WO2023127985A1 - 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 - Google Patents
피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 Download PDFInfo
- Publication number
- WO2023127985A1 WO2023127985A1 PCT/KR2021/020014 KR2021020014W WO2023127985A1 WO 2023127985 A1 WO2023127985 A1 WO 2023127985A1 KR 2021020014 W KR2021020014 W KR 2021020014W WO 2023127985 A1 WO2023127985 A1 WO 2023127985A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- group
- skin
- cosmetic composition
- amino acid
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Definitions
- the present application relates to peptides having skin condition improving activity and uses thereof.
- collagen a major component of the extracellular matrix, is a major matrix protein produced by fibroblasts of the skin.
- Collagen forms most of the organic matter of skin, tendons, bones and teeth, and its content is particularly high in bones and skin (dermis). It is known that such collagen is reduced by age and photoaging caused by UV irradiation, which is closely related to the formation of wrinkles in the skin.
- collagen plays an important role in wound healing, and by promoting the synthesis of collagen in damaged epithelium, wounds can be recovered quickly and without scarring.
- One aspect is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1.
- Another aspect is to provide a cosmetic composition for improving skin condition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
- One aspect provides a peptide consisting of the amino acid sequence of SEQ ID NO: 1.
- peptide may refer to a linear molecule formed by binding amino acid residues to each other by a peptide bond.
- the peptide may be prepared according to chemical synthesis methods known in the art, particularly solid phase synthesis techniques or liquid phase synthesis techniques (US Patent No. 5,516,891).
- solid phase synthesis techniques or liquid phase synthesis techniques (US Patent No. 5,516,891).
- the present inventors identified a peptide consisting of the amino acid sequence of SEQ ID NO: 1.
- the biologically effective activity is (a) promoting the proliferation of fibroblasts or keratinocytes; (b) enhancement of the expression of collagen type 1 (Col1a1), fibronectin, or elastin, which are components of the extracellular matrix; (c) enhancing the expression of skin barrier factor sirtuin-1 (SIRT-1) or aquaporin-3 (AQP3); And (d) it may represent any one or more selected from properties such as inhibition of death of fibroblasts or keratinocytes and reduction of active oxygen levels. Therefore, the peptide can be used for improving skin conditions or for antioxidant purposes.
- the peptides are N- or C-peptides to obtain chemical stability, enhanced pharmacological properties (half-life, uptake, potency, potency, etc.), altered specificity (e.g. broad biological activity spectrum), reduced antigenicity.
- a protecting group may be attached to the terminal.
- the N-terminus of the peptide is an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group group), a stearyl group, a butoxycarbonyl group, an aryloxycarbonyl group, and polyethylene glycol (PEG).
- the C-terminus of the peptide is bound to any one protecting group selected from the group consisting of an amino group (amino group, -NH 2 ), a tertiary alkyl group, and an azide (-NHNH 2 )
- the peptide may optionally further include a targeting sequence, a tag, a labeled residue, an amino acid sequence prepared for a specific purpose to increase half-life or stability of the peptide.
- the term “stability” may mean storage stability (eg, room temperature storage stability) as well as in vivo stability that protects the peptide from attack by proteolytic enzymes in vivo.
- Another aspect provides a cosmetic composition for improving skin condition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
- the term “improvement” may refer to any activity that at least reduces a parameter related to alleviation or treatment of a condition, for example, the severity of a symptom.
- the term "improvement of skin condition” may comprehensively mean a process or effect of treating, reducing, mitigating damage to the skin caused by intrinsic or extrinsic factors of the skin, and the like, for example, it may be interpreted as indicating wrinkle improvement, skin elasticity improvement, wound healing, skin barrier enhancement, or inhibition of skin aging, but is not limited thereto.
- wrinkle improvement may refer to any action that increases the total amount of extracellular matrix factors including promotion of collagen synthesis and the like.
- stressening the skin barrier may mean strengthening the natural function of the skin to prevent leakage of moisture and nutrients in the skin to the outside and to prevent penetration of harmful substances such as bacteria and viruses into the skin.
- suppression of skin aging may mean suppression of functional deterioration of the skin, such as wrinkles, skin sagging, and a decrease in elasticity.
- the skin aging may be photoaging, for example, skin aging by ultraviolet rays.
- the cosmetic composition according to one embodiment contains a peptide consisting of 10 or less amino acids as an active ingredient, and thus, the skin penetration rate of the active ingredient is very excellent. For example, when applied topically to the skin, In this case, the skin condition can be effectively improved.
- the peptide can restore the inhibited activity of fibroblasts and keratinocytes and enhance their antioxidant efficacy. Therefore, the peptide can be used as an active ingredient of a cosmetic composition for improving skin condition.
- the cosmetic composition includes a cosmetically effective amount of the peptide; And / or may include a cosmetically acceptable carrier, but is not limited thereto.
- cosmetically effective amount means an amount sufficient to achieve the skin condition improvement effect of the cosmetic composition.
- the weight ratio between the peptide and the cosmetically acceptable carrier may be, for example, 500:1 to 1:500, and as an example, the weight ratio is 450:1 to 1:450, 400:1 to 1:400, 350 :1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1 :6, 4:1 to 1:4, or 2:1 to 1:2, but is not limited thereto.
- the cosmetic composition may be prepared in any formulation commonly prepared in the art, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil , It may be formulated as a powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. For example, it may be formulated into a softening lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
- the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide are used as carrier components It can be.
- lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, for example, in the case of a spray, additionally chlorofluoro propellants such as hydrocarbons, propane/butane or dimethyl ether.
- a solvent, solubilizing agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan.
- the formulation of the cosmetic composition is a suspension
- a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspension agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.
- the formulation of the cosmetic composition is surfactant-containing cleansing
- carrier components aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
- the peptide may be contained in nanosomes or nanoparticles to further improve skin permeation or stability problems.
- the nanosomes may be prepared with a microfluidizer using lecithin as a raw material, and may be contained in lecithin particles. Any known method for preparing the nanosome may be used.
- the size of the nanosome particles is preferably 30 to 200 nm. When the size of the nanosome particles is less than 30 nm, skin penetration proceeds very quickly, which may cause side effects on the skin, and when the size exceeds 200 nm, skin penetration is not easy, making it difficult to obtain the effect of using the nanosome structure. there is.
- ingredients included in the cosmetic composition include ingredients commonly used in cosmetic compositions, in addition to peptides and carrier components as active ingredients, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.
- a phosphorus adjuvant may be included.
- the content of the peptide as an active ingredient contained in the cosmetic composition may be appropriately selected without limitation depending on the shape of the product, desired use, etc., for example, 0.01 to 15% by weight of the total weight of the cosmetic composition. there is.
- the cosmetic composition may include the peptide in an amount of 1.0 wt% to 3.0 wt%, preferably 2.0 wt% to 3.0 wt%, based on the total weight.
- Another aspect is a method for improving skin condition comprising applying to the skin of a subject a cosmetic composition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient; Provided is the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 for the preparation of a composition for improving skin condition.
- the term "subject” refers to a subject in need of skin condition improvement, and more specifically, a human or non-human primate, mouse, dog, cat, horse, and cow. mammals such as
- applying As used herein, the terms “applying”, “administering”, and “applying” are used interchangeably and result in at least partial localization of a composition according to an embodiment to a desired site, or route of administration. By, it may mean disposing of the composition according to an embodiment into an object.
- composition for antioxidant comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
- the antioxidant composition may be in the form of a pharmaceutical composition, a quasi-drug composition, or a cosmetic composition.
- the composition is a cosmetic composition for improving skin condition, or a drug for improving or treating a condition related to skin damage. It can be used as a scientific composition.
- the peptide showed that the peptide can restore the inhibited activity of fibroblasts and keratinocytes and enhance their antioxidant efficacy. Therefore, the peptide can be used as an active ingredient of an antioxidant composition.
- the antioxidant composition may be provided in the form of a pharmaceutical composition.
- the pharmaceutical composition may contain a pharmaceutically effective amount of the peptide; And / or may include a pharmaceutically acceptable carrier, but is not limited thereto.
- the term "pharmaceutically effective amount” may mean an amount sufficient to achieve the efficacy of preventing or treating diseases related to skin damage of the pharmaceutical composition.
- the pharmaceutically acceptable carrier is one commonly used in formulation, and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
- the weight ratio between the peptide and the pharmaceutically acceptable carrier may be, for example, 500:1 to 1:500, and as an example, the weight ratio is 450:1 to 1:450, 400:1 to 1:400, 350 :1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1 :6, 4:1 to 1:4, or 2:1 to 1:2, but is not limited thereto.
- the pharmaceutical composition may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components, but is not limited thereto.
- the pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. , but is not limited thereto.
- the dosage of the pharmaceutical composition may be 0.0001 to 1000 ug (microgram, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug per day), but is not limited thereto, formulation method , It can be prescribed in various ways depending on factors such as administration method, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate and reaction sensitivity.
- the pharmaceutical composition is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art, or It can be prepared by placing it in a multi-dose container.
- the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally contain a dispersing agent and/or a stabilizer.
- Another aspect provides a food composition for improving skin condition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
- the content of the peptide as an active ingredient contained in the food composition may be appropriately selected without limitation depending on the type of food, desired use, etc., for example, 0.01 to 15% by weight of the total food weight may be added. . Also, for example, the health drink composition may be added at a rate of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml.
- the peptide according to one aspect by promoting the proliferation of fibroblasts and keratinocytes and promoting the synthesis of extracellular matrix components and skin barrier factors, wrinkle improvement, skin elasticity improvement, wound recovery, skin barrier strengthening, or It can be applied to improve skin conditions, including suppression of skin aging.
- the peptide according to one aspect by restoring the inhibited activity of fibroblasts and keratinocytes and enhancing their antioxidant efficacy, it can contribute to recovering skin damage that may be caused by an external environment such as ultraviolet rays.
- the peptide according to one aspect can be used as an active ingredient of a composition for improving skin conditions or a composition for antioxidant.
- Figure 1 is a result of confirming the level of cell proliferation after adding a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to skin cells. This is the result showing the change in survival rate.
- FIG. 2 shows the results of confirming the increase in the expression of Col1a1, fibronectin, and elastin, which are components of the extracellular matrix, after the addition of the peptide having the amino acid sequence of SEQ ID NO: 1 to NIH3T3 cells.
- FIG. 3 is a quantitative evaluation of the expression level of extracellular matrix constituents after the addition of a peptide having the amino acid sequence of SEQ ID NO: 1 to NIH3T3 cells.
- a of FIG. 3 is the result of confirming the expression level of Col1a1.
- 3B is the result of confirming the expression level of fibronectin, and
- C of FIG. 3 is the result of confirming the expression level of elastin.
- FIG. 4 shows the results confirming the increase in the expression of skin barrier factors SIRT-1 and AQP3 after adding the peptide having the amino acid sequence of SEQ ID NO: 1 to HaCaT cells.
- Figure 5 is a quantitative evaluation of the expression level of skin barrier factors after adding the peptide consisting of the amino acid sequence of SEQ ID NO: 1 to HaCaT cells.
- Figure 5A is the result of confirming the expression level of SIRT-1
- 5B is the result of confirming the expression level of AQP3.
- Figure 6 shows the addition of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to skin cells, and then confirming the inhibitory effect on the death of skin cells induced by UV irradiation through survival rate evaluation. It is a result showing the change in viability, and FIG. 6B is a result showing the change in viability of HaCaT cells.
- Figure 7 shows the addition of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to skin cells, and then confirming the antioxidant effect on skin cells induced by UV irradiation through evaluation of the level of active oxygen. It is a result showing the change in the level of active oxygen, and FIG. 6B is a result showing the change in the level of active oxygen in HaCaT cells.
- a peptide having the amino acid sequence of SEQ ID NO: 1 described in [Table 1] was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and C18 reverse phase high performance liquid chromatography (HPLC) (Waters Associates, USA) These synthesized peptides were purified using .
- ACQUITY UPLC BEH300 C18 (2.1 mm ⁇ 100 mm, 1.7 ⁇ m, Waters Co, USA) was used as the column.
- NIH3T3 cells which are mouse fibroblasts, or HaCaT cells, which are human keratinocytes.
- NIH3T3 cells or HaCaT cells were cultured for 24 hours. Then, the cells were washed once with serum-free DMEM media, and the culture medium was replaced with the serum-free medium. Thereafter, 50 ⁇ M or 100 ⁇ M of the peptide having the amino acid sequence of SEQ ID NO: 1 was dispensed into the medium, and incubated in a CO 2 incubator at 37° C. for 72 hours. Thereafter, the culture was washed twice with PBS, and then treated with a 4% paraformaldehyde (PFA) solution for 15 minutes to fix the cultured cells.
- PFA paraformaldehyde
- control group was used as an untreated group, and the insulin-like growth factor-added group (IGF) was used as a positive control group.
- IGF insulin-like growth factor-added group
- NIH3T3 cells after seeding NIH3T3 cells in a 6-well plate at a density of 3 ⁇ 10 5 cells/well, they were cultured for 24 hours. Thereafter, the cells were washed once with serum-free DMEM media, and the culture medium was replaced with the serum-free medium. Thereafter, 50 ⁇ M or 100 ⁇ M of the peptide having the amino acid sequence of SEQ ID NO: 1 was dispensed into the medium, and incubated in a CO 2 incubator at 37° C. for 24 hours. Then, after washing the culture twice with PBS, RNA was isolated from the culture using easy blue (iNtRON, Korea).
- easy blue iNtRON, Korea
- RNA was reverse transcribed to synthesize each cDNA.
- PCR polymerase chain reaction
- a non-treated group was used as a control group, and a group to which TGF- ⁇ 1 was added (TGF- ⁇ 1) was used as a positive control group.
- TGF- ⁇ 1 TGF- ⁇ 1
- HaCaT cells were seeded in a 6-well plate at a density of 3 ⁇ 10 5 cells/well and cultured for 24 hours. Then, the cells were washed once with serum-free DMEM media, and the culture medium was replaced with the serum-free medium. Thereafter, 50 ⁇ M or 100 ⁇ M of the peptide having the amino acid sequence of SEQ ID NO: 1 was dispensed into the medium, and incubated in a CO 2 incubator at 37° C. for 24 hours. Then, after washing the culture twice with PBS, RNA was isolated from the culture using easy blue (iNtRON, Korea).
- easy blue iNtRON, Korea
- RNA was reverse transcribed to synthesize each cDNA. Then, a polymerase chain reaction was performed using the cDNA, sirtuin-1, and aquaporin-3 primers. On the other hand, a non-treated group was used as a control group, and a group to which EGF was added (EGF) was used as a positive control group.
- EGF EGF
- NIH3T3 cells or HaCaT cells were cultured for 24 hours. Thereafter, the cells were washed once with serum-free DMEM media, the culture medium was replaced with the serum-free medium, and the peptide consisting of the amino acid sequence of SEQ ID NO: 1 was added thereto at 50 ⁇ M or 100 ⁇ M each Busy.
- the culture medium in which the peptide was dispensed was incubated for 1 hour in a CO 2 incubator at 37° C., transferred to an e-tube, mixed with 100 ul of PBS, and then dispensed to a well-plate.
- NIH3T3 cells were irradiated with 6J/cm 2 of UV light, and HaCaT cells were irradiated with 15 mJ/cm 2 of UV light.
- VILBER LOURMAT UV irradiator
- HaCaT cells were irradiated with 15 mJ/cm 2 of UV light.
- the well plate After removing the PBS and adding 900 ⁇ L of the culture medium in which the peptide was dispensed, it was cultured in a CO 2 incubator at 37° C. for 72 hours. Thereafter, the culture was washed twice with PBS, and then treated with a 4% paraformaldehyde (PFA) solution for 15 minutes to fix the cultured cells.
- PFA paraformaldehyde
- NIH3T3 cells or HaCaT cells were cultured for 24 hours. Thereafter, the cells were washed once with serum-free DMEM media, the culture medium was replaced with the serum-free medium, and the peptide consisting of the amino acid sequence of SEQ ID NO: 1 was added thereto at 50 ⁇ M or 100 ⁇ M each Busy.
- the culture medium in which the peptide was dispensed was incubated for 1 hour in a CO 2 incubator at 37° C., transferred to an e-tube, mixed with 100 ul of PBS, and then dispensed to a well-plate.
- NIH3T3 cells were irradiated with 6J/cm 2 of UV light, and HaCaT cells were irradiated with 15 mJ/cm 2 of UV light.
- VILBER LOURMAT UV irradiator
- NIH3T3 cells were irradiated with 6J/cm 2 of UV light
- HaCaT cells were irradiated with 15 mJ/cm 2 of UV light.
- the well plate After removing the PBS and adding 900 ⁇ L of the culture medium in which the peptide was dispensed, it was cultured for 24 hours in a CO 2 incubator at 37°C. Thereafter, the culture was treated with DCFG-DA (2',7'-dichlorofluorescin diacetate), wrapped in foil, and cultured in a CO 2 incubator at 37°C for 30 minutes.
- DCFG-DA 2',7'-dichlorofluorescin diacetate
- the level of active oxygen in fibroblasts and keratinocytes increased by UV irradiation was reduced by the peptide consisting of the amino acid sequence of SEQ ID NO: 1.
- the peptide according to one embodiment contributes to the antioxidant effect on skin cells induced by ultraviolet rays.
- Softening lotion containing the peptide according to an embodiment and having the following composition was prepared by employing a method known in the art.
- a nutritional cream containing the peptide according to one embodiment and having the following composition was prepared by employing a method known in the art.
- a nutritional lotion containing the peptide according to one embodiment and having the following composition was prepared by employing a method known in the art.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Dermatology (AREA)
- Peptides Or Proteins (AREA)
- Cosmetics (AREA)
Abstract
본 출원은 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도에 관한 것으로서, 서열번호 1의 아미노산 서열로 이루어진 펩타이드, 및 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물을 제공한다.
Description
본 출원은 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도에 관한 것이다.
인간의 피부는 끊임없이 변화를 겪게 되며, 그 중 가장 대표적인 것이 노화에 의한 피부의 기능 저하 및 시각적인 아름다움의 감소이다. 노화는 피부의 주름을 형성시키며, 대표적인 주름 형성의 인자로서 자외선 노출 및 콜라겐의 생합성 감소 등을 들 수 있다. 피부의 노화는 크게 유전적 요소에 따른 내인성 노화와 태양 광선 등의 외부 환경적 요소에 따른 외인성 노화로 구분된다. 이 중에서도 외인성 노화의 경우 활성산소 제거, 섬유아세포의 증식 및 콜라겐의 생합성 촉진 등을 통하여 노화를 예방, 치료 또는 지연시킬 수 있는 것으로 알려져 있다.
한편, 세포외 기질(extracellular matrix)의 주요 구성 성분인 콜라겐은 피부의 섬유아세포에서 생성되는 주요 기질 단백질이다. 콜라겐은 피부, 건(tendon), 뼈 및 치아의 유기물질의 대부분을 형성하는데, 특히, 뼈와 피부(진피)에 그 포함량이 높다. 이러한 콜라겐은 연령 및 자외선 조사에 의한 광노화에 의해 감소되며, 이는 피부의 주름 형성과 밀접한 연관이 있다고 알려져 있다. 또한, 콜라겐은 상처치유에 있어서 중요한 역할을 담당하며, 손상된 상피에서 콜라겐의 합성을 촉진시켜서 상처를 신속하고 흉터 없이 회복시킬 수 있다. 아울러, 콜라겐의 생합성이 촉진됨에 따라 기저층 등의 치밀도가 높아지게 되면 단위 피부 밀도당 멜라닌 색소 농도가 낮아지게 되어, 피부톤이 밝아지는 효과를 기대할 수 있음이 보고된 바 있다.
이러한 기술적 배경 하에서, 콜라겐의 생합성 촉진, 섬유아세포 등의 증식 및 활성 증진과 같은 기작을 통하여 피부 상태를 개선하기 위한 다각적인 연구가 진행되고 있으나(한국 등록특허 제10-1813629호), 아직은 미비한 실정이다.
일 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 제공하는 것이다.
다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물을 제공하는 것이다.
본 출원의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사한 기술 분야 내 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
일 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 제공한다.
본 명세서에서 사용되는 용어, "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미할 수 있다. 상기 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술 또는 액상 합성 기술 (US 등록특허 제5,516,891호)에 따라 제조될 수 있다. 본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 예의 노력한 결과, 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 규명하였다. 여기서, 상기 생물학적으로 유효한 활성은 (a) 섬유아세포 또는 각질형성세포의 증식 촉진; (b) 세포외 기질 구성 인자인 콜라겐 type 1(Col1a1), 피브로넥틴, 또는 엘라스틴의 발현 증진; (c) 피부 장벽 인자인 시르투인-1(SIRT-1) 또는 아쿠아포린-3 (AQP3)의 발현 증진; 및 (d) 섬유아세포 또는 각질형성세포의 사멸 억제 및 활성 산소 수준의 감소와 같은 특성으로부터 선택되는 어느 하나 이상을 나타내는 것일 수 있다. 따라서, 상기 펩타이드는 피부 상태 개선을 위한 용도 또는 항산화 용도로 활용될 수 있다.
상기 펩타이드는 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 펩타이드의 N- 또는 C-말단에 보호기가 결합되어 있을 수 있다. 일 구체예에 있어서, 상기 펩타이드의 N-말단은 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group), 부톡시카르보닐기(butoxycarbonyl group), 아릴옥시카르보닐기(allyloxycarbonyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합될 수 있고; 및/또는 상기 펩타이드의 C-말단은 아미노기(amino group, -NH2), 삼차 알킬기(tertiary alkyl group) 및 아자이드(azide, -NHNH2)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합될 수 있다. 또한, 상기 펩타이드는 선택적으로, 표적화 서열, 태그 (tag), 표지된 잔기, 반감기 또는 펩타이드 안정성을 증가시키기 위한 특정 목적으로 제조된 아미노산 서열도 추가적으로 포함할 수 있다.
본 명세서에서 사용되는 용어, "안정성"은 생체 내 단백질 절단효소의 공격으로부터 상기 펩타이드를 보호하는 인 비보 안정성뿐만 아니라, 저장 안정성 (예컨대, 상온 저장 안정성)도 의미할 수 있다.
다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물을 제공한다.
상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.
본 명세서에서 사용되는 용어, "개선"은 상태의 완화 또는 치료와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다.
본 명세서에서 사용되는 용어, "피부 상태 개선"은 피부의 내재적 요인 또는 외인적인 요인에 의하여 유발되는 피부의 손상을 치료, 경감, 완화시키는 과정 또는 그의 효과 등을 포괄적으로 의미할 수 있으며, 예를 들어, 주름 개선, 피부 탄력 개선, 상처 회복, 피부 장벽 강화, 또는 피부 노화 억제를 나타내는 것으로 해석될 수 있으나, 이에 제한되는 것은 아니다.
여기에서, "주름 개선", "피부 탄력 개선", 및 "상처 회복"은 콜라겐의 합성 촉진 등을 포함하는 세포외 기질 인자의 총량을 증가시키는 모든 작용을 의미할 수 있다. 또한, "피부 장벽 강화"는 피부 내 수분과 영양 성분에 대한 외부로의 누출을 막고, 세균이나 바이러스 등 유해한 물질에 대한 피부로의 침투를 막는 피부 본연의 기능을 강화시키는 것을 의미할 수 있다. 또한, "피부 노화 억제"는 주름, 피부의 쳐짐, 탄력성 감소 등과 같은 피부의 기능 저하를 억제하는 것을 의미할 수 있다. 이때, 상기 피부 노화는 광노화, 예를 들어, 자외선에 의한 피부 노화일 수 있다.
종래의 기능성 펩타이드는 유효한 생물학적 활성에도 불구하고 펩타이드 자체의 크기로 인해, 표적 조직 또는 세포에 효과적으로 유입되지 못하거나 반감기가 짧아 단기간에 체내에서 소멸되는 단점을 보여 주었다. 반면, 일 실시예에 따른 화장료 조성물은 10개 이하의 아미노산으로 이루어진 펩타이드를 유효성분으로 포함하며, 이에 따라, 유효성분의 피부 침투율 등이 매우 우수하고, 예를 들어, 국소적으로 피부에 도포하는 경우, 피부 상태를 효과적으로 개선할 수 있다.
일 실시예에 따르면, 섬유아세포 및 각질형성세포의 증식을 촉진하고, 세포외 기질 구성 인자 및 피부 장벽 인자의 합성을 증진시킬 수 있었다. 또한, 상기 펩타이드는 섬유아세포 및 각질형성세포의 저해된 활성을 회복시키고 이들의 항산화 효능을 증진시킬 수 있음을 보여주었다. 따라서, 상기 펩타이드는 피부 상태 개선용 화장료 조성물의 유효성분으로 활용될 수 있다.
상기 화장료 조성물은 상기 펩타이드의 화장품학적 유효량(cosmetically effective amount); 및/또는 화장품학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 사용되는 용어 "화장품학적 유효량"은 상기 화장료 조성물의 피부 상태 개선 효능을 달성하는 데 충분한 양을 의미한다.
상기 펩타이드 및 화장품학적으로 허용되는 담체간 중량비는 예를 들어, 500:1 내지 1:500일 수 있으며, 일례로서, 상기 중량비는 450:1 내지 1:450, 400:1 내지 1:400, 350:1 내지 1:350, 300:1 내지 1:300, 250:1 내지 1:250, 200:1 내지 1:200, 150:1 내지 1:150, 100:1 내지 1:100, 80:1 내지 1:80, 60:1 내지 1:60, 40:1 내지 1:40, 20:1 내지 1:20, 10:1 내지 1:10, 8:1 내지 1:8, 6:1 내지 1:6, 4:1 내지 1:4, 또는 2:1 내지 1:2일 수 있으나, 이에 제한되는 것은 아니다.
상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 예를 들어, 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르를 포함할 수 있다.
상기 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등 이 이용될 수 있다.
상기 화장료 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
상기 펩타이드는 피부 투과 문제 또는 안정성 문제를 보다 개선시키기 위하여 나노좀 또는 나노파티클에 함유될 수 있다. 예를 들어, 상기 나노좀은 레시틴을 원료로 사용하여 마이크로플루다이져로 제조될 수 있고, 레시틴 입자 내에 함유될 수 있다. 상기 나노좀의 제조 방법은 공지의 것이라면 어떠한 방법이라도 사용될 수 있다. 상기 나노좀 입자의 크기는 30 내지 200 nm인 것이 바람직하다. 상기 나노좀 입자의 크기가 30 nm 미만인 경우에는 피부 침투가 매우 빨리 진행되어 피부 부작용이 발생할 수 있고, 200 nm를 초과하는 경우에는 피부 침투가 용이하지 않아 나노좀 구조를 사용하는 효과를 얻기 어려울 수 있다.
상기 화장료 조성물에 포함되는 성분은 유효성분으로서의 펩타이드와 담체 성분 이외에, 화장료 조성물에 통상적으로 이용되는 성분들을 포함하며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.
상기 화장료 조성물에 함유된 유효성분으로서 펩타이드의 함량은 제품의 형태, 소망하는 용도 등에 따라 적절하게 비제한적으로 선택될 수 있으며, 예를 들어, 전체 화장료 조성물 중량의 0.01 내지 15 중량%로 첨가할 수 있다. 또한 예를 들어, 화장료 조성물은 전체 중량을 기준으로 1.0 중량% 내지 3.0 중량%, 바람직하게는 2.0 중량% 내지 3.0 중량%로 펩타이드를 포함할 수 있다.
또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 화장료 조성물을 개체의 피부에 도포하는 단계를 포함하는, 피부 상태를 개선하는 방법; 피부 상태 개선을 위한 조성물의 제조를 위한 상기 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 용도를 제공한다.
상기 화장료 조성물에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.
본 명세서에서 사용되는 용어, 상기 "개체"는 피부 상태 개선을 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐(mouse), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 명세서에서 사용되는 용어, "적용하는", "투여하는", 및 "도포하는"은 상호교환적으로 사용되고 일 실시예에 따른 조성물을 원하는 부위로의 적어도 부분적 국소화를 초래하는 것, 또는 투여 경로에 의해 개체 내로 일 실시예에 따른 조성물의 배치하는 것을 의미할 수 있다.
또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 항산화용 조성물을 제공한다.
상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.
상기 항산화용 조성물은 약제학적 조성물, 의약외품 조성물, 또는 화장료 조성물의 형태일 수 있으며, 일례로서, 상기 조성물은 피부 상태 개선을 위한 화장료 조성물, 또는 피부 손상과 관련된 질환의 상태를 개선 또는 치료하기 위한 약제학적 조성물로 활용될 수 있다.
일 실시예에 따르면, 상기 펩타이드는 상기 펩타이드는 섬유아세포 및 각질형성세포의 저해된 활성을 회복시키고 이들의 항산화 효능을 증진시킬 수 있음을 보여주었다. 따라서, 상기 펩타이드는 항산화용 조성물의 유효성분으로 활용될 수 있다.
상기 항산화용 조성물은 일례로서, 약제학적 조성물 형태로 제공될 수 있다. 상기 약제학적 조성물은 상기 펩타이드의 약제학적 유효량 (pharmaceutically effective amount); 및/또는 약제학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 사용되는 용어 "약제학적 유효량"은 상기 약제학적 조성물의 피부 손상과 관련된 질환의 예방 또는 치료 효능을 달성하는 데 충분한 양을 의미할 수 있다.
상기 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
상기 펩타이드 및 약제학적으로 허용되는 담체간 중량비는 예를 들어, 500:1 내지 1:500일 수 있으며, 일례로서, 상기 중량비는 450:1 내지 1:450, 400:1 내지 1:400, 350:1 내지 1:350, 300:1 내지 1:300, 250:1 내지 1:250, 200:1 내지 1:200, 150:1 내지 1:150, 100:1 내지 1:100, 80:1 내지 1:80, 60:1 내지 1:60, 40:1 내지 1:40, 20:1 내지 1:20, 10:1 내지 1:10, 8:1 내지 1:8, 6:1 내지 1:6, 4:1 내지 1:4, 또는 2:1 내지 1:2일 수 있으나, 이에 제한되는 것은 아니다.
상기 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물의 투여량은 1일당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 제한되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있다.
또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 식품 조성물을 제공한다.
상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.
상기 식품 조성물에 함유된 유효성분으로서의 펩타이드의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 비제한적으로 선택될 수 있으며, 예를 들어, 전체 식품 중량의 0.01 내지 15 중량%로 첨가할 수 있다. 또한 예를 들어, 건강 음료 조성물은 100 ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 첨가할 수 있다.
일 양상에 따른 펩타이드에 의하면, 섬유아세포 및 각질형성세포의 증식을 촉진하고, 세포외 기질 구성 인자 및 피부 장벽 인자의 합성을 증진시킴으로써, 주름 개선, 피부 탄력 개선, 상처 회복, 피부 장벽 강화, 또는 피부 노화 억제 등을 포함하는 피부 상태 개선에 적용할 수 있다
일 양상에 따른 펩타이드에 의하면, 섬유아세포 및 각질형성세포의 저해된 활성을 회복시키고 이들의 항산화 효능을 증진시킴으로써, 자외선 등에 의한 외부 환경으로부터 야기될 수 있는 피부 손상을 회복하는데 기여할 수 있다.
따라서, 일 양상에 따른 펩타이드는 피부 상태 개선용 조성물 또는 항산화용 조성물의 유효성분으로 활용될 수 있다.
도 1은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 피부 세포에 첨가한 후, 세포 증식 수준을 확인한 것으로서, 도 1의 A는 NIH3T3 세포의 생존율 변화를 나타낸 결과이고, 도 1의 B는 HaCaT 세포의 생존율 변화를 나타낸 결과이다.
도 2는 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 NIH3T3 세포에 첨가한 후, 세포외 기질 구성 인자인 Col1a1, 피브로넥틴, 및 엘라스틴의 발현 증가를 확인한 결과이다.
도 3은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 NIH3T3 세포에 첨가한 후, 세포외 기질 구성 인자의 발현 수준을 정량적으로 평가한 것으로서, 도 3의 A는 Col1a1의 발현 수준을 확인한 결과이고, 도 3의 B는 피브로넥틴의 발현 수준을 확인한 결과이며, 도 3의 C는 엘라스틴의 발현 수준을 확인한 결과이다.
도 4는 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 HaCaT 세포에 첨가한 후, 피부 장벽 인자인 SIRT-1 및 AQP3의 발현 증가를 확인한 결과이다.
도 5는 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 HaCaT 세포에 첨가한 후, 피부 장벽 인자의 발현 수준을 정량적으로 평가한 것으로서, 도 5의 A는 SIRT-1의 발현 수준을 확인한 결과이고, 도 5의 B는 AQP3의 발현 수준을 확인한 결과이다.
도 6은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 피부 세포에 첨가한 후, 자외선 조사에 의해 유도된 피부 세포의 사멸에 대한 억제 효과를 생존율 평가를 통해 확인한 것으로서, 도 6의 A는 NIH3T3 세포의 생존율 변화를 나타낸 결과이고, 도 6의 B는 HaCaT 세포의 생존율 변화를 나타낸 결과이다.
도 7은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 피부 세포에 첨가한 후, 자외선 조사에 의해 유도된 피부 세포에 대한 항산화 효과를 활성 산소 수준 평가를 통해 확인한 것으로서, 도 7의 A는 NIH3T3 세포의 활성 산소 수준 변화를 나타낸 결과이고, 도 6의 B는 HaCaT 세포의 활성 산소 수준 변화를 나타낸 결과이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 펩타이드의 합성
자동 펩타이드 합성기(Milligen 9050, Millipore, 미국)를 이용하여 하기의 [표 1]에 기재된 서열번호 1의 아미노산 서열을 갖는 펩타이드를 합성하고, C18 역상 고성능액체크로마토그래피(HPLC)(Waters Associates, 미국)를 이용하여 이들 합성된 펩타이드를 순수 분리하였다. 컬럼은 ACQUITY UPLC BEH300 C18 (2.1㎜ Х 100㎜, 1.7㎛, Waters Co, 미국)을 이용하였다.
서열번호 | 서열 (5'->3') |
1 | EALKYWYEN |
실시예 2. 피부 세포에 대한 증식 촉진 효과 확인
본 실시예에서는 마우스 섬유아세포인 NIH3T3 세포 또는 인간 각질형성세포인 HaCaT 세포의 생존율 변화를 평가함으로써, 피부 세포의 증식에 일 실시예에 따른 펩타이드가 미치는 영향을 확인하고자 하였다.
구체적으로, NIH3T3 세포 또는 HaCaT 세포를 96-웰 플레이트에 5×103 cells/well의 밀도로 시딩한 후, 이를 24 시간 동안 배양하였다. 이후, 상기 세포를 무혈청 배지 (serum-free DMEM media)로 1회 세척하고, 배양 배지를 상기 무혈청 배지로 교체하였다. 이후, 상기 배지에 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 50μM, 또는 100μM씩 분주하고, 이를 37℃ 조건의 CO2 인큐베이터에서 72 시간 동안 배양하였다. 이후, 상기 배양물을 PBS로 2회 세척한 후, 여기에 4% 파라포름알데히드(PFA) 용액을 15분간 처리하여 배양된 세포를 고정시켰다. 이후, 이를 증류수로 2회 세척하고, SRB 용액을 1시간 처리하여 세포 염색을 실시하고, 이를 1% 아세트산 용액으로 세척한 뒤, 건조시켰다. 이후, 상기 건조된 배양물을 20mM Tris 완충액에 녹인 후, microplate reader (Molecular Devices, USA)를 이용하여 560nm에서의 흡광도를 측정하였다. 본 실시예에서 대조군은 비처리군, 양성 대조군으로는 인슐린 유사 성장 인자를 첨가한 군(IGF)을 사용하였다.
그 결과, 도 1에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해, 섬유아세포 및 각질형성세포의 증식이 촉진됨을 확인하였다.
실시예 3. 주름 개선 및 탄력 증진 효과 확인
본 실시예에서는 진피의 구성 성분으로 알려진 콜라겐 type 1(Col1a1), 피브로넥틴 또는 엘라스틴의 발현 수준을 평가함으로써, 주름 개선 및 탄력 증진 등을 포함하는 내인성 피부 노화 개선에 일 실시예에 따른 펩타이드가 미치는 영향을 확인하고자 하였다.
구체적으로, NIH3T3 세포를 6-웰 플레이트에 3×105 cells/well의 밀도로 시딩한 후, 이를 24 시간 동안 배양하였다. 이후, 상기 세포를 무혈청 배지(serum-free DMEM media)로 1회 세척하고, 배양 배지를 상기 무혈청 배지로 교체하였다. 이후, 상기 배지에 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 50μM, 또는 100μM씩 분주하고, 이를 37℃ 조건의 CO2 인큐베이터에서 24 시간 동안 배양하였다. 이후, 상기 배양물을 PBS로 2회 세척한 후, easy blue(iNtRON, Korea)를 이용하여 배양물로부터 RNA를 분리하였다. RT kit (Enzynomics, Korea)를 이용하여, 상기 분리된 RNA 1μg를 역전사시켜 각각의 cDNA를 합성하였다. 이후, 상기 cDNA와 Col1a1, 피브로넥틴, 및 엘라스틴 프라이머를 사용하여 중합효소연쇄 반응(polymerase chain reaction: PCR)을 수행하였다. 한편, 대조군은 비처리군, 양성 대조군으로는 TGF-β1을 첨가한 군(TGF-β1)을 사용하였으며, 본 실시예에서 사용한 프라이머의 뉴클레오타이드 서열은 하기 표 2와 같다.
프라이머명 | 서열 (5'->3') | 서열번호 | |
Col1a1 | 정방향 | CACCCTCAAGAGCCTGAGTC | 2 |
역방향 | AGACGGCTGAGTAGGGAACA | 3 | |
Fibronectin | 정방향 | CCAGGAACCGAGTACACCAT | 4 |
역방향 | ATACCCAGGTTGGGTGATGA | 5 | |
Elastin | 정방향 | GCAAGACCTGGCTTTGGACT | 6 |
역방향 | GGGAGTTTCTGGTTAGGGCTG | 7 | |
GAPDH | 정방향 | GGAGCCAAAAGGGTCATCAT | 8 |
역방향 | GTGATGGCATGGACTGTGGT | 9 |
그 결과, 도 2 및 3에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해, 세포외 기질 구성 인자인 Col1a1, 피브로넥틴, 및 엘라스틴의 발현이 증가됨을 확인하였다. 상기 결과를 통해, 일 실시예에 따른 펩타이드는 세포외 기질 구성 인자를 증가시킴으로써, 주름 개선 및 탄력 증진 등을 포함하는 내인성 피부 노화 개선에 기여함을 알 수 있었다.
실시예 4. 피부 장벽 강화 효과 확인
본 실시예에서는 시르투인-1(SIRT-1) 또는 아쿠아포린-3(AQP3)의 발현 수준을 평가함으로써, 피부 장벽 방화에 일 실시예에 따른 펩타이드가 미치는 영향을 확인하고자 하였다.
구체적으로, HaCaT 세포를 6-웰 플레이트에 3×105 cells/well의 밀도로 시딩한 후, 이를 24 시간 동안 배양하였다. 이후, 상기 세포를 무혈청 배지 (serum-free DMEM media)로 1회 세척하고, 배양 배지를 상기 무혈청 배지로 교체하였다. 이후, 상기 배지에 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 50μM, 또는 100μM씩 분주하고, 이를 37℃ 조건의 CO2 인큐베이터에서 24 시간 동안 배양하였다. 이후, 상기 배양물을 PBS로 2회 세척한 후, easy blue(iNtRON, Korea)를 이용하여 배양물로부터 RNA를 분리하였다. RT kit(Enzynomics, Korea)를 이용하여, 상기 분리된 RNA 1 μg를 역전사시켜 각각의 cDNA를 합성하였다. 이후, 상기 cDNA와 시르투인-1, 및 아쿠아포린-3 프라이머를 사용하여 중합효소연쇄 반응을 수행하였다. 한편, 대조군은 비처리군, 양성 대조군으로는 EGF를 첨가한 군(EGF)을 사용하였으며, 본 실시예에서 사용한 프라이머의 뉴클레오타이드 서열은 하기 표 3과 같다.
프라이머명 | 서열 (5'->3') | 서열번호 | |
SIRT1 | 정방향 | TCAGTGGCTGGAACAGTGAG | 10 |
역방향 | TCTGGCATGTCCCACTATCA | 11 | |
AQP3 | 정방향 | CCTTCTTGGGTGCTGGAATA | 12 |
역방향 | ACACGATAAGGGAGGCTGTG | 13 | |
GAPDH | 정방향 | GGAGCCAAAAGGGTCATCAT | 8 |
역방향 | GTGATGGCATGGACTGTGGT | 9 |
그 결과, 도 4 및 5에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해, 피부 장벽 인자인 SIRT-1 및 AQP3의 발현이 증가됨을 확인하였다. 상기 결과를 통해, 일 실시예에 따른 펩타이드는 피부 장벽 인자를 증가시킴으로써, 피부 장벽 강화 및 피부 항노화에 기여함을 알 수 있었다.
실시예 5. 자외선에 의해 유도된 피부 세포의 사멸에 대한 억제 효과 확인
본 실시예에서는 자외선 조사에 의해 사멸이 유도된 피부 세포에 대한 생존율 변화를 평가함으로써, 자외선에 의해 유도된 피부 세포의 사멸 억제 또는 세포의 회복에 일 실시예에 따른 펩타이드가 미치는 영향을 확인하고자 하였다.
구체적으로, NIH3T3 세포 또는 HaCaT 세포를 96-웰 플레이트에 1×104 cells/well의 밀도로 시딩한 후, 이를 24 시간 동안 배양하였다. 이후, 상기 세포를 무혈청 배지 (serum-free DMEM media)로 1회 세척하고, 배양 배지를 상기 무혈청 배지로 교체한 뒤, 여기에 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 50μM, 또는 100μM씩 분주하였다. 상기 펩타이드가 분주된 배양 배지를 37℃ 조건의 CO2 인큐베이터에서 1시간 동안 배양하고, 이를 e-tube에 옮겨 담은 뒤, 100ul의 PBS을 혼합하여 웰-플레이트에 분주하였다. 이후, UV 조사기(VILBER LOURMAT, France) 를 이용하여, NIH3T3 세포를 대상으로 6J/cm2의 자외선을 조사하였고, HaCaT 세포를 대상으로 15mJ/cm2의 자외선을 조사하였다. 이후, 상기 웰 플레이트 내 PBS를 제거하고, 상기 펩타이드가 분주된 배양배지 900μL를 첨가한 뒤, 37℃ 조건의 CO2 인큐베이터에서 72시간 동안 배양하였다. 이후, 상기 배양물을 PBS로 2회 세척한 후, 여기에 4% 파라포름알데히드(PFA) 용액을 15분간 처리하여 배양된 세포를 고정시켰다. 이후, 이를 증류수로 2회 세척하고, SRB 용액을 1시간 동안 처리하여 세포 염색을 실시하고, 이를 1% 아세트산 용액으로 세척한 뒤, 건조시켰다. 이후, 상기 건조된 배양물을 20mM Tris 완충액에 녹인 후, microplate reader(Molecular Devices, USA)를 이용하여 560nm에서의 흡광도를 측정하였다. 본 실시예에서 대조군은 비처리군, 양성 대조군으로는 Trolox를 첨가한 군(Trolox)을 사용하였다.
그 결과, 도 6에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해, 자외선 조사에 의해 감소된 섬유아세포 및 각질형성세포의 세포 생존율이 회복됨을 확인하였다. 상기 결과를 통해, 일 실시예에 따른 펩타이드는 자외선에 의해 유도된 피부 세포의 사멸에 대한 억제에 기여함을 알 수 있었다.
실시예 6. 자외선에 의해 유도된 피부 세포에 대한 항산화 효과 확인
본 실시예에서는 자외선 조사에 의해 증가된 피부 세포 내 활성 산소 수준을 평가함으로서, 자외선에 의해 유도된 피부 세포에서의 항산화 효과에 일 실시예에 따른 펩타이드가 미치는 영향을 확인하고자 하였다.
구체적으로, NIH3T3 세포 또는 HaCaT 세포를 6-웰 플레이트에 5×105 cells/well의 밀도로 시딩한 후, 이를 24 시간 동안 배양하였다. 이후, 상기 세포를 무혈청 배지 (serum-free DMEM media)로 1회 세척하고, 배양 배지를 상기 무혈청 배지로 교체한 뒤, 여기에 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 50μM, 또는 100μM씩 분주하였다. 상기 펩타이드가 분주된 배양 배지를 37℃ 조건의 CO2 인큐베이터에서 1시간 동안 배양하고, 이를 e-tube에 옮겨 담은 뒤, 100ul의 PBS을 혼합하여 웰-플레이트에 분주하였다. 이후, UV 조사기(VILBER LOURMAT, France) 를 이용하여, NIH3T3 세포를 대상으로 6J/cm2의 자외선을 조사하였고, HaCaT 세포를 대상으로 15mJ/cm2의 자외선을 조사하였다. 이후, 상기 웰 플레이트 내 PBS를 제거하고, 상기 펩타이드가 분주된 배양배지 900μL를 첨가한 뒤, 37℃ 조건의 CO2 인큐베이터에서 24시간 동안 배양하였다. 이후, 상기 배양물에 DCFG-DA (2',7'-dichlorofluorescin diacetate)를 처리하고, 호일로 감싼 뒤, 이를 37℃ 조건의 CO2 인큐베이터에서 30분간 배양하였다. 이후, 이를 PBS로 2회 세척한 후, 여기에 1× trypsin/EDTA 500 μL을 처리하여 세포를 수득한 뒤, 원심분리를 실시하였다. 원심분리한 세포를 PBS로 세척한 뒤, flow cytometry(FACS, BD, USA)를 통해 FL1형광 값을 측정하였다. 본 실시예에서 대조군은 비처리군, 양성 대조군으로는 Trolox를 첨가한 군(Trolox)을 사용하였다.
그 결과, 도 7에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해, 자외선 조사에 의해 증가된 섬유아세포 및 각질형성세포 내 활성 산소 수준이 감소됨을 확인하였다. 상기 결과를 통해, 일 실시예에 따른 펩타이드는 자외선에 의해 유도된 피부 세포에 대한 항산화 효과에 기여함을 알 수 있었다.
제형예 1. 유연 화장수
일 실시예에 따른 펩타이드를 포함하며, 하기의 조성으로 이루어진 유연수 화장수를 당업계 공지의 방식을 채용하여 제조하였다.
성분 | 함량(중량%) |
펩타이드 | 1.0 |
1,3-부틸렌글리콜 | 6 |
글리세린 | 4 |
PEG 1500 | 1 |
소듐히알루로네이트 | 1 |
폴리솔베이트 20 | 0.5 |
에탄올 | 8 |
벤조페논-9 | 0.05 |
방부제, 색소 | 적량 |
향 | 적량 |
정제수 | 잔량 |
합계 | 100 |
제형예 2. 영양 크림
일 실시예에 따른 펩타이드를 포함하며, 하기의 조성으로 이루어진 영양 크림을 당업계 공지의 방식을 채용하여 제조하였다.
성분 | 함량(중량%) |
펩타이드 | 2.5 |
메도우폼오일 | 3 |
세테아릴알콜 | 1.5 |
스테아린산 | 1.5 |
글리세릴스테아레이트 | 1.5 |
유동 파라핀 | 10 |
밀납 | 2 |
폴리솔베이트 60 | 0.6 |
솔비탄 세스퀴올레이트 | 2.5 |
스쿠알란 | 3 |
1,3-부틸렌글리콜 | 3 |
글리세린 | 5 |
트리에탄올아민 | 0.5 |
토코페릴아세테이트 | 0.5 |
방부제, 색소 | 적량 |
향 | 적량 |
정제수 | 잔량 |
합계 | 100 |
제형예 3. 영양 화장수
일 실시예에 따른 펩타이드를 포함하며, 하기의 조성으로 이루어진 영양 화장수를 당업계 공지의 방식을 채용하여 제조하였다.
성분 | 함량(중량%) |
펩타이드 | 3.0 |
1,3-부틸렌글리콜 | 4 |
글리세린 | 4 |
세테아릴알콜 | 0.8 |
글리세릴스테아레이트 | 1 |
트리에탄올아민 | 0.13 |
토코페릴아세테이트 | 0.3 |
유동파라핀 | 5 |
스쿠알란 | 3 |
오일 | 2 |
폴리솔베이트 60 | 1.5 |
솔비탄세스퀴올레이트 | 0.5 |
카르복시비닐폴리머 | 1 |
방부제, 색소 | 적량 |
향 | 적량 |
정제수 | 잔량 |
합계 | 100 |
제형예 4. 에센스
일 실시예에 따른 펩타이드를 포함하며, 하기의 조성으로 이루어진 에센스를 당업계 공지의 방식을 채용하여 제조하였다.
성분 | 함량(중량%) |
펩타이드 | 2.0 |
글리세린 | 10 |
1,3-부틸렌글리콜 | 5 |
PEG 1500 | 2 |
알란토인 | 0.1 |
DL-판테놀 | 0.3 |
EDTA-2Na | 0.02 |
히드록시에틸 셀룰로오스 | 0.1 |
소듐히알루로네이트 | 8 |
카르복시비닐폴리머 | 0.2 |
트리에탄올아민 | 0.18 |
옥틸도데세스-16 | 0.4 |
에탄올 | 6 |
방부제, 색소 | 적량 |
향 | 적량 |
정제수 | 잔량 |
합계 | 100 |
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
Claims (7)
- 서열번호 1의 아미노산 서열로 이루어진, 펩타이드.
- 청구항 1에 있어서, 상기 펩타이드의 N-말단은 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group), 부톡시카르보닐기(butoxycarbonyl group), 아릴옥시카르보닐기(allyloxycarbonyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합된 것인, 펩타이드.
- 청구항 1에 있어서, 상기 펩타이드의 C-말단은 아미노기(amino group, -NH2), 삼차 알킬기(tertiary alkyl group) 및 아자이드(azide, -NHNH2)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합된 것인, 펩타이드.
- 청구항 1에 있어서, 상기 펩타이드는 하기와 같은 특성으로부터 선택되는 어느 하나 이상을 나타내는 것인, 펩타이드:(a) 섬유아세포 또는 각질형성세포의 증식 촉진;(b) 세포외 기질 구성 인자인 콜라겐 type 1(Col1a1), 피브로넥틴, 또는 엘라스틴의 발현 증진;(c) 피부 장벽 인자인 시르투인-1(SIRT-1) 또는 아쿠아포린-3 (AQP3)의 발현 증진; 및(d) 섬유아세포 또는 각질형성세포의 사멸 억제 및 활성 산소 수준의 감소.
- 청구항 1 내지 4 중 어느 한 항의 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물.
- 청구항 5에 있어서, 상기 피부 상태 개선은 주름 개선, 피부 탄력 개선, 상처 회복, 피부 장벽 강화, 또는 피부 노화 억제인 것인, 화장료 조성물.
- 청구항 6에 있어서, 상기 피부 노화는 자외선에 의한 피부 노화인 것인, 화장료 조성물.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210188874A KR20230099481A (ko) | 2021-12-27 | 2021-12-27 | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 |
KR10-2021-0188874 | 2021-12-27 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2023127985A1 true WO2023127985A1 (ko) | 2023-07-06 |
Family
ID=86999284
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2021/020014 WO2023127985A1 (ko) | 2021-12-27 | 2021-12-28 | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR20230099481A (ko) |
WO (1) | WO2023127985A1 (ko) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20150126621A (ko) * | 2013-03-13 | 2015-11-12 | 네오큐티스 에스아 | 피부 회춘을 위한 펩타이드 및 이것을 사용하는 방법 |
KR20190024914A (ko) * | 2019-01-14 | 2019-03-08 | (주)케어젠 | 주름 개선 활성을 나타내는 펩타이드 및 이의 용도 |
KR20200002868A (ko) * | 2017-03-30 | 2020-01-08 | 이스케이프 테라퓨틱스, 인코퍼레이티드 | 표피 각화 전구세포에 있어서의 시르투인 유전자 발현의 데카펩티드-12 조절 |
KR20200086395A (ko) * | 2019-01-08 | 2020-07-17 | 주식회사 바이오에프디엔씨 | 항상성 증가를 통한 피부면역개선, 외부환경에 대한 피부보호 및 피부활력증진을 위한 인삼 유래 테트라펩타이드를 함유하는 화장료 조성물 |
KR20210022405A (ko) * | 2019-08-20 | 2021-03-03 | (주)케어젠 | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 |
-
2021
- 2021-12-27 KR KR1020210188874A patent/KR20230099481A/ko unknown
- 2021-12-28 WO PCT/KR2021/020014 patent/WO2023127985A1/ko unknown
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20150126621A (ko) * | 2013-03-13 | 2015-11-12 | 네오큐티스 에스아 | 피부 회춘을 위한 펩타이드 및 이것을 사용하는 방법 |
KR20200002868A (ko) * | 2017-03-30 | 2020-01-08 | 이스케이프 테라퓨틱스, 인코퍼레이티드 | 표피 각화 전구세포에 있어서의 시르투인 유전자 발현의 데카펩티드-12 조절 |
KR20200086395A (ko) * | 2019-01-08 | 2020-07-17 | 주식회사 바이오에프디엔씨 | 항상성 증가를 통한 피부면역개선, 외부환경에 대한 피부보호 및 피부활력증진을 위한 인삼 유래 테트라펩타이드를 함유하는 화장료 조성물 |
KR20190024914A (ko) * | 2019-01-14 | 2019-03-08 | (주)케어젠 | 주름 개선 활성을 나타내는 펩타이드 및 이의 용도 |
KR20210022405A (ko) * | 2019-08-20 | 2021-03-03 | (주)케어젠 | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 |
Also Published As
Publication number | Publication date |
---|---|
KR20230099481A (ko) | 2023-07-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2021033829A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2021033831A1 (ko) | 피부 미백 활성을 갖는 펩타이드 및 이의 용도 | |
WO2020171285A1 (ko) | 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도 | |
WO2021033830A1 (ko) | 발모 촉진 활성을 갖는 펩타이드 및 이의 용도 | |
EP2222325A2 (en) | Compositions for reducing oxidative stress and uses thereof | |
WO2017164609A2 (ko) | 피부 재생 또는 상처 치료용 펩타이드 및 이의 용도 | |
WO2017116138A1 (ko) | 멜라닌 억제 기능성 펩티드 및 이를 포함하는 조성물 | |
KR101908077B1 (ko) | 천연 한방 추출물을 유효성분으로 포함하는 미백, 피부 노화 방지 또는 피부 주름 개선용 조성물 | |
WO2023055007A1 (ko) | 항노화 활성을 갖는 펩타이드 및 이의 용도 | |
WO2021033833A1 (ko) | 피부 미백 활성을 갖는 펩타이드 및 이의 용도 | |
WO2023127985A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2023127984A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2023127986A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2023054817A1 (ko) | 항노화 활성을 갖는 펩타이드 및 이의 용도 | |
WO2021033832A1 (ko) | 발모 촉진 활성을 갖는 펩타이드 및 이의 용도 | |
WO2023127987A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2019139403A1 (ko) | 세리신, 사상자 추출물 및 겨우살이 추출물을 포함하는, 피부 재생, 진정 또는 상처 치유용 조성물 | |
WO2024106587A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2024106588A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2024106585A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2022124776A1 (ko) | 알로페론 판토텐산 복합체를 유효성분으로 함유하는 미백용 또는 주름개선용 조성물 | |
WO2021251790A1 (ko) | 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도 | |
WO2024122713A1 (ko) | 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도 | |
WO2019225891A1 (ko) | 아이리린 b를 포함하는 피부 항노화 조성물 | |
WO2023055006A1 (ko) | 항노화 활성을 갖는 펩타이드 및 이의 용도 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21970055 Country of ref document: EP Kind code of ref document: A1 |