ratio of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml.
  • the liquid ingredient other than the peptide when the food is a beverage, there is no particular restriction on the liquid ingredient other than the peptide as an essential ingredient at the indicated ratio, and it may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages.
  • the natural carbohydrate may be selected from the group consisting of monosaccharides such as disaccharides such as glucose and fructose such as maltose and sucrose and polysaccharides such as dextrin and cyclodextrin, , Sorbitol, and erythritol.
  • monosaccharides such as disaccharides such as glucose and fructose such as maltose and sucrose
  • polysaccharides such as dextrin and cyclodextrin, , Sorbitol, and erythritol.
  • Natural flavors can be advantageously used as flavors other than those described above
  • the ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.
  • the food composition of the present invention can be used as a flavoring agent such as a variety of nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, coloring agents and thickening agents (cheese, chocolate etc.), pectic acid and its salts, A salt thereof, an organic acid, a protective colloid thickener, a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.
  • a flavoring agent such as a variety of nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, coloring agents and thickening agents (cheese, chocolate etc.), pectic acid and its salts, A salt thereof, an organic acid, a protective colloid thickener, a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.
  • the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not so critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.
  • Another aspect of the present invention relates to a cosmetic composition for improving skin condition comprising at least one selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • the skin condition improvement may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration or skin whitening, but is not limited thereto.
  • the cosmetic composition comprises: (a) a cosmetically effective amount of the peptides of the invention described above; And / or (b) a cosmetically acceptable carrier.
  • a cosmetically effective amount means an amount sufficient to achieve the skin condition improving effect of the composition of the present invention described above.
  • the cosmetic composition may be in any form conventionally prepared in the art and may be in the form of, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant- , A powder foundation, an emulsion foundation, a wax foundation, and a spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.
  • the formulation of the cosmetic of the present invention is a paste, a cream or a gel, an animal oil, a vegetable oil, a wax, a paraffin, a starch, a tracer, a cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, Can be used.
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in the case of a spray, additionally a chlorofluorohydrocarbon , Propane / butane or dimethyl ether.
  • a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid esters of sorbitan.
  • the formulation of the cosmetic composition of the present invention is a suspension
  • a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.
  • the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester.
  • ingredients contained in the cosmetic composition of the present invention include, in addition to the peptide and carrier component as the active ingredient, components commonly used in cosmetic compositions, such as antioxidants, stabilizers, solubilizers, vitamins, And may contain the same conventional adjuvants.
  • improvement of skin condition encompasses a process of treating, alleviating, or alleviating damage to the skin caused by intrinsic or extrinsic factors of the skin or its effect. For example, But it is not limited thereto.
  • Another aspect of the present invention relates to a skin condition improving use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • the skin condition improvement may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration or skin whitening, but is not limited thereto.
  • Another aspect of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 for the prevention or treatment of skin diseases.
  • the skin disease may be psoriasis, atopic dermatitis, non-allergic dermatitis, and dry skin, but is not limited thereto.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 is the same as described above.
  • peptide refers to a linear molecule formed by peptide bonds and amino acid residues joined together.
  • the peptides of the present invention can be synthesized by chemical synthesis methods known in the art, especially solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891).
  • stability means not only stability in vivo but also storage stability (e.g., room temperature storage stability).
  • the term " pharmaceutically effective amount” means an amount sufficient to achieve efficacy or activity of the peptides described above.
  • the present invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases containing the peptide, a cosmetic composition for improving skin condition comprising the peptide, A method for preventing or treating skin diseases using the peptide, and a method for preventing, treating or improving a skin disease of the peptide.
  • Fig. 1 is a graph showing the results of evaluating the proliferation of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • FIG. 2 is a graph showing the results of evaluating the proliferation of fibroblasts of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 3 is a graph showing the results of evaluating the proliferation of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO. 3 according to an embodiment of the present invention.
  • FIG. 4 is a graph showing the results of evaluating the proliferation of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
  • FIG. 5 is a graph showing the results of evaluating promotion of proliferation of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • FIG. 6 is a graph showing the results of evaluating promotion of proliferation of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 7 is a graph showing a result of evaluating promotion of proliferation of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO. 3 according to an embodiment of the present invention.
  • FIG. 8 is a graph showing the results of evaluating promotion of proliferation of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
  • FIG. 9 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT elimination) in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • FIG. 10 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT elimination) in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 11 is a photograph showing the results of measurement of the phosphorylation level of MAPK and AKT in fibroblasts of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to the embodiment of the present invention.
  • FIG. 12 is a photograph showing the results of measuring the phosphorylation level of MAPK and AKT in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
  • FIG. 13 is a photograph showing the results of measuring the phosphorylation level of MAPK (AKT elimination) in keratinocytes of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • FIG. 14 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT elimination) in keratinocytes of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 15 is a photograph showing the results of collagen 1a, fibronectin and elastin RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • 16 is a photograph showing the results of collagen 1a, fibronectin and elastin RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • 17 is a photograph showing the results of collagen 1a, fibronectin and elastin RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to the embodiment of the present invention.
  • FIG. 18 is a photograph showing the results of collagen 1a, fibronectin and elastin RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to the embodiment of the present invention.
  • FIG. 19 is a photograph showing the result of AQP3 (Aquaporin 3) RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • 20 is a photograph showing the SIRT1 RT-PCR result of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • 21 is a photograph showing the result of AQP3 (Aquaporin 3) RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 22 is a photograph showing the result of measuring the amount of collagen 1a expression of the peptide consisting of the amino acid sequence of SEQ ID NO. 1 according to the embodiment of the present invention.
  • FIG. 22 is a photograph showing the result of measuring the amount of collagen 1a expression of the peptide consisting of the amino acid sequence of SEQ ID NO. 1 according to the embodiment of the present invention.
  • FIG. 23 is a photograph showing the result of measurement of the amount of fibronectin expressed in the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • FIG. 24 is a photograph showing the measurement result of the amount of elastin expressed in the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present invention.
  • FIG. 25 is a photograph showing the result of measuring the amount of collagen 1a expression of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 26 is a photograph showing the result of measurement of the amount of fibronectin expressed in the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 27 is a photograph showing the measurement result of elastin expression amount of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • 29 is a photograph showing the result of Procollagen1a ELISA of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present invention.
  • FIG. 30 is a photograph showing the result of Procollagen1a ELISA of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to the embodiment of the present invention.
  • FIG. 31 is a photograph showing the result of Procollagen1a ELISA of the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to the embodiment of the present invention.
  • FIG. 32 is a photograph showing an HA ELISA result of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • the present invention relates to a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.
  • chlorotrityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was placed in a reaction vessel, and 490 ml of methylene chloride (MC) was added and stirred for 3 minutes. Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added, stirred for 3 minutes, and then the solvent was removed. 200 ml of Fmoc-Tyr (tBu) -OH (Bachem, Swiss) and 400 mmole of diisopropylethylamine (DIEA) were added to the reactor, 700 ml of dichloromethane solution was added, stirred well and dissolved for 1 hour The reaction was carried out with stirring.
  • CTC resin chlorotrityl chloride resin
  • MC methylene chloride
  • DMF dimethylformamide
  • DIEA diisopropylethylamine
  • Peptidyl resin was washed three times each with DMF, MC and methanol, dried slowly by flowing nitrogen air, and then completely dried by vacuum reduction under P 2 O 5 , followed by filtration (Trifluroacetic acid 81.5 , 1,900 ml of distilled water 5.0%, Thioanisole 5.0%, Phenol 5.0%, EDT, Ethanedithiol 2.5%, TIS (Triisopropylsilane 1.0%) and the mixture was shaken at room temperature The reaction was maintained for 2 hours. The resin was filtered and the resin was washed with a small amount of TFA solution and then combined with the mother liquor.
  • the combined mother liquor (2,090 ml) was added with cold ether to induce precipitation, and the precipitate was collected by centrifugation and washed twice with cold ether.
  • the mother liquor was removed and sufficiently dried under nitrogen to synthesize 79.8 g of the peptide consisting of SEQ ID NO: 1 before purification (yield: 97.0%).
  • the molecular weight was 822.9 (theoretical value: 822.9) when the molecular weight was measured using a molecular weight analyzer.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 was synthesized as described above.
  • SEQ ID NO Sequence List Analytical value (mass spectrometer) Analytical value Theoretical value One KWGGGRY 822.9 822.9 2 ILGRWCG 803.9 803.9 3 GPVH 408.4 408.4 4 EDEFKPPAAGR 1216.3 1216.3
  • Mouse fibroblast NIH3T3 was seeded in a 96-well plate at a density of 5 x 10 3 cells / well and then cultured overnight. Subsequently, the cells were changed to 0.05% serum-containing media. Then, the positive control 100 nM bFGF and the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM for 3 days, / ml MTT solution and reacted for 4 hours. Then, the resulting formazan glass was dissolved by treatment with dimethyl sulfoxide (hereinafter referred to as DMSO), and the absorbance at 560 nm was measured using a microplate reader. The results are shown in Figs. 1 to 4 And Table 2.
  • DMSO dimethyl sulfoxide
  • Fibroblast proliferation (%) 1 Control SEQ ID NO: 1 bFGF (100 nM) 10uM 50 uM 100 170 194 279 2 Control SEQ ID NO: 2 bFGF (100 nM) 10uM 50 uM 100 188 253 400 3 Control SEQ ID NO: 3 bFGF (100 nM) 10uM 50 uM 100 194 261 386 4 Control SEQ ID NO: 4 bFGF (100 nM) 10uM 50 uM 100 114 193 386
  • the peptide having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 promoted fibroblast proliferation.
  • HaCaT a human keratinocyte
  • DMSO dimethyl sulfoxide
  • NIH3T3 mouse fibroblasts at a density of 5x10 3 cells / well and then seeded in 6-well plates and incubated overnight. Subsequently, the cells were treated with 10 uM or 50 uM of the peptide consisting of the positive control 100 nM bFGF and the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 for 30 minutes, And cell lysate was prepared. Then, western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38), p-Akt or Actin antibody (santacruz biotechnology, USA) The results are shown in Figures 9-12.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 can be produced by the activation of MAPK (ERK, p38, JNK), a signaling factor involved in the proliferation of fibroblasts, In the case of the present invention.
  • MAPK ERK, p38, JNK
  • a signaling factor involved in the proliferation of fibroblasts In the case of the present invention.
  • HaCaT a human keratinocyte
  • a human keratinocyte was seeded in a 6-well plate at a density of 3 x 10 cells / well and then cultured overnight. Subsequently, the cells were treated with 10 uM or 50 uM of the peptide consisting of the positive control 10 nM EGF and the amino acid sequence of SEQ ID NO: 1 or 2 for 30 minutes, and the cells were recovered to obtain cells Cell lysate was prepared. Then, western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38) and p-Akt antibody (santacruz biotechnology, USA) 13 and 14, respectively.
  • P-MAPK p-Erk, p-JNK, p-p38
  • p-Akt antibody asantacruz biotechnology, USA
  • peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 showed an effect of promoting proliferation through activation of ERK and p38, which are signal transduction factors involved in human keratinocyte proliferation.
  • Example 4 Collagen 1a, fibronectin and elastin RT-PCR
  • NIH3T3 mouse fibroblasts at a density of 5x10 3 cells / well and then seeded in 6-well plates and incubated overnight. Then, the medium containing the 0.05% FBS was replaced with the culture medium for 4 hours, and the positive control 100 nM IGF-1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM for 24 hours And the cells were recovered and RNA was isolated.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 shows the effect of increasing the expression of collagen, fibronectin, and elastin mRNA as constituents of ECM through promoting fibroblast activity Respectively.
  • HaCaT a human keratinocyte
  • a human keratinocyte was seeded in a 6-well plate at a density of 3 x 10 cells / well and then cultured overnight. Then, the medium was replaced with 0.05% FBS-containing medium and incubated for 4 hours. Then, positive control 100 nM EGF and 10 uM of peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 were treated with 50 uM for 24 hours and cells were recovered RNA was isolated.
  • CDNA was synthesized using cDNA synthesis kit (Intron, Korea) after quantification of RNA, and PCR was carried out using primers of AQP3, SIRT1 and GAPDH of PCR premix (Intron, Korea) and Table 5 below. Then, the cells were run on 5% agarose gel to compare the mRNA expression levels of the growth factors under the respective peptide treatment conditions, and the results are shown in FIGS. 19 to 21.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 increased the expression of AQP3, a protein involved in skin barrier enhancement, through promotion of keratinocyte activation.
  • NIH3T3 mouse fibroblasts at a density of 5x10 3 cells / well and then seeded in 6-well plates and incubated overnight. Subsequently, the cells were changed to serum-free medium, treated with a positive control 100 nM bFGF, and a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 for 24 hours, and cultured in 4% paraformaldehyde ) For 30 minutes. Then, after washing 3 times, the cells were reacted with 0.5% Triton X-100 for 15 minutes and washed again 3 times.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 exhibited the effect of increasing the expression of collagen, fibronectin, and elastin protein as components of the ECM through promoting fibroblast activity.
  • NIH3T3 mouse fibroblasts at a density of 5x10 3 cells / well and then seeded in 6-well plates and incubated overnight. Subsequently, the cells were changed to 0.05% FBS-containing media and cultured for 4 hours. Then, the positive control 100 nM IGF-1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated and cultured for 72 hours Recall. The content in the medium was measured using Procollagen1a ELISA kit (Usbiological lifescience, USA), and the results are shown in Figs. 28 to 31 and Table 6. Fig.
  • HaCaT a human keratinocyte
  • a human keratinocyte was seeded in a 6-well plate at a density of 3 x 10 cells / well and then cultured overnight. After replacing with 0.05% FBS-containing media and incubating for 4 hours, the peptide consisting of the positive control 100 nM IGF-1 and the amino acid sequence of SEQ ID NO: 2 was cultured for 72 hours and the medium was recovered. The content in the medium was measured using an HA ELISA kit (Echelon, USA), and the results are shown in FIG. 32 and Table 7.
  • HA expression (ng / ml) 32 Control SEQ ID NO: 2 IGF-1 (100 nM) 10uM 50 uM 251 286 292 280
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 2 increased the expression of HA, a protein involved in skin barrier enhancement, through promotion of keratinocyte activation.
  • the present invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases containing the peptide, a cosmetic composition for improving skin condition comprising the peptide, A method for preventing or treating skin diseases using the peptide, and a method for preventing, treating or improving a skin disease of the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Birds (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법, 및 상기 펩타이드의 피부 질환 예방, 치료 또는 상태 개선 용도에 관한 것이다.

Description

주름 개선 활성을 나타내는 펩타이드 및 이의 용도
본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법, 및 상기 펩타이드의 피부 질환 예방, 치료 또는 상태 개선 용도에 관한 것이다.
인간의 피부는 끊임없이 변화를 겪게 되며, 그 중 가장 대표적인 것이 노화에 의한 피부의 기능 저하 및 시각적인 아름다움의 감소이다. 피부의 노화는 크게 유전적 요소에 따른 내인성 노화와 태양광선 등의 외부 환경적 요소에 따른 외인성 노화로 구분된다.
노화는 피부의 주름을 형성시키며, 대표적인 주름 형성의 인자로서 활성 산소, 자외선 및 콜라겐의 생합성 감소 등을 들 수 있다. 피부의 내인성 노화의 경우 인위적인 조절이 불가능하나, 외인성 노화의 경우 활성산소 제거, 섬유아세포의 증식 및 콜라겐의 생합성 촉진 등을 통하여 노화를 예방, 치료 또는 지연시킬 수 있다.
본 발명자들은 생물학적으로 유효한 활성을 갖는 우수한 펩타이드를 개발하고자 노력한 결과, 서열번호 1, 2, 3 또는 4의 아미노산 서열을 포함하는 펩타이드가 피부 주름 개선에 유용하게 이용될 수 있다는 것을 규명함으로써, 본 발명을 완성하게 되었다.
이에, 본 발명의 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 이용한 피부 질환 예방 또는 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드의 피부 상태 개선 용도에 관한 것이다.
본 발명의 또 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드의 피부 질환 예방 또는 치료 용도에 관한 것이다.
본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법, 및 상기 펩타이드의 피부 질환 예방, 치료 또는 상태 개선 용도에 관한 것이다.
피부 주름 부위의 대표적 특징은 진피를 구성하는 세포외 기질 단백질(extracellular matrix protein; 이하, ECM)인 콜라겐(collagen), 엘라스틴(elastin), 파이브로넥틴(fibronectin) 수준(level) 저해이다.
피부 주름 개선 효과를 나타내기 위해서는, 진피를 구성하는 주요 세포인 섬유아세포의 증식 촉진 및 활성 촉진에 따른 ECM 분자 발현 증가 효능을 보여야 하며, 본 펩타이드들의 효능 확인을 위해 MTT 어세이, MAPK, AKT 인산화 수준 테스트 (세포 증식과 관련된 주요 신호전달 물질(signaling molecules)로써 인산화 형태가 활성 형태임), 콜라겐, 엘라스틴, 파이브로넥틴 발현 테스트(RT-PCR을 이용한 mRNA 수준 확인 및 ELISA를 통한 단백질 수준 확인)를 진행 하였고, 이들에 대한 긍정적인 효과를 확인하였다.
또한, 표피 구성 세포인 각질세포의 증식 촉진 및 HA, AQP3, SIRT1 발현 증가 효과를 관찰함으로써, 장벽 강화에 의한 외부 자극 저해 효과도 본 펩타이드가 가지고 있음을 확인하였다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.
상기 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 및/또는 C-말단 변형이 유도된 것일 수 있다. 이러한 N-말단 및/또는 C-말단 변형을 통해 본 발명의 펩타이드의 안정성을 현저하게 향상시킬 수 있으며, 예를 들어, 펩타이드의 생체 내 투여 시 반감기를 증가시킬 수 있다.
상기 N-말단 변형은 펩타이드의 N-말단에 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택된 보호기가 결합한 것일 수 있다.
상기 C-말단 변형은 펩타이드의 C-말단에 히드록시기(hydroxyl group, -OH), 아미노기(amino group, -NH2), 아자이드(azide, -NHNH2) 등이 결합한 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.
본 발명의 다른 일 양태는 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.
상기 피부 질환은 건선, 아토피성 피부염, 비(非)알러지성 피부염 및 피부 건조증인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드의 약제학적 유효량을 포함하는 것일 수 있다.
또한, 상기 약제학적 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있다.
상기 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물의 투여량은 1일당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 한정되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 일 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 식품 조성물에 관한 것이다.
상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 식품은 각종 식품, 음료, 식품 첨가제 등일 수 있다.
상기 식품 조성물에 함유된 유효성분으로서의 펩타이드의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 특별한 제한이 없으며, 예를 들어, 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100 ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 가할 수 있다.
상기 식품이 음료인 경우에는 지시된 비율로 필수 성분으로서 상기 펩타이드를 함유하는 것 외에 액체성분에는 특별한 제한점은 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.
상기 천연 탄수화물은 모노사카라이드, 예를 들어, 포도당, 과당 등의 디사카라이드, 예를 들어 말토스, 슈크로스 등, 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다.
상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20g, 바람직하게는 약 5 내지 12g이다.
상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다.
그밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명의 또 다른 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상을 포함하는 피부 상태 개선용 화장품 조성물에 관한 것이다.
상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물은 (a) 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount); 및/또는 (b) 화장품학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "화장품학적 유효량"은 상술한 본 발명의 조성물의 피부상태 개선 효능을 달성하는 데 충분한 양을 의미한다.
상기 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
본 발명의 화장품의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 화장품의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 화장품의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 화장품의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 화장품의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
본 발명의 화장품 조성물에 포함되는 성분은 유효 성분으로서의 펩타이드와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함하며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.
본 발명의 용어 "피부상태 개선"이란, 피부의 내재적 요인 또는 외인적인 요인에 의하여 유발되는 피부의 손상을 치료, 경감, 완화시키는 과정 또는 그의 효과 등을 포괄적으로 의미하며, 예를 들어, 피부에서 발생되는 염증의 완화, 개선 등의 효과를 나타내는 것으로 해석될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드의 피부 상태 개선 용도에 관한 것이다.
상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드의 피부 질환 예방 또는 치료 용도에 관한 것이다.
상기 피부 질환은 건선, 아토피성 피부염, 비(非)알러지성 피부염 및 피부 건조증인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 기설명한 바와 동일하다.
본 명세서의 용어 "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
본 명세서의 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 명세서에서 용어 "약제학적 유효량"은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.
본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법, 및 상기 펩타이드의 피부 질환 예방, 치료 또는 상태 개선 용도에 관한 것이다.
도 1은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 2는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 3은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 4는 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 5는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 6은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 7은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 8은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 9는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 10은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 11은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK 및 AKT의 인산화 수준 측정 결과를 보여주는 사진이다.
도 12는 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK 및 AKT의 인산화 수준 측정 결과를 보여주는 사진이다.
도 13은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 14는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 15는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 16은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 17은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 18은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 19는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 AQP3(Aquaporin3) RT-PCR 결과를 보여주는 사진이다.
도 20은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 SIRT1 RT-PCR 결과를 보여주는 사진이다.
도 21은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 AQP3(Aquaporin3) RT-PCR 결과를 보여주는 사진이다.
도 22는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a 발현량 측정 결과를 보여주는 사진이다.
도 23은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 파이브로넥틴 발현량 측정 결과를 보여주는 사진이다.
도 24는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 엘라스틴 발현량 측정 결과를 보여주는 사진이다.
도 25는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a 발현량 측정 결과를 보여주는 사진이다.
도 26은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 파이브로넥틴 발현량 측정 결과를 보여주는 사진이다.
도 27은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 엘라스틴 발현량 측정 결과를 보여주는 사진이다.
도 28은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 29는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 30은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 31은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 32는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 HA ELISA 결과를 보여주는 사진이다.
본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
합성예 1: 펩타이드의 합성
클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTC resin, Nova biochem Cat No. 01-64-0021) 70g을 반응용기에 넣고 메틸렌 클로라이드(MC) 490ml를 가하여 3분간 교반하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF) 490 ml를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 그 다음, 반응기에 700 ml의 디클로로메탄용액을 넣고 Fmoc-Tyr(tBu)-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 그 다음, 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF)를 490 ml 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 700ml를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Tyr(tBu)-CTC 레진(Resin)을 제조하였다.
새로운 반응기에 700ml의 DMF 용액을 넣고 Fmoc-Arg(Pbf)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 HBTu 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Arg(Pbf)-Tyr(tBu)-CTC Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 81.5%, 증류수 5.0%, 티오아니졸(Thioanisole) 5.0%, 패놀(Phenol) 5.0%, 이디티(EDT, Ethanedithiol) 2.5%, 티아에스(TIS, Triisopropylsilane) 1.0%] 1,900 ml을 넣은 후 상온에서 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 합친 모액 2,090ml는 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 서열번호 1로 이루어진 펩타이드 79.8g을 합성하였다(수율: 97.0%). 분자량 측정기를 이용하여 분자량 측정 시 분자량 822.9 (이론 값: 822.9)를 얻을 수 있었다.
서열번호 2, 서열번호 3 또는 서열번호 4의 아미노산 서열로 이루어진 펩타이드도 상기와 같은 방법으로 합성을 진행하였다.
서열 번호 서열 목록 분석값(질량분석기)
분석치 이론치
1 KWGGGRY 822.9 822.9
2 ILGRWCG 803.9 803.9
3 GPVH 408.4 408.4
4 EDEFKPPAAGR 1216.3 1216.3
실시예 1. 섬유아세포의 증식 촉진 평가
마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 96-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% 혈청 첨가 배지(serum-containing media)로 바꿔준 후 양성 대조군 100nM bFGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 3일간 배양하고, 4mg/ml MTT 솔루션(solution)을 처리하여 4시간 반응시켰다. 그 다음, 생성된 포마잔을 다이메틸설폭사이드(dimethyl sulfoxide; 이하, DMSO) 처리를 통해 녹여낸 후 마이크로플래이트 리더(microplate reader)를 사용하여 560nm에서의 흡광도를 측정하여, 그 결과를 도 1 내지 4 및 표 2에 나타내었다.
Fibroblast proliferation (%)
도 1 Control SEQ ID NO: 1 bFGF(100nM)
10uM 50uM
100 170 194 279
도 2 Control SEQ ID NO: 2 bFGF(100nM)
10uM 50uM
100 188 253 400
도 3 Control SEQ ID NO: 3 bFGF(100nM)
10uM 50uM
100 194 261 386
도 4 Control SEQ ID NO: 4 bFGF(100nM)
10uM 50uM
100 114 193 386
도 1 내지 4 및 표 2에서 확인할 수 있듯이, 서열번호 1, 서열번호 2, 서열번호 3 또는 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포 증식 촉진 효능을 확인하였다.
실시예 2. 각질 형성 세포의 증식 촉진 평가
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% 혈청 첨가 배지(serum-containing media)로 바꿔준 후 양성 대조군 10nM EGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 3일간 배양하고, 4mg/ml MTT 솔루션(solution)을 처리하여 4시간 반응시켰다. 그 다음, 생성된 포마잔을 다이메틸설폭사이드(dimethyl sulfoxide; 이하, DMSO) 처리를 통해 녹여낸 후 마이크로플래이트 리더(microplate reader)를 사용하여 560nm에서의 흡광도를 측정하여, 그 결과를 도 5 내지 8 및 표 3에 나타내었다.
keratinocyte proliferation (%)
도 5 Control SEQ ID NO: 1 EGF(10nM)
10uM 50uM
100 120 136 142
도 6 Control SEQ ID NO: 2 EGF(10nM)
10uM 50uM
100 111 119 152
도 7 Control SEQ ID NO: 3 EGF(10nM)
10uM 50uM
100 183 197 187
도 8 Control SEQ ID NO: 4 EGF(10nM)
10uM 50uM
100 113 142 187
실시예 3. MAPK 및 AKT의 인산화 수준 측정
3-1. 섬유아세포
마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지(FBS-containing media)로 바꿔준 후, 양성 대조군 100nM bFGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 30분 배양하고 세포를 회수하여 세포 용해물(Cell lysate)을 준비하였다. 그 다음, P-MAPK(p-Erk, p-JNK, p-p38), p-Akt 또는 Actin 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블랏(western blotting)을 수행하여 인산화 양상을 비교하여, 그 결과를 도 9 내지 12에 나타내었다.
도 9 내지 12에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드는 섬유아세포의 증식에 관련된 신호 전달 인자인 MAPK (ERK, p38, JNK) 및 AKT의 활성화를 통해 증식을 촉진하는 효능을 보임을 확인하였다.
3-2. 각질 형성 세포
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지(FBS-containing media)로 바꿔준 후, 양성 대조군 10nM EGF 및 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 30분 배양하고 세포를 회수하여 세포 용해물(Cell lysate)을 준비하였다. 그 다음, P-MAPK(p-Erk, p-JNK, p-p38), p-Akt 항체 (santacruz biotechnology, USA)를 이용하여 웨스턴 블랏(western blotting)을 수행하여 인산화 양상을 비교하여, 그 결과를 도 13 및 14에 나타내었다.
도 13 및 14에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 인간 각질 형성 세포 증식에 관련된 신호 전달 인자인 ERK 및 p38의 활성화를 통해 증식을 촉진하는 효능을 보임을 확인하였다.
실시예 4. 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR
마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지로 바꿔주고 4시간 동안 배양한 후, 양성 대조군 100nM IGF-1 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)을 이용하여 cDNA를 합성하고 PCR premix(Intron, Korea) 및 하기 표 4의 콜라겐1a(collagen1a), 파이브로넥틴(fibronectin), 엘라스틴(elastin), GAPDH 각각의 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로즈 겔에 러닝하여 각 펩타이드 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 15 내지 18에 나타내었다.
서열번호 프라이머 서열(5'-3')
5 Collagen1a_F CACCCTCAAGAGCCTGAGTC
6 Collagen1a_R AGACGGCTGAGTAGGGAACA
7 Fibronectin_F CCAGGAACCGAGTACACCAT
8 Fibronectin_R ATACCCAGGTTGGGTGATGA
9 Elastin_F GGACCCCTGACTCGCGACCT
10 Elastin_R GGGGAGGTGGGACTGCCCAA
11 GAPDH_F GGTGTGAACGGATTTGGCCGTATTG
12 GAPDH_R CCGTTGAATTTGCCGTGAGTGGAGT
도 15 내지 18에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드는 섬유아세포 활성 촉진을 통해 ECM 구성 성분인 콜라겐, 파이브로넥틴, 엘라스틴 mRNA의 발현 증가 효과를 나타냄을 확인하였다.
실시예 5. AQP3(Aquaporin3) 및 SIRT1 RT-PCR
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS-포함 배지로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM EGF 및 각각 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드 10uM, 50uM을 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)을 이용하여 cDNA를 합성하고, PCR premix(Intron, Korea) 및 하기 표 5의 AQP3, SIRT1, GAPDH 각각의 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로즈 겔에 러닝하여 각 펩타이드 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 19 내지 21에 나타내었다.
서열번호 프라이머 서열(5'-3')
13 AQP3_F CCTTCTTGGGTGCTGGAATA
14 AQP3_R ACACGATAAGGGAGGCTCTG
15 SIRT1_F TCAGTGGCTGGAACAGTGAG
16 SIRT1_R TCTGGCATGTCCCACTATCA
도 19 내지 21에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 각질세포 활성 촉진을 통해 피부 장벽 강화와 관련된 단백질인 AQP3의 발현을 증가시킴을 확인하였다.
실시예 6. 콜라겐1a, 파이브로넥틴 및 엘라스틴 발현량 측정
마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 무혈청배지(Serum-free media)로 바꿔준 후, 양성 대조군 100nM bFGF, 및 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 처리하여 24시간 동안 배양하고, 4% 파라폼알데히드(paraformaldehyde)로 30분간 고정하였다. 그 다음, 3번 세척 후 0.5% Triton X-100에 15분간 반응시키고 다시 3번 세척하였다. 그 다음, 3% BSA에 1시간 블록킹(blocking)하고 Collagen 1a, Fibronectin 및 Elastin에 대한 1차 항체(1:100)를 4℃에서 하루밤 동안 반응시켰다. 그 다음, 2차 항체(1:500)를 실온에서 2시간 반응시킨 후, 다피 염색법(DAPI staining)으로 염색하여 형광 현미경(Fluorescent microscope)으로 관찰하여, 그 결과를 도 22 내지 27에 나타내었다.
도 22 내지 27에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 섬유아세포 활성 촉진을 통해 ECM 구성 성분인 콜라겐, 파이브로넥틴, 엘라스틴 단백질의 발현 증가 효과를 나타냄을 확인하였다.
실시예 7. Procollagen1a ELISA
마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS-containing media로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM IGF-1 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 처리하여 72시간 동안 배양하고 배지를 회수한다. Procollagen1a ELISA kit (Usbiological lifescience, USA)을 이용하여 배지 내 함량을 측정하여, 그 결과를 도 28 내지 31 및 표 6에 나타내었다.
Procollagen1a expression(%)
도 28 Control SEQ ID NO: 1 IGF-1(100nM)
10uM 50uM
100 98 157 140
도 29 Control SEQ ID NO: 2 IGF-1(100nM)
10uM 50uM
100 145 146 140
도 30 Control SEQ ID NO: 3 IGF-1(100nM)
10uM 50uM
100 138 143 113
도 31 Control SEQ ID NO: 4 IGF-1(100nM)
10uM 50uM
100 122 141 113
도 28 내지 31 및 표 6에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드 처리시 섬유아세포에서 Pro-collagen1α 단백질의 발현이 증가하는 것을 확인하였다.
실시예 9. HA ELISA
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 0.05% FBS-containing media로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM IGF-1 및 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 처리하여 72시간 동안 배양하고 배지를 회수한다. HA ELISA 키트(Echelon, USA)를 이용하여 배지 내 함량을 측정하고, 그 결과를 도 32 및 표 7에 나타내었다.
HA expression(ng/ml)
도 32 Control SEQ ID NO: 2 IGF-1(100nM)
10uM 50uM
251 286 292 280
도 32 및 표 7에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드는 각질세포 활성 촉진을 통해 피부 장벽 강화와 관련된 단백질인 HA의 발현을 증가시킴을 확인하였다.
본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법, 및 상기 펩타이드의 피부 질환 예방, 치료 또는 상태 개선 용도에 관한 것이다.

Claims (8)

  1. 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 피부 상태 개선 활성을 갖는 펩타이드.
  2. 제1항에 있어서, 상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것인, 펩타이드.
  3. 서열번호 1의 아미노산 서열로 이루어진 펩타이드, 서열번호 2의 아미노산 서열로 이루어진 펩타이드, 서열번호 3의 아미노산 서열로 이루이전 펩타이드 및 서열번호 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물.
  4. 제3항에 있어서, 상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것인, 피부 상태 개선용 화장품 조성물.
  5. 서열번호 1의 아미노산 서열로 이루어진 펩타이드 및 서열번호 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물.
  6. 제5항에 있어서, 상기 피부 질환은 건선, 아토피성 피부염, 비(非)알러지성 피부염 및 피부 건조증인 것인, 피부 질환 예방 또는 치료용 약제학적 조성물.
  7. 서열번호 1의 아미노산 서열로 이루어진 펩타이드, 서열번호 2의 아미노산 서열로 이루어진 펩타이드, 서열번호 3의 아미노산 서열로 이루이전 펩타이드 및 서열번호 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 식품 조성물.
  8. 제7항에 있어서, 상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것인, 피부 상태 개선용 식품 조성물.
PCT/KR2018/007515 2017-08-31 2018-07-03 주름 개선 활성을 나타내는 펩타이드 및 이의 용도 WO2019045248A2 (ko)

Priority Applications (14)

Application Number Priority Date Filing Date Title
US16/642,974 US11103436B2 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
CN202311147533.8A CN117186179A (zh) 2017-08-31 2018-07-03 一种具有改善皱纹活性的肽及其用途
EP24157601.6A EP4349361A2 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
EP24157582.8A EP4349359A2 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
CN202311152562.3A CN117186180A (zh) 2017-08-31 2018-07-03 一种具有改善皱纹活性的肽及其用途
EP18850102.7A EP3677590B1 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
JP2020512447A JP6944046B2 (ja) 2017-08-31 2018-07-03 しわ改善活性を示すペプチド及びその用途
CN202311147173.1A CN117186175A (zh) 2017-08-31 2018-07-03 一种具有改善皱纹活性的肽及其用途
BR112020004088-6A BR112020004088A2 (pt) 2017-08-31 2018-07-03 peptídeo apresentando atividade de melhoria de rugas e usos do mesmo
EP24157599.2A EP4349360A2 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
CN201880056604.4A CN111148751B (zh) 2017-08-31 2018-07-03 一种具有改善皱纹活性的肽及其用途
US17/389,731 US11672749B2 (en) 2017-08-31 2021-07-30 Peptide exhibiting wrinkle-improving activity and uses thereof
US18/308,985 US20230285264A1 (en) 2017-08-31 2023-04-28 Peptide exhibiting wrinkle-improving activity and uses thereof
US18/308,908 US20230285263A1 (en) 2017-08-31 2023-04-28 Peptide exhibiting wrinkle-improving activity and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170111211A KR101943081B1 (ko) 2017-08-31 2017-08-31 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
KR10-2017-0111211 2017-08-31

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/642,974 A-371-Of-International US11103436B2 (en) 2017-08-31 2018-07-03 Peptide exhibiting wrinkle-improving activity and uses thereof
US17/389,731 Continuation US11672749B2 (en) 2017-08-31 2021-07-30 Peptide exhibiting wrinkle-improving activity and uses thereof

Publications (2)

Publication Number Publication Date
WO2019045248A2 true WO2019045248A2 (ko) 2019-03-07
WO2019045248A3 WO2019045248A3 (ko) 2019-04-18

Family

ID=65322932

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/007515 WO2019045248A2 (ko) 2017-08-31 2018-07-03 주름 개선 활성을 나타내는 펩타이드 및 이의 용도

Country Status (7)

Country Link
US (4) US11103436B2 (ko)
EP (4) EP4349359A2 (ko)
JP (1) JP6944046B2 (ko)
KR (1) KR101943081B1 (ko)
CN (4) CN111148751B (ko)
BR (1) BR112020004088A2 (ko)
WO (1) WO2019045248A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2023281657A1 (ko) * 2021-07-07 2023-01-12
EP3611182B1 (en) * 2017-03-30 2024-02-14 Caregen Co., Ltd. Peptide having cytoprotective effect against environmental pollutant and use thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101943081B1 (ko) * 2017-08-31 2019-01-29 (주)케어젠 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
KR102265430B1 (ko) * 2019-08-20 2021-06-15 주식회사 케어젠 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
KR102462330B1 (ko) * 2020-10-28 2022-11-02 주식회사 에이엠메딕스 피부노화 또는 주름의 예방 또는 개선용 조성물
KR102566132B1 (ko) * 2021-05-18 2023-08-14 대봉엘에스 주식회사 신규 펩타이드 및 이를 포함하는 화장료 조성물

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1064382T3 (da) * 1998-03-17 2008-12-08 Genentech Inc Homologe polypeptider til VEGF og BMP1
US8344211B2 (en) * 2008-08-13 2013-01-01 Ceres, Inc. Plant nucleotide sequences and corresponding polypeptides
JP4547538B2 (ja) 2003-10-10 2010-09-22 独立行政法人産業技術総合研究所 ダイオキシン結合材料及びダイオキシンの検出又は定量方法
TWI496582B (zh) * 2008-11-24 2015-08-21 必治妥美雅史谷比公司 雙重專一性之ｅｇｆｒ／ｉｇｆｉｒ結合分子
KR101092915B1 (ko) * 2009-07-10 2011-12-12 (주)케어젠 성장인자―유래 펩타이드 및 이의 용도
KR101187871B1 (ko) * 2009-09-23 2012-10-05 (주)케어젠 Ｆｇｆ１０－유래 펩타이드 및 그의 용도
US20110214205A1 (en) * 2010-02-26 2011-09-01 Monsanto Technology Llc. Isolated Novel Nucleic Acid and Protein Molecules from Foxtail Millet and Methods of Using Those Molecules to Generate Transgenic Plants with Enhanced Agronomic Traits
AU2012208283B2 (en) * 2011-01-20 2017-01-05 Oneday - Biotech And Pharma Ltd. Antioxidant, anti-inflammatory, anti-radiation, metal chelating compounds and uses thereof
KR101363455B1 (ko) 2011-09-09 2014-02-21 (주)케어젠 매트릭스 메탈로프로테아제 활성 억제 펩타이드 및 이의 용도
EP2841454A1 (en) * 2012-04-24 2015-03-04 ThromboGenics N.V. Anti-pdgf-c antibodies
KR101573745B1 (ko) 2013-09-11 2015-12-04 (주)셀아이콘랩 콜라겐 합성 촉진 펩타이드, 이의 제조방법, 및, 이를 함유하는 조성물
KR20150130616A (ko) 2014-05-13 2015-11-24 (주)케어젠 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
KR101744959B1 (ko) * 2014-12-05 2017-06-12 (주)케어젠 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
CN107667112B (zh) 2015-05-26 2021-12-07 珍白斯凯尔有限公司 新型肽和含有其的组合物
KR101831977B1 (ko) * 2015-08-25 2018-02-23 (주)피앤피바이오팜 상피세포 성장인자의 활성을 가지는 펩타이드 및 그의 용도
WO2017043920A1 (ko) * 2015-09-10 2017-03-16 한양대학교 산학협력단 피부 투과성 펩티드 및 그 이용방법
KR101943083B1 (ko) * 2017-03-30 2019-01-29 (주)케어젠 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
KR101943081B1 (ko) 2017-08-31 2019-01-29 (주)케어젠 주름 개선 활성을 나타내는 펩타이드 및 이의 용도

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1995
MERRIFIELD, J. AMER. CHEM. SOC., vol. 85, 1963, pages 2149 - 54
STEWART ET AL.: "Solid Phase Peptide Synthesis", 1984, PIERCE CHEM. CO.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3611182B1 (en) * 2017-03-30 2024-02-14 Caregen Co., Ltd. Peptide having cytoprotective effect against environmental pollutant and use thereof
JPWO2023281657A1 (ko) * 2021-07-07 2023-01-12

Also Published As

Publication number Publication date
CN117186179A (zh) 2023-12-08
US20230285264A1 (en) 2023-09-14
US20230285263A1 (en) 2023-09-14
WO2019045248A3 (ko) 2019-04-18
US20210369585A1 (en) 2021-12-02
CN111148751B (zh) 2023-09-05
CN117186175A (zh) 2023-12-08
CN111148751A (zh) 2020-05-12
EP4349360A2 (en) 2024-04-10
BR112020004088A2 (pt) 2020-09-24
JP6944046B2 (ja) 2021-10-06
EP3677590B1 (en) 2024-03-27
EP4349361A2 (en) 2024-04-10
EP3677590A4 (en) 2021-10-06
JP2020531558A (ja) 2020-11-05
EP4349359A2 (en) 2024-04-10
US20200197285A1 (en) 2020-06-25
US11103436B2 (en) 2021-08-31
EP3677590A2 (en) 2020-07-08
CN117186180A (zh) 2023-12-08
US11672749B2 (en) 2023-06-13
KR101943081B1 (ko) 2019-01-29

Similar Documents

Publication Publication Date Title
WO2019045248A2 (ko) 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
WO2019103203A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2017155232A2 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2016190660A1 (ko) 신규 펩티드 및 이를 포함한 조성물
KR101959012B1 (ko) 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
WO2016088968A1 (ko) 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2017105161A2 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2017142264A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017142305A1 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017034301A1 (ko) 상피세포 성장인자의 활성을 가지는 펩타이드 및 그의 용도
WO2017159922A1 (ko) 피나스테라이드와 펩타이드의 결합체
WO2018199358A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2018034453A1 (ko) 미녹시딜과 펩타이드의 결합체
WO2018216884A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR101957352B1 (ko) 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
KR101959020B1 (ko) 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
WO2018151352A1 (ko) 살리실산과 펩타이드의 결합체
WO2024106588A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106585A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106587A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2020226419A2 (ko) 트롤록스-펩타이드 결합체 및 그의 용도
WO2023127985A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127984A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127986A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127987A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18850102

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2020512447

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020004088

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018850102

Country of ref document: EP

Effective date: 20200331

ENP Entry into the national phase

Ref document number: 112020004088

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200228