WO2020171285A1 - 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도 - Google Patents

대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도 Download PDF

Info

Publication number
WO2020171285A1
WO2020171285A1 PCT/KR2019/004881 KR2019004881W WO2020171285A1 WO 2020171285 A1 WO2020171285 A1 WO 2020171285A1 KR 2019004881 W KR2019004881 W KR 2019004881W WO 2020171285 A1 WO2020171285 A1 WO 2020171285A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
skin
aging
contaminants
cells
Prior art date
Application number
PCT/KR2019/004881
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to US17/059,909 priority Critical patent/US11433013B2/en
Priority to JP2020567020A priority patent/JP7048766B2/ja
Priority to CN201980037621.8A priority patent/CN112236441B/zh
Priority to BR112021016104A priority patent/BR112021016104A2/pt
Priority to EP19916142.3A priority patent/EP3904369A4/en
Publication of WO2020171285A1 publication Critical patent/WO2020171285A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/16—Emollients or protectives, e.g. against radiation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids

Definitions

  • the present invention relates to a novel peptide having an anti-aging effect and an activity for preventing skin damage by contaminants, and a use thereof.
  • Air pollutants have the greatest effect on the respiratory tract among the internal organs of the human body, but the skin with the largest surface area in direct contact with pollutants and continuous exposure is one of the organs that are the main targets of pollutants.
  • the problem of skin health deterioration caused by the external environment has been focused on problems caused by ultraviolet rays contained in sunlight, but due to the increasingly deteriorating air pollution problem and the increase of pollutants in the air, studies are no longer relevant.
  • the aryl hydrocarbon receptor is a key receptor that plays a role in inducing skin damage by transmitting harmful signals within cells when air pollutants contact the skin.
  • 2,3,7,8-tetra Dioxins such as chlorodibenzo-p-dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD) and polyaromatic hydrocarbons (PAHs) are bound to the AhR when exposed to the human skin Thus, it moves to the cell nucleus, like the mechanism of action of steroid hormones, and causes a toxic mechanism.
  • the dioxin complex bound to AhR binds to the Arnt (AhR nuclear translocator) protein present in the nucleus, and the AhR/Arnt complex is a transcriptional regulatory region of the target gene including Cytochrome P450s (P450 or cyps; CYP1A1, CYP1A2, and CYP1B1). It binds to a nucleotide sequence called DRE or XRE (drug/xenobiotic responsive element) in induces the transcription of several gene groups, resulting in toxicity.
  • DRE drug/xenobiotic responsive element
  • skin cells may undergo aging due to various causes, and wrinkles may occur due to aging of skin cells. It can be divided into chronological aging (intrinsic aging), which is a natural aging that appears over time according to biological processes, and degenerative change occurring in the area exposed to sunlight, and photoaging (photosensitive aging) in which the chronological aging is combined. I can. When the expression or activity of various factors related to cell growth is inhibited, natural cell aging may occur, and photoaging of skin cells may proceed by light of 280 nm to 400 nm wavelength contained in sunlight.
  • chronological aging intrinsic aging
  • photoaging photosensitive aging
  • UVB ultraviolet rays
  • UVB having a wavelength in the range of 280 nm to 320 nm
  • damage to the skin or fibers may occur, and a soot phenomenon may occur in which the skin burns black.
  • UVB When UVB is irradiated, the accumulation of ROS and free radicals in skin cells is promoted, and by stimulating the intracellular signaling system by radicals, it can induce oxidative stress on biomolecules such as DNA, proteins, and lipids. Damage may occur.
  • An object of the present invention is to provide a peptide that can be used to protect skin cells by preventing skin damage caused by pollutants by inhibiting the influx of contaminants such as dioxin, fine dust, cigarette smoke, and the like.
  • an object of the present invention is to provide a peptide that can be used to reduce the aging phenomenon of skin cells that occurs naturally or is caused by ultraviolet rays of sunlight, thereby improving skin wrinkles.
  • an object of the present invention is to provide a pharmaceutical composition capable of preventing or treating diseases caused by contaminants or improving skin aging, including the above peptide as an active ingredient.
  • an object of the present invention is to provide a cosmetic composition capable of preventing skin damage by contaminants and improving skin aging by including the above peptide as an active ingredient.
  • one aspect of the present invention provides a peptide for preventing skin damage by contaminants, comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the invention provides a skin anti-aging peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating diseases caused by contaminants, comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the present invention provides a pharmaceutical composition for improving skin aging, comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the present invention provides a cosmetic composition for preventing skin damage due to contaminants or improving skin aging, containing a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
  • the peptides provided by the present invention prevent the influx of pollutants such as dioxin, fine dust, cigarette smoke, etc. existing in the air into the cells, and suppress the aging phenomenon of skin cells, so cancer and skin that can be caused by pollutants It can be usefully used as an active ingredient in a pharmaceutical composition that prevents or treats diseases, lung diseases, or improves skin aging, and can be used as an active ingredient in a cosmetic composition to protect the skin from contaminants and to improve skin aging and wrinkles. It can have an effect.
  • pollutants such as dioxin, fine dust, cigarette smoke, etc.
  • 1A to 1C are Western blotting results showing the amount of AhR nuclear transfer when treated with TCDD, PM, and CSE, respectively, for HaCaT cells treated with the peptide containing the amino acid sequence of SEQ ID NO: 1.
  • Con means control
  • NC means negative control.
  • 1D is a Western blotting result showing the amount of AhR nuclear transfer when CSE was treated with respect to A549 cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • 2A to 2C are RT-PCR results showing the expression levels of CYP1A1 and COX-2 genes when treated with TCDD, PM, and CSE, respectively, for HaCaT cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1. to be.
  • 3A and 3B are Western blotting results showing the amount of proteins of MMP-1 and COX-2 when treated with TCDD and PM, respectively, for HaCaT cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1. .
  • 4A and 4B are photographs confirming whether the peptide containing the amino acid sequence of SEQ ID NO: 1 is precipitated by adsorption with PM and CSE, respectively.
  • 5A is a Western blotting result showing the amount of p-Akt and p-ERK proteins of HaCaT cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • 5B is an RT-PCR result showing the expression level of the SIRT1 gene in HaCaT cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • 6A is a Western blotting result showing the amount of p-Akt and p-ERK proteins in NIH3T3 cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • 6B is an RT-PCR result showing the expression levels of collagen (Col1a1), fibronectin, and elastin genes in NIH3T3 cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • FIG. 7 is an RT-PCR result showing the expression levels of SIRT1 and AQP3 genes in HaCaT cells irradiated with UVB and treated with a peptide containing the amino acid sequence of SEQ ID NO: 1.
  • 8A is an RT-PCR result showing the expression levels of collagen (Col1a1), fibronectin, and elastin genes of NIH3T3 cells irradiated with UVB and treated with a peptide containing the amino acid sequence of SEQ ID NO: 1. .
  • Figure 8b is a gelatin character showing the result of Western blotting showing the amount of MMP-1 protein in NIH3T3 cells treated with a peptide containing the amino acid sequence of SEQ ID NO: 1 by UVB irradiation and confirming the amount of MMP-2 protein This is the result of the emography.
  • One aspect of the present invention provides a novel peptide capable of preventing skin damage caused by contaminants.
  • Another aspect of the present invention provides a novel peptide capable of inhibiting skin aging.
  • the peptide refers to a polymer consisting of two or more amino acids linked by a peptide bond.
  • the peptide itself is too large to effectively enter the target tissue or cell, or has a short half-life and thus disappears in the body in a short period of time.
  • the peptide is composed of 20 or less, for example, 15 or less, or 10 or less amino acids, which have the activity of inhibiting cell entry of contaminants.
  • the peptide of the present invention may include the amino acid sequence of SEQ ID NO: 1, and within a range that does not affect the skin damage inhibitory activity and anti-aging activity of the skin by contaminants of the peptide, deletion, insertion, and It may be variants or fragments of amino acids having different sequences by substitution or a combination thereof.
  • Amino acid exchange at the peptide level that does not totally alter the skin damage inhibitory activity and the anti-aging activity of the skin by contaminants of the peptide is known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, and farnesylation.
  • the present invention includes a peptide comprising an amino acid sequence substantially identical to that of a peptide comprising the amino acid sequence of SEQ ID NO: 1, and a variant thereof or an active fragment thereof.
  • the substantially identical protein refers to an amino acid sequence having 75% or more, for example, 80% or more, 90% or more, 95% or more, sequence homology with the amino acid sequence of SEQ ID NO: 1.
  • the peptide may additionally include a targeting sequence, a tag, a labeled residue, a half-life, or an amino acid sequence prepared for a specific purpose to increase the stability of the peptide.
  • the peptide of the present invention can be obtained by various methods well known in the art.
  • it may be prepared by using a polynucleotide recombination and protein expression system, or by a method for in vitro synthesis through chemical synthesis such as peptide synthesis, and a cell-free protein synthesis method.
  • the N-terminus of the peptide or A protecting group may be attached to the C-terminus.
  • the protecting group may be an acetyl group, a fluorenyl methoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, or a polyethylene glycol (PEG), but it is possible to modify the peptide, especially to improve the stability of the peptide. If there is an ingredient, it can be included without limitation.
  • The'stability' means not only stability in vivo that protects the peptide of the present invention from attack by protein cleavage enzymes in vivo, but also storage stability (eg, room temperature storage stability).
  • the contaminant of the present invention may be dioxin (TCDD), particulate matter (PM), or cigarette smoke extract (CSE), but is not limited thereto. It can contain any xenobiotics that are toxic that can interfere with the growth and normal metabolic processes of the body. Prevention of skin damage by contaminants can be achieved by preventing contaminants from entering the cell, thereby making it impossible for the contaminants to be toxic within the cells.
  • TCDD dioxin
  • PM particulate matter
  • CSE cigarette smoke extract
  • the peptide of the present invention may inhibit the inflow of contaminants into cells through adsorption with the contaminants.
  • contaminants such as dioxins enter the cell, they can bind to AhR to induce expression of several gene groups, and accordingly, expression of CYP1A1, CYP1A2, CYP1B1, COX-2, MMPs, etc. may increase.
  • CYP1A1, CYP1A2, CYP1B1, COX-2, MMPs, etc. may increase.
  • By checking the change in the expression level of the genes as described above it is possible to confirm the cytoprotective effect of the peptide of the present invention by inhibiting the inflow of the contaminant into the cell.
  • the skin anti-aging of the present invention means an effect of inhibiting the aging phenomenon of skin cells.
  • the aging may be aging that occurs naturally in cells over time, may be photoaging caused by sunlight, and in particular, may be photoaging caused by ultraviolet rays.
  • the aging may be induced by intracellular oxidative stress phenomena that may be caused by various causes, thereby inhibiting cell growth or apoptosis, and inhibiting the synthesis of various fibrous proteins constituting it in skin cells. And the expression of degrading enzymes can be increased.
  • genes such as SIRT1, AQP3, Col1a1, fibronectin, and elastin are suppressed in skin cells by UV irradiation, and the expression of MMP-1 and MMP-2 genes is promoted, which can cause photoaging and wrinkles in skin cells.
  • the peptides of the present invention may increase the expression of genes in pathways related to cell proliferation in skin cells, increase the expression of a fiber protein synthesis gene, or induce the suppression of the expression of a fiber proteolytic gene. Therefore, the peptide can improve the wrinkles and elasticity of the skin by increasing the synthesis of fibrous protein, and has anti-aging activity of the skin by improving the skin barrier.
  • Anti-aging and skin of the peptide of the present invention by confirming the expression level of a protein related to cell proliferation, an anti-aging gene, a fiber protein, and a gene related to its degrading enzyme whose expression level changes as the skin aging progresses. You can check the wrinkle improvement effect.
  • dioxin and fine dust together with a peptide containing the amino acid sequence of SEQ ID NO: 1 in keratinocytes and fibroblasts .
  • the tobacco smoke extract As a result of confirming the amount of nuclear transfer of AhR, the expression level of CYP1A1, COX-2 and MMP-1, the inflow of contaminants such as the dioxin, fine dust, and tobacco smoke extract into the cell is suppressed, It was confirmed that the amount of nuclear transfer of AhR and the amount of expression of CYP1A1, COX-2, and MMP-1 according to the influx of contaminants decreased depending on the peptide treatment of the present invention (see FIGS. 1A to 3B).
  • fine dust and tobacco smoke extract are mixed with the peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention.
  • the peptide of the present invention was precipitated by adsorption with contaminants such as the fine dust and tobacco smoke extract, and it was confirmed that adsorption occurred depending on the amount of the peptide (see FIGS. 4A and 4B). .
  • keratinocytes and fibroblasts are treated with a peptide containing the amino acid sequence of SEQ ID NO: 1, and phosphorylation
  • Akt and ERK in the form of Akt, the amount of expression of SIRT1, collagen, fibronectin, and elastin, the amount of phosphorylated Akt, ERK, the amount of SIRT1 protein, and the amount of fibroproteins such as collagen, fibronectin, and elastin It was confirmed that the increase was dependent on the peptide treatment of the present invention (see FIGS. 5A to 6B).
  • the amino acid sequence of SEQ ID NO: 1 is used in keratinocytes and fibroblasts.
  • the peptide of the present invention prevents skin damage by inhibiting the inflow of contaminants such as TCDD, PM, and CSE into the cell, and inhibits the expression of genes related to photoaging caused by natural aging of skin cells or ultraviolet rays. It is clear that it has the activity of improving the wrinkles of the skin through anti-aging activity by controlling it, and therefore, the peptide of the present invention is an active ingredient of a composition for preventing skin damage by contaminants, anti-aging and improving skin wrinkles. It can be useful.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating diseases caused by contaminants containing a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
  • Another aspect of the present invention provides a pharmaceutical composition for improving skin aging containing a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
  • the peptide comprising the amino acid sequence of SEQ ID NO: 1 is the '1. It is the same as the peptide described in the section'Peptides for cell protection against contaminants or anti-aging skin cells'. 'Peptides for cell protection against contaminants or anti-aging of skin cells' are used, and hereinafter, only the configuration specific to a pharmaceutical composition for preventing or treating diseases caused by contaminants and improving skin aging will be described.
  • the peptide of the present invention has the effect of inhibiting the influx of contaminants into cells and inhibiting aging of skin cells, and the pharmaceutical composition containing the peptide as an active ingredient prevents diseases caused by contaminants or It can be used for therapeutic purposes, and it can be used for improving aging of skin cells to reduce wrinkles and improve skin elasticity.
  • Diseases caused by the pollutants refer to diseases that can be caused by pollutants such as dioxin, fine dust, and air pollutants such as cigarette smoke, skin diseases, lung diseases, nervous system diseases, reproductive system diseases, cardiovascular disease.
  • pollutants such as dioxin, fine dust, and air pollutants
  • pollutants such as cigarette smoke, skin diseases, lung diseases, nervous system diseases, reproductive system diseases, cardiovascular disease.
  • related diseases including cancer, atopic dermatitis, contact dermatitis, seborrheic dermatitis, acne, dry skin, psoriasis, lethality, immunotoxicity, peripheral nervous system damage, central nervous system damage, endocrine gland abnormalities, reproductive system disorders, infants and toddlers.
  • Developmental disorders anemia, bronchitis, emphysema, reduced lung function, asthma, chronic branchitis, arrhythmia, heart attack, angina, or myocardial infarction.
  • the pharmaceutical composition of the present invention prevents the occurrence of diseases caused by the pollutants by inhibiting the influx of pollutants into cells, or alleviates symptoms by inhibiting the pollutants additionally introduced into the cells of the patient of the disease. , It can be used for treating diseases by inhibiting the worsening of the condition.
  • the skin aging refers to a negative change in the skin condition that can be caused by natural aging or photoaging of skin cells, and reduces wrinkles, fine lines, skin elasticity and/or tension, thinning, thinning of the skin, It may be physiological and/or actinic aging such as decreased gloss and gloss, and external skin degradation due to aging such as deterioration of the dermis due to exposure to ultraviolet rays, and especially collagen fibers. have.
  • the pharmaceutical composition of the present invention restores a medically good skin condition, such as returning the skin elasticity to a normal level in relation to the skin aging caused by natural or light by inhibiting the aging phenomenon that may occur in the skin cells. It can be used to improve skin aging.
  • the pharmaceutical composition containing the peptide of the present invention as an active ingredient is a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary skill in the art. It may be prepared in a unit dosage form by formulation using or may be prepared by incorporating it into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel), and may additionally include a dispersant or a stabilizer. have.
  • the peptides included in the pharmaceutical composition may be transported in a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline, lipids, liposomes, microspheres, or nano spherical particles. They can be complexed or associated with a vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.
  • a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline, lipids, liposomes, microspheres, or nano spherical particles. They can be complexed or associated with a vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamin
  • pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, which are commonly used in formulation.
  • a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like may be additionally included in addition to the above components.
  • the pharmaceutical composition according to the present invention can be administered orally or parenterally during clinical administration, and can be used in the form of a general pharmaceutical formulation. That is, the pharmaceutical composition of the present invention can be administered in various oral and parenteral dosage forms at the time of actual clinical administration, but when formulated, diluents such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. Or it is formulated using excipients.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient, such as starch, calcium carbonate, sucrose, or It is prepared by mixing lactose and gelatin.
  • Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as the non-aqueous solvent and the suspension.
  • injectable esters such as ethyl oleate
  • Witepsol, Macrogol, Tween 61, cacao butter, laurin, glycerol, gelatin, and the like can be used as a base for suppositories.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • the'pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of disease, severity, drug activity, Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent, or may be administered in combination with a therapeutic agent for a disease caused by other contaminants or a therapeutic agent for improving skin aging, and simultaneously, separately, or sequentially with the conventional therapeutic agent. Can be administered, single or multiple administration. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.
  • the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient in the body, inactivation rate, excretion rate, type of disease, and drugs used in combination, and the route of administration, Obesity may be increased or decreased according to the severity, sex, weight, age, etc.
  • the peptide of the present invention may be administered from about 0.0001 ⁇ g to 500 mg, such as 0.01 ⁇ g to 100 mg, per 1 kg of the patient's body weight per day.
  • it may be dividedly administered several times a day, for example, 2 to 3 times a day at regular time intervals.
  • Another aspect of the present invention provides a cosmetic composition for preventing skin damage or improving skin aging by contaminants containing a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.
  • the peptide comprising the amino acid sequence of SEQ ID NO: 1 is the '1. It is the same as the peptide described in the section'Peptides for cell protection against contaminants or anti-aging skin cells'. 'Peptides for cell protection against contaminants or anti-aging of skin cells' are used, and hereinafter, only the unique composition of the cosmetic composition for preventing skin damage or improving skin aging caused by contaminants will be described.
  • the peptide of the present invention has the effect of inhibiting the influx of contaminants into cells and inhibiting aging of skin cells, and the cosmetic composition containing the peptide as an active ingredient prevents skin damage that may be caused by contaminants. It can be used for the purpose of improving the aging of skin cells, reducing wrinkles and improving the elasticity of the skin.
  • the peptide may be contained in 0.001 to 30% by weight of the total 100% by weight of the cosmetic composition, for example, 0.1 to 20% by weight, 0.1 to 10% by weight, 1 to 10% by weight, or 2 to 5% by weight. , But is not limited thereto.
  • the cosmetic composition containing the peptide of the present invention as an active ingredient may have a synergistic effect on the activity of the peptide, for example, within a range that does not affect the cell influx of contaminants of the peptide and the activity of improving aging of skin cells. It may further contain other ingredients that may have characteristics that may be.
  • fatty substances for example, fatty substances, organic solvents, solubilizing agents, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, Cosmetics such as fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics, etc. Or, it may contain an adjuvant commonly used in the field of dermatology, and the ingredients may be contained in an amount generally used in the field of cosmetics or dermatology.
  • the cosmetic composition of the present invention may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, gels, lotions, essences, creams, powders, soaps, shampoos, rinses, It can be formulated with cosmetics such as pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation or spray.
  • cosmetics such as pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation or spray.
  • a solvent, a solubilizing agent or an emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan can be used.
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or tracant, and the like may be used.
  • a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or tracant, and the like
  • the formulation is a cream or gel, wax, paraffin, tracant, animal oil, starch, cellulose derivatives, silicone, bentonite, polyethylene glycol, silica, zinc oxide or talc may be used as a carrier component.
  • a propellant such as silica, talc, aluminum hydroxy group, lactose, calcium silicate, chlorofluorohydrocarbon, propane/butane, or dimethyl ether may be included as a carrier component.
  • the formulation is a surfactant-containing cleansing
  • aliphatic alcohol sulfate aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, isethionate, methyltaurate, sarcosinate, fatty acid amide ether sulfate , Aliphatic alcohols, alkylamidobetaines, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters, and the like may be used.
  • dioxin hereinafter referred to as'TCDD'
  • particulate matter hereinafter referred to as'PM'
  • cigarette smoke extract hereinafter referred to as'CSE'
  • AhR aryl hydrocarbon receptor
  • HaCaT cells human keratinocyte
  • TCDD, PM, and CSE were treated with TCDD, PM, and CSE, respectively
  • A549 cells human alveolar epithelial cells
  • TCDD, PM, and CSE were mixed with the peptides of the present invention and reacted for 1 hour on serum-free media before use.
  • the experimental process in the case of treatment with PM and CSE was also carried out in the same manner as in the case of treatment with TCDD, PM was treated with a concentration of 50 ⁇ g/cm 2 and CSE with a concentration of 2%, respectively.
  • the CSE was prepared by filling 50 ml of PBS into a vacuum flask and connecting the flask to a vacuum pump to burn 40 cigarettes.
  • the experiment confirmed by treatment with CSE on A549 cells (human alveolar epithelial cells) is also similar to the above experimental procedure. After seeding 48 passages of A549 cells in a 6-well plate at a cell density of 5 ⁇ 10 5 /well, CSE Western blotting was performed on the nuclear protein separated by treatment.
  • TCDD, PM, and CSE were treated on HaCaT cells, and then the expression levels of CYP1A1 and COX-2 were confirmed.
  • AhR acts as a transcription factor and increases the expression of CYP1A1 and COX-2. Therefore, by checking how much genes of CYP1A1 and COX-2 are expressed, the It is possible to check the degree of inflow into the cell and whether or not AhR is active.
  • TCDD, PM, and CSE were mixed with the peptides of the present invention and reacted for 1 hour on serum-free media before use.
  • RNA was reverse transcribed into cDNA, and RT-PCR was performed using the primers (Table 2) of CYP1A1 and COX-2 (cDNA polymerization kit and PCR pre-mix: Intron, Korea).
  • GAPDH primers used for comparison of the total amount of RNA in each treatment group were those having the sequence shown in Table 2 below.
  • the experimental process in the case of treatment with PM and CSE was also carried out in the same manner as in the case of treatment with TCDD, PM was treated with a concentration of 25 ⁇ g/cm 2 and CSE with a concentration of 2%, respectively.
  • the CSE was prepared by filling 50 ml of PBS into a vacuum flask and connecting the flask to a vacuum pump to burn 40 cigarettes.
  • Sequence number Sequence name Base sequence 2 CYP1A1 forward 5'- GGATCTTTCTCTGTACCCTGG -3' 3 CYP1A1 reverse 5'- AGCATGTCCTTCAGCCCAGA -3' 4 COX-2 forward 5'- ATCATTCACCAGGCAAATTGC -3' 5 COX-2 reverse 5'- GGCTTCAGCATAAAGCGTTTG -3' 6 GAPDH forward 5'- GGTGTGAACGGATTTGGCCGTATTG -3' 7 GAPDH reverse 5'- CCGTTGAATTTGCCGTGAGTGGAGT -3'
  • TCDD and PM were treated on HaCaT cells, and then the amounts of MMP-1 and COX-2 proteins were confirmed.
  • the MMP-1 is a collagen-degrading enzyme, and when the activity of AhR is promoted by contaminants such as TCDD, AhR acts as a transcription factor to increase the expression of MMP-1 and COX-2, so MMP-1, COX-2 By checking how much of the gene is expressed, the degree of inflow of the contaminants into the cell and the activity of AhR can be confirmed.
  • TCDD and PM were mixed with the peptides of the present invention and reacted for 1 hour in serum-free media before use.
  • MMP-1 and COX were used using an anti-MMP-1 antibody (cell signaling, USA) and an anti-COX-2 antibody (Santacruz biotechnology, USA). Western blotting was performed on -2.
  • -Actin is anti- to compare the total amount of protein used in the experiment. -It was confirmed using an actin antibody (Santacruz biotechnology, USA).
  • the precipitation pattern of the peptide and contaminant mixture was observed with the naked eye.
  • the peptide containing the amino acid sequence of SEQ ID NO: 1 has the effect of trapping and adsorbing contaminant molecules such as PM and CSE, thereby inhibiting the inflow of the contaminant molecules into the skin. I can.
  • the amount of protein and gene expression related to natural aging were confirmed.
  • Akt and ERK are proteins involved in the signal transduction process related to cell proliferation, and exhibit activity in phosphorylated forms (p-Akt and p-ERK, respectively).
  • p-Akt and p-ERK phosphorylated forms
  • 81 passages of HaCaT cells were seeded in a 6-well plate at a cell concentration of 3 ⁇ 10 5 /well, and then cultured in serum free media for 24 hours, and then the peptides of the present invention were at a concentration of 10, 50, and 100 ⁇ M, respectively. Treated for 15 minutes. Positive control was treated with growth factors of bFGF 100 nM and IGF 100 nM instead of the peptide. After the cells were reacted with the mixture for 15 minutes, a lysate was obtained from the cells, and p-Akt and p were obtained using an anti-p-Akt antibody (cell signaling, USA) and an anti-p-ERK antibody (cell signaling, USA). Western blotting for -ERK was performed.
  • -Actin is anti- to compare the total amount of protein used in the experiment. -It was confirmed using an actin antibody (Santacruz biotechnology, USA).
  • the degree of phosphorylation of Akt and ERK in HaCaT cells is increased by the peptide containing the amino acid sequence of SEQ ID NO: 1, which means that the growth of cells is promoted. It can be seen that it can suppress the natural aging phenomenon.
  • the amounts of proteins and genes related to natural aging were checked.
  • Akt and ERK are proteins involved in the signal transduction process related to cell proliferation, and exhibit activity in phosphorylated forms (p-Akt and p-ERK, respectively).
  • p-Akt and p-ERK phosphorylated forms
  • NIH3T3 cells (mouse fibroblast) were seeded in a 6-well plate at a cell density of 3 ⁇ 10 5 /well, and then cultured with serum free media for 24 hours, and then the peptides of the present invention were respectively 10, 50, Treatment was performed for 15 minutes at a concentration of 100 ⁇ M. Positive control was treated with 50 nM of growth factors bFGF and 25 nM of IGF instead of the peptide. After the cells were reacted with the mixture for 15 minutes, a lysate was obtained from the cells, and p-Akt and p were obtained using an anti-p-Akt antibody (cell signaling, USA) and an anti-p-ERK antibody (cell signaling, USA). Western blotting for -ERK was performed. -Actin is anti- to compare the total amount of protein used in the experiment. -It was confirmed using an actin antibody (Santacruz biotechnology, USA).
  • the degree of phosphorylation of Akt and ERK in NIH3T3 cells is increased by the peptide containing the amino acid sequence of SEQ ID NO: 1, which means that cell growth is promoted. It can be seen that it can suppress the natural aging phenomenon.
  • COL1A1 is a gene encoding collagen I.
  • NIH3T3 cells 34 passages of NIH3T3 cells were seeded in a 6-well plate at a cell density of 5 ⁇ 10 5 /well, and then cultured with serum-free media for 16 hours, and then the peptides of the present invention were at a concentration of 10, 50, and 100 ⁇ M, respectively. Treated with for 1 hour. After washing with PBS and filling with PBS, UVA of 6 J/cm 2 was previously irradiated 1 hour before. And again, the peptides of the present invention were each treated at the above concentration for 6 hours. Positive control was treated with NaC 2.5 mM and Quercetin 50 ⁇ M instead of the peptide.
  • MMP-1 and MMP-2 which encode proteins related to collagen degradation, are increased by irradiation with ultraviolet rays.
  • the peptide of the present invention is treated, the synthesis of the MMP-1 and MMP-2 proteins is inhibited again, resulting in cell It was confirmed whether it can suppress the aging phenomenon.
  • NIH3T3 cells 31 passages of NIH3T3 cells were seeded in a 6-well plate at a cell density of 5 ⁇ 10 5 /well, and then cultured in serum free media for 16 hours, and then the peptides of the present invention were added at concentrations of 10, 50 and 100 ⁇ M, respectively. Treated for hours. After washing with PBS and filling with PBS, UVB of 6 J/cm 2 was irradiated 1 hour ago. And again, the peptides of the present invention were each treated at the above concentration for 48 hours. Positive control was treated with NaC 2.5 mM and Quercetin 50 ⁇ M instead of the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Birds (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Pulmonology (AREA)
  • Cell Biology (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 오염물질에 의한 피부 손상 방지 활성, 피부의 항노화 및 주름 개선 활성을 갖는 신규 펩타이드 및 오염물질에 의해 유발되는 질환의 예방 또는 치료나 피부 노화의 개선과 관련된 상기 펩타이드의 용도에 관한 것으로, 구체적으로 본 발명에 따른 신규 펩타이드는 다이옥신, 미세먼지, 담배연기와 같은 오염물질의 피부 세포 내 유입을 억제하고, 피부 노화와 관련된 유전자의 발현을 조절함으로써, 오염물질에 의해 발생하는 암, 피부 질환, 폐 질환 등이나 피부 노화 관련 질환을 예방 또는 치료하는 약학적 조성물의 유효성분으로 사용되거나, 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선 효과를 위한 화장료 조성물의 의 유효성분으로 유용하게 사용될 수 있는 장점이 있다.

Description

대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
본 발명은 오염물질에 의한 피부 손상 방지 활성과 항노화 효과를 갖는 신규 펩타이드 및 이의 용도에 관한 것이다.
현대 사회에 이르러 대도시의 형성과 산업화에 따른 대기 오염이 심각한 사회적 문제로 부상하였고, 대기 중 오염물질이 호흡기를 비롯한 인간의 전반적인 건강에 악영향을 끼칠 수 있다는 각종 연구 결과들이 보고되어 왔다. 특히, 최근 들어 우리나라의 대기 중 미세먼지의 농도가 예년들에 비해 현저하게 증가하면서 이에 대한 언론의 보도가 이어짐에 따라 대기 오염의 심각성에 대한 대중들의 관심과 우려가 커져가고 있다.
대기 중 오염물질은 인체의 내부 장기 중 호흡기에 가장 큰 영향을 미치지만, 직접적으로 오염물질과 맞닿는 표면적이 가장 넓고 지속적인 노출이 일어나는 피부는 오염물질의 주요한 표적이 되는 장기 중 하나이다. 일반적으로, 외부 환경에 의한 피부 건강 악화 문제는, 햇빛에 포함된 자외선에 의해 유발되는 문제들에 집중되어 왔으나, 갈수록 악화되어 가는 대기 오염 문제와 공기 중 오염물질의 증가 현상으로 인하여 더 이상 관련된 연구를 게을리 할 수는 없는 실정이며, 대기 오염물질로부터 피부를 보호하고 회복할 수 있는 물질이나 이를 포함하는 화장품 등의 연구와 개발의 필요성이 대두되고 있다.
아릴 탄화수소 수용체(AhR, aryl hydrocarbon receptor)는 대기 오염물질이 피부에 접촉했을 때 세포 내에서 유해 신호를 전달하여 피부 손상을 유도하는 역할을 하는 핵심적인 수용체이며, 2,3,7,8-테트라클로로디벤조-p-다이옥신(2,3,7,8-tetrachlorodibenzo-p-dioxin, TCDD)와 같은 다이옥신류와 다환방향족탄소(PAHs, polyaromatic hydrocarbons) 등이 인체의 피부에 노출되면 상기 AhR에 결합하여 스테로이드 호르몬의 작용 기작과 같이 세포 핵으로 이동하여 독성 기작을 일으킨다. AhR과 결합된 다이옥신 복합체는 핵 내에 존재하는 Arnt(AhR nuclear translocator) 단백질과 결합하는데, AhR/Arnt 복합체는 Cytochrome P450s(P450 또는 cyps; CYP1A1, CYP1A2, 그리고 CYP1B1)를 포함하는 표적유전자의 전사조절영역에 있는 DRE 혹은 XRE(drug/xenobiotic responsive element)라고 불리는 염기서열과 결합하여 여러 유전자군의 전사를 유도하고 이로 인해 독성을 나타낸다.
한편, 피부 세포는 각종 원인에 의하여 노화 현상이 일어날 수 있고, 피부 세포의 노화에 의하여 주름이 발생할 수 있다. 생물학적 과정에 따라 시간이 경과하며 나타나는 자연적인 노화인 연대학적 노화(내인적 노화)와 햇빛에 노출되는 부위에서 발생하는 퇴행성 변화와 상기 연대학적 노화가 복합적으로 나타나는 광노화(광인성 노화)로 구분될 수 있다. 세포의 성장과 관련된 각종 인자들의 발현 또는 활성이 저해되는 경우 자연적인 세포의 노화가 발생할 수 있으며, 햇빛에 포함된 280 nm 내지 400 nm 파장의 빛에 의하여 피부 세포의 광노화가 진행될 수 있다. 그 중에서도 특히 280 nm 내지 320 nm 범위의 파장을 갖는 UVB와 같은 자외선의 조사에 의하여 피부나 섬유의 손상이 발생할 수 있으며 피부가 까맣게 타는 그을음 현상이 발생할 수 있다. UVB가 조사되면 피부 세포 내의 ROS 및 자유 라디칼의 축적이 촉진되며, 라디칼에 의해 세포 내 신호전달 체계를 자극하여 DNA, 단백질, 지질과 같은 생체 분자에 산화적 스트레스를 유발할 수 있고, 이로 인하여 피부 조직의 손상이 발생될 수 있다.
피부 세포의 산화적 스트레스가 증가하면, 표피의 각질세포나 진피의 섬유아세포에 자극이 발생하고 일련의 세포 내 신호 전달 과정을 거쳐 콜라겐 분해효소인 MMP(matrix metalloproteinase)와 같은 유전자의 발현이 증가될 수 있고, 피부의 주요 구성성분으로 진피의 90%를 차지하며 피부에 강도, 장력을 부여해 외부 자극이나 힘으로부터 피부를 보호하는 역할을 하는 콜라겐(collagen)의 감소가 유발되어, 이에 따라 피부의 노화나 주름이 형성될 수 있다. 따라서, 상기 콜라겐과 같은 섬유 단백질들의 합성이나 분해에 관련된 유전자의 발현 조절을 통해 피부 세포의 노화를 방지하고 주름의 개선 효과를 기대할 수 있다.
햇빛에 포함된 자외선의 조사에 따른 세포의 노화 작용이나, 상기와 같은 대기 오염물질의 세포 내 유입은 단지 피부의 손상에 의하여 미용적인 측면에서 문제를 발생시키는 것뿐만 아니라, 세포의 DNA 손상으로 인하여 암을 유발하거나 중추 및 말초 신경계의 손상, 면역 시스템 파괴, 생식기관 장애, 영아 및 유아 발달 장애, 그리고 염소좌창 등의 피부 질환을 일으킬 수 있어 심각한 건강 상의 문제도 발생할 수 있는바, 그에 대한 해결책이 시급한 실정이다.
상기와 같은 문제점을 해결하기 위하여, 여러 종류의 물질들이 개발되어 왔으며 다양한 종류의 식물이나 미생물들로부터 얻은 추출물을 이용하여 상기와 같은 문제점을 극복하고자 하는 시도들이 있어 왔다. 그러나 많은 경우, 자연물로부터 얻은 추출물 내에서 구체적으로 어떤 물질이 피부 세포의 보호나 노화 현상으로부터의 회복 효과를 이끌어낼 수 있는지 확인하지 못하여, 정확한 구성을 알 수 없어 미지의 물질들도 함께 함유하고 있는 추출물 조성물을 이용하고 있는 실정이다. 인체에 직접 접촉시키거나 적용하여 사용되어야 하는 특성상, 부작용을 최소화하고 인체에 대한 안전성이 담보되어야 하는바, 상기와 같은 문제점을 해결할 수 있는 효과를 갖는 단일 물질을 정확하게 규명하여 인체의 피부 세포 등에 적용해야 할 필요성이 있다.
본 발명은 다이옥신, 미세먼지, 담배연기 등과 같은 오염물질의 세포 유입을 저해함으로써 오염물질에 의해 발생하는 피부 손상을 방지하여 피부 세포를 보호하는 용도로 이용할 수 있는 펩타이드를 제공하는 것을 목적으로 한다.
또한, 본 발명은 자연적으로 발생하거나 햇빛의 자외선에 의해 발생하는 피부 세포의 노화 현상을 줄이고, 이에 따라 피부 주름을 개선하기 위한 용도로 이용할 수 있는 펩타이드를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기와 같은 펩타이드를 유효성분으로 포함하여 오염물질에 의해 유발되는 질환을 예방 또는 치료하거나, 피부 노화를 개선할 수 있는 약학적 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기와 같은 펩타이드를 유효성분으로 포함하여 오염물질에 의한 피부 손상을 방지하고 피부 노화를 개선할 수 있는 화장료 조성물을 제공하는 것을 목적으로 한다.
상기의 목적을 달성하기 위하여, 본 발명의 일 측면은 서열번호 1의 아미노산 서열을 포함하는, 오염물질에 의한 피부 손상 방지용 펩타이드를 제공한다.
본 발명의 다른 측면은 서열번호 1의 아미노산 서열을 포함하는, 피부 항노화용 펩타이드를 제공한다.
본 발명의 다른 측면은 서열번호 1의 아미노산 서열을 포함하는, 오염물질에 의해 유발되는 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 측면은 서열번호 1의 아미노산 서열을 포함하는, 피부 노화 개선용 약학적 조성물을 제공한다.
본 발명의 다른 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 유효성분으로 함유하는, 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물 을 제공한다.
본 발명에서 제공하는 펩타이드는 대기 중에 존재하는 다이옥신, 미세먼지, 담배연기 등과 같은 오염물질의 세포 내 유입을 방지하고, 피부 세포의 노화 현상을 억제하므로, 오염물질에 의해 유발될 수 있는 암, 피부 질환, 폐 질환 등을 예방 또는 치료하거나 피부 노화를 개선하는 약학적 조성물의 유효성분으로 유용하게 사용될 수 있으며, 오염물질로부터 피부를 보호하고 피부 노화 및 주름을 개선하기 위한 화장료 조성물의 유효성분으로 사용될 수 있는 효과가 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1a 내지 1c는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포에 대하여 각각 TCDD, PM, CSE를 처리한 경우의 AhR 핵 이동량을 확인하여 나타낸 웨스턴 블랏팅 결과이다. 이하, Con은 control, NC는 negative control을 의미한다.
도 1d는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 A549 세포에 대하여 CSE를 처리한 경우의 AhR 핵 이동량을 확인하여 나타낸 웨스턴 블랏팅 결과이다.
도 2a 내지 2c는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포에 대하여 각각 TCDD, PM, CSE를 처리한 경우의 CYP1A1 및 COX-2 유전자의 발현량을 확인하여 나타낸 RT-PCR 결과이다.
도 3a 및 3b는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포에 대하여 각각 TCDD, PM을 처리한 경우의 MMP-1 및 COX-2의 단백질 양을 확인하여 나타낸 웨스턴 블랏팅 결과이다.
도 4a 및 4b는 서열번호 1의 아미노산 서열을 포함하는 펩타이드가 각각 PM, CSE와 흡착하여 침전되는지 여부를 확인한 사진이다.
도 5a는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포의 p-Akt, p-ERK의 단백질 양을 확인하여 나타낸 웨스턴 블랏팅 결과이다.
도 5b는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포의 SIRT1 유전자의 발현량을 확인하여 나타낸 RT-PCR 결과이다.
도 6a는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 NIH3T3 세포의 p-Akt, p-ERK의 단백질 양을 확인하여 나타낸 웨스턴 블랏팅 결과이다.
도 6b는 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 NIH3T3 세포의 콜라겐(Col1a1), 피브로넥틴(Fibronectin), 엘라스틴(Elastin) 유전자의 발현량을 확인하여 나타낸 RT-PCR 결과이다.
도 7은 UVB를 조사하고 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 HaCaT 세포의 SIRT1 및 AQP3 유전자의 발현량을 확인하여 나타낸 RT-PCR 결과이다.
도 8a는 UVB를 조사하고 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 NIH3T3 세포의 콜라겐(Col1a1), 피브로넥틴(Fibronectin), 엘라스틴(Elastin) 유전자의 발현량을 확인하여 나타낸 RT-PCR 결과이다.
도 8b는 UVB를 조사하고 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리한 NIH3T3 세포의 MMP-1 단백질의 양을 확인하여 나타낸 웨스턴 블랏팅 결과와 MMP-2 단백질의 양을 확인하여 나타낸 젤라틴 자이모그래피 결과이다.
이하, 본 발명을 상세히 설명한다.
1. 오염물질에 의한 피부 손상 방지 또는 피부 항노화용 펩타이드
본 발명의 일 측면은 오염물질에 의한 피부 손상을 방지할 수 있는 신규 펩타이드를 제공한다.
본 발명의 또 다른 측면은 피부의 노화를 억제할 수 있는 신규 펩타이드를 제공한다.
상기 펩타이드는 펩타이드 결합으로 연결된 2개 이상의 아미노산으로 이루어진 폴리머를 의미하는데, 펩타이드 자체 크기가 너무 커서 표적 조직 또는 세포에 효과적으로 유입되지 못하거나 반감기가 짧아 단기간에 체내에서 소멸되는 단점이 있으므로, 본 발명의 상기 펩타이드는 오염물질의 세포 유입 억제 활성을 가지는, 20개 이하, 예컨대, 15개 이하, 또는 10개 이하의 아미노산으로 이루어진다.
본 발명의 펩타이드는 서열번호 1의 아미노산 서열을 포함할 수 있고, 상기 펩타이드의 오염물질에 의한 피부 손상 억제 활성 및 피부의 항노화 활성에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체들 또는 단편들일 수 있다. 상기 펩타이드의 오염물질에 의한 피부 손상 억제 활성 및 피부의 항노화 활성을 전체적으로 변경시키지 않는 펩티드 수준에서의 아미노산 교환은 당해 분야에 공지되어 있다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서 본 발명은 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 실질적으로 동일한 아미노산 서열을 포함하는 펩타이드 및 이의 변이체 또는 이의 활성 단편을 포함한다. 상기 실질적으로 동일한 단백질이란 상기 서열번호 1의 아미노산 서열과 각각 75% 이상, 예컨대, 80% 이상, 90% 이상, 95% 이상의 서열 상동성을 가지는 아미노산 서열을 의미한다. 또한, 상기 펩타이드에는 표적화 서열, 태그(tag), 표지된 잔기, 반감기 또는 펩타이드 안정성을 증가시키기 위한 특정 목적으로 제조된 아미노산 서열이 추가적으로 포함할 수 있다.
또한, 본 발명의 상기 펩타이드는 당해 분야에서 널리 공지된 다양한 방법으로 획득할 수 있다. 일례로서, 폴리뉴클레오타이드 재조합과 단백질 발현 시스템을 이용하여 제조하거나 펩타이드 합성과 같은 화학적 합성을 통하여 시험관 내에서 합성하는 방법, 및 무세포 단백질 합성법 등으로 제조될 수 있다.
또한, 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 펩타이드의 N-말단 또는 C-말단에 보호기가 결합되어 있을 수 있다. 예컨대, 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 펩타이드의 개질, 특히 펩타이드의 안정성 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다. 상기 '안정성'은 생체 내 단백질 절단 효소의 공격으로부터 본 발명의 펩타이드를 보호하는 인 비보에서의 안정성뿐만 아니라, 저장안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명의 상기 오염물질은 다이옥신(dioxin, TCDD), 미세먼지(particulate matter, PM), 또는 담배연기 추출물(Cigarette smoke extract, CSE)일 수 있으나 이에 제한되는 것은 아니며, 외부로부터 세포 내에 유입되어 세포의 성장과 정상적인 대사 과정을 방해할 수 있는 독성을 가진 제노바이오틱스(xenobiotics)라면 어느 것이든 포함할 수 있다. 오염물질에 의한 피부 손상 방지는 오염물질이 세포 내부로 유입되지 않도록 함으로써 달성될 수 있으며, 이에 따라 세포 내에서 오염물질이 독성을 나타낼 수 없게 할 수 있다.
또한, 본 발명의 펩타이드는 상기 오염물질과의 흡착을 통해 오염물질의 세포 내 유입을 저해할 수 있다. 상기 다이옥신과 같은 오염물질은 세포 내부로 유입되면 AhR과 결합하여 여러 유전자군의 발현을 유도할 수 있으며, 이에 따라 CYP1A1, CYP1A2, CYP1B1, COX-2, MMPs 등의 발현이 증가되어 나타날 수 있는바, 상기와 같은 유전자들의 발현량의 변화를 확인함으로써 상기 오염물질의 세포 내 유입 억제를 통한 본 발명의 상기 펩타이드의 세포 보호 효과를 확인할 수 있다.
본 발명의 상기 피부 항노화는 피부 세포의 노화 현상을 억제하는 효과를 의미한다. 상기 노화는 시간의 흐름에 따라 세포에서 자연적으로 발생하는 노화일 수 있고, 햇빛에 의해 발생하는 광노화일 수 있으며, 특히, 자외선에 의해 발생하는 광노화일 수 있다. 또한, 상기 노화는 다양한 원인에 의해 발생할 수 있는 세포 내 산화적 스트레스 현상에 의해 유도될 수 있으며, 이에 따라 세포 성장 억제나 세포사멸이 진행될 수 있고 피부세포에서 이를 구성하는 각종 섬유 단백질의 합성이 저해되고 분해 효소의 발현이 증가될 수 있다. 특히, 자외선 조사에 따라 피부 세포에서는 SIRT1, AQP3, Col1a1, 피브로넥틴, 엘라스틴과 같은 유전자의 발현이 억제되고 MMP-1, MMP-2 유전자의 발현은 촉진되어 피부 세포의 광노화 및 주름 발생을 유발할 수 있다.
본 발명의 펩타이드는 피부세포 내에서 세포 증식과 관련된 경로의 유전자 발현을 증가시키거나, 섬유 단백질 합성 유전자의 발현 증가, 섬유 단백질 분해 유전자의 발현 억제를 유도할 수 있다. 따라서, 상기 펩타이드는 섬유 단백질의 합성을 증가시킴에 따라 피부의 주름 및 탄력을 개선할 수 있으며, 피부 장벽을 개선시킴에 따라 피부의 항노화 활성을 갖는다. 피부의 노화가 진행됨에 따라 피부세포 내에서 발현량이 변화하는 세포 증식과 관련된 단백질이나 항노화 유전자, 섬유 단백질 및 이의 분해 효소 관련 유전자의 발현량을 확인함으로써, 본 발명의 상기 펩타이드의 항노화 및 피부 주름 개선 효과를 확인할 수 있다.
본 발명의 상기 펩타이드가 가지는 오염물질에 의한 피부 손상 방지 효과를 확인하기 위하여, 본 발명의 구체적인 실시예에서는 각질형성세포와 섬유아세포에 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 함께 다이옥신, 미세먼지, 담배연기 추출물을 처리하여, AhR의 핵 이동량, CYP1A1, COX-2 및 MMP-1의 발현량을 확인한 결과, 상기 다이옥신, 미세먼지, 담배연기 추출물과 같은 오염물질의 세포 내 유입이 억제되어, 오염물질의 유입에 따른 AhR의 핵 이동량과 CYP1A1, COX-2 및 MMP-1의 발현량이 본 발명의 펩타이드 처리 의존적으로 감소하는 것을 확인하였다(도 1a 내지 도 3b 참고).
또한, 본 발명의 상기 펩타이드와 오염물질 사이의 흡착 여부를 확인하기 위하여, 본 발명의 구체적인 실시예에서는 미세먼지와 담배연기 추출물을 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드와 혼합하여 육안으로 관찰한 결과, 본 발명의 펩타이드는 상기 미세먼지, 담배연기 추출물과 같은 오염물질과 흡착하여 침전됨을 확인할 수 있었고 상기 펩타이드의 양에 의존적으로 흡착이 일어나는 것을 확인하였다(도 4a 및 도 4b 참고).
또한, 본 발명의 상기 펩타이드가 가지는 피부 세포의 자연노화 억제 효과를 확인하기 위하여, 본 발명의 구체적인 실시예에서는 각질형성세포와 섬유아세포에 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하여, 인산화된 형태의 Akt 및 ERK의 양, SIRT1, 콜라겐, 피브로넥틴, 엘라스틴의 발현량을 확인한 결과, 인산화된 형태의 Akt, ERK의 양, SIRT1 단백질의 양과, 콜라겐, 피브로넥틴, 엘라스틴과 같은 섬유 단백질의 발현량이 본 발명의 펩타이드 처리 의존적으로 증가하는 것을 확인하였다(도 5a 내지 6b 참고).
아울러, 본 발명의 상기 펩타이드가 가지는 자외선(UV) 조사에 따른 피부 세포의 광노화 현상의 회복 효과를 확인하기 위하여, 본 발명의 구체적인 실시예에서는 각질형성세포와 섬유아세포에 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하여, 감소되었던 SIRT1, AQP3, 콜라겐, 피브로넥틴, 엘라스틴의 발현량이 다시 증가하는지 여부, 그리고 증가되었던 MMP1, MMP2의 발현량이 다시 감소하는지 여부를 확인한 결과, SIRT1, AQP3, 콜라겐, 피브로넥틴, 엘라스틴의 발현량이 본 발명의 펩타이드 처리 의존적으로 증가하여 자외선 조사로 인해 감소되었던 발현량이 회복되는 것을 확인하였고(도 7 및 도 8a 참고), MMP-1, MMP-2의 발현량이 본 발명의 펩타이드 처리 의존적으로 감소하여 자외선 조사로 인해 증가되었던 발현량이 회복되는 것을 확인하였다(도 8b 참고).
따라서 본 발명의 상기 펩타이드는 TCDD, PM, CSE와 같은 오염물질의 세포 내 유입을 억제하여 피부 손상을 방지하고, 피부 세포의 자연적인 노화 현상이나 자외선에 의해 발생하는 광노화 현상과 관련된 유전자의 발현을 조절함으로써 항노화 활성을 통해 피부의 주름을 개선할 수 있는 활성을 가짐이 분명하고, 따라서 본 발명의 상기 펩타이드는 오염물질에 의한 피부 손상 방지, 항노화 및 피부 주름 개선을 위한 조성물의 유효성분으로 유용하게 사용될 수 있다.
2. 오염물질에 의해 유발되는 질환의 예방 또는 치료용, 피부 노화 개선용 약학적 조성물
본 발명의 또 다른 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 유효성분으로 함유하는 오염물질에 의해 유발되는 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 또 다른 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 유효성분으로 함유하는 피부 노화 개선용 약학적 조성물을 제공한다.
상기 서열번호 1의 아미노산 서열을 포함하는 펩타이드는 상기 '1. 오염물질에 대한 세포 보호용 또는 피부 세포 항노화용 펩타이드' 항목에서 설명한 펩타이드와 동일한바, 구체적인 설명은 위 '1. 오염물질에 대한 세포 보호용 또는 피부 세포 항노화용 펩타이드' 항목을 원용하고, 이하에서는 오염물질에 의해 유발되는 질환의 예방 또는 치료용, 피부 노화 개선용 약학적 조성물에 특유한 구성에 대해서만 설명하도록 한다.
본 발명의 상기 펩타이드는 오염물질의 세포 내 유입을 저해하고, 피부 세포의 노화를 억제하는 효과가 있는바, 상기 펩타이드를 유효성분으로 함유하는 약학적 조성물은 오염물질에 의해 유발되는 질환을 예방하거나 치료하는 용도로 이용할 수 있으며, 피부 세포의 노화를 개선하여 주름을 감소시키고 피부의 탄력을 개선하기 위한 용도로 이용할 수 있다.
상기 오염물질에 의해 유발되는 질환은 오염물질, 예컨대 다이옥신, 미세먼지, 담배연기와 같은 대기 오염물질에 의해 유발될 수 있는 질환을 의미하는 것으로, 피부 질환, 폐 질환, 신경계 질환, 생식계 질환, 심혈관계 질환 등을 포함하며, 암, 아토피 피부염, 접촉성 피부염, 지루성 피부염, 여드름, 피부건조증, 건선, 치사, 면역 독성, 말초 신경계 손상, 중추 신경계 손상, 내분비선 이상, 생식기관 장애, 영아 및 유아의 발달 장애, 빈혈, 기관지염, 폐기종, 폐기능 감소, 천식, 만성지관지염, 부정맥, 심장마비, 협심증, 또는 심근경색증을 포함한다.
본 발명의 상기 약학적 조성물은 오염물질의 세포 유입을 저해함으로써 상기 오염물질에 의해 유발되는 질환이 발생하지 않도록 예방하거나, 상기 질환의 환자의 세포에 추가적으로 유입되는 오염물질을 억제하여 증상을 완화하거나, 병세의 악화를 저해하여 질환을 치료하기 위한 용도로 사용될 수 있다.
상기 피부 노화는 피부 세포의 자연적인 노화 또는 광노화에 의해 유발될 수 있는 피부 상태의 부정적 변화를 의미하는 것으로, 피부의 주름, 미세선, 피부 탄성 및/또는 긴장의 감소, 쪼글거림, 얇아짐, 윤기와 광택 감소 등 생리학적 및/또는 화학선적 노화일 수 있고, 자외선에 노출되어 진피가 얇아지는 내부 피부 열화(internal skin degradation), 특히 콜라겐 섬유의 열화 등 노화로 인한 피부의 외형적인 변화일 수 있다.
본 발명의 상기 약학적 조성물은 피부 세포에서 발생할 수 있는 노화 현상을 억제함으로써, 자연적 또는 빛에 의해 유발된 상기 피부 노화와 관련하여 피부 탄력을 정상적인 수준으로 되돌리는 등 의학적으로 양호한 피부 상태로 복구하여 피부 노화를 개선하는 용도로 사용될 수 있다.
한편, 본 발명의 상기 펩타이드를 유효성분으로 함유하는 약학적 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때, 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 또는 젤(예컨대, 하이드로젤) 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한, 상기 약학적 조성물이 포함하는 상기 펩타이드는 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres), 또는 나노 구형입자와 같은 약학적으로 허용될 수 있는 담체에 운반될 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
이 외에도, 약학적으로 허용되는 담체는 제제시 통상적으로 이용되는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아, 고무, 인산칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성 셀룰로스, 폴리비닐 피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물은 임상 투여시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다. 즉, 본 발명의 약학적 조성물은 실제 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구 투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 생약 추출물 또는 생약 발효물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서 '약학적으로 유효한 양'은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 다른 약학적 조성물은 개별 치료제로 투여하거나, 다른 오염물질에 의해 유발되는 질환의 치료제 또는 피부 노화 개선을 위한 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 동시에, 별도로, 또는 순차적으로 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로 본 발명의 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성율, 배설 속도, 질병 종류, 병용되는 약물에 따라 달라질 수 있으며, 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라 증감될 수 있으며, 일례로 본 발명의 펩타이드를 1일당 환자 체중 1 ㎏ 당 약 0.0001 ㎍ 내지 500 mg, 예컨대 0.01 ㎍ 내지 100 mg 투여할 수 있다. 또한, 의사 또는 약사의 판단에 따라 일정 시간 간격으로 1일 수회, 예컨대 하루 2회 내지 3회 분할 투여될 수 있다.
3. 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물
본 발명의 또 다른 측면은 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 유효성분으로 함유하는 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물을 제공한다.
상기 서열번호 1의 아미노산 서열을 포함하는 펩타이드는 상기 '1. 오염물질에 대한 세포 보호용 또는 피부 세포 항노화용 펩타이드' 항목에서 설명한 펩타이드와 동일한바, 구체적인 설명은 위 '1. 오염물질에 대한 세포 보호용 또는 피부 세포 항노화용 펩타이드' 항목을 원용하고, 이하에서는 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물의 특유한 구성에 대해서만 설명하도록 한다.
본 발명의 상기 펩타이드는 오염물질의 세포 내 유입을 저해하고, 피부 세포의 노화를 억제하는 효과가 있는바, 상기 펩타이드를 유효성분으로 함유하는 화장료 조성물은 오염물질에 의해 발생할 수 있는 피부 손상을 방지하는 용도로 이용할 수 있으며, 피부 세포의 노화를 개선하여 주름을 감소시키고 피부의 탄력을 개선하기 위한 용도로 이용할 수 있다.
상기 펩타이드는 화장료 조성물 전체 100 중량% 중 0.001 내지 30 중량%로 함유될 수 있으며, 예컨대 0.1 내지 20 중량%, 0.1 내지 10 중량%, 1 내지 10 중량% 또는 2 내지 5 중량%로 함유될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 펩타이드를 유효성분으로 함유하는 화장료 조성물은 상기 펩타이드의 오염물질의 세포 유입 억제 활성 및 피부 세포의 노화 개선 활성에 영향을 미치지 않는 범위 내에서, 예컨대 상기 펩타이드의 활성에 상승 효과를 줄 수 있는 특징이 있는 다른 성분을 추가로 함유할 수 있다. 예를 들어, 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 향료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분 등과 같이 화장품이나 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있으며, 상기 성분들은 화장품이나 피부 과학 분야에서 일반적으로 사용되는 양으로 함유될 수 있다.
본 발명의 상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션 또는 스프레이 등의 화장료로 제형화 될 수 있다.
상기 제형이 용액 또는 유탁액인 경우에는 담체 성분으로 용매, 용해화제 또는 유탁화제가 이용될 수 있고, 예컨대 물, 에탄올, 이소프로판올, 에틸카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 이용될 수 있다. 상기 제형이 현탁액인 경우에는 담체 성분으로 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 알루미늄 메타히드록시드, 미소결정성 셀룰로오스, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다. 상기 제형이 크림 또는 겔인 경우에는 담체 성분으로서 왁스, 파라핀, 트라칸트, 동물성유, 전분, 셀룰로오스 유도체, 실리콘, 벤토나이트, 폴리에틸렌 글리콜, 실리카, 산화아연 또는 탈크 등이 이용될 수 있다. 상기 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 실리카, 탈크, 알루미늄 히드록시기, 락토스, 칼슘 실리케이트, 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다. 상기 제형이 계면활성제-함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이미다졸리늄 유도체, 이세티오네이트, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 지방족 알코올, 알킬아미도베타인, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
[제조예] 펩타이드의 제작
자동 펩타이드 합성기(Milligen 9050, Millipore, 미국)를 이용하여 하기의 표 1에 기재된 서열번호 1의 아미노산 서열을 갖는 펩타이드를 합성하고, C18 역상 고성능액체크로마토그래피(HPLC)(Waters Associates, 미국)를 이용하여 이들 합성된 펩타이드를 순수 분리하였다. 컬럼은 ACQUITY UPLC BEH300 C18 (2.1 ㎜ × 100 ㎜, 1.7㎛, Waters Co, 미국)을 이용하였다.
서열번호 펩타이드 서열
1 SYSGVLFFLK
[실험예 1] 펩타이드 처리에 따른 AhR의 핵 이동량 감소 확인
오염물질의 세포 내 유입 억제 효과를 확인하기 위하여, 다이옥신(dioxin, 이하 'TCDD'), 미세먼지(particulate matter, 이하 'PM') 및 담배연기 추출물(Cigarette smoke extract, 이하 'CSE')을 세포에 처리한 후, AhR(aryl hydrocarbon receptor)의 핵 이동량을 확인하였다. 상기 AhR은 세포 외부에서 유입된 제노바이오틱스(xenobiotics)가 존재하는 경우 이와 결합하여 전사인자로 작용할 수 있어 세포 내 핵으로 이동하게 되므로, AhR의 핵 이동량을 확인함으로써 상기 오염물질들의 세포 내 유입량을 확인할 수 있다. HaCaT 세포(human keratinocyte)를 대상으로 TCDD, PM, CSE를 각각 처리하여 확인하였고, A549 세포(human alveolar epithelial cell)를 대상으로 CSE를 처리하여 확인하였다. TCDD, PM, CSE는 본 발명의 펩타이드와 혼합하여 serum-free media 상에서 1시간 동안 미리 반응시켜둔 다음 사용하였다.
TCDD를 처리한 경우의 실험 결과를 확인하기 위하여, 먼저, 74 passage의 HaCaT 세포를 3×105/well의 세포 밀도로 6-well plate에 seeding 후 16시간 동안 배양시키고 배양액을 serum free media로 교체한 다음, 여기에 미리 반응시켜 둔 TCDD와 상기 펩타이드의 혼합물을 1시간 동안 처리하였다. TCDD는 0.1 μM의 농도로 처리하였고 펩타이드는 각각 10, 50, 100 μM의 농도로 처리하였다. negative control은 펩타이드는 처리하지 않고 TCDD만 처리하였고, positive control은 TCDD와 함께 CH223191를 10 μM의 농도로 처리하였다. 세포를 상기 혼합물과 1시간 동안 반응시킨 후, 세포를 용해하고 세포질 및 핵 단백질을 분리할 수 있는 키트(Nuclear and Cytoplasmic Extraction Reagents Kit, Thermo scientific, USA)를 이용하여 핵 단백질만을 분리한 다음, 항-AhR 항체(Santacruz biotechnology, USA)와 항-HDAC 항체(Santacruz biotechnology, USA)를 사용하여 AhR에 대한 웨스턴 블랏팅을 진행하였다. 실험에 사용한 핵 단백질 총량을 비교하기 위하여 HDAC도 함께 확인하였다.
PM과 CSE를 처리한 경우의 실험 과정 역시 상기의 TCDD를 처리한 경우와 동일한 방법을 통해 진행되었으며, PM은 50 μg/cm2의 농도로, CSE는 2%의 농도로 각각 처리하였다. 상기 CSE는 감압플라스크에 50 ml의 PBS를 채워 넣고 플라스크를 진공 펌프에 연결하여 담배 40개피를 태워 조제한 것을 이용하였다. A549 세포(human alveolar epithelial cell)을 대상으로 CSE를 처리하여 확인한 실험 역시 상기의 실험 과정과 유사하며, 48 passage의 A549 세포를 5×105/well의 세포 밀도로 6-well plate에 seeding 후 CSE를 처리하여 분리한 핵 단백질을 대상으로 웨스턴 블랏팅을 진행하였다.
그 결과, 도 1a 내지 도 1d의 웨스턴 블랏팅 결과에서 볼 수 있듯이, 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하지 않고 TCDD, PM 또는 CSE만을 처리한 negative control에서는 핵 단백질 중 AhR이 다량 존재하는 것에 비해, 상기 펩타이드를 처리한 경우에는 펩타이드의 농도가 증가함에 따라 점차 AhR의 핵 내 존재하는 양이 감소하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포 및 A549 세포에서 TCDD, PM, CSE와 같은 오염물질의 유입이 저해되고 이로 인하여 AhR의 핵 이동량 역시 감소한 것임을 알 수 있다.
[실험예 2] 펩타이드 처리에 따른 CYP1A1 및 COX-2의 발현량 감소 확인
오염물질의 세포 내 유입 억제 효과를 다른 방법을 통해 확인하기 위하여, TCDD, PM 및 CSE를 HaCaT 세포에 처리한 후, CYP1A1 및 COX-2의 발현량을 확인하였다. TCDD와 같은 오염물질에 의하여 AhR의 활성이 촉진되면 AhR이 전사인자로 작용하여 CYP1A1 및 COX-2의 발현을 증가시키므로, CYP1A1, COX-2의 유전자가 얼마나 발현되었는지 여부를 확인함으로써 상기 오염물질들의 세포 내 유입 정도와 AhR의 활성 여부를 확인할 수 있다. TCDD, PM, CSE는 본 발명의 펩타이드와 혼합하여 serum-free media 상에서 1시간 동안 미리 반응시켜둔 다음 사용하였다.
TCDD를 처리한 경우의 실험 결과를 확인하기 위하여, 먼저, 78 passage의 HaCaT 세포를 3×105/well의 세포 밀도로 6-well plate에 seeding 후 16시간 동안 배양시키고 배양액을 serum free media로 교체한 다음, 여기에 미리 반응시켜 둔 TCDD와 상기 펩타이드의 혼합물을 2시간 동안 처리하였다. TCDD는 0.1 μM의 농도로 처리하였고 펩타이드는 각각 10, 50, 100 μM의 농도로 처리하였다. negative control은 펩타이드는 처리하지 않고 TCDD만 처리하였고, positive control은 TCDD와 함께 CH223191를 10 μM의 농도로 처리하였다. 세포를 상기 혼합물과 2시간 동안 반응시킨 후 RNA를 분리하였다. 배양액을 제거한 후 세포를 배양한 플레이트에 TRIzol(Thermo Fisher Scientific, USA)을 처리하여 스크래퍼를 이용해 RNA를 포함하는 시료를 얻은 다음, 클로로포름을 처리하고 원심분리를 통해 상층액을 얻었다. 상층액에 이소프로판올을 처리하고 다시 원심분리하여 바닥의 RNA pellet을 확인하고 여기에 70%의 에탄올을 처리하여 pellet을 세척한 후 충분히 건조시켜 RNA를 분리하였다. 분리된 RNA는 RNase-free water(Corning, USA)에 녹여 사용하였다. 분리된 RNA를 cDNA로 역전사시켜 CYP1A1 및 COX-2의 프라이머(표 2)를 이용하여 RT-PCR을 수행하였다(cDNA 중합 키트 및 PCR pre-mix: Intron, Korea). 각 처리군의 전체 RNA 양 비교를 위해 사용된 GAPDH의 프라이머는 하기 표 2의 서열을 가진 것을 이용하였다.
PM과 CSE를 처리한 경우의 실험 과정 역시 상기의 TCDD를 처리한 경우와 동일한 방법을 통해 진행되었으며, PM은 25 μg/cm2의 농도로, CSE는 2%의 농도로 각각 처리하였다. 상기 CSE는 감압플라스크에 50 ml의 PBS를 채워 넣고 플라스크를 진공 펌프에 연결하여 담배 40개피를 태워 조제한 것을 이용하였다.
서열번호 서열 이름 염기서열
2 CYP1A1 forward 5'- GGATCTTTCTCTGTACCCTGG -3'
3 CYP1A1 reverse 5'- AGCATGTCCTTCAGCCCAGA -3'
4 COX-2 forward 5'- ATCATTCACCAGGCAAATTGC -3'
5 COX-2 reverse 5'- GGCTTCAGCATAAAGCGTTTG -3'
6 GAPDH forward 5'- GGTGTGAACGGATTTGGCCGTATTG -3'
7 GAPDH reverse 5'- CCGTTGAATTTGCCGTGAGTGGAGT -3'
그 결과, 도 2a 내지 도 2c의 RT-PCR 결과에서 볼 수 있듯이, 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하지 않고 TCDD, PM 또는 CSE만을 처리한 negative control에서는 CYP1A1 및 COX-2의 유전자가 다량 발현된 것에 비해, 상기 펩타이드를 처리한 경우에는 펩타이드의 농도가 증가함에 따라 점차 CYP1A1과 COX-2의 발현량이 감소하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포 에서 TCDD, PM, CSE와 같은 오염물질의 유입이 저해되고 이로 인하여 CYP1A1 및 COX-2의 발현량 역시 감소한 것임을 알 수 있다.
[실험예 3] 펩타이드 처리에 따른 MMP-1 및 COX-2의 단백질 양 감소 확인
오염물질의 세포 내 유입 억제 효과를 다른 방법을 통해 확인하기 위하여, TCDD 및 PM을 HaCaT 세포에 처리한 후, MMP-1 및 COX-2 단백질의 양을 확인하였다. 상기 MMP-1은 콜라겐 분해 효소로, TCDD와 같은 오염물질에 의하여 AhR의 활성이 촉진되면 AhR이 전사인자로 작용하여 MMP-1 및 COX-2의 발현을 증가시키므로, MMP-1, COX-2의 유전자가 얼마나 발현되었는지 여부를 확인함으로써 상기 오염물질들의 세포 내 유입 정도와 AhR의 활성 여부를 확인할 수 있다. TCDD, PM은 본 발명의 펩타이드와 혼합하여 serum-free media 상에서 1시간 동안 미리 반응시켜둔 다음 사용하였다.
TCDD를 처리한 경우의 실험 결과를 확인하기 위하여, 먼저, 80 passage의 HaCaT 세포를 3×105/well의 세포 밀도로 6-well plate에 seeding 후 16시간 동안 배양시키고 배양액을 serum free media로 교체한 다음, 여기에 미리 반응시켜 둔 TCDD와 상기 펩타이드의 혼합물을 24시간 동안 처리하였다. TCDD는 0.1 μM의 농도로 처리하였고 펩타이드는 각각 10, 50, 100 μM의 농도로 처리하였다. negative control은 펩타이드는 처리하지 않고 TCDD만 처리하였고, positive control은 TCDD와 함께 CH223191를 10 μM의 농도로 처리하였다. 세포를 상기 혼합물과 24시간 동안 반응시킨 후 세포로부터 용해물을 얻어 항-MMP-1 항체(cell signaling, USA)와 항-COX-2 항체(Santacruz biotechnology, USA)를 사용하여 MMP-1 및 COX-2에 대한 웨스턴 블랏팅을 진행하였다.
Figure PCTKR2019004881-appb-I000001
-액틴은 실험에 사용한 단백질 총량을 비교하기 위하여 항-
Figure PCTKR2019004881-appb-I000002
-액틴 항체(Santacruz biotechnology, USA)를 이용하여 확인하였다.
PM을 처리한 경우의 실험 과정 역시 상기의 TCDD를 처리한 경우와 동일한 방법을 통해 진행되었으며, PM은 50 μg/cm2의 농도로 처리하였다
그 결과, 도 3a 및 도 3b의 웨스턴 블랏팅 결과에서 볼 수 있듯이, 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하지 않고 TCDD 또는 PM만을 처리한 negative control에서는 MMP-1 및 COX-2의 단백질 양이 다량인 것에 비해, 상기 펩타이드를 처리한 경우에는 펩타이드의 농도가 증가함에 따라 점차 MMP-1 및 COX-2의 단백질 양이 감소하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포 에서 TCDD, PM과 같은 오염물질의 유입이 저해되고 이로 인하여 MMP-1 및 COX-2의 단백질 양 역시 감소한 것임을 알 수 있다.
[실험예 4] 펩타이드의 환경 오염물질과의 흡착 효과 확인
본 발명의 펩타이드가 오염물질들과 흡착되는지 여부를 확인하기 위하여, 펩타이드와 오염물질 혼합물의 침전되는 양상을 육안으로 관찰하였다.
먼저, 미세먼지의 흡착 정도를 확인하기 위하여 100 μg/ml의 PM과 각각 100, 200 μM의 상기 펩타이드를 혼합하여 침전되는 양상을 관찰하였고, 담배 40개비의 연기를 이용하여 조제한 CSE와 200 μM의 펩타이드를 혼합하여 육안관찰 하였다.
그 결과, 도 4a 및 도 4b의 결과에서 볼 수 있듯이, 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 처리하지 않고 PM 또는 CSE만을 처리한 경우에는 혼합물 내 PM과 CSE가 섞여 그대로 존재하는 것에 비해, 상기 펩타이드를 처리한 경우에는 펩타이드의 농도가 증가함에 따라 점차 침전되어 아래쪽으로 가라앉는 정도가 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드는 PM이나 CSE와 같은 오염물질 분자들을 붙잡아 흡착되는 효과가 있어, 상기 오염물질 분자들의 피부 내 유입을 저해하는 효과가 있음을 알 수 있다.
[실험예 5] 자연노화 억제 - 펩타이드 처리에 따른 각질형성세포의 활성 촉진 확인
각질형성세포(keratinocyte)를 대상으로 세포에서 자연적으로 진행되는 세포 노화현상을 본 발명의 펩타이드가 억제시켜줄 수 있는지 여부를 확인하기 위하여, 자연노화와 관련된 단백질의 양 및 유전자의 발현량을 확인하였다.
<5-1> 증식 관련 신호 단백질의 인산화 여부 확인
Akt 및 ERK는 세포의 증식과 관련한 신호 전달 과정에 관여하는 단백질의 일종으로, 인산화된 형태(각각 p-Akt, p-ERK)에서 활성을 나타내는바, 본 발명의 펩타이드를 처리하는 경우 인산화된 Akt, ERK가 증가하여 세포 노화 현상을 억제할 수 있는지 여부를 확인하였다.
먼저, 81 passage의 HaCaT 세포를 3×105/well의 세포 농도로 6-well plate에 seeding 후 24시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 15분 동안 처리하였다. positive control은 상기 펩타이드 대신에 성장인자인 bFGF 100 nM 및 IGF 100 nM를 처리한 것으로 하였다. 세포를 상기 혼합물과 15분 동안 반응시킨 후 세포로부터 용해물을 얻어 항-p-Akt 항체(cell signaling, USA)와 항-p-ERK 항체(cell signaling, USA)를 사용하여 p-Akt 및 p-ERK에 대한 웨스턴 블랏팅을 진행하였다.
Figure PCTKR2019004881-appb-I000003
-액틴은 실험에 사용한 단백질 총량을 비교하기 위하여 항-
Figure PCTKR2019004881-appb-I000004
-액틴 항체(Santacruz biotechnology, USA)를 이용하여 확인하였다.
그 결과, 도 5a의 웨스턴 블랏팅 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 펩타이드의 농도가 증가함에 따라 점차 Akt 및 ERK의 인산화 정도가 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포에서 Akt 및 ERK의 인산화 정도가 증가하고, 이는 세포의 성장이 촉진됨을 의미하는바, 상기 펩타이드를 처리함으로써 세포의 자연적인 노화 현상을 억제할 수 있음을 알 수 있다.
<5-2> SIRT1(항노화 유전자)의 발현 증가 확인
노화를 방지하는 역할을 하는 SIRT1 유전자의 발현량 증가 여부를 확인함으로써 본 발명의 펩타이드를 처리하는 경우 세포 노화 현상을 억제할 수 있는지 여부를 확인하였다.
78 passage의 HaCaT 세포를 3×105/well의 세포 농도로 6-well plate에 seeding 후 24시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 24시간 동안 처리하였다. positive control은 상기 펩타이드 대신에 성장인자인 bFGF 100 nM 및 IGF 100 nM를 처리한 것으로 하였다. 세포를 상기 혼합물과 24시간 동안 반응시킨 후 세포로부터 상기 실험예 2에서와 동일한 방법을 통해 RNA를 분리한 다음, 분리된 RNA를 cDNA로 역전사시켜 SIRT1의 프라이머(표 3)를 이용하여 RT-PCR을 수행하였다(cDNA 중합 키트 및 PCR pre-mix: Intron, Korea). 각 처리군의 전체 RNA 량 비교를 위해 사용된 GAPDH의 프라이머는 상기 표 2의 서열을 가진 것을 이용하였다.
서열번호 서열 이름 염기서열
8 SIRT1 forward 5'- TCAGTGGCTGGAACAGTGAG -3'
9 SIRT1 reverse 5'- TCTGGCATGTCCCACTATCA -3'
그 결과, 도 5b의 RT-PCR 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 펩타이드의 농도가 증가함에 따라 점차 SIRT1 유전자의 발현량이 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포 에서 항노화 유전자인 SIRT1 유전자의 발현량이 증가하고, 세포의 자연적인 노화 현상이 억제되는 효과가 있음을 알 수 있다.
[실험예 6] 자연노화 억제 - 펩타이드 처리에 따른 섬유아세포의 활성 촉진 확인
섬유아세포(fibroblast)를 대상으로 세포에서 자연적으로 진행되는 세포 노화현상을 본 발명의 펩타이드가 억제시켜줄 수 있는지 여부를 확인하기 위하여, 자연노화와 관련된 단백질의 양 및 유전자의 발현량을 확인하였다.
<6-1> 증식 관련 신호 단백질의 인산화 여부 확인
Akt 및 ERK는 세포의 증식과 관련한 신호 전달 과정에 관여하는 단백질의 일종으로, 인산화된 형태(각각 p-Akt, p-ERK)에서 활성을 나타내는바, 본 발명의 펩타이드를 처리하는 경우 인산화된 Akt, ERK가 증가하여 세포 노화 현상을 억제할 수 있는지 여부를 확인하였다.
먼저, 38 passage의 NIH3T3 세포(mouse fibroblast)를 3×105/well의 세포 밀도로 6-well plate에 seeding 후24시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 15분 동안 처리하였다. positive control은 상기 펩타이드 대신에 성장인자인 bFGF 50 nM 및 IGF 25 nM를 처리한 것으로 하였다. 세포를 상기 혼합물과 15분 동안 반응시킨 후 세포로부터 용해물을 얻어 항-p-Akt 항체(cell signaling, USA)와 항-p-ERK 항체(cell signaling, USA)를 사용하여 p-Akt 및 p-ERK에 대한 웨스턴 블랏팅을 진행하였다.
Figure PCTKR2019004881-appb-I000005
-액틴은 실험에 사용한 단백질 총량을 비교하기 위하여 항-
Figure PCTKR2019004881-appb-I000006
-액틴 항체(Santacruz biotechnology, USA)를 이용하여 확인하였다.
그 결과, 도 6a의 웨스턴 블랏팅 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 펩타이드의 농도가 증가함에 따라 점차 Akt 및 ERK의 인산화 정도가 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 NIH3T3 세포 에서 Akt 및 ERK의 인산화 정도가 증가하고, 이는 세포의 성장이 촉진됨을 의미하는바, 상기 펩타이드를 처리함으로써 세포의 자연적인 노화 현상을 억제할 수 있음을 알 수 있다.
<5-2> 진피 구성성분(콜라겐, 피브로넥틴, 엘라스틴)의 발현 증가 확인
진피를 구성하는 성분의 일종으로 섬유 형성과 관련된 콜라겐(collagen), 피브로넥틴(fibronectin) 및 엘라스틴(elastin) 유전자의 발현량 증가 여부를 확인함으로써 본 발명의 펩타이드를 처리하는 경우 세포 노화 현상을 억제할 수 있는지 여부를 확인하였다. COL1A1은 콜라겐 I을 암호화하는 유전자이다.
26 passage의 NIH3T3 세포를 3×105/well의 세포 농도로 6-well plate에 seeding 후 24시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 24시간 동안 처리하였다. positive control은 상기 펩타이드 대신에 성장인자인 bFGF 100 nM 및 TGF-
Figure PCTKR2019004881-appb-I000007
5 ng/ml을 처리한 것으로 하였다. 세포를 상기 혼합물과 24시간 동안 반응시킨 후 세포로부터 상기 실험예 2에서와 동일한 방법을 통해 RNA를 분리한 다음, 분리된 RNA를 cDNA로 역전사시켜 Col1a1, Fibronectin, Elastin의 프라이머(표 4)를 이용하여 RT-PCR을 수행하였다(cDNA 중합 키트 및 PCR pre-mix: Intron, Korea). 각 처리군의 전체 RNA 량 비교를 위해 사용된 GAPDH의 프라이머는 상기 표 2의 서열을 가진 것을 이용하였다.
서열번호 서열 이름 염기서열
16 AQP3 forward 5'- CCTTCTTGGGTGCTGGAATA -3'
17 AQP3 reverse 5'- ACACGATAAGGGAGGCTCTG -3'
그 결과, 도 7의 RT-PCR 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 UVB 조사에 의해 저해 되었던 SIRT1 및 AQP3 유전자의 발현량이 펩타이드의 농도가 증가함에 따라 점차 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 HaCaT 세포 에서 감소되었던 항노화 유전자인 SIRT1 및 피부 장벽 구성 유전자인 AQP3의 발현량이 증가하여 다시 회복되고, 세포의 광노화 현상이 억제되는 효과가 있음을 알 수 있다.
[실험예 8] 광 노화 억제 - 자외선에 의해 억제된 섬유아세포의 활성 회복 확인
<8-1> 진피 구성성분(콜라겐, 피브로넥틴, 엘라스틴)의 발현 회복 확인
UV가 조사되면 진피를 구성하는 콜라겐, 피브로넥틴, 엘라스틴 유전자의 발현이 저해되므로, 본 발명의 펩타이드를 처리하는 경우 콜라겐, 피브로넥틴, 엘라스틴 유전자의 발현량이 다시 회복되어 증가하는지 여부를 확인함으로써 세포의 광노화 현상을 억제할 수 있는지 여부를 확인하였다.
먼저, 34 passage의 NIH3T3 세포를 5×105/well의 세포 밀도로 6-well plate에 seeding 후16시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 1시간 동안 처리하였다. PBS로 세척하고 PBS를 채운 후 다시 6 J/cm2의 UVA를 1시간 전 미리 조사하였다. 그리고 다시 본 발명의 펩타이드를 각각 상기의 농도로 6시간 동안 처리하였다. positive control은 상기 펩타이드 대신에 NaC 2.5 mM 및 Quercetin 50 μM를 처리한 것으로 하였다. 세포를 상기 펩타이드와 6시간 동안 반응시킨 후 세포로부터 상기 실험예 2에서와 동일한 방법을 통해 RNA를 분리한 다음, 분리된 RNA를 cDNA로 역전사시켜 콜라겐(Col1a1), 피브로넥틴, 엘라스틴의 프라이머(표 4)를 이용하여 RT-PCR을 수행하였다(cDNA 중합 키트 및 PCR pre-mix: Intron, Korea). 각 처리군의 전체 RNA 량 비교를 위해 사용된 GAPDH의 프라이머는 상기 표 2의 서열을 가진 것을 이용하였다.
그 결과, 도 8a의 RT-PCR 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 펩타이드의 농도가 증가함에 따라 점차 콜라겐(Col1a1), 피브로넥틴, 엘라스틴 유전자의 발현량이 증가하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 NIH3T3 세포 에서 UVA 조사에 의해 감소되었던 콜라겐(Col1a1), 피브로넥틴, 엘라스틴 유전자의 발현량이 증가하여 다시 회복되고, 세포의 광노화 현상이 억제됨에 따라 상기 유전자들로부터 발현되는 단백질들로 인하여 피부의 주름이 개선되는 효과가 있음을 알 수 있다.
<8-2> MMP-1 및 MMP-2의 발현 저해 확인
콜라겐 분해와 관련된 단백질을 암호화하는 MMP-1 및 MMP-2는 자외선 조사에 의하여 발현이 증가되는바, 본 발명의 펩타이드를 처리하는 경우 상기 MMP-1 및 MMP-2 단백질의 합성이 다시 억제되어 세포 노화 현상을 억제할 수 있는지 여부를 확인하였다.
31 passage의 NIH3T3 세포를 5×105/well의 세포 밀도로 6-well plate에 seeding 후 16시간 동안 serum free media로 배양한 다음, 본 발명의 펩타이드를 각각 10, 50, 100 μM의 농도로 1시간 동안 처리하였다. PBS로 세척하고 PBS를 채운 후 다시 6 J/cm2의 UVB를 1시간 전 조사하였다. 그리고 다시 본 발명의 펩타이드를 각각 상기의 농도로 48시간 동안 처리하였다. positive control은 상기 펩타이드 대신에 NaC 2.5 mM 및 Quercetin 50 μM를 처리한 것으로 하였다. 세포를 상기 혼합물과 48시간 동안 반응시킨 후 세포로부터 용해물을 얻어 항-MMP-1 항체(cell signaling, USA) 를 사용하여 MMP-1에 대한 웨스턴 블랏팅을 진행하였다.
Figure PCTKR2019004881-appb-I000008
-액틴은 실험에 사용한 단백질 총량을 비교하기 위하여 항-
Figure PCTKR2019004881-appb-I000009
-액틴 항체(Santacruz biotechnology, USA)를 이용하여 확인하였다.
또한, MMP-2의 양을 분석하기 위하여 상기에서 얻은 세포의 용해물을 준비한 후 젤라틴 자이모그래피(gelatin zymography)를 수행하였다. 젤라틴(2 mg/ml)을 기질로 하여 단백질 전기영동(SDS-PAGE)를 먼저 시행한 후, 2.5%의 트라이톤 X-100에 30분간 처리한 다음 다시 완충제(50 mM Tris-HCl, 0.2 M NaCl, 5 mM CaCl2, 1% 트라이톤 X-100)에서 24시간 동안 37℃에서 처리하였다. 처리된 젤은 쿠마시 브릴리언트 블루(Coomassie brilliant blue) R250(Sigma)으로 염색하고, 탈색 버퍼(5% 에탄올, 7.5% 아세트산 및 증류수)로 처리하였다. 그 후 젤라틴이 가수분해됨에 따라 나타나는 젤 상의 비어있는 밴드를 관찰함으로써 MMP-2의 활성을 확인하였다.
그 결과, 도 8b의 웨스턴 블랏팅 및 자이모그래피 결과에서 볼 수 있듯이, 상기 펩타이드를 처리한 경우 펩타이드의 농도가 증가함에 따라 점차 MMP-1 및 MMP-2의 단백질 양이 감소하는 것을 확인하였다.
상기와 같은 결과를 통해, 서열번호 1의 아미노산 서열을 포함하는 펩타이드에 의하여 NIH3T3 세포 에서 UVA 조사에 의해 증가되었던 MMP-1 및 MMP-2의 단백질 양이 다시 감소하여 회복되고, 콜라겐의 양이 다시 증가될 수 있어 세포의 광노화 현상이 억제됨에 따라 피부 주름의 개선 효과가 있음을 알 수 있다.
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 설명되었지만 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 청구범위에 속함은 당연한 것이다.

Claims (12)

  1. 서열번호 1의 아미노산 서열을 포함하는, 오염물질에 의한 피부 손상 방지용 펩타이드.
  2. 청구항 1에 있어서,
    상기 펩타이드는 오염물질의 피부 내 유입 억제 활성을 갖는 것인, 오염물질에 의한 피부 손상 방지용 펩타이드.
  3. 청구항 1에 있어서,
    상기 펩타이드는 오염물질과 흡착하는 것인, 오염물질에 의한 피부 손상 방지용 펩타이드.
  4. 청구항 1 내지 청구항 3 중 어느 한 항에 있어서,
    상기 오염물질은 다이옥신, 미세먼지 및 담배연기 추출물로 이루어진 군으로부터 선택되는 것인, 오염물질에 의한 피부 손상 방지용 펩타이드.
  5. 서열번호 1의 아미노산 서열을 포함하는, 피부 항노화용 펩타이드.
  6. 청구항 5에 있어서,
    상기 피부 항노화는 피부의 주름 또는 탄력의 개선인, 피부 항노화용 펩타이드.
  7. 청구항 1의 펩타이드를 유효성분으로 함유하는, 오염물질에 의해 유발되는 질환의 예방 또는 치료용 약학적 조성물.
  8. 청구항 7에 있어서,
    상기 오염물질에 의해 유발되는 질환은 암, 아토피 피부염, 접촉성 피부염, 지루성 피부염, 여드름, 피부건조증, 건선, 치사, 면역 독성, 말초 신경계 손상, 중추 신경계 손상, 내분비선 이상, 생식기관 장애, 영아 및 유아의 발달 장애, 빈혈, 기관지염, 폐기종, 폐기능 감소, 천식, 만성지관지염, 부정맥, 심장마비, 협심증, 및 심근경색증으로 구성된 군으로부터 선택되는 어느 하나 이상인, 오염물질에 의해 유발되는 질환의 예방 또는 치료용 약학적 조성물.
  9. 청구항 5의 펩타이드를 유효성분으로 함유하는, 피부 노화 개선용 약학적 조성물.
  10. 청구항 9에 있어서,
    상기 피부 노화 개선은 주름의 개선인, 피부 노화 개선용 약학적 조성물.
  11. 청구항 1 또는 청구항 5의 펩타이드 중 어느 하나를 유효성분으로 함유하는, 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물.
  12. 청구항 11에 있어서,
    상기 화장료 조성물은 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션, 및 스프레이로 이루어진 군으로부터 선택되는 1종의 제형을 갖는 것인, 오염물질에 의한 피부 손상 방지 또는 피부 노화 개선용 화장료 조성물.
PCT/KR2019/004881 2019-02-20 2019-04-23 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도 WO2020171285A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US17/059,909 US11433013B2 (en) 2019-02-20 2019-04-23 Peptide for preventing skin damage caused by air pollutants and for anti-aging, and use thereof
JP2020567020A JP7048766B2 (ja) 2019-02-20 2019-04-23 大気汚染物質による皮膚損傷防止用及び抗老化用のペプチド、並びにその用途
CN201980037621.8A CN112236441B (zh) 2019-02-20 2019-04-23 大气污染物质导致的皮肤损伤防止及抗老化用肽及其用途
BR112021016104A BR112021016104A2 (pt) 2019-02-20 2019-04-23 Peptídeo para prevenir danos à pele causados por poluentes do ar e para antienvelhecimento, e uso do mesmo
EP19916142.3A EP3904369A4 (en) 2019-02-20 2019-04-23 PEPTIDE FOR THE PREVENTION OF SKIN DAMAGE CAUSED BY ATMOSPHERIC POLLUTANTS AND FOR THE FIGHT AGAINST AGING, AND USE IN RELATION

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190020013A KR102065171B1 (ko) 2019-02-20 2019-02-20 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
KR10-2019-0020013 2019-02-20

Publications (1)

Publication Number Publication Date
WO2020171285A1 true WO2020171285A1 (ko) 2020-08-27

Family

ID=69153102

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/004881 WO2020171285A1 (ko) 2019-02-20 2019-04-23 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도

Country Status (7)

Country Link
US (1) US11433013B2 (ko)
EP (1) EP3904369A4 (ko)
JP (1) JP7048766B2 (ko)
KR (1) KR102065171B1 (ko)
CN (1) CN112236441B (ko)
BR (1) BR112021016104A2 (ko)
WO (1) WO2020171285A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220072348A (ko) * 2020-11-25 2022-06-02 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102539445B1 (ko) 2020-11-25 2023-06-05 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도
KR20230046141A (ko) * 2021-09-29 2023-04-05 (주)케어젠 항노화 활성을 갖는 펩타이드 및 이의 용도
KR20230046140A (ko) * 2021-09-29 2023-04-05 (주)케어젠 항노화 활성을 갖는 펩타이드 및 이의 용도
KR20230046872A (ko) * 2021-09-30 2023-04-06 (주)케어젠 항노화 활성을 갖는 펩타이드 및 이의 용도
KR20230046873A (ko) * 2021-09-30 2023-04-06 (주)케어젠 항노화 활성을 갖는 펩타이드 및 이의 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100136103A1 (en) * 2007-05-08 2010-06-03 Tupperware Products S.A. Cosmetic anti-ageing skin care compositions
KR101092915B1 (ko) * 2009-07-10 2011-12-12 (주)케어젠 성장인자―유래 펩타이드 및 이의 용도

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1585482A4 (en) 2002-09-25 2009-09-09 Genentech Inc NEW COMPOSITIONS AND METHODS FOR TREATING PSORIASIS
FR2873698B1 (fr) * 2004-07-29 2006-10-20 D Anjou Sa Lab Nouveau peptide et composition pharmaceutique le contenant
ES2358829B1 (es) 2009-10-23 2012-06-25 Lipotec, S.A. Péptidos útiles en el tratamiento y/o cuidado de la piel, mucosas y/o cabello y su uso en composiciones cosméticas o farmacéuticas.
JP6925805B2 (ja) 2014-10-31 2021-08-25 京都府公立大学法人 ラミニンによる角膜の新規治療
KR101744959B1 (ko) * 2014-12-05 2017-06-12 (주)케어젠 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2016164216A1 (en) * 2015-04-09 2016-10-13 Isp Investments Inc. Method of cosmetic treatment to protect the skin from pollution and improve skin regeneration
US11220669B2 (en) 2015-06-05 2022-01-11 Amolifescience Co., Ltd. Defined three dimensional microenvironment for cell culture
US11085056B2 (en) 2015-08-28 2021-08-10 Molecular Transfer, Inc. Transfection complexes and methods of using the same
WO2017151733A1 (en) * 2016-03-01 2017-09-08 Molecular Transfer, Inc. Plant virus movement proteins and methods of using the same
KR101889322B1 (ko) * 2016-08-17 2018-08-20 (주)진셀팜 주름 개선 및 항노화 효과를 가지는 펩타이드, 및 이의 용도
JP2020500009A (ja) * 2016-10-21 2020-01-09 ベスタロン コーポレイション 切断可能ペプチドならびにそれを含む殺虫性タンパク質及び殺線虫性タンパク質
US20190382719A1 (en) * 2016-12-07 2019-12-19 Amolifescience Co., Ltd. Three-dimensional micro-environment structure for controlling cell behavior, three-dimensional surface for controlling cell behavior, and method for manufacturing array and three-dimensional micro-environment structure
KR101943083B1 (ko) * 2017-03-30 2019-01-29 (주)케어젠 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100136103A1 (en) * 2007-05-08 2010-06-03 Tupperware Products S.A. Cosmetic anti-ageing skin care compositions
KR101092915B1 (ko) * 2009-07-10 2011-12-12 (주)케어젠 성장인자―유래 펩타이드 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 16 September 2010 (2010-09-16), DOI,M., THYBOLL,J., KORTESMAA,J., JANSSON,K., IIVANAINEN,A., PARVARDEH,M., TIMPL,R.: "laminin alpha5 chain precursor [Homo sapiens]", XP055733053, retrieved from NCBI Database accession no. AAM12527.1 *
DATABASE Protein 20 March 2018 (2018-03-20), "laminin subunit alpha-5 isoform X1 [Pan troglodytes]", XP055733207, retrieved from NCBI Database accession no. XP_024207819.1 *
DATABASE Protein 23 March 2015 (2015-03-23), VENTER, J. C. AND ADAMS,M.D., MYERS,E.W., LI,P.W., MURAL,R.J., SUTTON,G.G., SMITH,H.O., YANDELL,M., EVANS,C.A.: "laminin, alpha 5, isoform CRA_b [Homo sapiens]", XP055732947, retrieved from NCBI Database accession no. EAW75373.1 *
See also references of EP3904369A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220072348A (ko) * 2020-11-25 2022-06-02 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도
KR102474470B1 (ko) 2020-11-25 2022-12-07 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도

Also Published As

Publication number Publication date
CN112236441A (zh) 2021-01-15
JP7048766B2 (ja) 2022-04-05
CN112236441B (zh) 2023-12-05
EP3904369A4 (en) 2022-11-23
US20210205200A1 (en) 2021-07-08
KR102065171B1 (ko) 2020-01-13
JP2021526145A (ja) 2021-09-30
EP3904369A1 (en) 2021-11-03
BR112021016104A2 (pt) 2021-11-09
US11433013B2 (en) 2022-09-06

Similar Documents

Publication Publication Date Title
WO2020171285A1 (ko) 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
WO2021033829A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2017155232A2 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018182172A1 (ko) 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
WO2020218781A1 (ko) 불멸화 줄기세포 유래 엑소좀 풍부 배양액 및 장미꽃봉오리 추출물을 유효성분으로 포함하는 기능성 조성물
WO2017200288A1 (ko) 천연 한방 추출물을 유효성분으로 포함하는 미백, 피부 노화 방지 또는 피부 주름 개선용 조성물
WO2023055007A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2023054817A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2017119756A1 (ko) 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
WO2018111042A2 (ko) 한약재 추출물을 유효성분으로 포함하는 화장료 조성물
WO2020138674A1 (ko) 근육 이완용 조성물
RU2773534C1 (ru) Пептид для профилактики повреждений кожи, вызванных атмосферными загрязнениями, и для омолаживающей терапии, а также его использование
WO2023055006A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2023127986A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106585A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127985A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023055010A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2023127984A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2019088648A1 (ko) 미도드린을 포함하는 조성물 및 이의 용도
WO2024106588A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023055011A1 (ko) 항노화 활성을 갖는 펩타이드 및 이의 용도
WO2024106587A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023055051A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023127987A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023055060A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19916142

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020567020

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019916142

Country of ref document: EP

Effective date: 20210728

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021016104

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112021016104

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210813