WO2018182172A1 - 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도 - Google Patents

환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2018182172A1
WO2018182172A1 PCT/KR2018/001953 KR2018001953W WO2018182172A1 WO 2018182172 A1 WO2018182172 A1 WO 2018182172A1 KR 2018001953 W KR2018001953 W KR 2018001953W WO 2018182172 A1 WO2018182172 A1 WO 2018182172A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
peptide
dioxin
acid sequence
Prior art date
Application number
PCT/KR2018/001953
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to EP18774488.3A priority Critical patent/EP3611182B1/en
Priority to JP2019552607A priority patent/JP6896094B2/ja
Priority to ES18774488T priority patent/ES2975420T3/es
Priority to EA201992304A priority patent/EA201992304A1/ru
Priority to CN201880021782.3A priority patent/CN110461864B/zh
Priority to US16/497,056 priority patent/US11104704B2/en
Priority to BR112019020063A priority patent/BR112019020063A2/pt
Publication of WO2018182172A1 publication Critical patent/WO2018182172A1/ko
Priority to US17/391,261 priority patent/US11597748B2/en
Priority to US18/158,642 priority patent/US11859016B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00—Preparations for affecting hair growth
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a peptide having a cell protective effect against an environmental pollutant and its use.
  • Environmental pollutants are classified as so-called endocrine disruptors, and their types include organochlorine-based substances including dioxins, pesticides, phthalates, benzopyrenes, penta-nonyl phenols, bisphenol A, heavy metals, styrene dimers and trimers. These substances are very chemically stable, have a long time in the environment and have high bioaccumulation, which leads to the human body through the food chain.
  • dioxin is a chlorinated hydrocarbon compound, and generally refers to dioxins (polychlorinated dibenzo- p- dioxin (PCDD) and furan (polychlorinated dibenzofuran (PCDF)) having similar chemical structures.
  • PCDD and 135 PCDF isomers exist.
  • Fine dust is composed of sulfurous acid gas, nitrogen oxide, lead, ozone, carbon monoxide, etc., and the particle size is fine dust with diameter of 10um or less, PM10. If the particle diameter is 2.5um or less, it is called ultrafine dust, PM2.5.
  • the natural causes of fine dust include soil dust, salt from sea water, pollen of plants, etc.
  • the causes of artificial dust are fumes from burning fossil fuels, automobile exhaust, flying dust from construction sites, raw materials in powder form in factories, Subsidiary materials, and incineration smoke.
  • Phenoic aromatic hydrocarbons contained in dioxins and fine dusts are known to infiltrate cells and commonly activate the aryl hydrocarbon receptor (AhR).
  • AhR activation mechanism increases intracellular reactive oxygen species (ROS), and AhR, ARNT heterodimer complexes bind to the xenobiotic response element (XRE) in the nucleus for various inflammations.
  • ROS reactive oxygen species
  • XRE xenobiotic response element
  • MITf microphthalmia-associated transcription factor
  • MMPs matrix metalloproteases
  • Previously released anti-pollutants used materials to prevent the adsorption of fine dust to the skin or to strengthen the skin barrier. This does not prevent the direct mechanism of action of environmental pollutants such as dioxin or fine dust, but has an indirect protective effect. If environmental pollutants directly affect skin and affect skin cells, no raw materials or products have been developed that inhibit them.
  • TCDD 2,3,7,8-tetrachlorodibenzodioxin
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating a disease caused by a dioxin-like substance comprising at least one member selected from the group consisting of peptides consisting of amino acid sequences of SEQ ID NO: 1, 2 or 3 .
  • Another object of the present invention is to alleviate diseases caused by dioxin-like substances comprising as an active ingredient at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 It is to provide a food composition for improvement.
  • Another object of the present invention to provide a cosmetic composition for improving skin conditions comprising at least one selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3.
  • Another object of the present invention is to provide a method for preventing or treating a disease caused by a dioxin analog.
  • Another object of the invention relates to the use of the prophylaxis or treatment of diseases caused by dioxin analogs of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, or 3.
  • the present invention relates to a peptide having a cell protective effect against environmental pollutants and its use, wherein the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 is known to be the most toxic among dioxin series 2,3,7, Direct binding to 8-tetrachlorodibenzodioxin (hereinafter TCDD) prevents penetration into the skin and prevents AhR activation mechanism by polycyclic aromatic hydrocarbons contained in TCDD and fine dust. For example, the effect of cell protection on these direct pollutants is indirectly different from existing methods of indirectly preventing opportunities for contact with the substance or reducing toxicity by strengthening barriers.
  • TCDD 8-tetrachlorodibenzodioxin
  • One aspect of the invention relates to a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3.
  • the peptide may be one in which N-terminal and / or C-terminal modifications are induced to select a portion of an amino acid sequence and increase its activity.
  • N-terminal and / or C-terminal modifications can significantly improve the stability of the peptides of the present invention and, for example, increase the half-life upon in vivo administration of the peptides.
  • the N-terminal modification is an acetyl group, fluorenylmethoxycarbonyl group, formyl group, palmitoyl group, myristyl group at the N-terminus of the peptide.
  • a stearyl group, and a polyethylene glycol (PEG) may be combined with a protecting group selected from the group consisting of.
  • the protecting group serves to protect the peptide of the present invention from the attack of protein cleavage enzymes in vivo.
  • the C-terminal modification may be a combination of a hydroxyl group (-OH), an amino group (amino group, -NH2), azide (azide, -NHNH2), etc. to the C-terminal end of the peptide, but is not limited thereto. .
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 is 2,3,7,8-tetrachlorodibenzodioxin (hereinafter referred to as TCDD) which is known to be the most toxic among the dioxins family It binds directly to and prevents penetration into the skin, and prevents AhR activation mechanism by polycyclic aromatic hydrocarbons contained in TCDD and fine dust.
  • TCDD 2,3,7,8-tetrachlorodibenzodioxin
  • Polycyclic aromatic hydrocarbons introduced into the cell are combined with AhR, move into the nucleus, form a complex with AHR nuclear translocator (ARNT), attach to a dioxin-responsive element (DRE), and promote the expression of subgenes.
  • Subgenes include CYP1A1 and several inflammation related factors. CYP1A1 is involved in the metabolism of several carcinogenic progenitors such as benzopyrene, and these metabolites are known to react with DNA and cause mutations. In addition, the expression of inflammation-related factors such as COX2, TNF-a and IL-1b may be increased to cause inflammatory responses in the contact area and systemic.
  • Another aspect of the invention relates to a pharmaceutical composition for preventing or treating a disease caused by a dioxin analogue comprising at least one peptide selected from the group consisting of peptides consisting of amino acid sequences of SEQ ID NOs: 1, 2 or 3 .
  • Diseases caused by the dioxin-like substance are very complex, skin diseases such as chlorine acne, sperm count, testicular cancer, prostate cancer, endometrial hyperplasia, breast cancer, hepatotoxicity, reduced immune function, hyperlipidemia, lower urethral fever, incubation It may include, but is not limited to, birth defects, vascular injuries, hepatocellular carcinoma, hypertrophy of the liver, adenofibrosis, weight loss, hair loss, oral edema, bleeding, or gastric mucosal ulcers. (Carter et al., Science 188: 738 (1975); Fourth Annual Report on Carcinogens, NTP 85-002: 170, 185 (1985)).
  • TCDD 2,3,7,8-tetrachlorodibenzodioxin
  • PCDD polychlorinated dibenzo-p-dioxin
  • PCDFs polychlorinated dibenzofuran
  • PCBs polychlorinated biphenyls
  • dioxin refers to all compounds included in the PCDD, and "dioxin-like substance" includes the above-described PCDD, PCDFs and PCBs, and exhibits the same cellular effect as PCDD. Means.
  • Dioxins are carcinogenic substances that have been reported to cause serious diseases such as reproductive and developmental disturbances, damage to the immune system and interference with hormonal regulation (Yang, JH et al., Carcinogenesis. 20: 13-18 (1999). ), Lee, YW et al., Toxicol. Lett., 102-103: 29-83 (1998).
  • the pharmaceutical composition may include a pharmaceutically effective amount of at least one peptide selected from the group consisting of peptides consisting of the amino acid sequences of SEQ ID NO: 1, 2 or 3.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is conventionally used in the preparation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention may further include, but is not limited to, a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • the pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, may be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, or the like. It is not limited to this.
  • the dosage of the pharmaceutical composition may be 0.0001 to 1000 ug per day (microgram, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug, but is not limited thereto. It may be prescribed in various ways by factors such as method, mode of administration, age, weight, sex, pathological condition, food, time of administration, route of administration, rate of excretion and response to response of the patient.
  • the pharmaceutical composition may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person skilled in the art. It can be prepared by incorporation into a multi-dose container.
  • the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants and / or stabilizers.
  • Another aspect of the present invention is directed to an antagonistic food composition for a dioxin analogue comprising at least one peptide selected from the group consisting of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient It is about.
  • Another aspect of the present invention is to alleviate a disease caused by a dioxin-like material comprising at least one peptide selected from the group consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient And / or a food composition for improvement.
  • Diseases caused by the dioxin-like substance include sperm count, testicular cancer, prostate cancer, endometrial hyperplasia, breast cancer, hepatotoxicity, decreased immune function, hyperlipidemia, subesophageal fever, latent, birth defects, vascular injury, hepatocellular carcinoma, liver It may include, but is not limited to, hypertrophy, fibrosis, weight loss, hair loss, oral edema, eyelid edema, or gastric mucosal ulcer.
  • the food may be various foods, beverages, food additives and the like.
  • the content of the peptide as an active ingredient contained in the food composition is not particularly limited according to the form of the food, the desired use, etc., for example, may be added to 0.01 to 15% by weight of the total food weight, health beverage composition It can be added at a ratio of 0.02 to 10 g, preferably 0.3 to 1 g based on 100 ml of silver.
  • the food is a beverage
  • the liquid component in addition to containing the peptide as an essential ingredient in the indicated ratio, there are no particular limitations on the liquid component, and may contain various flavors or natural carbohydrates as additional ingredients as in general beverages.
  • the natural carbohydrates are monosaccharides such as disaccharides such as glucose, fructose and the like, and conventional sugars and xylitol such as maltose, sucrose and the like, and polysaccharides such as dextrin, cyclodextrin and the like.
  • Sugar alcohols such as sorbitol and erythritol.
  • natural flavoring agents such as, tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of natural carbohydrates is generally about 1-20 g, preferably about 5-12 g per 100 ml of the composition of the present invention.
  • the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid and Salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the food composition of the present invention may contain a fruit flesh for producing natural fruit juice and fruit juice beverage and vegetable beverage.
  • These components can be used independently or in combination.
  • the proportion of such additives is not so critical but is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.
  • Another aspect of the present invention relates to a cosmetic composition for improving skin conditions comprising at least one member selected from the group consisting of peptides consisting of the amino acid sequences of SEQ ID NO: 1, 2 or 3.
  • the cosmetic composition comprises (a) a cosmetically effective amount of the above-described peptide of the present invention; And / or (b) a cosmetically acceptable carrier, but is not limited thereto.
  • cosmetic effective amount means an amount sufficient to achieve the skin condition improving efficacy of the composition of the present invention described above.
  • the cosmetic composition may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing, oils It may be formulated as powder foundation, emulsion foundation, wax foundation, spray, and the like, but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
  • the carrier components include animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide. Can be used.
  • the cosmetic formulation of the present invention is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular, in the case of a spray, additionally chlorofluorohydrocarbon.
  • Propellant such as propane / butane or dimethyl ether.
  • a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol , Fatty acid esters of 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • the cosmetic formulation of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the carrier component is aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • the components included in the cosmetic composition of the present invention include components commonly used in cosmetic compositions, in addition to peptides and carrier components as active ingredients, and include, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and flavorings. Such conventional adjuvants may be included.
  • the term "improvement of skin condition” means a process of treating, alleviating, or alleviating damage to skin caused by an intrinsic or exogenous factor of the skin, or an effect thereof, for example, in skin It may be interpreted to exhibit the effect of alleviating, improving, or the like, but is not limited thereto.
  • Another aspect of the invention relates to a method of preventing or treating a disease caused by a dioxin analog.
  • the prophylactic or therapeutic method may include contacting a subject with a pharmaceutical composition comprising one or more peptides selected from the group consisting of peptides consisting of amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 .
  • the pharmaceutical composition is as described above.
  • Another aspect of the invention relates to the use of the prophylaxis or treatment of a disease caused by a dioxin analog of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, or 3.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, or 3 is the same as described.
  • peptide herein refers to a linear molecule formed by binding amino acid residues to each other by peptide bonds.
  • the peptides of the present invention may be prepared by chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. Ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Pat. No. 5,516,891).
  • the term “stability” refers to in vivo stability as well as storage stability (eg, room temperature storage stability).
  • the term "pharmaceutically effective amount” means an amount sufficient to achieve the efficacy or activity of the aforementioned peptides.
  • the present invention relates to a peptide having a cell protective effect against environmental pollutants and its use, wherein the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 is known to be the most toxic among dioxin series 2,3,7, Direct binding to 8-tetrachlorodibenzodioxin (hereinafter TCDD) prevents penetration into the skin and prevents AhR activation mechanism by polycyclic aromatic hydrocarbons contained in TCDD and fine dust. For example, the effect of cell protection on these direct pollutants is indirectly different from existing methods of indirectly preventing opportunities for contact with the substance or reducing toxicity by strengthening barriers.
  • TCDD 8-tetrachlorodibenzodioxin
  • Figure 1a is a graph showing the binding force to TCDD of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 1b is a graph showing the binding force to TCDD of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 1c is a graph showing the binding force to TCDD of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 2a is a diagram showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 2b is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 2c is a diagram showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 2d is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 2e is a diagram showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 2f is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 3a is a graph showing the TCDD ICC results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 3b is a graph showing the TCDD ICC results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 3c is a graph showing the TCDD ICC results of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 4a is a graph showing the results of intracellular ROS analysis of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 4b is a graph showing the results of intracellular ROS analysis of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 4c is a graph showing the results of intracellular ROS analysis of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 5a is a graph showing the CYP1A1 and inflammatory molecule RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 5b is a graph showing the CYP1A1 and inflammatory molecule RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 5c is a graph showing the results of CYP1A1 and inflammatory molecules RT-PCR of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 6a is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 6b is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 6c is a graph showing the AhR nuclear translocation test results of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 7a is a graph showing the CYP1A1 and inflammatory molecule RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 7b is a graph showing the CYP1A1 and inflammatory molecule RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 7c is a graph showing the CYP1A1 and inflammatory molecule RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • chloro trityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was added to a reaction vessel, and 490 ml of methylene chloride (MC) was added thereto, followed by stirring for 3 minutes. Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added thereto, stirred for 3 minutes, and then the solvent was removed again.
  • CTC resin chloro trityl chloride resin
  • MC methylene chloride
  • DMF dimethylformamide
  • the deprotection reaction was performed twice as described above with the deprotection solution to prepare Arg (Pbf) -Tyr (tBu) -CTL Resin. After sufficient washing with DMF and MC, once again Kaiser test was performed, and the following amino acid attachment experiment was performed as above. Based on the selected amino acid sequence, chain reaction was performed in the order of Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, and Fmoc-Lys (Boc) -OH. The Fmoc-protector was reacted twice with a deprotection solution twice for 10 minutes and then washed well.
  • the peptidyl resin was washed three times with DMF, MC and methanol, and dried slowly by flowing nitrogen air, and then dried under reduced pressure under vacuum under P 2 O 5 to completely dry, followed by a fugitive solution (Trifluroacetic acid 81.5). %, Distilled water 5.0%, Thianisole 5.0%, Phenol 5.0%, EDT (EDT, Ethanedithiol) 2.5%, TIS (Tisopropylsilane) 1.0%] After adding 1,900 ml, shake at room temperature The reaction was maintained for 2 hours. The resin was filtered off and the resin was washed with a small amount of TFA solution and then combined with the mother liquor.
  • Peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 was also synthesized in the same manner as described above.
  • SEQ ID Nos. 1, 2, and 3 peptides were each mixed with a coating buffer (20 mM sodium phosphate pH 9.6) at a concentration of 1.8 mM and incubated at 4 ° C. overnight. Then, the cells were washed with PBST (Phosphate buffered saline with Tween-20) and blocked with 3% bovine serum albumin (BSA) for 2 hours at room temperature. Then, after washing with PBST again, 2,3,7,8-tetrachlorodibenzo-p-dioxin (hereinafter referred to as TCDD) was added 2 uM per well and incubated at room temperature for 2 hours.
  • PBST Phosphate buffered saline with Tween-20
  • BSA bovine serum albumin
  • HaCaT a human keratinocyte
  • 50uM peptide consisting of TCDD 10nM and amino acid sequences of SEQ ID NOs: 1, 2 or 3 was added to the medium, treated for 30 hours after the reaction for 1 hour, and the cells were recovered to separate nuclear and cytoplasmic proteins, respectively.
  • Western blot using AhR (Aryl hydrocarbon receptor) antibody was performed to confirm activated AhR nuclear migration, and the results are shown in FIGS. 2A to 2F and Table 3.
  • HaCaT a human keratinocyte
  • TCDD 50 nM amino acid sequences of SEQ ID NOs: 1, 2 or 3
  • 50 uM of peptide consisting of TCDD 50 nM and amino acid sequences of SEQ ID NOs: 1, 2 or 3 were added to the medium and treated for 5 minutes after reaction for 30 minutes, and fixed with 4% paraformaldehyde for 30 minutes. Then, after washing three times, reacted with 0.5% Triton X-100 for 15 minutes and washed three times.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 inhibited the influx of TCDD into the cell.
  • HaCaT a human keratinocyte
  • TCDD 10 nM amino acid sequences of SEQ ID NOs: 1, 2 or 3
  • DCFH-DA DCFH-DA
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 lowered the level of intracellular ROS increased by TCDD.
  • HaCaT a human keratinocyte
  • 50uM of peptide consisting of TCDD 10nM and amino acid sequence of SEQ ID NO: 1, 2 or 3 was added to the medium, and after 30 minutes reaction, the cells were treated for 6 hours or 24 hours, and the cells were recovered to separate RNA.
  • cDNA was synthesized using cDNA synthesis kit (Intron, Korea), and PCR premix (Intron, Korea) and CYP1A1, TNF-a, IL-6, IL-1b, and COX-2 of Table 4, respectively. PCR was performed using the primers. Then, running on a 5% agarose gel to compare the mRNA expression of the growth factors in each sample treatment conditions, the results are shown in Figures 5a to 5c.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 showed the effect of inhibiting the expression of CYP1A1 and various inflammation-related factors induced by TCDD.
  • HaCaT a human keratinocyte
  • PM urban particulate matters
  • 10 uM peptide consisting of amino acid sequences of SEQ ID NOs: 1, 2 or 3 were added to the medium, treated for 1 hour after the reaction for 30 minutes, and the cells were recovered to recover the nuclear and cytoplasmic proteins. Were separated respectively.
  • Western blot using AhR (Aryl hydrocarbon receptor) antibody was performed to confirm activated AhR nuclear migration, and the results are shown in FIGS. 6A to 6C.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 inhibited AhR nuclear migration by fine dust.
  • HaCaT a human keratinocyte
  • a human keratinocyte was seeded in 6-well plates at a density of 3 ⁇ 10 5 cells / well and incubated overnight.
  • 50 uM of peptide consisting of 10 nM of PM (Particulate matter) and amino acid sequences of SEQ ID NOs: 1, 2 or 3 was added to the medium, and after 30 minutes of reaction, the cells were treated for 6 hours or 24 hours, and the cells were recovered to separate RNA.
  • RNA was quantified, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), PCR premix (Intron, Korea) and CYP1A1, TNF-a, IL-6, IL-1b, PCR was performed using primers for each of COX-2. Then, run on a 5% agarose gel to compare the mRNA expression level of the growth factors in each sample treatment conditions, the results are shown in Figure 7a to 7c.
  • the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2 or 3 showed the effect of inhibiting the expression of CYP1A1 and various inflammation-related factors induced by fine dust.
  • the present invention relates to a peptide having a cell protective effect against an environmental pollutant and its use.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Nutrition Science (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Polymers & Plastics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Birds (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Cosmetics (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 환경오염 물질에 대한 세포 보호 효능을 갖는 펩타이드 및 이의 용도에 관한 것으로, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드가 다이옥신 계열 중 독성이 가장 강한 것으로 알려진 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 직접적으로 바인딩(binding)하여 피부 내 침투를 막고, TCDD 및 미세먼지에 포함된 다환방향족탄화수소에 의한 AhR 활성 기전을 막아주는 역할을 하는 것으로 확인되었으며, 이러한 직접적인 환경오염 물질에 대한 세포 보호 효과는 간접적으로 물질에 대한 접촉 기회를 막아주거나 장벽 강화를 통해 독성을 감소 시키는 기존의 방법과는 차별성을 가지는 것이다.

Description

환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
본 발명은 환경오염 물질에 대한 세포 보호 효능을 갖는 펩타이드 및 이의 용도에 관한 것이다.
환경오염 물질은 소위 내분비계장애물질로 분류되어 있으며, 그 종류에는 다이옥신을 포함한 유기염소계물질, 농약, 프탈레이트, 벤조피렌, 펜타-노닐 페놀, 비스페놀 A, 중금속, 스티렌 다이머 및 트리머 등이 있다. 이들 물질들은 화학적으로 매우 안정하여 환경에 잔류하는 시간이 길며 생체 축적도가 높아 먹이사슬을 통하여 인체에까지 이르게 된다.
이 중 다이옥신은 염화탄화수소 화합물로 서로 비슷한 화학적 구조를 가지는 다이옥신류(polychlorinated dibenzo-p-dioxin; PCDD)와 퓨란류(polychlorinated dibenzofuran; PCDF)를 통상적으로 말하며, 치환되는 염소의 수에 따라 75종의 PCDD와 135종의 PCDF 이성질체가 존재한다.
주로 쓰레기 소각, 종이 또는 펄프의 표백과정, 플라스틱 제조, 유기 염소계 농약의 제조 등에서 배출 또는 생성된다. 상온에서 무색의 결정성 고체이고 열화학적으로 안정하며 지방에 잘 녹기 때문에 생물체 안에 들어올 경우 지방 조직에 축적되는 성질을 갖는다. 인체에 미치는 영향으로는 생식 기능 장애, 유산, 태아의 비정상적 발달, 호르몬 조절 기능의 변화, 당뇨 발병, 면역체계의 이상, 암 유발 가능성 등이 있다.
미세먼지는 아황산가스, 질소 산화물, 납, 오존, 일산화 탄소 등으로 이루어지고 입자의 크기가 지름 10um 이하인 미세한 먼지이며 PM10이라 하고 입자의 지름이 2.5um 이하인 경우 초미세먼지, PM2.5 라고 부른다. 미세먼지의 자연적 발생 원인은 흙먼지, 바닷물에서 생기는 소금, 식물의 꽃가루 등이 있으며 인위적 발생 원인은 화석연료 등을 태울 때 생기는 매연, 자동차 배기가스, 건설 현장의 날림 먼지, 공장 내 분말 형태의 원자재, 부자재, 그리고 소각장 연기 등이 있다.
이러한 미세먼지는 입자의 지름이 사람 머리카락 굵기의 1/5 내지 1/7배 정도로 매우 작아 인체의 비강, 구강, 기관지에서 걸러지지 않고 깊숙하게 침투된다. 상기의 유해 물질과 흡착된 형태로 몸속에 들어와 기도, 폐, 심혈관, 뇌 등 각 기관의 염증반응을 유발하여 호흡기 질환, 심혈관계 질환들을 유발한다. 또한 2013년 10월에는 세계보건기구 산하 국제암연구소에 의해 1군 발암물질로 분류되기도 하였다.
다이옥신과 미세먼지에 포함된 다환방향족탄화수소(polycyclic aromatic hydrocarbon, PAH)는 세포 내로 침투되어 공통적으로 아릴 하이드로카본 수용체(Aryl hydrocarbon receptor; AhR)를 활성화 시키는 것으로 알려져 있다. AhR 활성화 기전을 통해 세포 내 활성 산소종(Reactive oxygen species; ROS)이 증가되고 AhR, ARNT 이종 이량체 복합체(heterodimer complex)가 핵 내 이명생물반응요소(xenobiotic response element; XRE)에 결합하여 다양한 염증 매개 인자, 멜라닌 합성 관련 전사인자인 작은 안구증 연관 전사 요소(Microphthalmia-associated transcription factor; Mitf), 주름 생성 관련 효소인 메트릭스 메탈로프로테아제(Matrix metalloproteases; MMPs)의 발현을 증가시켜 피부에서는 피부염, 색소 과형성(기미, 주근깨 등), 주름 등을 일으키게 된다.
기존에 출시된 안티 폴루턴트 제품들은 전하를 이용하여 미세먼지의 피부 흡착을 막거나 피부 장벽을 강화시키는 원료를 사용하고 있었다. 이는 다이옥신이나 미세먼지와 같은 환경오염 물질의 직접적인 작용 기전을 막는 것이 아닌 간접적인 보호 효과를 나타낸다. 환경오염 물질이 피부에 직접 접촉되어 피부 세포에 영향을 줄 경우 이를 저해시키는 원료나 제품은 개발되지 않은 상황이다.
이에 본 발명자들은 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드가 다이옥신 계열 중 독성이 가장 강한 것으로 알려진 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 직접적으로 바인딩(binding)하여 피부 내 침투를 막고, TCDD 및 미세먼지에 포함된 다환방향족탄화수소에 의한 AhR 활성 기전을 막아주는 역할을 하는 것으로 확인되었다.
이에, 본 발명의 목적은 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상을 포함하는 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 다이옥신 유사물질에 의해 유발되는 질병의 완화 및/또는 개선용 식품 조성물을 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상을 포함하는 피부상태 개선용 화장품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1, 2, 또는 3의 아미노산 서열로 이루어진 펩타이드의 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료 용도에 관한 것이다.
본 발명은 환경오염 물질에 대한 세포 보호 효능을 갖는 펩타이드 및 이의 용도에 관한 것으로, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드가 다이옥신 계열 중 독성이 가장 강한 것으로 알려진 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 직접적으로 바인딩(binding)하여 피부 내 침투를 막고, TCDD 및 미세먼지에 포함된 다환방향족탄화수소에 의한 AhR 활성 기전을 막아주는 역할을 하는 것으로 확인되었으며, 이러한 직접적인 환경오염 물질에 대한 세포 보호 효과는 간접적으로 물질에 대한 접촉 기회를 막아주거나 장벽 강화를 통해 독성을 감소 시키는 기존의 방법과는 차별성을 가지는 것이다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.
상기 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 및/또는 C-말단 변형이 유도 된 것일 수 있다. 이러한 N-말단 및/또는 C-말단 변형을 통해 본 발명의 펩타이드의 안정성을 현저하게 향상시킬 수 있으며, 예를 들어, 펩타이드의 생체 내 투여 시 반감기를 증가시킬 수 있다.
상기 N-말단 변형은 펩타이드의 N-말단에 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택된 보호기가 결합한 것일 수 있다. 상기 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.
상기 C-말단 변형은 펩타이드의 C-말단에 히드록시기(hydroxyl group, -OH), 아미노기(amino group, -NH2), 아자이드(azide, -NHNH2) 등이 결합한 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 따르면, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 다이옥신 계열 중 독성이 가장 강한 것으로 알려진 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 직접적으로 바인딩(binding)하여 피부 내 침투를 막고, TCDD 및 미세먼지에 포함된 다환방향족탄화수소에 의한 AhR 활성 기전을 막아주는 효과를 나타낸다.
세포 내로 유입된 다환방향족탄화수소는 AhR과 결합하여 핵 내로 이동하고 ARNT(AHR nucleartranslocator)와 복합체를 형성하여 DRE(dioxin-responsive element)에 붙고 하위 유전자의 발현을 촉진한다. 하위 유전자에는 CYP1A1 및 여러 염증 관련 인자들이 있다. CYP1A1은 벤조피렌과 같은 여러 발암 전구 인자의 대사에 관여하여 이렇게 생성된 대사체들은 DNA와 반응하여 돌연변이를 야기하는 것으로 알려져 있다. 또한, COX2, TNF-a 및 IL-1b와 같은 염증 관련 인자들의 발현을 증가시켜 접촉 부위 및 전신의 염증 반응을 유발하기도 한다.
이러한 결과는 본 발명의 펩타이드가 다이옥신 유사물질에 의해 유발되는 질병의 예방 및/또는 치료에 매우 우수한 효능을 가진다는 것을 의미한다.
본 발명의 다른 일 양태는 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 다이옥신 유사물질에 의해 유발되는 질병 예방 또는 치료용 약제학적 조성물에 관한 것이다.
상기 다이옥신 유사물질에 의해 유발되는 질병은 매우 복합적으로 나타나며, 염소성 여드름과 같은 피부 질환, 정자수 감소, 고환암, 전립선암, 자궁내막 증식증, 유방암, 간독성, 면역기능 저하, 고지혈증, 요도하열, 잠복고한, 기형아 출산, 혈관 손상, 간세포성 암종, 간의 비대, 선섬유증, 체중 손실, 모발 손실, 구강 부종, 안검 부종 또는 위점막성 궤양 등을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.(Carter et al., Science 188:738(1975); Fourth Annual Report on Carcinogens, NTP 85-002:170, 185(1985))
본 명세서의 용어 "다이옥신"은 일반적으로 대중매체에서 사용되고 있는 용어로서, 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 대한 단축어로서 사용되고 있다. 그러나, TCDD는 폴리염소화 디벤조-p-다이옥신 (이하, PCDD) 패밀리의 일종으로서, PCDD는 염소 원자의 위치 및 수에 따라 75종의 동족체(congener)를 갖는다. 생물학적으로, TCDD는 가장 강력한 독성을 갖는 PCDD로 알려져 있다.
한편, TCDD와 공통된 생물학적 특성을 갖는 다른 방향족 탄화수소가 공지되어 있으며, 예를 들어, 폴리염소화 디벤조퓨란(PCDFs) 패밀리 및 폴리염소화 비페닐(PCBs) 패밀리가 있다.
이에, 본 명세서에서 사용되는 용어인 "다이옥신"은 PCDD에 포함되는 모든 화합물을 의미하고, "다이옥신 유사물질"은 상기한 PCDD, PCDFs 및 PCBs를 포함하는 것으로서, PCDD와 동일한 세포적 효과를 나타내는 물질을 의미한다.
다이옥신은 발암성 물질로 생식계 및 발생과정 교란, 면역체계의 손상 및 호르몬 조절작용의 간섭 등의 심각한 질병을 유발하는 것으로 보고 되고 있다 (Yang, J. H. et al., Carcinogenesis. 20: 13-18(1999), Lee, Y. W. et al., Toxicol. Lett., 102-103:29-83(1998)).
미국환경처(EPA)의 보고에 의하면 다이옥신 및 다이옥신 유사물질에 노출시 일어나는 인체내의 악영향에 대한 통계로서, 50년 전과 비교하여 남성의 정자수가 50% 수준으로 감소하고, 고환암 발생 빈도가 3배 정도 증가하며, 전립선암은 2배 이상 증가하는 것으로 보고되었다. 또한, 다이옥신 등에 기인하여 과거와 달리 자궁내막 증식증과 여성의 유방암 발생빈도의 증가 등이 확인되고 있다.
상기 약제학적 조성물은 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드의 약제학적 유효량을 포함하는 것일 수 있다.
또한, 상기 약제학적 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있다.
상기 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적 조성물의 투여량은 1일 당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 한정되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 일 양태는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 다이옥신 유사물질에 대한 길항성 식품 조성물에 관한 것이다.
본 발명의 또 다른 일 양태는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 다이옥신 유사물질에 의해 유발되는 질병의 완화 및/또는 개선용 식품 조성물에 관한 것이다.
상기 다이옥신 유사물질에 의해 유발되는 질병은 정자수 감소, 고환암, 전립선암, 자궁내막 증식증, 유방암, 간독성, 면역기능 저하, 고지혈증, 요도하열, 잠복고한, 기형아 출산, 혈관 손상, 간세포성 암종, 간의 비대, 선섬유증, 체중 손실, 모발 손실, 구강 부종, 안검 부종 또는 위점막성 궤양 등을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 식품은 각종 식품, 음료, 식품 첨가제 등일 수 있다.
상기 식품 조성물에 함유된 유효성분으로서의 펩타이드의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 특별한 제한이 없으며, 예를 들어, 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100 ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 가할 수 있다.
상기 식품이 음료인 경우에는 지시된 비율로 필수 성분으로서 상기 펩타이드를 함유하는 것 외에 액체성분에는 특별한 제한점은 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.
상기 천연 탄수화물은 모노사카라이드, 예를 들어, 포도당, 과당 등의 디사카라이드, 예를 들어 말토스, 슈크로스 등, 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다.
상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20g, 바람직하게는 약 5 내지 12g이다.
상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.
그밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명의 또 다른 양태는 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상을 포함하는 피부상태 개선용 화장품 조성물에 관한 것이다.
상기 화장품 조성물은 (a) 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount); 및/또는 (b) 화장품학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "화장품학적 유효량"은 상술한 본 발명의 조성물의 피부상태 개선 효능을 달성하는 데 충분한 양을 의미한다.
상기 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
본 발명의 화장품의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 화장품의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 화장품의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 화장품의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 화장품의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
본 발명의 화장품 조성물에 포함되는 성분은 유효 성분으로서의 펩타이드와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함하며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.
본 발명의 용어 "피부상태 개선"이란, 피부의 내재적 요인 또는 외인적인 요인에 의하여 유발되는 피부의 손상을 치료, 경감, 완화시키는 과정 또는 그의 효과 등을 포괄적으로 의미하며, 예를 들어, 피부에서 발생되는 염증의 완화, 개선 등의 효과를 나타내는 것으로 해석될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료 방법에 관한 것이다.
상기 예방 또는 치료 방법은 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 약학적 조성물을 대상에 접촉시키는 단계를 포함하는 것일 수 있다.
상기 약학적 조성물은 기설명한 바와 동일하다.
본 발명의 또 다른 양태는 서열번호 1, 2, 또는 3의 아미노산 서열로 이루어진 펩타이드의 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료 용도에 관한 것이다.
상기 서열번호 1, 2, 또는 3의 아미노산 서열로 이루어진 펩타이드 기설명한 바와 동일하다.
본 명세서의 용어 "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
본 명세서의 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 명세서에서 용어 "약제학적 유효량"은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.
본 발명은 환경오염 물질에 대한 세포 보호 효능을 갖는 펩타이드 및 이의 용도에 관한 것으로, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드가 다이옥신 계열 중 독성이 가장 강한 것으로 알려진 2,3,7,8-테트라클로로디벤조다이옥신(이하, TCDD)에 직접적으로 바인딩(binding)하여 피부 내 침투를 막고, TCDD 및 미세먼지에 포함된 다환방향족탄화수소에 의한 AhR 활성 기전을 막아주는 역할을 하는 것으로 확인되었으며, 이러한 직접적인 환경오염 물질에 대한 세포 보호 효과는 간접적으로 물질에 대한 접촉 기회를 막아주거나 장벽 강화를 통해 독성을 감소 시키는 기존의 방법과는 차별성을 가지는 것이다.
도 1a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 TCDD에 대한 결합력을 보여주는 그래프이다.
도 1b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 TCDD에 대한 결합력을 보여주는 그래프이다.
도 1c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 TCDD에 대한 결합력을 보여주는 그래프이다.
도 2a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그림이다.
도 2b는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 2c는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그림이다.
도 2d는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 2e는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그림이다.
도 2f는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 3a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 TCDD ICC 결과를 보여주는 그래프이다.
도 3b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 TCDD ICC 결과를 보여주는 그래프이다.
도 3c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 TCDD ICC 결과를 보여주는 그래프이다.
도 4a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 세포 내 ROS 분석 결과를 보여주는 그래프이다.
도 4b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 세포 내 ROS 분석 결과를 보여주는 그래프이다.
도 4c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 세포 내 ROS 분석 결과를 보여주는 그래프이다.
도 5a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
도 5b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
도 5c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
도 6a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 6b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 6c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 AhR 핵 전좌 검사 결과를 보여주는 그래프이다.
도 7a는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
도 7b는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
도 7c는 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 CYP1A1 및 염증분자 RT-PCR 결과를 보여주는 그래프이다.
서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
제조예. 서열목록의 합성
클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTC resin, Nova biochem Cat No. 01-64-0021) 70g을 반응용기에 넣고 메틸렌 클로라이드(MC) 490ml를 가하여 3분간 교반하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF) 490ml를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 그 다음, 반응기에 700ml의 디클로로메탄용액을 넣고 Fmoc-Tyr(tBu)-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 그 다음, 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF)를 490 ml 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 700ml를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Tyr(tBu)-CTL 레진(Resin)을 제조하였다.
새로운 반응기에 700ml의 DMF 용액을 넣고 Fmoc-Arg(Pbf)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 HBTu 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Arg(Pbf)-Tyr(tBu)-CTL Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 81.5%, 증류수 5.0%, 티오아니졸(Thioanisole) 5.0%, 페놀(Phenol) 5.0%, 이디티(EDT, Ethanedithiol) 2.5%, 티아에스(TIS, Triisopropylsilane) 1.0%] 1,900 ml을 넣은 후 상온에서 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 합친 모액 2,090ml는 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 서열번호 1로 이루어진 펩타이드 79.8g을 합성하였다(수율: 97.0%). 분자량 측정기를 이용하여 분자량 측정 시 분자량 822.9 (이론 값: 822.9)를 얻을 수 있었다.
서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드도 상기와 같은 방법으로 합성을 진행하였다.
서열 번호 서열 목록 분석값(질량분석기)
분석치 이론치
1 KWGGGRY 822.9 822.9
2 ILGRWCG 803.9 803.9
3 DVENTS 663.6 663.6
실시예 1. 시험관 내 결합 분석
ELISA(enzyme-linked immunosorbent assay)용 플레이트(plate)에 서열번호 1, 2, 3 펩타이드를 각각 1.8mM의 농도로 코팅 버퍼(20mM 인산나트륨 pH 9.6)와 섞어 4℃ 조건에서 하룻밤 동안 배양하였다. 그 다음, PBST(Phosphate bufferedsaline with Tween-20)로 세척 후 3% BSA(bovine serum albumin)로 2시간 동안 실온에서 블록킹(blocking)을 진행하였다. 그 다음, 다시 PBST로 세척 후 2,3,7,8-테트라클로로디벤조다이옥신(Tetrachlorodibenzo-p-dioxin; 이하, TCDD)를 웰(well)당 2uM 첨가하고 2시간 동안 실온에서 배양하였다. 그 다음, PBST로 세척 후 FITC (Fluorescein isothiocyanate)가 결합되어 있는 항-TCDD 항체를 항체:PBST=1:100의 비율로 처리하고 2시간 동안 실온에서 배양을 진행하였다. 그 다음, PBST로 세척 후 excitation 488nm / emission 520nm 값을 형광측정기로 측정하고 그 결과를 도 1a 내지 도 1c 및 표 2에 나타내었다.
서열번호 대조군 50 uM 500 uM 1000 uM 2000 uM
1 100 % 193 % 360 % 394 % 575 %
2 100 % 128 % 264 % 358 % 405 %
3 100 % 159 % 253 % 400 % 420 %
도 1a 내지 도 1c 및 표 2에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 TCDD에 대한 직접적인 결합력을 보임을 확인하였다.
실시예 2. AhR 핵 전좌 검사(nuclear translocation test)
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, TCDD 10nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 1시간 동안 처리하고, 세포를 회수하여 핵과 세포질 단백질을 각각 분리하였다. AhR(Aryl hydrocarbon receptor) 항체(santacruz biotechnology, USA)를 이용한 웨스턴 블랏을 수행하여 활성화된 AhR 핵 이동을 확인하여, 그 결과를 도 2a 내지 도 2f 및 표 3에 나타내었다.
서열번호 대조군 TCDD TCDD + 펩타이드
5uM 50 uM
1 1배 5.8배 1.9배 1.9배
2 1배 5.7배 2.5배 0.9배
3 1배 5.9배 3배 1.5배
도 2a 내지 도 2f 및 표 3에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 TCDD에 의한 AhR 핵 이동을 억제함을 확인하였다.
실시예 3. TCDD ICC
인간 각질 형성 세포인 HaCaT을 3x105cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, TCDD 50nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 5분간 처리하고, 4% 파라포름알데히드(paraformaldehyde)로 30분간 고정시켰다. 그 다음, 3번 세척 후 0.5% 트리톤 X-100에 15분간 반응시키고 3번 세척하였다. 그 다음, 3% BSA에 1시간 블로킹하고 FITC(Fluorescein isothiocyanate)가 결합된 TCDD에 대한 일차항체(1:100)를 4℃에서 하룻밤 동안 반응시켰다. DAPI(4,6-diamidino-2-phenylindole) 염색 및 마운팅하여 형광 현미경으로 관찰하고, 그 결과를 도 3a 내지 도 3c에 나타내었다.
도 3a 내지 도 3c에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 TCDD의 세포 내 유입을 저해하였다.
실시예 4. 세포 내 ROS 분석
인간 각질 형성 세포인 HaCaT을 3x105cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, TCDD 10nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 24시간 동안 처리하고 DCFH-DA를 30분간 추가 처리하였다. 그 다음, 세포 회수 후 FACS 분석을 통해 평균 FL1 값의 변화를 관찰하여, 그 결과를 도 4a 내지 도 4c에 나타내었다.
도 4a 내지 도 4c에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 TCDD에 의해 증가된 세포 내 ROS 수준을 낮춰주었다.
실시예 5. CYP1A1 및 염증분자 RT-PCR
인간 각질 형성 세포인 HaCaT을 3x105cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, TCDD 10nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 6시간 또는 24시간 동안 처리하고, 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 하기 표 4의 CYP1A1, TNF-a, IL-6, IL-1b, COX-2 각각에 대한 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로오즈 겔에 러닝하여 각 샘플처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 5a 내지 도 5c에 나타내었다.
서열번호 프라이머 서열(5'-3')
4 CYP1A1_F GGATCTTTCTCTGTACCCTGG
5 CYP1A1_R AGCATGTCCTTCAGCCCAGA
6 TNF-a_F CGTCAGCCGATTRTGCTATCT
7 TNF-a_R CGGACTCCGCAAAGTCTAAG
8 IL-6_F AAAGAGGCACTGCCAGAAAA
9 IL-6_R ATCTGAGGTGCCCATGCTAC
10 IL-1b_F TTCGACACATGGGATAACGA
11 IL-1b_R TCTTTCAACACGCAGGACAG
12 COX-2_F ATCATTCACCAGGCAAATTGC
13 COX-2_R GGCTTCAGCATAAAGCGTTTG
도 5a 내지 도 5c에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 TCDD에 의해 유도되는 CYP1A1 및 여러 염증 관련 인자들의 발현을 억제하는 효과를 보였다.
실시예 6. AhR 핵 전좌 검사
인간 각질 형성 세포인 HaCaT을 3x105cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. Urban particulate matters (PM, Sigma Aldrich, USA) 10nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 1시간 동안 처리하고 세포를 회수하여 핵과 세포질 단백질을 각각 분리하였다. 그 다음, AhR(Aryl hydrocarbon receptor) 항체(santacruz biotechnology, USA)를 이용한 웨스턴 블랏을 수행하여 활성화된 AhR 핵 이동을 확인하여, 그 결과를 도 6a 내지 도 6c에 나타내었다.
도 6a 내지 도 6c에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 미세먼지에 의한 AhR 핵 이동을 억제하였다.
실시예 7. CYP1A1 및 염증분자 RT-PCR
인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. PM (Particulate matter) 10nM과 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드 50uM을 배지에 첨가하여 30분 반응 후 세포에 6시간 또는 24시간 동안 처리하고 세포를 회수하여 RNA를 분리하였다. 그 다음, RNA를 정량하고, cDNA 합성 키트(Intron, Korea)을 이용하여 cDNA를 합성하고, PCR 프리믹스(Intron, Korea) 및 하기 표 5의 CYP1A1, TNF-a, IL-6, IL-1b, COX-2 각각에 대한 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로오즈 겔에 러닝하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 7a 내지 도 7c에 나타내었다.
서열번호 프라이머 서열(5'-3')
4 CYP1A1_F GGATCTTTCTCTGTACCCTGG
5 CYP1A1_R AGCATGTCCTTCAGCCCAGA
6 TNF-a_F CGTCAGCCGATTRTGCTATCT
7 TNF-a_R CGGACTCCGCAAAGTCTAAG
8 IL-6_F AAAGAGGCACTGCCAGAAAA
9 IL-6_R ATCTGAGGTGCCCATGCTAC
10 IL-1b_F TTCGACACATGGGATAACGA
11 IL-1b_R TCTTTCAACACGCAGGACAG
12 COX-2_F ATCATTCACCAGGCAAATTGC
13 COX-2_R GGCTTCAGCATAAAGCGTTTG
도 7a 내지 도 7c에서 확인할 수 있듯이, 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드는 미세먼지에 의해 유도되는 CYP1A1 및 여러 염증 관련 인자들의 발현을 억제하는 효과를 보였다.
본 발명은 환경오염 물질에 대한 세포 보호 효능을 갖는 펩타이드 및 이의 용도에 관한 것이다.

Claims (7)

  1. 서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드.
  2. 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 다이옥신 유사물질에 의해 유발되는 질병의 예방 또는 치료용 약제학적 조성물.
  3. 제2항에 있어서, 상기 다이옥신 유사물질에 의해 유발되는 질병은, 염소성 여드름과 같은 피부 질환, 정자수 감소, 고환암, 전립선암, 자궁내막 증식증, 유방암, 간독성, 면역기능 저하, 고지혈증, 요도하열, 잠복고한, 기형아 출산, 혈관 손상, 간세포성 암종, 간의 비대, 선섬유증, 체중 손실, 모발 손실, 구강 부종, 안검 부종 및 위점막성 궤양인 것인, 다이옥신 유사물질에 의해 유발되는 질병의 약제학적 조성물.
  4. 제2항에 있어서, 상기 다이옥신 유사물질은 폴리염소화 디벤조다이옥신(PCDD), 폴리염소화 디벤조퓨란(PDCF) 및 폴리염소화 비페닐(PCB)로 이루어진 군에서 선택된 1종 이상인 것인, 다이옥신 유사물질에 의해 유발되는 질병의 약제학적 조성물.
  5. 제4항에 있어서, 상기 폴리염소화 디벤조다이옥신은 2,3,7,8-테트라클로로디벤조다이옥신(TCDD)인 것인, 다이옥신 유사물질에 의해 유발되는 질병의 약제학적 조성물.
  6. 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 다이옥신 유사물질에 대한 길항성 식품 조성물.
  7. 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 피부상태 개선용 화장품 조성물.
PCT/KR2018/001953 2017-03-30 2018-02-14 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도 WO2018182172A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP18774488.3A EP3611182B1 (en) 2017-03-30 2018-02-14 Peptide having cytoprotective effect against environmental pollutant and use thereof
JP2019552607A JP6896094B2 (ja) 2017-03-30 2018-02-14 環境汚染物質に対する細胞保護効果を有するペプチド及びその用途
ES18774488T ES2975420T3 (es) 2017-03-30 2018-02-14 Péptido que tiene efecto citoprotector contra contaminantes medioambientales y uso del mismo
EA201992304A EA201992304A1 (ru) 2017-03-30 2018-02-14 Пептид, обладающий цитопротекторным эффектом против действия загрязняющих окружающую среду веществ, и его применение
CN201880021782.3A CN110461864B (zh) 2017-03-30 2018-02-14 具有抵抗环境污染物质的细胞保护效果的肽及其用途
US16/497,056 US11104704B2 (en) 2017-03-30 2018-02-14 Peptide having cytoprotective effect against environmental pollutant and use thereof
BR112019020063A BR112019020063A2 (pt) 2017-03-30 2018-02-14 peptídeo que tem efeito citoprotetor contra poluente ambiental e seu uso
US17/391,261 US11597748B2 (en) 2017-03-30 2021-08-02 Peptide having cytoprotective effect against environmental pollutant and use thereof
US18/158,642 US11859016B2 (en) 2017-03-30 2023-01-24 Peptide having cytoprotective effect against environmental pollutant and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0040514 2017-03-30
KR1020170040514A KR101943083B1 (ko) 2017-03-30 2017-03-30 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/497,056 A-371-Of-International US11104704B2 (en) 2017-03-30 2018-02-14 Peptide having cytoprotective effect against environmental pollutant and use thereof
US17/391,261 Continuation US11597748B2 (en) 2017-03-30 2021-08-02 Peptide having cytoprotective effect against environmental pollutant and use thereof

Publications (1)

Publication Number Publication Date
WO2018182172A1 true WO2018182172A1 (ko) 2018-10-04

Family

ID=63676649

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/001953 WO2018182172A1 (ko) 2017-03-30 2018-02-14 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도

Country Status (9)

Country Link
US (3) US11104704B2 (ko)
EP (1) EP3611182B1 (ko)
JP (1) JP6896094B2 (ko)
KR (1) KR101943083B1 (ko)
CN (1) CN110461864B (ko)
BR (1) BR112019020063A2 (ko)
EA (1) EA201992304A1 (ko)
ES (1) ES2975420T3 (ko)
WO (1) WO2018182172A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3904369A4 (en) * 2019-02-20 2022-11-23 Caregen Co., Ltd. PEPTIDE FOR THE PREVENTION OF SKIN DAMAGE CAUSED BY ATMOSPHERIC POLLUTANTS AND FOR THE FIGHT AGAINST AGING, AND USE IN RELATION

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101943083B1 (ko) 2017-03-30 2019-01-29 (주)케어젠 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
KR101943081B1 (ko) 2017-08-31 2019-01-29 (주)케어젠 주름 개선 활성을 나타내는 펩타이드 및 이의 용도
KR102114275B1 (ko) * 2018-11-07 2020-05-25 제주대학교 산학협력단 C-펩타이드를 유효성분으로 포함하는 미세먼지에 대한 피부보호용 화장료 조성물
KR102351515B1 (ko) * 2019-12-17 2022-01-14 (주)수파드엘릭사 아릴 탄화수소 수용체의 활성을 억제하는 폡타이드 및 이를 이용하는 화장료 조성물
KR102539445B1 (ko) * 2020-11-25 2023-06-05 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도
KR102474470B1 (ko) * 2020-11-25 2022-12-07 (주)케어젠 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
JP2003231697A (ja) * 2002-02-06 2003-08-19 Japan Science & Technology Corp ダイオキシントラッピング能を有するタンパク質
KR20060035432A (ko) * 2004-10-22 2006-04-26 한국생명공학연구원 다이옥신 노출 여부 진단용 마커 및 이를 이용하여 다이옥신 노출을 확인하는 방법
US20080038838A1 (en) * 2003-10-10 2008-02-14 Towa Kagaku Co., Ltd. Dioxin-Binding Material and Method of Detecting or Quantifying Dioxin

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999042565A1 (en) * 1997-05-31 1999-08-26 Hoechst Schering Agrevo Gmbh Herbicides test method
US6783953B1 (en) 1998-12-22 2004-08-31 Janssen Pharmaceutica N.V. Vascular endothelial growth factor-X
KR100480972B1 (ko) * 2001-03-24 2005-05-06 (주)내츄럴엔도텍 초피나무 추출물을 유효성분으로 하는 다이옥신유사물질에 대한 길항성 조성물
KR100480971B1 (ko) * 2001-03-24 2005-05-17 (주)내츄럴엔도텍 정향 추출물을 유효성분으로 하는 다이옥신 유사물질에대한 길항성 조성물
US8344211B2 (en) * 2008-08-13 2013-01-01 Ceres, Inc. Plant nucleotide sequences and corresponding polypeptides
US20060045902A1 (en) * 2004-09-01 2006-03-02 Serbousek Jon C Polymeric wrap for in vivo delivery of osteoinductive formulations
US8088976B2 (en) * 2005-02-24 2012-01-03 Monsanto Technology Llc Methods for genetic control of plant pest infestation and compositions thereof
CN101400699A (zh) * 2006-01-11 2009-04-01 布里斯托尔-迈尔斯·斯奎布公司 人胰高血糖素样肽-1调节剂及其在治疗糖尿病和相关病症中的用途
US20140343129A1 (en) * 2011-12-14 2014-11-20 Moderna Therapeutics, Inc. Modified nucleic acids, and acute care uses thereof
US8877434B2 (en) * 2012-04-19 2014-11-04 Hsinyu Lee Method and system of detecting dioxin-like compounds
NZ700274A (en) * 2012-04-24 2016-10-28 Thrombogenics Nv Anti-pdgf-c antibodies
KR101510742B1 (ko) * 2013-05-13 2015-04-10 (주)케어젠 비만세포―특이적 아팝토시스-유도용 펩타이드 및 이의 용도
KR101632948B1 (ko) * 2014-05-13 2016-06-27 (주)케어젠 항염증, 골 형성 및 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR101943083B1 (ko) 2017-03-30 2019-01-29 (주)케어젠 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
KR101943081B1 (ko) * 2017-08-31 2019-01-29 (주)케어젠 주름 개선 활성을 나타내는 펩타이드 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
JP2003231697A (ja) * 2002-02-06 2003-08-19 Japan Science & Technology Corp ダイオキシントラッピング能を有するタンパク質
US20080038838A1 (en) * 2003-10-10 2008-02-14 Towa Kagaku Co., Ltd. Dioxin-Binding Material and Method of Detecting or Quantifying Dioxin
KR20060035432A (ko) * 2004-10-22 2006-04-26 한국생명공학연구원 다이옥신 노출 여부 진단용 마커 및 이를 이용하여 다이옥신 노출을 확인하는 방법

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"Fourth Annual Report on Carcinogens, NTP 85-002:170", vol. 185, 1985
"Remington's Pharmaceutical Sciences", 1995
CARTER ET AL., SCIENCE, vol. 188, 1975, pages 738
LEE, Y. W. ET AL., TOXICOL. LETT., vol. 102-103, 1998, pages 29 - 83
MERRIFIELD, J. AMER. CHEM. SOC., vol. 85, 1963, pages 2149 - 54
NAKAMURA, CHIKASHI: "Dioxin-binding pentapeptide for use in a high- sensitivity on-bead detection assay", ANALYTICAL CHEMISTRY, vol. 77, no. 23, 29 October 2005 (2005-10-29) - 1 December 2005 (2005-12-01), pages 7750 - 7757, XP055612579 *
PANDINI, ALESSANDRO: "Detection of the TCDD binding-fingerprint within the Ah receptor ligand binding domain by structurally driven mutagenesis and functional analysis", BIOCHEMISTRY, vol. 48, no. 25, 30 June 2009 (2009-06-30), pages 5972 - 5983, XP055612586 *
See also references of EP3611182A4
STEWART ET AL.: "Solid Phase Peptide Synthesis", vol. 111, 1984, PIERCE CHEM. CO.
YANG, J. H. ET AL., CARCINOGENESIS, vol. 20, 1999, pages 13 - 18

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3904369A4 (en) * 2019-02-20 2022-11-23 Caregen Co., Ltd. PEPTIDE FOR THE PREVENTION OF SKIN DAMAGE CAUSED BY ATMOSPHERIC POLLUTANTS AND FOR THE FIGHT AGAINST AGING, AND USE IN RELATION

Also Published As

Publication number Publication date
CN110461864A (zh) 2019-11-15
EA201992304A1 (ru) 2020-02-25
JP6896094B2 (ja) 2021-06-30
US11597748B2 (en) 2023-03-07
US11104704B2 (en) 2021-08-31
EP3611182A1 (en) 2020-02-19
ES2975420T3 (es) 2024-07-05
US11859016B2 (en) 2024-01-02
BR112019020063A2 (pt) 2020-04-28
KR101943083B1 (ko) 2019-01-29
EP3611182A4 (en) 2020-10-28
EP3611182B1 (en) 2024-02-14
US20230227501A1 (en) 2023-07-20
JP2020515547A (ja) 2020-05-28
US20210371464A1 (en) 2021-12-02
US20200377550A1 (en) 2020-12-03
KR20180112140A (ko) 2018-10-12
CN110461864B (zh) 2023-05-26

Similar Documents

Publication Publication Date Title
WO2018182172A1 (ko) 환경오염 물질에 대한 세포 보호 효과를 갖는 펩타이드 및 이의 용도
EP0915910B1 (de) Exendin-analoga, verfahren zu deren herstellung und diese enthaltende arzneimittel
WO2013169060A1 (ko) 패혈증 예방 또는 치료용 조성물
EP2709645B1 (en) Improved peptide pharmaceuticals
CN118324870A (zh) 用于胰岛素抗性的改良的肽药物
WO2014046478A1 (ko) 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
WO2020171285A1 (ko) 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
FI68246B (fi) Analogifoerfarande foer framstaellning av nya cyklopeptider
EP0395417A1 (en) Linear somatostatin analogues
WO2017142264A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018216884A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
CA2010660A1 (en) Osteogenic growth polypeptides identified from regenerating bone marrow
EA042132B1 (ru) Пептид, обладающий цитопротекторным эффектом против действия загрязняющих окружающую среду веществ, и его применение
WO2024106585A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106588A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2022114261A1 (ko) 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도
WO2022114260A1 (ko) 미세먼지에 의한 세포 손상 방지 활성을 갖는 펩타이드 및 이의 용도
WO2023127986A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127984A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127985A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2023127987A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024122713A1 (ko) 피부 상태 개선 활성을 갖는 펩타이드 및 이의 용도
WO2024106586A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2024122719A1 (ko) 연골 재생용 펩타이드 및 이의 용도
JP2812803B2 (ja) 有機保護活性を備えたペプチド

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18774488

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019552607

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019020063

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018774488

Country of ref document: EP

Effective date: 20191030

ENP Entry into the national phase

Ref document number: 112019020063

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190925