WO2018216884A1 - 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 - Google Patents

멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2018216884A1
WO2018216884A1 PCT/KR2018/002109 KR2018002109W WO2018216884A1 WO 2018216884 A1 WO2018216884 A1 WO 2018216884A1 KR 2018002109 W KR2018002109 W KR 2018002109W WO 2018216884 A1 WO2018216884 A1 WO 2018216884A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
peptide
melanin
amino acid
present
Prior art date
Application number
PCT/KR2018/002109
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to US16/615,899 priority Critical patent/US10865226B2/en
Publication of WO2018216884A1 publication Critical patent/WO2018216884A1/ko
Priority to US17/104,663 priority patent/US11518785B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/04—Preparations for care of the skin for chemically tanning the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/10—General cosmetic use
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention provides a peptide that exhibits melanin production promoting activity, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and / or preventing melanin hypopigmentation comprising the peptide as an active ingredient.
  • the present invention relates to a cosmetic composition for improvement, and to the prevention, improvement and / or treatment of melanin hypopigmentation of the peptide.
  • Skin cells produce melanin in the melanocytes of melanocytes (melanocytes) in the epidermal basement layer as a protective mechanism against stimulation of ultraviolet rays, environmental pollution, and other external factors.
  • Melanin is an important factor in determining the color of skin, eyes and hair in animals. Hypopigmentation is also known as a risk factor for skin cancer.
  • Asians are sensitive to the excessive production of melanin, so a lot of research related to whitening that suppresses melanin production has been conducted. Recently, however, the demand for vitiligo, which is suppressed by melanin production, is also increasing.
  • Vitiligo is an acquired depigmentation disease in which white patches of various sizes and shapes appear on the skin due to the death or necrosis of melanocytes. It is a relatively common disease in about 1% of the world's population, with no differences in race or location. The incidence is most common at 10-30 years, 95% of patients develop before 40 years of age, and 30% of patients have a family history.
  • vitiligo The cause of vitiligo has not been elucidated yet, but many theories have been suggested, including autoimmune theory, neuronal fluidism, and melanocyte self-destruction. Autoimmune theories suggest that expression of autoantibodies against melanocyte antigens results in the destruction or dysfunction of melanocytes or the destruction of melanocytes in lymphokines secreted by cytotoxic lymphocytes or activated lymphocytes.
  • Neuronal fluid is a disorder of catecholamine biosynthesis and an increase in monoamine oxidase, which leads to stress-related hydrogen peroxide, which causes melanocytes to be destroyed, and vitiligo may occur along the ganglion or after nerve damage or stress.
  • the melanin self-destruction theory suggests that phenol complexes, which are intermediate metabolites or final metabolites, generated during melanin formation accumulate in melanocytes and destroy cells.
  • various factors such as inherent cellular defects, genetic factors, apoptosis, and calcium metabolism abnormality have been suggested.
  • Melanin is synthesized from melanocytes and plays an important role in protecting the skin by UV irradiation or by absorbing toxic and chemicals. Therefore, in people whose melanin synthesis does not occur normally, there is an external problem in which all skin becomes partially white and stained, rather than white, and more sensitive to external stimuli.
  • Tyrosinase tyrosinase related protein-1 (TRP-1) and tyrosinase related protein-2 (TRP-2), which are important enzymes for melanin synthesis, catalyze oxidative reactions (Pigment Cell Res. 14 ( 6): 43744).
  • Tyrosinase oxidizes tyrosine to DOPA (L-3,4-dihydroxyphenylalanine) and DOPA to DOPA quinone
  • TRP-1 is dihydroxyindole carboxylic acid.
  • DHICA 5,6-dihydroxyindole-2-carboxylic acid
  • TRP-1 also plays a role in stabilizing tyrosinase and regulating activity.
  • TRP-2 is a DOPA chromium tautomerase that converts DOPA chromium into DHICA to form eumelanon and pheomelanon, which form melanocytes, and according to the ratio of skin, hair, The color of the pupil is determined.
  • ⁇ -MSH ⁇ -melanocyte stimulating hormone
  • ⁇ -MSH acts on melanocyte-producing melanocytes by paracrine to regulate the activity of the microphthalmia-associated transcription factor (MITF), a tyrosinase that plays an important role in melanin synthesis. It modulates the activity of TRP-1 (DHICA oxidase), TRP-2 (DOPAchrome tautomerase), etc. (THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July 31, pp. 195609565, 1998).
  • MITF microphthalmia-associated transcription factor
  • tyrosinase When melanocytes are stimulated by UV or ⁇ -MSH, tyrosinase is activated by p38 or protein kinase A (PKA), respectively.
  • PKA protein kinase A
  • ⁇ -MSH-> cAMP-> PKA process plays an important role in melanin synthesis, the increase of cAMP promotes the phosphorylation of cAMP-responsive element binding protein (CREB), which is the transcription factor MITF Has been reported to enhance the activity of tyrosinase and increase tyrosinase mRNA expression (Nucleic Acids Res. 30 (14): 3096106, Pigment Cell Melanoma Res 21 (6): 66576).
  • CREB cAMP-responsive element binding protein
  • the present inventors have tried to develop a peptide that can promote melanin production, and as a result, the peptide comprising a sequence selected from the group consisting of the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 3 shows excellent melanin production promoting activity
  • the present invention was completed by confirming that they can be usefully used for the prevention and treatment of melanin hypopigmentation.
  • a peptide that exhibits melanin production promoting activity comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
  • Another object of the present invention is a drug for the prevention and / or treatment of melanin hypopigmentation comprising at least one peptide selected from the group consisting of a peptide comprising a sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 3 To provide a pharmaceutical composition.
  • Another object of the present invention is for the prevention and / or improvement of melanin hypopigmentation comprising at least one peptide selected from the group consisting of a peptide comprising a sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 3 It is to provide a cosmetic composition.
  • the present inventors have tried to develop a peptide capable of promoting melanin production, and as a result, it was confirmed that the peptides comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 shows excellent melanin production promoting activity, It was found that they can be usefully used to improve, prevent and / or treat melanin hypopigmentation.
  • the present invention provides a peptide showing melanin production promoting activity, pharmaceutical composition for the prevention and / or treatment of melanin hypopigmentation comprising the peptide as an active ingredient, prevention of melanin hypopigmentation comprising the peptide as an active ingredient and And / or cosmetic compositions for improvement, and to prevent, ameliorate and / or treat melanin hypopigmentation of the peptide.
  • One aspect of the invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
  • the peptide may include the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, for example, may be composed of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
  • the peptide may exhibit melanin production promoting activity.
  • the peptide of the present invention is provided with a total of three kinds of peptides excellent in promoting melanin formation through experiments on gene and protein expression changes among peptide libraries possessed by the present inventors.
  • peptide refers to a linear molecule formed by binding amino acid residues to each other by peptide bonds.
  • the peptides of the present invention may be prepared by chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis , 2nd. Ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Pat. No. 5,516,891).
  • the peptide may be one that induces modification at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity.
  • the N-terminal and / or C-terminal modification of the peptide acts to greatly improve the stability of the peptide.
  • the peptide of the present invention may have a high half-life by increasing the half-life when administered in vivo.
  • modification of the C-terminal or N-terminal increases the action of protecting the peptide of the present invention from the attack of protein cleavage enzymes in vivo or binding ability to the receptor.
  • the C-terminal modification may be one in which the C-terminal of the peptide is modified with a hydroxyl group (-OH), an amino group (-NH 2 ), an azide (-NHNH 2 ), and the like, but is not limited thereto.
  • the N-terminal modification is at least one selected from the group consisting of acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG)
  • the protecting group may be combined, but is not limited thereto.
  • stability herein means not only in vivo stability but also storage stability (eg, room temperature storage stability).
  • the peptide of the present invention increases melanogenesis in melanocytes, increases activity and expression of tyrosinase, an enzyme that regulates melanin synthesis, and MITF, TRP1, a factor involved in melanogenesis. Increases expression of CREB and increases phosphorylation of CREB.
  • the peptide of the present invention has the effect of alleviating vitiligo by increasing melanogenesis.
  • the peptides of the present invention can be used for the prevention, amelioration and / or treatment of melanin hypopigmentation.
  • Melanin hypopigmentation in the present invention may be vitiligo, albinism, depigmentation nevus, white nasal mucus, rash, post-inflammatory depigmentation, ecchymosis, partial leukemia, idiopathic red hypopigmentation and / or dot leukemia It doesn't happen.
  • Another aspect of the present invention is for the prevention and / or treatment of melanin hypopigmentation comprising at least one peptide selected from the group consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient It relates to a pharmaceutical composition.
  • the pharmaceutical composition includes the above-described peptide of the present invention as an active ingredient, the common content between the two is omitted in order to avoid excessive complexity of the present specification.
  • the pharmaceutical composition of the present invention may be one containing a pharmaceutically effective amount of the peptide.
  • the term "pharmaceutically effective amount” means an amount sufficient to achieve the efficacy or activity of the aforementioned peptides.
  • the pharmaceutical composition of the present invention may additionally include a pharmaceutically acceptable carrier, but is not limited thereto.
  • the pharmaceutically acceptable carrier may be one conventionally used in the preparation, for example, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and / or mineral oil, and the like, It is not limited to this.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • composition of the present invention may be in any form suitable for the intended method of administration.
  • administration means introducing the predetermined substance into the patient in any suitable way.
  • the pharmaceutical composition of the present invention may be administered via any general route as long as the drug can reach the desired tissue.
  • it may be intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, pulmonary administration, rectal administration, etc., preferably parenterally. It may be, and more preferably, it can be administered by skin topical administration.
  • composition of the present invention can be administered by any device that can be moved to the target cell active ingredient.
  • Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.001 to 1000 mg / kg.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of extracts, powders, granules, tablets, capsules, or gels (eg, hydrogels), and may further include dispersants or stabilizers. .
  • Another aspect of the present invention is the prevention and / or improvement of melanin hypopigmentation comprising at least one peptide selected from the group consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 as an active ingredient It relates to a cosmetic composition for.
  • the cosmetic composition of the present invention may include a cosmetically effective amount of the peptide.
  • cosmetic effective amount means an amount sufficient to achieve the efficacy of the compositions of the invention described above.
  • the cosmetic composition may further include a cosmetically acceptable carrier, but is not limited thereto.
  • Cosmetic compositions of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and / or sprays, and the like, but are not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, a nourishing lotion, a nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray and / or powder.
  • the carrier component may be animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc and / or zinc oxide. It may be used, but is not limited thereto.
  • the formulation of the cosmetic composition is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular, in the case of a spray, additionally chlorofluorohydrocarbon, Propellants such as propane / butane and / or dimethyl ether may be included, but are not limited thereto.
  • a solvent, a solubilizer or an emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, Fatty acid esters of 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol and / or sorbitan.
  • liquid diluents such as water, ethanol and / or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and / or polyoxyethylene sorbitan ester
  • Suspending agents microcrystalline cellulose, aluminum metahydroxy, bentonite, agar and / or tracant, etc. may be used, but are not limited thereto.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid.
  • Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives and / or ethoxylated glycerol fatty acid esters and the like may be used, but are not limited thereto.
  • the components included in the cosmetic composition of the present invention may include components commonly used in cosmetic compositions, in addition to the peptides and carrier components as active ingredients, for example, antioxidants, stabilizers, solubilizers, vitamins, Conventional adjuvants such as pigments and / or flavors may be included, but are not limited thereto.
  • the present invention provides a peptide that exhibits melanin production promoting activity, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and / or preventing melanin hypopigmentation comprising the peptide as an active ingredient.
  • the present invention relates to a cosmetic composition for improvement and to the prevention, improvement and / or treatment of melanin hypopigmentation of the peptide, the peptide of the present invention increases the activity and expression of tyrosinase, and increases the expression of factors involved in melanin formation. It shows an excellent effect in the production of melanin, and can be very advantageously applied to medicines, quasi-drugs and cosmetics by excellent activity and stability.
  • 1 is a graph confirming the melanin formation increase effect of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 2 is a graph showing the effect of increasing the activity of tyrosinase of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • FIG. 3 is a diagram showing the effect of increasing the expression of genes related to melanin formation of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 4 is a diagram showing the effect of increasing the expression of melanin-related proteins of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • FIG. 5 is a diagram showing the effect of increasing the phosphorylation of CREB of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 6 is a graph confirming the effect of increasing the melanin formation of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 7 is a graph showing the effect of increasing the activity of tyrosinase of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 8 is a view showing the effect of increasing the expression of genes related to melanin formation of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 9 is a diagram showing the effect of increasing the expression of the protein related to melanin formation of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • FIG. 10 is a diagram showing the effect of increasing the phosphorylation of CREB of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • 11 is a graph confirming the melanin formation increase effect of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • FIG. 12 is a graph showing the effect of increasing the activity of tyrosinase of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • FIG. 13 is a diagram showing the effect of increasing the expression of genes related to melanin formation of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • FIG. 14 is a diagram showing the effect of increasing the expression of melanin-related protein expression of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • 15 is a diagram showing the effect of increasing the phosphorylation of CREB of the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • chloro trityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was added to a reaction vessel, and 490 ml of methylene chloride (MC) was added thereto, followed by stirring for 3 minutes. Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added thereto, stirred for 3 minutes, and then the solvent was removed again. Then, 700 ml of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-Leu-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added to the mixture, followed by stirring to dissolve well. I was.
  • CTC resin chloro trityl chloride resin
  • MC methylene chloride
  • DMF dimethylformamide
  • Chain reaction was performed in order of -Gly-OH, Fmoc-Leu-OH, Fmoc-Cys (Trt) -OH, Fmoc-Phe-OH.
  • the Fmoc-protector was reacted twice with a deprotection solution twice for 10 minutes and then washed well.
  • the peptidyl resin was washed three times with DMF, MC and methanol, and dried slowly by flowing nitrogen air, and then dried under reduced pressure under vacuum under P 2 O 5 to completely dry, followed by a fugitive solution (Trifluroacetic acid 81.5).
  • Trifluroacetic acid 81.5 Trifluroacetic acid 81.5.
  • the resin was filtered off and the resin was washed with a small amount of TFA solution and then combined with the mother liquor.
  • Peptides consisting of SEQ ID NO: 2 or SEQ ID NO: 3 amino acid sequence was also synthesized in the same manner as described above.
  • the culture medium was removed, the cells were removed, transferred to a 1.5 ml tube, centrifuged at 13,000 rpm for 3 minutes to remove the supernatant, and the cell pellets were recovered to observe melanin.
  • Cell pellets were placed in 150 ul of 1N NaOH to lyse intracellular melanin at 60 ° C. for 30 minutes. 100 ⁇ l of the supernatant obtained by dissolving each well in a 96-well plate was measured for absorbance at 450 nm, and is shown in FIGS. 1, 6, 11, and Tables 2 to 4.
  • Melanoma cell line (B16F10) cells were incubated for 24 hours in a 6-well culture plate, and the peptides of the preparations were incubated for 72 hours by treating each concentration. Then, place the 6-well culture plate on ice and wash with cold PBS, add 300 uL of 0.1 M sodium phosphate buffer (pH 6.8, lysis buffer) containing 1% Triton X-100, and collect the cells in a 1.5 mL tube. After freezing at -270 ° C, thawing was repeated five times to destroy cell membranes. After centrifugation at 15,000 rpm for 10 minutes, the supernatants were collected in another 1.5 mL tube and the proteins of the samples were quantified.
  • 0.1 M sodium phosphate buffer pH 6.8, lysis buffer
  • the protein concentration of the samples was diluted to the same concentration, three wells were dispensed into 96-well culture plates, and 20 ⁇ L of 10 mM L-DOPA was added and incubated at 37 ° C. for 1 hour. Blank and positive control are shown in Table 5 below.
  • the intracellular tyrosinase of the peptide was treated with the mouse melanin cell line B16F10. Activity was increased.
  • the present invention provides a peptide that exhibits melanin production promoting activity, a pharmaceutical composition for preventing and / or treating melanin hypopigmentation comprising the peptide as an active ingredient, and / or preventing melanin hypopigmentation comprising the peptide as an active ingredient.
  • the present invention relates to a cosmetic composition for improvement, and to the prevention, improvement and / or treatment of melanin hypopigmentation of the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)

Abstract

본 발명은 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공한다. 본 발명의 펩타이드는 티로시나아제의 활성 및 발현을 증가시키고, 멜라닌 형성에 관여하는 인자들의 발현을 증가시킴으로써 멜라닌 생성에 있어서 우수한 효과를 나타낸다. 본 발명의 펩타이드는 멜라닌 저색소증의 예방, 개선 및 치료용도로 이용될 수 있다. 상술한 본 발명의 펩타이드의 우수한 활성 및 안정성은 의약, 의약외품 및 화장품에 매우 유리하게 적용될 수 있도록 한다.

Description

멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
본 발명은 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물, 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.
피부세포는 자외선이나 환경오염, 그 밖의 외부 요인의 자극에 대해 방어기전으로 표피기저층에 존재하는 멜라닌 세포(melanocyte)의 멜라닌소체(melanosome)에서 멜라닌을 생성한다. 멜라닌은 동물들의 피부, 눈동자, 머리카락의 색을 결정하는 중요한 요인이다. 저색소증은 피부암의 위험인자로도 알려졌다. 동양인들은 멜라닌이 과다로 생성되는 것에 민감하여 멜라닌 생성을 억제하는 미백관련이 연구가 많이 수행되었다. 하지만 최근에는 멜라닌 생성이 억제되어 나타나는 백반증(Vitiligo)에 대한 요구도 증가하고 있어 이에 대한 연구도 진행되고 있다.
백반증은 멜라닌 세포의 사멸이나 괴사로 인한 여러 가지 크기 및 형태의 백색반이 피부에 나타나는 후천성 탈색소 질환이다. 전세계적으로 인구의 약 1%에서 나타나는 비교적 흔한 질환으로, 인종이나 지역에 따른 차이는 없다. 발생 연령은 10~30세에 가장 많고, 95%의 경우 40세 이전에 발병하고, 환자의 30%에서 가족력이 있다.
백반증이 생기는 원인에 대해서 아직 정확히 밝혀진 바는 없으나, 자가 면역설, 신경체액설, 멜라닌 세포 자가 파괴설 등 여러 가지 설이 제시되고 있다. 자가 면역설은 멜라닌 세포계 항원에 대한 자가항체의 발현으로 멜라닌 세포의 파괴 또는 기능 이상이 초래되거나 세포 독성 림프구나 활성화된 림프구가 분비한 림포카인에 멜라닌 세포가 파괴된다는 설이다. 신경체액설은 카테콜아민 생합성의 이상과 모노아민 산화효소의 증가 등으로 인하여 스트레스와 관련된 과산화수소가 만들어지고 이로 인해 멜라닌 세포가 파괴된다는 설로, 백반증이 신경절을 따라 발생하거나 신경 손상이나 스트레스 후에 발병할 수도 있다. 멜라닌 세포 자가 파괴설은 멜라닌 형성 과정에서 생기는 중간대사 물질이나 최종대사 물질인 페놀 복합체가 멜라닌 세포 내에 축척되어 세포를 파괴한다는 설이다. 그 외 고유세포 결손(inherent cellular defect), 유전요인, 세포사멸, 칼슘대사 이상 등의 다양한 인자들이 제시되고 있다.
멜라닌은 멜라닌 생성세포(melanocytes)로부터 합성되고 자외선 조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 그러므로 멜라닌 합성이 정상적으로 일어나지 않는 사람들에서는 모든 피부가 백색으로 되기보다는 부분적으로 백색으로 변해 얼룩이 생기는 외형적인 문제점도 있고 외부 자극에 민감해지는 것이 더 문제이다.
멜라닌 합성에 중요한 효소인 티로시나아제(tyrosinase), TRP-1(tyrosinase related protein-1), TRP-2(tyrosinase related protein-2)는 산화적 반응에 촉매로 작용한다(Pigment Cell Res. 14 (6): 43744).
티로시나아제는 티로신(tyrosine)을 DOPA(L-3,4-dihydroxyphenylalanine)로, DOPA를 DOPA 퀴논(quinone)으로 산화시키는 작용을 하고, TRP-1은 디히드록시인돌 카복실산 옥시다제(dihydroxyindole carboxylic acid oxidase)로서 5,6-디히드록시인돌-2-카복실산(5,6-dihydroxyindole-2-carboxylic acid; DHICA)을 인돌-5,6-퀴논-2-카복실산(indol-5,6-quinone-2-carboxylic acid)으로 변화시키는데 관여한다. 또한, TRP-1은 티로시나아제를 안정화시키고 활성을 조절하는 역할을 한다. TRP-2는 DOPA 크롬 타우토머라아제(tautomerase)로써 DOPA 크롬을 DHICA로 변화시켜 멜라닌세포를 이루는 유멜라논(eumelanon)과 페오멜라논(pheomelanon)을 형성하고 이들의 비율에 따라 피부, 머리카락, 눈동자의 색깔 등이 결정된다.
멜라닌 합성은 자외선 조사와 MSH(α-melanocyte stimulating hormone)로 인해 활성화된다. α-MSH는 펩타이드 호르몬으로 자외선에 의해 생성되며 뇌하수체 및 피부를 포함한 여러 세포에서 만들어지는 것으로 알려져 있다.
α-MSH는 측분비(paracrine)에 의해 멜라닌 생성세포의 MCR(melanocortin receptor)에 작용하여 전사인자인 MITF(microphthalmia-associated transcription factor)의 활성을 조절하여 멜라닌 합성에 중요한 역할을 하는 티로시나아제, TRP-1(DHICA oxidase), TRP-2(DOPAchrome tautomerase) 등의 활성을 조절한다(THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July31, pp. 195609565, 1998).
멜라닌 형성세포가 UV 또는 α-MSH에 의해서 자극이 되면, 각각 p38이나 PKA(protein kinase A)에 의해서 티로시나아제가 활성화된다고 보고되었다. 그런데 이 두 가지 경로 중 특히 α-MSH -> cAMP -> PKA 과정이 멜라닌 합성에 중요한 역할을 하는데, cAMP의 증가는 CREB(cAMP-responsive element binding protein) 인산화를 촉진시키고 이것이 전사인자인 MITF의 발현을 증가시키고, 이것은 티로시나아제의 활성을 향상시키며, 티로시나아제 mRNA 발현을 증가시킨다는 보고들이 있다(Nucleic Acids Res. 30 (14): 3096106, Pigment Cell Melanoma Res 21 (6): 66576).
한편, 우리나라를 비롯한 동양인들은 누구나 하얀 피부색을 가지기를 원하기 때문에 멜라닌 생성을 억제하는 미백 성분에 대한 연구를 많이 수행해 왔다. 그러나 멜라닌은 피부의 멜라닌 생성세포로부터 합성되며 자외선조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 멜라닌의 정상적인 합성이 나타나지 않는 경우는 피부가 외부 자극에 민감하고 외형적으로도 비정상적으로 보이므로 멜라닌 합성이 정상화될 수 있도록 치료하는 것이 필요하고 이에 대한 연구도 수행된 것들이 있다. 그러나 아직까지 멜라닌 합성을 촉진시키는 것에 대한 기술개발이 충분히 수행되지 않았다.
본 발명자들은 멜라닌 생성을 촉진시킬 수 있는 펩타이드를 개발하고자 노력하였고, 그 결과, 서열번호 1 내지 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 서열을 포함하는 펩타이드가 우수한 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고 이들이 멜라닌 저색소증의 예방 및 치료에 유용하게 사용될 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열을 포함하는 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1 내지 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 서열을 포함하는 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 멜라닌 저색소증의 예방 및/또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 내지 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 서열을 포함하는 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물을 제공하는 것이다.
본 발명자들은 멜라닌 생성을 촉진시킬 수 있는 펩타이드를 개발하고자 노력하였고 그 결과, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열을 포함하는 펩타이드들이 우수한 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고, 이들이 멜라닌 저색소증의 개선, 예방 및/또는 치료에 유용하게 사용될 수 있음을 규명하였다.
이에, 본 발명은 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물, 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열을 포함하는 펩타이드에 관한 것이다.
상기 펩타이드는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열을 포함하는 것일 수 있으며, 예를 들어, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 것일 수 있다.
상기 펩타이드는 멜라닌 생성 촉진 활성을 나타내는 것일 수 있다.
본 발명의 펩타이드는 본 발명자들이 보유하고 있는 펩타이드 라이브러리 가운데 유전자 및 단백질 발현 변화 등에 대한 실험을 통해 멜라닌 형성 촉진 효능이 우수한 펩타이드를 스크리닝한 것으로써 총 3종이 제공된다.
본 명세서에서 용어 "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
상기 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 및/또는 C-말단에 변형을 유도한 것일 수 있다.
상기 펩타이드의 N-말단 및/또는 C-말단 변형은 펩타이드의 안정성을 크게 개선하는 작용을 하며, 이러한 변형을 통해 본 발명의 펩타이드는 생체 내 투여시의 반감기를 증가시켜 높은 반감기를 가질 수 있다.
또한, 상기 C-말단 또는 N-말단의 변형은 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용이나 수용체에 대한 결합력을 증가시킨다.
상기 C-말단 변형은 펩타이드의 C-말단이 히드록시기(-OH), 아미노기(-NH2), 아자이드(-NHNH2) 등으로 변형되는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 N-말단 변형은 펩타이드의 N-말단이 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 및 폴리에틸렌글리콜(PEG)로 구성된 군으로부터 선택된 1종 이상의 보호기가 결합되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명의 일 양태에 따르면 본 발명의 펩타이드는 멜라닌 형성 세포에서 멜라닌 생성을 증가시키며, 멜라닌 합성을 조절하는 효소인 티로시나아제의 활성 및 발현을 증가시키고, 멜라닌 형성에 관여하는 인자인 MITF, TRP1의 발현을 증가시키며, CREB의 인산화를 증가시킨다.
이러한 결과는 본 발명의 펩타이드가 멜라닌 생성을 증가시킴으로써 백반증이 완화되도록 하는 효과를 가진다는 것을 의미한다. 따라서, 본 발명의 펩타이드는 멜라닌 저색소증의 예방, 개선 및/또는 치료 용도로 이용될 수 있다.
본 발명에서 멜라닌 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 및/또는 점상 백피증인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 일 양태는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 치료용 약제학적 조성물에 관한 것이다.
상기 약제학적 조성물은 상술한 본 발명의 펩타이드를 유효성분으로 포함하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 약제학적 조성물은 펩타이드의 약제학적 유효량(pharmaceutically effective amount)을 포함하는 것일 수 있다.
본 명세서에서 용어 "약제학적 유효량"은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.
본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것일 수으로서, 있으며, 예를 들어, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및/또는 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명의 약제학적 조성물은 의도한 투여 방법에 적합한 임의의 형태일 수 있다.
본 발명의 약학 조성물에 있어서 "투여"는 어떠한 적절한 방법으로 환자에게 소정의 물질을 도입하는 것을 의미한다.
본 발명의 약제학적 조성물은 약물이 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 예를 들어, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피 내 투여, 경구 투여, 국소 투여, 비 내 투여, 폐 내 투여, 직장 내 투여 등일 수 있으며, 바람직하게는 비경구로 투여하는 것일 수 있으며, 더욱 바람직하게는 피부 국소 투여에 의해 투여할 수 있다.
또한, 본 발명의 약제학적 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.001 내지 1000 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 또는 젤(예컨대, 하이드로젤) 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 또 다른 일 양태는 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물에 관한 것이다.
본 발명의 화장품 조성물은 상기 펩타이드의 화장품학적 유효량(cosmetically effective amount)을 포함하는 것일 수 있다.
본 명세서에서 용어 "화장품학적 유효량"은 상술한 본 발명의 조성물의 효능을 달성하는 데 충분한 양을 의미한다.
상기 화장품 조성물은 화장품학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및/또는 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 및/또는 파우더의 제형으로 제조될 수 있다.
상기 화장품 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 및/또는 산화아연이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 및/또는 디메틸 에테르와 같은 추진체를 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 및/또는 소르비탄의 지방산 에스테르가 있다.
상기 화장품 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 및/또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및/또는 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 및/또는 트라칸트 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 및/또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 화장품 조성물에 포함되는 성분은 유효 성분으로서의 펩타이드류와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함하는 것일 수 있으며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및/또는 향료와 같은 통상적인 보조제를 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명은 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것으로,본 발명의 펩타이드는 티로시나아제의 활성 및 발현을 증가시키고, 멜라닌 형성에 관여하는 인자들의 발현을 증가시킴으로써 멜라닌 생성에 있어서 우수한 효과를 나타내며, 우수한 활성 및 안정성에 의해 의약, 의약외품 및 화장품에 매우 유리하게 적용될 수 있다.
도 1은 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 증가 효과를 확인한 그래프이다.
도 2는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 티로시나아제의 활성이 증가 효과를 보여주는 그래프이다.
도 3은 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 유전자 발현 증가 효과를 보여주는 그림이다.
도 4는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 단백질 발현 증가 효과를 보여주는 그림이다.
도 5는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 CREB의 인산화 증가 효과를 보여주는 그림이다.
도 6은 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 증가 효과를 확인한 그래프이다.
도 7은 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 티로시나아제의 활성이 증가 효과를 보여주는 그래프이다.
도 8은 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 유전자 발현 증가 효과를 보여주는 그림이다.
도 9는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 단백질 발현 증가 효과를 보여주는 그림이다.
도 10은 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 CREB의 인산화 증가 효과를 보여주는 그림이다.
도 11은 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 증가 효과를 확인한 그래프이다.
도 12는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 티로시나아제의 활성이 증가 효과를 보여주는 그래프이다.
도 13은 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 유전자 발현 증가 효과를 보여주는 그림이다.
도 14는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 멜라닌 형성 관련 단백질 발현 증가 효과를 보여주는 그림이다.
도 15는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 CREB의 인산화 증가 효과를 보여주는 그림이다.
서열번호 1, 2 또는 3의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
합성예 1: 펩타이드의 합성
클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTC resin, Nova biochem Cat No. 01-64-0021) 70g을 반응용기에 넣고 메틸렌 클로라이드(MC) 490ml를 가하여 3분간 교반하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF) 490 ml를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 그 다음, 반응기에 700 ml의 디클로로메탄용액을 넣고 Fmoc-Leu-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 그 다음, 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF)를 490 ml 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 700ml를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Leu-CTC 레진(Resin)을 제조하였다.
새로운 반응기에 700ml의 DMF 용액을 넣고 Fmoc-Ser(tBu)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 HBTu 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Ser(tBu)-Leu-CTC Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Trp-OH, Fmoc-Ile-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Pro-OH, Fmoc-Cys(Trt)-OH, Fmoc-Pro-OH, Fmoc-Gly-OH, Fmoc-Leu-OH, Fmoc-Cys(Trt)-OH, Fmoc-Phe-OH,순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 81.5%, 증류수 5.0%, 티오아니졸(Thioanisole) 5.0%, 패놀(Phenol) 5.0%, 이디티(EDT, Ethanedithiol) 2.5%, 티아에스(TIS, Triisopropylsilane) 1.0%] 1,900 ml을 넣은 후 상온에서 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 합친 모액 2,090ml는 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 서열번호 1로 이루어진 펩타이드 129.8g을 합성하였다(수율: 92.8%). 분자량 측정기를 이용하여 분자량 측정 시 분자량 1398.6 (이론 값: 1398.6)를 얻을 수 있었다.
서열번호 2 또는 서열번호 3 아미노산 서열로 이루어진 펩타이드도 상기와 같은 방법으로 합성을 진행하였다.
서열번호 서열목록 (5'->3') 분석값(질량분석기)
분석치 이론치
1 FCLGPCPYIWSL 1398.6 1398.6
2 KVTAMRCFLL 1181.5 1181.5
3 RVTAMRCFLL 1209.5 1209.5
실시예 1: 멜라닌 형성 어세이
6-웰 배양용 평판에 멜라닌형성 세포(B16F10 세포주)를 5x104 cells/well의 밀도로 시딩한 후, 37℃ 배양기에서 24시간 배양하고, 각 판의 배지를 제거하고 2% 혈청 첨가 배지(serum-containing media)로 교체 후, 제조예에서 합성한 각각의 펩타이드를 농도별로 처리하여 72시간 동안 배양하였다.
그 다음, 배양액을 제거 하고 세포를 떼어 낸 뒤 1.5 ml 튜브로 옮겨 13,000 rpm에서 3분간 원심분리 하여 상층액을 제거하고, 세포 펠렛을 회수하여 멜라닌을 관찰하였다. 세포 펠렛을 1N NaOH 150ul씩 넣어 60℃에서 30분 동안 세포 내 멜라닌을 용해시켰다. 96-웰 평판 각 웰에 용해시켜 얻은 상층액을 100ul씩 넣어 450 nm에서 흡광도를 측정하여, 도 1, 도 6, 도 11 및 표 2 내지 4에 나타내었다.
대조군 SEQ ID NO: 1(10uM) SEQ ID NO: 1(50uM) a-MSH(200nM)
Melanin content (%) 100 125 264 276
대조군 SEQ ID NO: 2(10uM) SEQ ID NO: 2(50uM) a-MSH(200nM)
Melanin content (%) 100 109 155 263
대조군 SEQ ID NO: 3(10uM) SEQ ID NO: 3(50uM) a-MSH(200nM)
Melanin content (%) 100 106 164 263
도 1, 도 6, 도 11 및 표 2 내지 4에서 확인할 수 있듯이, 마우스 멜라닌 세포주 B16F10에 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 마우스 멜라닌 세포주 B16F10에 처리 시 멜라닌 형성 증가가 확인되었다.
실시예 2: 티로시나아제 활성 시험
흑색종 세포주(B16F10) 세포를 6-웰 배양용 평판에 24시간 배양하고, 제조예의 펩타이드를 각각 농도별로 처리하여 72시간 배양하였다. 그 다음, 얼음 위에 6-웰 배양용 평판을 올리고 차가운 PBS으로 세척한 후 1% Triton X-100이 함유된 0.1 M 인산 나트륨 버퍼(pH 6.8, 용해 버퍼)를 300uL 넣고 세포를 1.5mL 튜브에 모아 -270℃에 급속 냉동시킨 후 해동시키는 반응을 5번 반복하여 세포막을 파괴하였다. 15,000 rpm에서 10분간 원심분리 한 후 상층액을 다른 1.5 mL 튜브에 모으고, 이 시료들의 단백질을 정량하였다. 시료들의 단백질 농도가 같은 농도가 되게 희석하여 96-웰 배양용 평판에 3개 웰씩 분주하고 10mM L-DOPA 20uL를 첨가하여 37℃에서 1시간 배양하였다. 블랭크(Blank)와 양성 대조군(positive control)은 하기 표 5와 같다.
Sample Blank Positive control
Sample 90 ul - -
Buffer - 90 ul 80 ul
Mushroomtyrosinase(0.1 mg/ml) - - 10 ul
그 다음, 475 nm에서 흡광도를 측정하여, 그 결과를 도 2, 도 7, 도 12 및 표 6 내지 표 8에 나타내었다.
대조군 SEQ ID NO: 1(10uM) SEQ ID NO: 1(50uM) a-MSH(200nM)
Tyrosinase activity (%) 100 157 201 467
대조군 SEQ ID NO: 2(10uM) SEQ ID NO: 2(50uM) a-MSH(200nM)
Tyrosinase activity (%) 100 144 189 484
대조군 SEQ ID NO: 3(10uM) SEQ ID NO: 3(50uM) a-MSH(200nM)
Tyrosinase activity (%) 100 114 173 484
도 2, 도 7, 도 12 및 표 6 내지 표 8에서 확인할 수 있듯이, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 마우스 멜라닌 세포주 B16F10에 처리 시 세포 내 티로시나아제의 활성이 증가되었다.
실시예 3: 멜라닌 생성 관련 유전자 RT-PCR
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 5x104 cells/well의 밀도로 시딩하여 24시간 배양하였다. 그 다음, 배지를 00으로 교체하고 제조예의 펩타이드를 각각 농도별로 처리하여 72시간 동안 배양하였다. 그 다음, 세포의 RNA 추출하여 정량한 후, cDNA synthesis kit (Intron, Korea)을 이용하여 cDNA를 합성하였다. 그 다음, 표 3에 나타낸 바와 같이 멜라닌 형성에 관여 하는 인자인 MITF, 티로시나아제 및 TRP1에 대한 각각의 특이적인 프라이머를 이용하여 PCR을 수행하였다. 그 다음, 5% 아가로스 겔에 러닝(running)하여 각 시료처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 3, 도 8 및 도 13에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
4 MITF_F CCAGCCTGGCGATCATGTCAT
5 MITF_R GGTCTGGACAGGAGTTGCTG
6 tyrosinase_F GGCCAGCTTTCAGGCAGAGG
7 tyrosinase_R TGGTGCTTCATGGGCAAAAT
8 TRP1_F TCTGTGAAGGTGTGCAGGAG
9 TRP1_R CCGAAACAGAGTGGAAGGTT
도 3, 도 8 및 도 13에서 확인할 수 있듯이, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 마우스 멜라닌 세포주 B16F10에 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF, 티로시나아제 및 TRP1의 mRNA 발현이 증가되었다.
실시예 4: 멜라닌 생성 관련 단백질 웨스턴 블롯팅
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 5x104 cells/well의 밀도로 시딩하여 24시간 배양 후, 제조예의 펩타이드를 각각 농도별로 처리하였다. 그 다음, 72시간 동안 배양하고 세포를 용해하여 멜라닌 형성에 관여 하는 인자인 MITF 및 티로시나아제에 특이적인 각각의 항체(antacruz biotechnology, USA)를 이용하여 웨스턴 블롯으로 확인하여, 그 결과를 도 4, 도 9 및 도 14에 나타내었다.
도 4, 도 9 및 도 14에서 확인할 수 있듯이, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 마우스 멜라닌 세포주 B16F10에 처리 시, 멜라닌 형성 과정에 관여하는 단백질 발현이 증가되었다.
실시예 5: 멜라닌 생성 관련 단백질 활성 시험
멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 5x104 cells/well의 밀도로 시딩하여 24시간 배양 후, 제조예의 펩타이드를 각각 농도별로 처리하였다. 그 다음, 48시간 동안 세포를 배양한 후 세포를 용해하여 멜라닌 형성에 관여 하는 신호전달 물질인 CREB의 인산화 정도를 특이적인 항체(cell Signaling Technology, USA)를 이용하여 웨스턴 블롯으로 확인하여, 그 결과를 도 5, 도 10 및 도 15에 나타내었다.
도 5, 도 10 및 도 15에서 확인할 수 있듯이, 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 마우스 멜라닌 세포주 B16F10에 처리 시 멜라닌 형성 과정에 관여하는 인자인 CREB의 인산화 레벨이 증가되었다.
본 발명은 멜라닌 생성 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증 예방 및/또는 치료용 약제학적 조성물, 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 및/또는 개선용 화장품 조성물, 및 상기 펩타이드의 멜라닌 저색소증 예방, 개선 및/또는 치료 용도에 관한 것이다.

Claims (5)

  1. 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드.
  2. 서열번호 1의 아미노산 서열로 이루어진 펩타이드 서열번호 2의 아미노산 서열로 이루어진 펩타이드 및 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물.
  3. 제2항에 있어서, 상기 멜라닌 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 또는 점상 백피증인 것인, 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물.
  4. 서열번호 1의 아미노산 서열로 이루어진 펩타이드 서열번호 2의 아미노산 서열로 이루어진 펩타이드 및 서열번호 3의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 개선용 화장품 조성물.
  5. 제4항에 있어서, 상기 멜라닌 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 또는 점상 백피증인 것인, 멜라닌 저색소증의 예방 또는 개선용 화장품 조성물.
PCT/KR2018/002109 2017-05-23 2018-02-21 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도 WO2018216884A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/615,899 US10865226B2 (en) 2017-05-23 2018-02-21 Peptide showing melanogenesis promoting activity and use thereof
US17/104,663 US11518785B2 (en) 2017-05-23 2020-11-25 Peptide showing melanogenesis promoting activity and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0063701 2017-05-23
KR1020170063701A KR101954214B1 (ko) 2017-05-23 2017-05-23 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/615,899 A-371-Of-International US10865226B2 (en) 2017-05-23 2018-02-21 Peptide showing melanogenesis promoting activity and use thereof
US17/104,663 Continuation US11518785B2 (en) 2017-05-23 2020-11-25 Peptide showing melanogenesis promoting activity and use thereof

Publications (1)

Publication Number Publication Date
WO2018216884A1 true WO2018216884A1 (ko) 2018-11-29

Family

ID=64395679

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/002109 WO2018216884A1 (ko) 2017-05-23 2018-02-21 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Country Status (3)

Country Link
US (2) US10865226B2 (ko)
KR (1) KR101954214B1 (ko)
WO (1) WO2018216884A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101954214B1 (ko) 2017-05-23 2019-03-06 (주)케어젠 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR102265432B1 (ko) * 2019-08-20 2021-06-15 주식회사 케어젠 피부 미백 활성을 갖는 펩타이드 및 이의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120084293A (ko) * 2009-09-09 2012-07-27 파마인 코포레이션 치료제 전달용 음이온-코어 조성물, 및 이를 제조 및 사용하는 방법
KR20150130615A (ko) * 2014-05-13 2015-11-24 (주)케어젠 저색소증 개선 및 지방 형성 억제 효능을 갖는 펩타이드 및 이의 용도
KR20170097832A (ko) * 2016-02-18 2017-08-29 (주)케어젠 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
ES2146552B1 (es) * 1998-11-24 2001-04-16 Inst Cientifico Tecnol Navarra Peptidos inhibidores de tgf/31
FR2871061B1 (fr) * 2004-06-04 2007-08-10 Coletica Sa Principe actif capable d'induire la transformation du tgbf- latent inactif en tgfb actif
CU23472A1 (es) * 2004-09-17 2009-12-17 Ct Ingenieria Genetica Biotech Péptido antagonista de la interleucina-15
KR101954214B1 (ko) 2017-05-23 2019-03-06 (주)케어젠 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120084293A (ko) * 2009-09-09 2012-07-27 파마인 코포레이션 치료제 전달용 음이온-코어 조성물, 및 이를 제조 및 사용하는 방법
KR20150130615A (ko) * 2014-05-13 2015-11-24 (주)케어젠 저색소증 개선 및 지방 형성 억제 효능을 갖는 펩타이드 및 이의 용도
KR20170097832A (ko) * 2016-02-18 2017-08-29 (주)케어젠 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank [O] 18 June 2016 (2016-06-18), XP055559626, Database accession no. XP _004606322 .1 *
DATABASE GenBank [O] 26 July 2016 (2016-07-26), XP055559614, Database accession no. AAF73230.1 *
DATABASE GenBank [O] 26 June 2016 (2016-06-26), XP055559622, Database accession no. XP_012884940 .1 *
SARKAR, C. ET AL.: "Human Placental Protein/peptides Stimulate Melanin Synthesis by Enhancing Tyrosinase Gene Expression", MOLECULAR AND CELLULAR BIOCHEMISTRY, vol. 285, 2006, pages 133 - 142, XP019403448 *

Also Published As

Publication number Publication date
KR20180128553A (ko) 2018-12-04
US20210079041A1 (en) 2021-03-18
US20200148721A1 (en) 2020-05-14
KR101954214B1 (ko) 2019-03-06
US11518785B2 (en) 2022-12-06
US10865226B2 (en) 2020-12-15

Similar Documents

Publication Publication Date Title
WO2017142264A1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017155232A2 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR101800877B1 (ko) 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017105161A2 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
US11518785B2 (en) Peptide showing melanogenesis promoting activity and use thereof
WO2018199358A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
WO2018034453A1 (ko) 미녹시딜과 펩타이드의 결합체
KR101885847B1 (ko) 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
CN110612125B (zh) 异维a酸和肽的偶联物
KR101920052B1 (ko) 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR20100097965A (ko) 엑티빈 ａ―유래 펩타이드 및 그의 용도
EP3275891A2 (en) Peptide having skin whitening activity, and use thereof
KR20200109930A (ko) Zdhhc13 유래 생리활성 펩타이드, 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18805008

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18805008

Country of ref document: EP

Kind code of ref document: A1